The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bonini, C.
Right arrow Articles by Greenberg, P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bonini, C.
Right arrow Articles by Greenberg, P. D.
The Journal of Immunology, 2001, 166: 5250-5257.
Copyright © 2001 by The American Association of Immunologists

Targeting Antigen in Mature Dendritic Cells for Simultaneous Stimulation of CD4+ and CD8+ T Cells1

Chiara Bonini*,{dagger}, Steven P. Lee{ddagger}, Stan R. Riddell* and Philip D. Greenberg2,*

* Program in Immunology, Fred Hutchinson Cancer Research Center, Seattle, WA 98103, and Department of Immunology and Medicine, University of Washington, Seattle, WA 98195; {dagger} Immunotherapy and Gene Therapy Program, H. S. Raffaele, Milan, Italy; and {ddagger} Cancer Research Campaign Institute for Cancer Studies, University of Birmingham, Birmingham, United Kingdom


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Due to their potent immunostimulatory capacity, dendritic cells (DC) have become the centerpiece of many vaccine regimens. Immature DC (DCimm) capture, process, and present Ags to CD4+ lymphocytes, which reciprocally activate DCimm through CD40, and the resulting mature DC (DCmat) loose phagocytic capacity, but acquire the ability to efficiently stimulate CD8+ lymphocytes. Recombinant vaccinia viruses (rVV) provide a rapid, easy, and efficient method to introduce Ags into DC, but we observed that rVV infection of DCimm results in blockade of DC maturation in response to all activation signals, including CD40L, monocyte-conditioned medium, LPS, TNF-{alpha}, and poly(I:C), and failure to induce a CD8+ response. By contrast, DCmat can be infected with rVV and induce a CD8+ response, but, having lost phagocytic activity, fail to process the Ag via the exogenous class II pathway. To overcome these limitations, we used the CMV protein pp65 as a model Ag and designed a gene containing the lysosomal-associated membrane protein 1 targeting sequence (Sig-pp65-LAMP1) to target pp65 to the class II compartment. DCmat infected with rVV-Sig-pp65-LAMP1 induced proliferation of pp65-specific CD4+ clones and efficiently induced a pp65-specific CD4+ response, suggesting that after DC maturation the intracellular processing machinery for class II remains intact for at least 16 h. Moreover, infection of DCmat with rVV-Sig-pp65-LAMP1 resulted in at least equivalent presentation to CD8+ cells as infection with rVV-pp65. These results demonstrate that despite rVV interference with DCimm maturation, a single targeting vector can deliver Ags to DCmat for the effective simultaneous stimulation of both CD4+ and CD8+ cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Dendritic cells (DC)3 are the most potent APCs for stimulating quiescent, memory, and naive T lymphocytes (1). However, optimal processing and presentation of Ags to CD4+ and CD8+ T cells occur at different stages of DC differentiation. Immature DC (DCimm) phagocytose, process, and present Ags to MHC class II-restricted CD4+ T cells, and the resulting activated CD4+ T cells can then reciprocally activate the DC through the interaction of CD40 ligand with CD40, promoting maturation of the DC with up-regulation of costimulatory molecules such as CD80 and CD86, secretion of stimulatory cytokines such as IL-12, and release of proinflammatory chemokines such as IL-8, macrophage inflammatory protein-1{alpha}, and macrophage inflammatory protein-1{beta} (2, 3, 4, 5, 6, 7, 8). Such maturation and activation of DC result in the loss of phagocytic capacity and thus an inability to process new exogenous Ags for class II presentation, but acquisition of the ability to efficiently stimulate MHC class I-restricted CD8+ T cells (9, 10, 11, 12).

Since 1980, when the Assembly of the World Health Organization declared smallpox eradicated and recommended the discontinuation of smallpox vaccination, vaccinia virus has become an appealing vector for vaccination purposes. In fact, among the several vectors that can be used to transfer genes into DC, recombinant vaccinia viruses (rVV) have proven to be relatively safe and effective.

Vaccinia is a nonintegrating virus that is easy to manipulate genetically and capable of accommodating large genes (13). However, it has been recently shown that vaccinia virus infection of immature DC blocks the ability of monocyte-conditioned medium (MCM) to induce subsequent DC maturation and activation (14). Presumably, this immune evasion mechanism is employed by the virus to lengthen the duration of in vivo viral replication, but it represents a significant obstacle to the development of recombinant vaccinia viruses for use in DC-based anti-viral and anti-tumor vaccines. Potentially, the vaccinia-induced blockade to maturation might be overcome by providing activation signals in addition to those present in MCM, such as ligation of CD40. Alternatively, DC could be activated before vaccinia infection. Such mature DC could be expected to effectively present introduced Ags in the context of MHC class I, but processing and presentation of Ags in the context of MHC class II may be inefficient. The major pathway for MHC class II presentation requires phagocytosis or endocytosis of exogenous Ags by APCs, followed by protein degradation to peptides in lysosome-like compartments (15, 16). The peptides subsequently are loaded onto MHC class II molecules that have been targeted to these endosomal/lysosomal compartments, and the complex trafficks to the cell surface for presentation to CD4+ T cells. Since activation of DC induces down-regulation of phagocytic ability, this pathway for exogenous Ags may no longer be available for processing.

Molecular approaches directly targeting intracellular Ags into the appropriate subcellular compartment for MHC class II processing have been recently described (17, 18, 19, 20, 21, 22). The lysosomal-MHC class II processing compartment is characterized by several specific membrane proteins that function to resist degradation by hydrolases, maintain an acidic environment, and promote fusion with other membrane organelles, such as endosomes and phagosomes (23). Lysosomal-associated membrane protein 1 (LAMP1) is a membrane glycoprotein detected predominantly in the lysosome and late endosomes (24, 25). Expression of truncated LAMP1 molecules in COS-1 cells revealed that a tyrosine in the cytoplasmic tail is necessary for targeting to lysosomes (26) and that peptide-targeting sequences located in the cytoplasmic tail are sufficient to deliver a reporter molecule to lysosomes (27). Recently, Wu and colleagues showed that linking the sorting signals of LAMP1 to the cytoplasmic/nuclear human papilloma virus E7 Ag routed this endogenously synthesized Ag into the MHC class II pathway, resulting in enhanced presentation to CD4+ cells both in vitro and in vivo (17, 19). The use of LAMP1-targeting sequences to improve MHC class II Ag presentation has also been shown with HIV gp160 (18, 20, 21), EBV, and influenza virus (22).

In this study we linked the sorting signals of LAMP1 to the CMV nuclear/cytoplasmic protein pp65, a protein being evaluated in CMV vaccines due in part to its ability to naturally elicit strong CD4+ and CD8+ responses in infected individuals, to determine whether facilitating targeting of the protein to the lysosomal compartment in mature DC (DCmat) could rescue class II presentation while preserving class I presentation. We observed that a single targeting recombinant vaccinia virus can infect previously activated DC and effectively introduce Ag into both MHC class I and MHC class II processing pathways for stimulation of both CD4+ and CD8+ cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Generation of DC

PBMC from healthy donors were isolated by Ficoll-Hypaque sedimentation, and 50 x 106 cells were plated in a T-25 flask. After 1 h floating cells were removed, and adherent cells were cultured in 5 ml of RPMI 1640 supplemented with 25 mmol/L of HEPES buffer, 4 mmol/L of L-glutamine, 50 U/ml penicillin/ml, 50 µg/ml streptomycin, and 10% FCS (HyClone, Logan, UT). GM-CSF (100 ng/ml; Immunex, Seattle, WA) and 25 ng/ml of IL-4 (Endogen, Moburn, MA) were added on days 0 and 4. Nonadherent DC (1–3 x 106) were harvested on day 7. When DC were generated to stimulate CD4+ T cells, 10% human serum (HS) was used in place of FCS.

Activation signals for DC

To generate MCM for activation of DC, Ig-coated bacteriologic plates were prepared by the addition of 4 ml of human {gamma}-globulin (10 mg/ml) for 1 min. The plates were washed three times, and 50 x 106 PBMC were added. After 1 h floating cells were removed, and adherent cells were cultured in 5 ml of RPMI 1640 containing 10% HS. After 24 h supernatant was harvested, filtered with a 0.22 µm pore size filter, and stored at -70°C. To induce DC activation, 1 vol of MCM was added to 1 vol of DC. Alternatively, DC were activated by addition of 10 µg/ml anti-CD40 mAb (G28.5, American Type Culture Collection (ATCC), Manassas, VA), 1 µg/ml LPS (Sigma, St. Louis, MO), 100 ng/ml TNF-{alpha} (Genzyme, Cambridge, MA), and 12.5 µg/ml poly(I:C).

Antibodies

The purity of the DC was evaluated by cell surface staining with FITC-conjugated Abs to CD19 and CD20; PE-conjugated Abs to CD11c, CD14, CD56, and CD3; and FITC- and PE-conjugated isotype controls (BD Biosciences, Mountain View, CA). Activation of DC was evaluated by staining the cells with PE-conjugated Abs to CD80 and HLA-DR (BD Biosciences), CD83 and CD86 (Immunotech, Westbrook, ME), and isotype controls. The samples were analyzed on a FACSCalibur (BD Biosciences) using CellQuest software. Data shown are representative of three or more independent experiments.

Plasmids and vaccinia viruses

The Sig-pp65-LAMP1 gene was constructed by 30 cycles of strand overlap extension PCR with the high fidelity PWO DNA polymerase, using as template the Sig-E7-LAMP1 gene (provided by D. Pardoll, Johns Hopkins University, Baltimore, MD) and the pp65 gene from CMV AD169 (obtained from ATCC). The forward primer CGGGATCCATGGCGGCCCCCGGC corresponding to aa 1–5 of LAMP1 (preceded by a BamHI restriction site) and the reverse primer GCGACCGCGCGACTCCATTAGATCCTCAAAGAGTGC corresponding to aa 1–6 of pp65 followed by aa 24–29 of LAMP1 (underlined nucleotides) were used to amplify the endoplasmic reticulum (ER) sorting signal (Sig) of LAMP1, with annealing at 50°C for 30 min and extensions at 72°C for 1 min. The forward primer ATGGAGTCGCGCGGTCGC corresponding to aa 1–6 of pp65 and the reverse primer GGGGATCAACATGTTGTTAAGACCTCGGTGCTTTTTGGGCGT corresponding to aa 365–371 of LAMP1 and to aa 555–561 of pp65 (underlined nucleotides) were used to amplify pp65, with annealing at 58°C for 1 min and extensions at 72°C for 2 min. The forward primer CTTAACAACATGTTGATCCCC corresponding to aa 365–371 of LAMP1 and the reverse primer GCTCTAGACTAGATGGT CTGATAGCCGGC corresponding to aa 400–405 of LAMP1 followed by a stop codon and an XbaI restriction site were used to amplify the cytoplasmic tail of LAMP1, with annealing at 58°C for 30 min and extensions at 72°C for 1 min. The overlapping extension PCR was performed with annealing at 60°C (to fuse Sig and pp65) and 58°C (to fuse pp65 and LAMP1-tail) for 1 min and extensions at 72°C for 2 min.

rVV Sig-pp65-LAMP1 was generated by cloning the gene in the psc11 plasmid downstream of the vaccinia p7.5 early/late promoter by blunt ligation in the SmaI site. The plasmid was transfected with Lipofectamine into BSC-40 cells infected with wild-type vaccinia (vacwt), and rVV was amplified in thymidine kinase-negative cells and plaque purified. An rVV coding for green fluorescence protein (GFP) under control of the vaccinia p7.5 promoter was provided by L. Corey (Fred Hutchinson Cancer Research Center, Seattle, WA). An rVV coding for pp65 under control of the vaccinia p7.5 promoter was provided by W. Britt (University of Alabama, Birmingham, AL). Viral stocks were prepared in BSC-40 cells, titrated simultaneously, and diluted in DMEM containing 2.5% FCS to a final titer of 109 PFU/ml.

Functional analysis of rVV-infected immature and mature DC

Infection. Adherent cells derived from PBMC were used to generate DC as previously described. Nonadherent cells were harvested and frozen. On day 6 half the DCimm were exposed to an activation signal for 24 h as described above. On day 7 both DCimm and DCmat were infected with a vaccinia virus for 8 h, and viral replication was halted by 4-min exposure to UV light (254 nm wavelength). A UV light in a Naui Bio-safety cabinet (NU-425-400; Nuaire, Plymouth, MN) was used as a UV source. Infected cells were placed at 3 cm from the UV source and were exposed to 3.06 mJ/cm2 (0.76 mJ/min/cm2). Noninfected DC, used as a control, were also exposed to UV light.

Induction of pp65-specific CD8+ CTL lines. Nonadherent cells were CD4 depleted by incubation with anti-CD4 Ab conjugated to Dynabeads (Dynal, Lake Success, NY) at a 1/5 cell/bead ratio and removed by a magnet. The rVV-pp65 infected DC (105) were used to stimulate 2 x 106 autologous CD8+ T cells from a CMV+ donor in RPMI 1640 supplemented with 10% FCS and 5 U/ml IL-2 (Cetus, Emeryville, CA) in 24-well culture plates. IL-2 was supplemented every 3–4 days. On day 7 the cells were restimulated with the same culture conditions. After two rounds of in vitro stimulation, standard 4-h 51Cr release assays were performed in triplicate using EBV-transformed B cell lines (EBV-LCL) infected with rVV-pp65 or with vacwt as target cells. The percent specific lysis was calculated using the standard formula.

Stimulation of pp65-specific CD4+ T cell clones. The pp65-specific CD4+ T cell clones (2 x 105) generated by limiting dilution cloning from CMV+ donors were stimulated in vitro by incubation with 104 autologous immature or activated DC infected with rVV-pp65, rVV-Sig-pp65-LAMP1, or vacwt at 37°C in triplicate. After 56 h 100 µCi of [3H]TdR was added to each well, and the counts per minute were determined at 72 h. The proliferative response was expressed as the total counts per minute.

Determination of pp65-specific CD4+ precursor frequency. Nonadherent cells were CD8 depleted by incubation with anti-CD8 Abs conjugated to Dynabeads at a 1/5 cell/bead ratio and removed by a magnet. CD4+ T cells (2 x 106) were stimulated by incubation in RPMI 1640 supplemented with 10% HS with 105 autologous immature or activated DC infected with rVV-pp65 or rVV-Sig-pp65-LAMP1 or were pulsed for 4 h with a CMV Ag preparation prepared by glycine extraction (28). After 7 days the CD4+ T cell lines were plated in limiting dilution in replicates of 12 in the presence of 2 x 104 autologous PBMC irradiated at 3000 rad and infected with rVV-pp65 or rVV-Sig-pp65-LAMP1 or were pulsed for 4 h with a CMV Ag. IL-2 (50 U/ml) was added every 3–4 days. After 10 days cells were stimulated in vitro by incubation with 2 x 104 autologous EBV-LCL infected with rVV-Sig-pp65-LAMP1 or vacwt at 37°C in triplicate. After 56 h 100 µCi of [3H]TdR was added to each well, and the counts per minute were determined at 72 h. The proliferative response was expressed as the total counts per minute. Wells with [3H]TdR incorporation in the presence of pp65 at least three times higher than that in the presence of only vacwt were considered positive. Regression curves were interpolated, and precursor frequencies were determined according to Poisson statistics.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Vaccinia infection of DCimm does not induce activation and blocks subsequent activation via alternative signals

A rVV coding for GFP (rVV-GFP) was used to analyze the ability of rVV to infect DCimm. DCimm, generated from PBMC as previously described, were infected at varying multiplicity of infection (MOI) for 8 h. An MOI of 10:1 reproducibly resulted in the highest infection efficiency (50–85%) and was used for additional experiments (Fig. 1GoA).



View larger version (40K):
[in this window]
[in a new window]
  		FIGURE 1. A, Infection of DCimm with vaccinia virus. A rVV coding for the GFP protein was used to infect DCimm. DCimm were infected for 8 h at different MOIs. Cells were stained with a PE-conjugated Ab specific for CD11c and were analyzed by FACS. The percentage of CD11c+/GFP+ cells is shown in the upper right quadrant. B and C, Failure of vaccinia infection to activate immature DC. DCimm were infected with rVV-GFP for 8 h. Twenty-four hours after infection, cells were stained with PE-conjugated Abs specific for CD80, CD83 (B), CD86, and HLA-DR (C) and were analyzed by FACS. As a positive control, DC were exposed to LPS for 24 h. Each dot plot represents 10,000 events.

 
Some viruses, such as influenza virus, induce activation of DCimm. Therefore, the maturation of GFP-expressing DC was assessed 24 h after vaccinia infection by staining with PE-conjugated Abs specific for the DC activation markers CD80, CD83, CD86, and HLA-DR. Vaccinia infection did not induce spontaneous expression of CD80 and CD83 or up-regulation of CD86 and HLA-DR. By contrast, control DC activated with LPS for 24 h exhibited up-regulation of all four markers (Fig. 1Go, B and C). This result was confirmed by analysis at earlier (12 h) and later (48 h) time points after rVV infection (data not shown).

It has been recently reported that exposure to MCM fails to induce activation of DCimm infected with rVV (14). However, there are many alternative pathways by which DC can be activated. Since such activation is required for optimal stimulation of T cell responses, we examined the effect on DCimm of additional activation signals provided 4 h after infection with vaccinia, including LPS, mAb to CD40, TNF-{alpha}, and poly(I:C). At 12 h postinfection cells were exposed to UV irradiation to halt viral replication. Control DCimm were mock infected, exposed to the activation signals, and subsequently exposed to UV irradiation. Since most activation signals induce detectable responses in 24 h, the maturation status of vaccinia-infected DC was analyzed 24 h after exposure to the activation signal. None of the signals examined, including MCM, induced up-regulation of activation markers such as CD80 and CD83 on vaccinia-infected DC (Fig. 2Go). By contrast, all the signals induced activation of uninfected immature DC, although with differing efficiencies. Since CD40 is a crucial molecule for DC maturation, CD40 expression was analyzed in rVV-infected DCimm. The level of CD40 on infected cells showed a pattern of expression very similar to that showed by the other activation markers tested. In fact, although rVV infection did not down-regulate the low levels of CD40 detected in DCimm, rVV-infected DCimm exposed to activation signals failed to up-regulate CD40. The block of activation of rVV-infected DC was not due to a delayed kinetics of activation, since no changes were detectable for up to 48 h after infection (data not shown).



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 2. Inability to activate DCimm infected with vaccinia virus. DCimm were infected with rVV-GFP for 12 h and exposed to an activation signal 4 h after the infection was begun. Mock-infected cells exposed to the activation signals were controls. Twenty-four hours after infection, cells were stained with PE-conjugated Abs specific for CD80 and CD83 and were analyzed by FACS. Each dot plot represents 10,000 events.

 
Activated DC can be infected by vaccinia virus and maintain a mature phenotype after rVV infection

DC that have been activated by exposure to reagents such as LPS are significantly more resistant than immature DC to influenza virus infection (29). Therefore, the susceptibility of activated DC to vaccinia virus infection was assessed. Immature DC were exposed to MCM or LPS for 16 h and then infected with rVV-GFP at an MOI of 10:1 for 8 h. DCmat were still susceptible to vaccinia virus infection (Fig. 3Go). Additionally, the infected activated DC were more resistant to the cytopathic effects of vaccinia virus than immature DC, with virtually all of the infected, GFP+ activated DC remaining viable at 48 h after infection compared with only 37% of infected GFP+ immature DC (data not shown). Analysis of DCmat that had been matured with different activation signals before infection revealed that vaccinia infection did not interfere with continued expression of maturation and costimulatory markers (Fig. 3Go). The level of expression of CD80 and CD83 in rVV-infected DCmat was significantly higher than that in rVV-infected DCimm. However, the level of expression of CD80 in rVV-infected DCmat was slightly lower than that in noninfected DCmat. This effect could be one of the manifestations of vaccinia virus infection, such as the reduction in protein synthesis often observed after viral infection (30). This phenomenon seems to be independent from the activation status of the cells, since the level of expression of the activation molecule CD83 was similar in rVV-infected and noninfected DCmat.



View larger version (40K):
[in this window]
[in a new window]
  		FIGURE 3. Infection of previously activated DC with vaccinia virus. DCimm were exposed to MCM or LPS for 16 h and then infected with rVV-GFP for 8 h or mock infected as a control. Cells were then stained with PE-conjugated Abs specific for CD80 and CD83 and were analyzed by FACS. Each dot plot represents 10,000 events.

 
Recombinant VV-infected DCmat are more efficient than rVV-infected DCimm for inducing a specific CD8+ T cell response

The abilities of DCimm and DCmat to stimulate a CD8+ T cell response after rVV infection were compared in vitro. The matrix protein pp65 of CMV was selected as a model Ag in part for its ability to induce an immunodominant CD8+ T cell response in CMV-seropositive individuals (28, 31). DCimm generated from PBMC of CMV-positive, non-smallpox-vaccinated, healthy individuals were infected with a vaccinia virus coding for pp65 (rVV-pp65) at an MOI of 10:1 for 8 h. Aliquots of DC from the same donor were activated for 16 h with LPS and subsequently infected with rVV-pp65 at an MOI of 10:1 for 8 h. After 4 min of UV irradiation to inactivate the virus, infected DC were used to stimulate autologous CD8+ T cells at a responder/stimulator (R/S) ratio of 20/1 as described in Materials and Methods. After two 7-day cycles of in vitro stimulation, the responding CD8+ T cell lines were assayed for cytolytic activity with autologous EBV-LCL infected with rVV-pp65 or vacwt. Weak cytolytic responses were observed following stimulation with rVV-pp65-infected DCimm, whereas DCmat stimulators induced a more robust response from the same initial responding population (Fig. 4Go). Comparable results were obtained with an anti-CD40 mAb or TNF-{alpha} to activate DC, suggesting that the improved ability of DCmat to induce CD8+ T cell responses is independent of the activation signal (data not shown).



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 4. Induction of a pp65-specific CD8+ T cell response by rVV-pp65 infected DCmat and DCimm. DCimm infected with rVV-pp65 (circles) and DC activated with LPS and subsequently infected with rVV-pp65 (squares) were used to stimulate autologous CD8+ T cells from a CMV-seropositive, smallpox-naive donor at an R/S ratio of 20/1. After 7 days, effector cells were restimulated using the same conditions. Seven days after the second stimulation, the CD8+ T cell lines were assayed for cytolytic activity against autologous EBV-LCL infected with rVV-pp65 ({blacksquare}) or with vacwt ({square}) in a 51Cr release assay.

 
Recombinant VV-pp65-infected DCimm are more efficient than rVV-pp65-infected DCmat for inducing proliferative responses by a pp65-specific CD4+ T cell clone

Since pp65 is a nonsecreted cytoplasmic protein, the transfer of newly synthesized pp65 in infected cells into the lysosomal/endosomal compartment is likely to be inefficient. Although DCimm can take up exogenous Ag for entry into the class II presentation pathway, activation of DC results in the loss of phagocytic activity and a rapid, but transient, boost of MHC class II synthesis followed by formation of peptide-MHC class II complexes characterized by a particularly long half-life and decreased new class II synthesis (32, 33). Thus, DC infected with rVV after activation may be effective for inducing CD8+ T cell responses to proteins such as pp65, but poor in inducing CD4+ responses.

To assess the presentation by DC of Ag in the context of class II, a sensitive assay measuring the recognition by high affinity T cell clones was employed. A pp65-specific CD4+ T cell clone was stimulated by autologous DCimm infected with rVV-pp65 or vacwt and autologous DCmat infected with rVV-pp65 or vacwt at an R/S ratio of 20/1, and [3H]TdR incorporation was assessed 72 h later. The rVV-pp65-infected DCimm induced strong proliferative responses by the pp65-specific CD4+ T cell clone (Fig. 5Go). This result could reflect either direct processing of an endogenously expressed cytosolic protein or, more likely, phagocytosis of the pp65 protein from infected dying cells and processing via the conventional exogenous processing pathway. By contrast, rVV-pp65-infected DCmat induced a very low level of proliferation by the pp65-specific CD4+ T cell clone (Fig. 5Go). This low, but still detectable, level of proliferation could reflect either contamination of the DCmat cell population with a small number of DCimm, as suggested by flow cytometry studies (Fig. 1Go), or the fact that the class II processing machinery is intact in DCmat, and CD4+ proliferation resulted from processing of cytoplasmic pp65 protein in DCmat through unconventional MHC class II processing pathways that are less efficient than the exogenous pathway. Since these two alternatives have distinct implications for designing a DC-based vaccine, the experiments described below were designed to assess class II processing of DCmat.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 5. Induction of proliferation by a pp65-specific CD4+ T cell clone by rVV-pp65 infected DCimm and DCmat. DCimm and DCmat were infected with rVV-pp65 or vacwt and used to stimulate a pp65-specific autologous CD4+ T cell clone at an R/S ratio of 20/1 in a 72-h [3H]thymidine incorporation assay.

 
Targeting the Ag to the MHC class II compartment fully restores the ability of activated DC to stimulate CD4+ T cells

A chimeric Sig-pp65-LAMP1 gene, containing the 5' sorting signal of the mouse LAMP1 (to mediate translocation of the nascent protein to the lumen of the endoplasmic reticulum) encoded in-frame with pp65 and the 3' transmembrane and cytoplasmic tail of the mouse LAMP1 for lysosomal targeting of the protein, was constructed to facilitate class II processing. To accurately compare rVV-pp65 with rVV-Sig-pp65-LAMP1, the viral titers of rVV-pp65 and rVV-Sig-pp65-LAMP1 were measured simultaneously three times. The level of Ag expression was evaluated by Western blot on LCL infected with rVV-pp65 and rVV-Sig-pp65-LAMP1 at an MOI of 10:1. The blot was probed with the C10C11 mAb specific for pp65 and showed that the same level of Ag expression was conferred by infection with rVV-pp65 or rVV-Sig-pp65-LAMP1 (data not shown). Intracellular trafficking of the pp65 protein to the appropriate compartment was confirmed by immunofluorescence. EBV-LCL were infected with rVV containing the chimeric and wild-type pp65 constructs at an MOI of 10:1 for 8 h and were stained with the C10C11 mAb and a secondary Ab conjugated with FITC. Lysosomal-targeted protein Sig-pp65-LAMP1 exhibited a cytoplasmic vesicular staining pattern, whereas wild-type pp65 demonstrated intranuclear localization (data not shown).

DCmat were infected with rVV-pp65 or rVV-Sig-pp65-LAMP1 and used to stimulate autologous CD8+-depleted, CD4+ T cells from a CMV-positive smallpox-naive donor. DCimm infected with rVV-pp65 and DCimm pulsed with a CMV Ag preparation obtained by glycine extraction of CMV-infected fibroblasts (28) were used as positive controls. All DC were exposed to 4 min of UV irradiation before the addition of T cells. After one cycle of stimulation the CD4+ T cell lines were plated in limiting dilution to quantify the number of responding cells. After 10 days, wells were split in two and stimulated with 2 x 104 autologous EBV-LCL infected with either rVV-Sig-pp65-LAMP1 or vacwt, and [3H]TdR incorporation was assessed 72 h later. A proliferation index >3 was interpreted as a positive well, and the frequency of pp65-specific CD4+ T cells elicited by the different APC during the initial in vitro stimulation was calculated by Poisson distribution (Fig. 6Go). Consistent with the results observed using pp65-specific CD4+ T cell clones, DCimm infected with rVV-pp65 was significantly more efficient than DCmat infected with rVV-pp65 at inducing an in vitro pp65-specific CD4+ T cell response from PBMC of the CMV-immune donor. However, DCmat infected with rVV-Sig-pp65-LAMP1 were significantly more efficient than DCmat infected with rVV-pp65 at inducing a pp65-specific CD4+ T cell response. The frequency of CD4+ T cells elicited by rVV-Sig-pp65-LAMP1-infected DCmat was similar to the frequency obtained with DCimm infected with rVV-pp65 or pulsed with CMV Ag. These results suggest that the intracellular processing machinery for class II remains intact for at least 16 h after activation, and that the poor Ag uptake by DCmat can be completely overcome by intracellular targeting of the Ag to the MHC class II compartment. Furthermore, the similar frequency of CD4+ T cells elicited by rVV-infected DC and Ag-pulsed DC suggest that rVV infection does not inherently diminish the immunostimulatory capacity of DC.



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 6. Frequency of CD4+ T cell precursors elicited with one cycle of stimulation with activated DC infected with rVV-pp65 or rVV-Sig-pp65-LAMP1. Activated DC from a CMV-seropositive, smallpox-naive donor were infected with either rVV-pp65 or rVV-Sig-pp65-LAMP1 and used to stimulate autologous CD4+ T cells. Immature DC either infected with rVV-pp65 or pulsed with CMV Ag were used as positive controls. After one round of stimulation the CD4+ T cell lines were restimulated in limiting dilution.

 
LAMP1 sequences targeting pp65 to the MHC class II processing pathway do not prevent concurrent processing and presentation by the MHC class I pathway

LAMP1 sequences targeting pp65 to the class II processing pathway could potentially interfere with class I processing and presentation of the same Ag by DCmat by reducing the amount of Ag reaching the proteasome. To assess this potential obstacle, EBV-LCL were infected with rVV-pp65 or rVV-Sig-pp65-LAMP1 at an MOI of 10:1 for 8 h and were used as targets for autologous pp65-specific CD8+ clones. EBV-LCL infected with rVV-Sig-pp65-LAMP1 were killed equivalently to EBV-LCL expressing wild-type pp65, suggesting that the presence of a lysosomal-targeting sequence does not preclude sufficient class I processing (Fig. 7GoA). Since settings with more limited protein production might more effectively reveal differences in MHC class I processing, EBV-LCL were infected at an MOI of 10:1 for 4 h (Fig. 7GoB) or at an MOI of 1:1 for 8 h (Fig. 7GoC) and used as targets. Surprisingly, in both conditions infection of EBV-LCL with rVV-Sig-pp65-LAMP1 resulted in better presentation to pp65-specific CD8+ T cell clones than infection with rVV-pp65, suggesting that the presence of the lysosomal-targeting sequence might actively enhance class I processing of the protein, perhaps by promoting degradation due to some improper folding.



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 7. Effects of LAMP1 sequences targeting pp65 to the MHC class II processing on presentation by the MHC class I pathway. EBV-LCL were infected with rVV-pp65 or rVV-Sig-pp65-LAMP1 at an MOI of 10:1 for 8 h (A) and used as targets for autologous pp65-specific CD8+ clones in a 51Cr release assay. To assess whether MHC class I interference occurred in settings with more limited protein production, EBV-LCL were infected at an MOI of 10:1 for only 4 h (B) or at an MOI of 1:1 for 8 h (C) and used as targets for the same autologous pp65-specific CD8+ clone in a 51Cr release assay.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Although Ag-specific cytotoxic CD8+ T cells may be the principal effectors for most anti-tumor and anti-viral immune responses, CD4+ cells provide the crucial helper functions required to sustain the CD8+ response; activate NK cells, macrophages, and B cells; and directly lyse MHC class II+ targets (34). The efficiency with which DC can stimulate both Ag-specific CD8+ and CD4+ T cells has engendered great interest in pursuing DC-based vaccines for malignancies and infectious agents. Immature DC pulsed with tumor Ags have been recently used to vaccinate patients with malignancies, and preliminary reports suggest that this approach is safe and has potential antitumor efficacy (35, 36). Studies have not yet adequately compared the efficiency of induction of T cell responses by DC derived from bone marrow progenitors or peripheral mononuclear cells or exhibiting distinct phenotypes. However, since mature DC are necessary for optimal activation of CD8+ T cells, whereas immature DC may tolerize the CD8+ response, administration of mature DC might represent a better vaccine than immature DC (37).

Viral vectors can be used to efficiently introduce genes encoding an Ag of interest into DC. Although some viruses, such as influenza, may directly promote DC maturation, it has been recently reported that pathogens, including viruses, can block maturation of immature DC (14, 38). Such disruption of DC maturation may represent an important mechanism by which these pathogens evade rapid elimination by the immune system (38, 39, 40). For example, erythrocytes infected by Plasmodium falciparum bind immature DC and inhibit LPS-induced maturation (39), Trypanosome cruzi produce soluble factors that inhibit DC maturation (40), herpes simplex virus infection of immature DC blocks LPS-induced DC maturation (38), and vaccinia virus infection of immature DC blocks MCM-induced DC maturation (14). Our results with a recombinant vaccinia vector reveal that the mechanism responsible for the block of DC maturation by vaccinia globally impairs the response to maturation signals, since it could not be overcome by alternative known DC activators, such as a ligand for CD40, TNF-{alpha}, LPS, and poly(I:C).

The host has many mechanisms in vivo with which to ultimately overcome this viral evasion strategy. Infected immature DC would not be expected to efficiently induce CD4+ or CD8+ responses, but the lytic infection should lead to the release of viral proteins that could be phagocytosed by immature uninfected DC, which are capable of processing proteins in the class II pathway and responding to maturation signals. This is consistent with our observation that the intracellular nuclear/cytoplasmic protein pp65 can be presented to CD4+ T cells following expression in vaccinia-infected immature DC, but not following infection of a mature nonphagocytic DC population. The induction of CD8+ responses could also result from uptake of exogenous Ag or phagocytosis of apoptotic infected cells by immature DC, which could then mature and process the Ag in the class I pathway via a process called cross-presentation (41, 42, 43, 44). Alternatively, CD8+ responses could result from direct infection of DC that have already been induced to mature by the local inflammatory response. Indeed, DCmat infected with vaccinia maintain a functional mature phenotype, as recently reported (14), and we observed that DCmat are less sensitive that DCimm to the cytopathic effects of rVV.

These differing requirements for efficient presentation by DC of distinct maturation states significantly complicate the use of rVV as a vector for introducing Ags in a DC-based vaccine for induction of both CD4+ and CD8+ responses. Therefore, we pursued alternative methods to establish a single rVV vector capable of infecting a single DC population capable of stimulating both CD4+ and CD8+ T cells. Using a molecular approach that directly targeted pp65 into the lysosomal compartment to facilitate presentation in the context of MHC class II (17, 18, 19, 20, 21, 22), we observed that the intracellular processing machinery for the class II pathway in DC remains intact for at least 16 h after the delivery of a maturation signal, and that such mature infected DC can effectively induce CD4+ T cell responses. Moreover, the hybrid pp65 protein fused to both the LAMP1 transmembrane-cytoplasmic tail and an ER sorting signal did not interfere with concurrent processing of the protein via the class I pathway. Such class I presentation of the hybrid protein was observed with multiple CD8+ clones recognizing different pp65 epitopes and using different restriction elements (data not shown). Preliminary results suggest that the MHC class I processing of LAMP1-targeted hybrid proteins is TAP dependant (data no shown), implying that cytosolic degradation of the protein, rather than ER retention, is responsible for this effect (45, 46, 47). Regardless, the results suggest that this strategy can be employed to express hybrid proteins in mature DC and effectively stimulate both CD4+ and CD8+ T cells.

There are many settings in which the use of DC that have processed Ags in the context of both class I and class II molecules might be employed. CMV infection represents a significant cause of morbidity and mortality in individuals undergoing hemopoietic stem cell transplantation (48, 49). The administration of donor-derived CMV-specific T cells has been shown to prevent the development of disease, and alternative strategies to increase the number of virus-specific T cells contained in the donor stem cell inoculum by intentional immunization of the donor are being pursued (28, 31, 50, 51). The CMV protein described in our studies, pp65, is the most abundant in virus particles and has been shown to elicit both CD4+ and the immunodominant protective CD8+ T cell response to CMV (52, 53). The reagents described here could prove useful for inducing/augmenting responses to pp65 in stem cell donors. Similarly, T cell transfer has been shown to be effective in the therapy of melanoma, and vaccine approaches have being pursued as a more feasible alternative (54). For melanoma Ags such as tyrosinase, which has been shown to induce both CD4+ and CD8+ responses (55), vaccination with DC expressing a hybrid-targeted protein rather than peptide-loaded DC might prove more efficient at inducing a broader and more effective repertoire of T cell responses. In vivo studies should elucidate the added benefit of this approach.


   Acknowledgments
 
We thank Drew Pardoll (Johns Hopkins University, Baltimore, MD) for providing the plasmid containing the Sig-E7-LAMP1 gene, and Larry Corey (Fred Hutchinson Cancer Research Center) for providing the recombinant vaccinia virus coding for GFP.


   Footnotes
 
1 This work was supported in part by a postdoctoral fellowship from the Cancer Research Institute (to C.B.), U.S. Public Health Service Grants CA18029, AI43650, and CA33084, and Italian Association for Cancer Research, Milan, Italy. Back

2 Address correspondence and reprint requests to Dr. Philip D. Greenberg, Department of Immunology and Medicine, University of Washington, Box 356527, Seattle, WA 98195. Back

3 Abbreviations used in this paper: DC, dendritic cells; DCimm, immature DC; DCmat, mature DC; LAMP-1, lysosomal-associated membrane protein 1; HS, human serum; rVV, recombinant vaccinia viruses; vacwt, wild-type vaccinia; GFP, green fluorescence protein; MOI, multiplicity of infection; MCM, monocyte-conditioned medium; EBV-LCL, EBV-transformed B cell lines; ER, endoplasmic reticulum; R/S, responder/stimulator. Back

Received for publication September 5, 2000. Accepted for publication February 2, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
  2. Ridge, J. P., F. Di Rosa, P. Matzinger. 1998. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature 393:474.[Medline]
  3. Bennett, S. R., F. R. Carbone, F. Karamalis, R. A. Flavell, J. F. Miller, W. R. Heath. 1998. Help for cytotoxic-T-cell responses is mediated by CD40 signalling. Nature 393:478.[Medline]
  4. Schoenberger, S. P., R. E. Toes, E. I. van der Voort, R. Offringa, C. J. Melief. 1998. T-cell help for cytotoxic T lymphocytes is mediated by CD40-CD40L interactions. Nature 393:480.[Medline]
  5. Lanzavecchia, A.. 1998. Immunology: licence to kill. Nature 393:413.[Medline]
  6. Cella, M., D. Scheidegger, K. Palmer-Lehmann, P. Lane, A. Lanzavecchia, G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med. 184:747.[Abstract/Free Full Text]
  7. Caux, C., C. Massacrier, B. Vanbervliet, B. Dubois, C. Van Kooten, I. Durand, J. Banchereau. 1994. Activation of human dendritic cells through CD40 cross-linking. J. Exp. Med. 180:1263.[Abstract/Free Full Text]
  8. Stout, R. D., J. Suttles. 1996. The many roles of CD40 in cell-mediated inflammatory responses. Immunol. Today 17:487.[Medline]
  9. Levine, T. P., B. M. Chain. 1992. Endocytosis by antigen presenting cells: dendritic cells are as endocytically active as other antigen presenting cells. Proc. Natl. Acad. Sci. USA 89:8342.[Abstract/Free Full Text]
  10. Sallusto, F., A. Lanzavecchia. 1994. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor {alpha}. J. Exp. Med. 179:1109.[Abstract/Free Full Text]
  11. Sallusto, F., M. Cella, C. Danieli, A. Lanzavecchia. 1995. Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products. J. Exp. Med. 182:389.[Abstract/Free Full Text]
  12. Bender, A., M. Sapp, M. Feldman, A. Reddy, R. Seder, G. Schuler, R. M. Steinman, N. Bhardwaj. 1997. Dendritic cells as immunogens for human CTL responses. Adv. Exp. Med. Biol. 417:383.[Medline]
  13. Bronte, V., M. W. Carroll, T. J. Goletz, M. Wang, W. W. Overwijk, F. Marincola, S. A. Rosenberg, B. Moss, N. P. Restifo. 1997. Antigen expression by dendritic cells correlates with the therapeutic effectiveness of a model recombinant poxvirus tumor vaccine. Proc. Natl. Acad. Sci. USA 94:3183.[Abstract/Free Full Text]
  14. Engelmayer, J., M. Larsson, M. Subklewe, A. Chahroudi, W. I. Cox, R. M. Steinman, N. Bhardwaj. 1999. Vaccinia virus inhibits the maturation of human dendritic cells: a novel mechanism of immune evasion. J. Immunol. 163:6762.[Abstract/Free Full Text]
  15. Blum, J. S., P. Cresswell. 1988. Role for intracellular proteases in the processing and transport of class II HLA antigens. Proc. Natl. Acad. Sci. USA 85:3975.[Abstract/Free Full Text]
  16. Yewdell, J. W., J. R. Bennink. 1990. The binary logic of antigen processing and presentation to T cells. Cell 62:203.[Medline]
  17. Wu, T. C., F. G. Guarnieri, K. F. Staveley-O’Carroll, R. P. Viscidi, H. I. Levitsky, L. Hedrick, K. R. Cho, J. T. August, D. M. Pardoll. 1995. Engineering a novel pathway for MHC class II presentation of HPV-16 E7. Proc. Natl. Acad. Sci. USA 92:11671.[Abstract/Free Full Text]
  18. Lin, X., A. Dashti, R. F. Schinazi, J. Tang. 1993. Intracellular diversion of glycoprotein GP160 of human immunodeficiency virus to lysosomes as a strategy of AIDS gene therapy. FASEB J. 7:1070.[Abstract]
  19. Lin, K. Y., F. G. Guarnieri, K. F. Staveley-O’Carroll, H. I. Levitsky, J. T. August, D. M. Pardoll, T. C. Wu. 1996. Treatment of established tumors with a novel vaccine that enhances major histocompatibility class II presentation of tumor antigen. Cancer Res. 56:21.[Abstract/Free Full Text]
  20. Rowell, J. F., A. L. Ruff, F. G. Guarnieri, K. Staveley-O’Carroll, X. Lin, J. Tang, J. T. August, R. F. Siliciano. 1995. Lysosome-associated membrane protein-1 mediated targeting of HIV-1 envelope protein to an endosomal/lysosomal compartment enhances its presentation to MHC class-II restricted T cells. J. Immunol. 155:1818.[Abstract]
  21. Ruff, A. L., F. G. Guarnieri, K. Staveley-O’Carroll, R. F. Siliciano, J. T. August. 1997. The enhanced immune response to the HIV gp160/LAMP chimeric gene product targeted to the lysosome membrane protein trafficking pathway. J. Biol. Chem. 272:8671.[Abstract/Free Full Text]
  22. Thomson, S. A., S. R. Burrows, I. S. Misko, D. J. Moss, B. E. H. Coupar, R. Khanna. 1998. Targeting a polyepitope protein incorporating multiple class II-restricted viral epitopes to the secretory/endocytic pathway facilitates immune recognition by CD4+ cytotoxic T lymphocytes: a novel approach to vaccine design. J. Virol. 72:2246.[Abstract/Free Full Text]
  23. Fukuda, M.. 1991. Lysosomal membrane glycoproteins. J. Biol. Chem. 266:21327.[Free Full Text]
  24. Lewis, V., S. A. Green, M. Marsh, P. Vihko, A. Helenius, I. Mellman. 1985. Glycoproteins of the lysosomal membrane. J. Cell Biol. 100:1839.[Abstract/Free Full Text]
  25. Chen, W. F., T. L. Murphy, M. C. Willingham, I. Pastan, J. T. August. 1985. Identification of two lysosomal membrane glycoproteins. J. Cell Biol. 101:85.[Abstract/Free Full Text]
  26. Williams, M. A., M. Fukuda. 1990. Accumulation of membrane glycoproteins in lysosomes requires a tyrosine residue at a particular position in the cytoplasmic tail. J. Cell Biol. 111:955.[Abstract/Free Full Text]
  27. Guarnieri, F. G., L. M. Arteburn, M. B. Penno, Y. Cha, J. T. August. 1993. The motif Tyr-X-X-hydrophobic residue mediates lysosomal membrane targeting of lysosome-associated membrane protein 1. J. Biol. Chem. 268:1941.[Abstract/Free Full Text]
  28. Riddell, S. R., K. S. Watanabe, J. M. Goodrich, C. R. Li, M. E. Agha, P. D. Greenberg. 1992. Restoration of viral immunity in immunodeficient humans by adoptive transfer of T cell clones. Science 257:238.[Abstract/Free Full Text]
  29. Cella, M., M. Salio, Y. Sakakibara, H. Langen, I. Julkunen, A. Lanzavecchia. 1999. Maturation, activation, and protection of dendritic cells induced by double-stranded RNA. J. Exp. Med. 189:821.[Abstract/Free Full Text]
  30. Smith, G. L., J. A. Symons, A. Khanna, A. Vanderplasschen, A. Alcamí’. 1997. Vaccinia virus immune evasion. Immunol. Rev. 159:137.[Medline]
  31. Walter, E. A., P. D. Greenberg, M. J. Gilbert, R. J. Finch, K. S. Watanabe, E. D. Thomas, S. R. Riddell. 1995. Reconstitution of cellular immunity against cytomegalovirus in recipients of allogeneic bone marrow by transfer of T-cell clones from the donor. N. Engl. J. Med. 333:1038.[Abstract/Free Full Text]
  32. Cella, M., A. Engering, V. Pinet, J. Pieters, A. Lanzavecchia. 1997. Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 388:782.[Medline]
  33. Pierre, P., S. J. Turley, E. Gatti, M. Hull, J. Meltzer, A. Mirza, K. Inaba, R. M. Steinman, I. Mellman. 1997. Developmental regulation of MHC class II transport in mouse dendritic cells. Nature 388:787.[Medline]
  34. Greenberg, P. D.. 1991. Adoptive T cell therapy of tumors: mechanisms operative in the recognition and elimination of tumor cells. Adv. Immunol. 49:281.[Medline]
  35. Hsu, F. J., C. Benike, F. Fagnoni, T. M. Liles, D. Czerwinski, B. Taidi, E. G. Engleman, R. Levy. 1996. Vaccination of patients with B-cell lymphoma using autologous antigen-pulsed dendritic cells. Nat. Med. 2:52.[Medline]
  36. Nestle, F. O., S. Alijagic, M. Gilliet, Y. Sun, S. Grabbe, R. Dummer, G. Burg, D. Schadendorf. 1998. Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med. 4:328.[Medline]
  37. Steinman, R. M., S. Turley, I. Mellman, K. Inaba. 2000. The induction of tolerance by dendritic cells that have captured apoptotic cells. J. Exp. Med. 191:411.[Free Full Text]
  38. Salio, M., M. Cella, M. Suter, A. Lanzavecchia. 1999. Inhibition of dendritic cell maturation by herpes simplex virus. Eur. J. Immunol. 29:3245.[Medline]
  39. Urban, B. C., D. J. Ferguson, A. Pain, N. Willcox, M. Plebanski, J. M. Austyn, D. J. Roberts. 1999. Plasmodium falciparum-infected erythrocytes modulate the maturation of dendritic cells. Nature 400:73.[Medline]
  40. Van Overtvelt, L., N. Vanderheyde, V. Verhasselt, J. Ismaili, L. De Vos, M. Goldman, F. Willems, B. Vray. 1999. Trypanosoma cruzi infects human dendritic cells and prevents their maturation: inhibition of cytokines, HLA-DR, and costimulatory molecules. Infect. Immun. 67:4033.[Abstract/Free Full Text]
  41. Kurts, C., H. Kosaka, F. R. Carbone, J. F. Miller, W. R. Heath. 1997. Class I-restricted cross-presentation of exogenous self-antigens leads to deletion of autoreactive CD8+ T cells. J. Exp. Med. 186:239.[Abstract/Free Full Text]
  42. Kurts, C., F. R. Carbone, M. Barnden, E. Blanas, J. Allison, W. R. Heath, J. F. Miller. 1997. CD4+ T cell help impairs CD8+ T cell deletion induced by cross- presentation of self-antigens and favors autoimmunity. J. Exp. Med. 186:2057.[Abstract/Free Full Text]
  43. Inaba, K., S. Turley, F. Yamaide, T. Iyoda, K. Mahnke, M. Inaba, M. Pack, M. Subklewe, B. Sauter, D. Sheff, et al 1998. Efficient presentation of phagocytosed cellular fragments on the major histocompatibility complex class II products of dendritic cells. J. Exp. Med. 188:2163.[Abstract/Free Full Text]
  44. Albert, M. L., S. F. Pearce, L. M. Francisco, B. Sauter, P. Roy, R. L. Silverstein, N. Bhardwaj. 1998. Immature dendritic cells phagocytose apoptotic cells via {alpha}v{beta}5 and CD36, and cross-present antigens to cytotoxic T lymphocytes. J. Exp. Med. 188:1359.[Abstract/Free Full Text]
  45. Elliott, T., A. Willis, V. Cerundolo, A. Townsend. 1995. Processing of major histocompatibility class I-restricted antigens in the endoplasmic reticulum. J. Exp. Med. 181:1481.[Abstract/Free Full Text]
  46. Anderson, K., P. Cresswell, M. Gammon, J. Hermes, A. Williamson, H. Zweerink. 1991. Endogenously synthesized peptide with an endoplasmic reticulum signal sequence sensitizes antigen processing mutant cells to class I-restricted cell mediated lysis. J. Exp. Med. 174:489.[Abstract/Free Full Text]
  47. Snyder, H. L., J. W. Yewdell, J. R. Bennick. 1994. Trimming of antigenic peptides in an early secretory compartment. J. Exp. Med. 180:2389.[Abstract/Free Full Text]
  48. Meyers, J. D., N. Flournoy, E. D. Thomas. 1986. Risk factors for cytomegalovirus infection after human marrow transplantation. J. Infect. Dis. 153:478.[Medline]
  49. Forman, S. J., J. A. Zaia. 1994. Treatment and prevention of cytomegalovirus pneumonia after bone marrow transplantation: where do we stand?. Blood 83:2392.[Free Full Text]
  50. Greenberg, P. D., S. R. Riddell. 1999. Deficient cellular immunity: finding and fixing the defects. Science 285:546.[Abstract/Free Full Text]
  51. Diamond, D. J., J. York, J. Y. Sun, C. L. Wright, S. J. Forman. 1997. Development of a candidate HLA A*0201 restricted peptide-based vaccine against human cytomegalovirus infection. Blood 90:1751.[Abstract/Free Full Text]
  52. Ruger, B., S. Klages, B. Walla, J. Albrecht, B. Fleckenstein, P. Tomlinson, B. Barrell. 1987. Primary structure and transcription of the genes coding for the two virion phosphoproteins pp65 and pp71 of human cytomegalovirus. J. Virol. 61:446.[Abstract/Free Full Text]
  53. McLaughlin-Taylor, E., B. Tanamache, H. Pande. 1994. Identification of the major late human cytomeglovirus matrix protein pp65 as a target antigen for CD8+ virus-specific cytotoxic T lymphocytes. J. Med. Virol. 43:103.[Medline]
  54. Brinckerhoff, L. H., L. W. Thompson, Jr C. L. Slingluff. 2000. Melanoma vaccines. Curr. Opin. Oncol. 12:163.[Medline]
  55. Yee, C., M. J. Gilbert, S. R. Riddell, V. G. Brichard, A. Fefer, J. A. Thompson, T. Boon, P. D. Greenberg. 1996. Isolation of tyrosinase-specific CD8+ and CD4+ T cell clones from the peripheral blood of melanoma patients following in vitro stimulation with recombinant vaccinia virus. J. Immunol. 157:4079.[Abstract]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
S. Kreiter, A. Selmi, M. Diken, M. Sebastian, P. Osterloh, H. Schild, C. Huber, O. Tureci, and U. Sahin
Increased Antigen Presentation Efficiency by Coupling Antigens to MHC Class I Trafficking Signals
J. Immunol., January 1, 2008; 180(1): 309 - 318.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
N. Fernandez-Borges, A. Brun, J. L. Whitton, B. Parra, F. Diaz-San Segundo, F. J. Salguero, J. M. Torres, and F. Rodriguez
DNA Vaccination Can Break Immunological Tolerance to PrP in Wild-Type Mice and Attenuates Prion Disease after Intracerebral Challenge.
J. Virol., October 1, 2006; 80(20): 9970 - 9976.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
G. S. Taylor, H. M. Long, T. A. Haigh, M. Larsen, J. Brooks, and A. B. Rickinson
A Role for Intercellular Antigen Transfer in the Recognition of EBV-Transformed B Cell Lines by EBV Nuclear Antigen-Specific CD4+ T Cells
J. Immunol., September 15, 2006; 177(6): 3746 - 3756.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
D. G. Kavanagh, D. E. Kaufmann, S. Sunderji, N. Frahm, S. Le Gall, D. Boczkowski, E. S. Rosenberg, D. R. Stone, M. N. Johnston, B. S. Wagner, et al.
Expansion of HIV-specific CD4+ and CD8+ T cells by dendritic cells transfected with mRNA encoding cytoplasm- or lysosome-targeted Nef
Blood, March 1, 2006; 107(5): 1963 - 1969.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. Oseroff, F. Kos, H.-H. Bui, B. Peters, V. Pasquetto, J. Glenn, T. Palmore, J. Sidney, D. C. Tscharke, J. R. Bennink, et al.
HLA class I-restricted responses to vaccinia recognize a broad array of proteins mainly involved in virulence and viral gene regulation
PNAS, September 27, 2005; 102(39): 13980 - 13985.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
L. Liu, Z. Xu, R. C. Fuhlbrigge, V. Pena-Cruz, J. Lieberman, and T. S. Kupper
Vaccinia Virus Induces Strong Immunoregulatory Cytokine Production in Healthy Human Epidermal Keratinocytes: a Novel Strategy for Immune Evasion
J. Virol., June 15, 2005; 79(12): 7363 - 7370.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. Muraro, A. Bondanza, M. Bellone, P. D. Greenberg, and C. Bonini
Molecular modification of idiotypes from B-cell lymphomas for expression in mature dendritic cells as a strategy to induce tumor-reactive CD4+ and CD8+ T-cell responses
Blood, May 1, 2005; 105(9): 3596 - 3604.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
I. B. Villada, M. M. Barracco, M. Ziol, A. Chaboissier, N. Barget, S. Berville, B. Paniel, E. Jullian, T. Clerici, B. Maillere, et al.
Spontaneous Regression of Grade 3 Vulvar Intraepithelial Neoplasia Associated with Human Papillomavirus-16-Specific CD4+ and CD8+ T-Cell Responses
Cancer Res., December 1, 2004; 64(23): 8761 - 8766.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
G. Liu, H. Ying, G. Zeng, C. J. Wheeler, K. L. Black, and J. S. Yu
HER-2, gp100, and MAGE-1 Are Expressed in Human Glioblastoma and Recognized by Cytotoxic T Cells
Cancer Res., July 15, 2004; 64(14): 4980 - 4986.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Bonehill, C. Heirman, S. Tuyaerts, A. Michiels, K. Breckpot, F. Brasseur, Y. Zhang, P. van der Bruggen, and K. Thielemans
Messenger RNA-Electroporated Dendritic Cells Presenting MAGE-A3 Simultaneously in HLA