| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Program in Immunology, Fred Hutchinson Cancer Research Center, Seattle, WA 98103, and Department of Immunology and Medicine, University of Washington, Seattle, WA 98195;
Immunotherapy and Gene Therapy Program, H. S. Raffaele, Milan, Italy; and
Cancer Research Campaign Institute for Cancer Studies, University of Birmingham, Birmingham, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and poly(I:C), and failure to induce a
CD8+ response. By contrast, DCmat can be
infected with rVV and induce a CD8+ response, but, having
lost phagocytic activity, fail to process the Ag via the exogenous
class II pathway. To overcome these limitations, we used the CMV
protein pp65 as a model Ag and designed a gene containing the
lysosomal-associated membrane protein 1 targeting sequence
(Sig-pp65-LAMP1) to target pp65 to the class II compartment.
DCmat infected with rVV-Sig-pp65-LAMP1 induced
proliferation of pp65-specific CD4+ clones and efficiently
induced a pp65-specific CD4+ response, suggesting that
after DC maturation the intracellular processing machinery for class II
remains intact for at least 16 h. Moreover, infection of
DCmat with rVV-Sig-pp65-LAMP1 resulted in at least
equivalent presentation to CD8+ cells as infection with
rVV-pp65. These results demonstrate that despite rVV interference with
DCimm maturation, a single targeting vector can deliver
Ags to DCmat for the effective simultaneous stimulation
of both CD4+ and CD8+
cells. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and macrophage
inflammatory protein-1
(2, 3, 4, 5, 6, 7, 8). Such maturation and
activation of DC result in the loss of phagocytic capacity and thus an
inability to process new exogenous Ags for class II presentation, but
acquisition of the ability to efficiently stimulate MHC class
I-restricted CD8+ T cells
(9, 10, 11, 12). Since 1980, when the Assembly of the World Health Organization declared smallpox eradicated and recommended the discontinuation of smallpox vaccination, vaccinia virus has become an appealing vector for vaccination purposes. In fact, among the several vectors that can be used to transfer genes into DC, recombinant vaccinia viruses (rVV) have proven to be relatively safe and effective.
Vaccinia is a nonintegrating virus that is easy to manipulate genetically and capable of accommodating large genes (13). However, it has been recently shown that vaccinia virus infection of immature DC blocks the ability of monocyte-conditioned medium (MCM) to induce subsequent DC maturation and activation (14). Presumably, this immune evasion mechanism is employed by the virus to lengthen the duration of in vivo viral replication, but it represents a significant obstacle to the development of recombinant vaccinia viruses for use in DC-based anti-viral and anti-tumor vaccines. Potentially, the vaccinia-induced blockade to maturation might be overcome by providing activation signals in addition to those present in MCM, such as ligation of CD40. Alternatively, DC could be activated before vaccinia infection. Such mature DC could be expected to effectively present introduced Ags in the context of MHC class I, but processing and presentation of Ags in the context of MHC class II may be inefficient. The major pathway for MHC class II presentation requires phagocytosis or endocytosis of exogenous Ags by APCs, followed by protein degradation to peptides in lysosome-like compartments (15, 16). The peptides subsequently are loaded onto MHC class II molecules that have been targeted to these endosomal/lysosomal compartments, and the complex trafficks to the cell surface for presentation to CD4+ T cells. Since activation of DC induces down-regulation of phagocytic ability, this pathway for exogenous Ags may no longer be available for processing.
Molecular approaches directly targeting intracellular Ags into the appropriate subcellular compartment for MHC class II processing have been recently described (17, 18, 19, 20, 21, 22). The lysosomal-MHC class II processing compartment is characterized by several specific membrane proteins that function to resist degradation by hydrolases, maintain an acidic environment, and promote fusion with other membrane organelles, such as endosomes and phagosomes (23). Lysosomal-associated membrane protein 1 (LAMP1) is a membrane glycoprotein detected predominantly in the lysosome and late endosomes (24, 25). Expression of truncated LAMP1 molecules in COS-1 cells revealed that a tyrosine in the cytoplasmic tail is necessary for targeting to lysosomes (26) and that peptide-targeting sequences located in the cytoplasmic tail are sufficient to deliver a reporter molecule to lysosomes (27). Recently, Wu and colleagues showed that linking the sorting signals of LAMP1 to the cytoplasmic/nuclear human papilloma virus E7 Ag routed this endogenously synthesized Ag into the MHC class II pathway, resulting in enhanced presentation to CD4+ cells both in vitro and in vivo (17, 19). The use of LAMP1-targeting sequences to improve MHC class II Ag presentation has also been shown with HIV gp160 (18, 20, 21), EBV, and influenza virus (22).
In this study we linked the sorting signals of LAMP1 to the CMV nuclear/cytoplasmic protein pp65, a protein being evaluated in CMV vaccines due in part to its ability to naturally elicit strong CD4+ and CD8+ responses in infected individuals, to determine whether facilitating targeting of the protein to the lysosomal compartment in mature DC (DCmat) could rescue class II presentation while preserving class I presentation. We observed that a single targeting recombinant vaccinia virus can infect previously activated DC and effectively introduce Ag into both MHC class I and MHC class II processing pathways for stimulation of both CD4+ and CD8+ cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
PBMC from healthy donors were isolated by Ficoll-Hypaque sedimentation, and 50 x 106 cells were plated in a T-25 flask. After 1 h floating cells were removed, and adherent cells were cultured in 5 ml of RPMI 1640 supplemented with 25 mmol/L of HEPES buffer, 4 mmol/L of L-glutamine, 50 U/ml penicillin/ml, 50 µg/ml streptomycin, and 10% FCS (HyClone, Logan, UT). GM-CSF (100 ng/ml; Immunex, Seattle, WA) and 25 ng/ml of IL-4 (Endogen, Moburn, MA) were added on days 0 and 4. Nonadherent DC (1–3 x 106) were harvested on day 7. When DC were generated to stimulate CD4+ T cells, 10% human serum (HS) was used in place of FCS.
Activation signals for DC
To generate MCM for activation of DC, Ig-coated bacteriologic
plates were prepared by the addition of 4 ml of human 
-globulin (10
mg/ml) for 1 min. The plates were washed three times, and 50 x
106 PBMC were added. After 1 h floating
cells were removed, and adherent cells were cultured in 5 ml of RPMI
1640 containing 10% HS. After 24 h supernatant was harvested,
filtered with a 0.22 µm pore size filter, and stored at -70°C. To
induce DC activation, 1 vol of MCM was added to 1 vol of DC.
Alternatively, DC were activated by addition of 10 µg/ml
anti-CD40 mAb (G28.5, American Type Culture Collection (ATCC),
Manassas, VA), 1 µg/ml LPS (Sigma, St. Louis, MO), 100 ng/ml TNF-
(Genzyme, Cambridge, MA), and 12.5 µg/ml poly(I:C).
Antibodies
The purity of the DC was evaluated by cell surface staining with FITC-conjugated Abs to CD19 and CD20; PE-conjugated Abs to CD11c, CD14, CD56, and CD3; and FITC- and PE-conjugated isotype controls (BD Biosciences, Mountain View, CA). Activation of DC was evaluated by staining the cells with PE-conjugated Abs to CD80 and HLA-DR (BD Biosciences), CD83 and CD86 (Immunotech, Westbrook, ME), and isotype controls. The samples were analyzed on a FACSCalibur (BD Biosciences) using CellQuest software. Data shown are representative of three or more independent experiments.
Plasmids and vaccinia viruses
The Sig-pp65-LAMP1 gene was constructed by 30 cycles of strand overlap extension PCR with the high fidelity PWO DNA polymerase, using as template the Sig-E7-LAMP1 gene (provided by D. Pardoll, Johns Hopkins University, Baltimore, MD) and the pp65 gene from CMV AD169 (obtained from ATCC). The forward primer CGGGATCCATGGCGGCCCCCGGC corresponding to aa 1–5 of LAMP1 (preceded by a BamHI restriction site) and the reverse primer GCGACCGCGCGACTCCATTAGATCCTCAAAGAGTGC corresponding to aa 1–6 of pp65 followed by aa 24–29 of LAMP1 (underlined nucleotides) were used to amplify the endoplasmic reticulum (ER) sorting signal (Sig) of LAMP1, with annealing at 50°C for 30 min and extensions at 72°C for 1 min. The forward primer ATGGAGTCGCGCGGTCGC corresponding to aa 1–6 of pp65 and the reverse primer GGGGATCAACATGTTGTTAAGACCTCGGTGCTTTTTGGGCGT corresponding to aa 365–371 of LAMP1 and to aa 555–561 of pp65 (underlined nucleotides) were used to amplify pp65, with annealing at 58°C for 1 min and extensions at 72°C for 2 min. The forward primer CTTAACAACATGTTGATCCCC corresponding to aa 365–371 of LAMP1 and the reverse primer GCTCTAGACTAGATGGT CTGATAGCCGGC corresponding to aa 400–405 of LAMP1 followed by a stop codon and an XbaI restriction site were used to amplify the cytoplasmic tail of LAMP1, with annealing at 58°C for 30 min and extensions at 72°C for 1 min. The overlapping extension PCR was performed with annealing at 60°C (to fuse Sig and pp65) and 58°C (to fuse pp65 and LAMP1-tail) for 1 min and extensions at 72°C for 2 min.
rVV Sig-pp65-LAMP1 was generated by cloning the gene in the psc11 plasmid downstream of the vaccinia p7.5 early/late promoter by blunt ligation in the SmaI site. The plasmid was transfected with Lipofectamine into BSC-40 cells infected with wild-type vaccinia (vacwt), and rVV was amplified in thymidine kinase-negative cells and plaque purified. An rVV coding for green fluorescence protein (GFP) under control of the vaccinia p7.5 promoter was provided by L. Corey (Fred Hutchinson Cancer Research Center, Seattle, WA). An rVV coding for pp65 under control of the vaccinia p7.5 promoter was provided by W. Britt (University of Alabama, Birmingham, AL). Viral stocks were prepared in BSC-40 cells, titrated simultaneously, and diluted in DMEM containing 2.5% FCS to a final titer of 109 PFU/ml.
Functional analysis of rVV-infected immature and mature DC
Infection. Adherent cells derived from PBMC were used to generate DC as previously described. Nonadherent cells were harvested and frozen. On day 6 half the DCimm were exposed to an activation signal for 24 h as described above. On day 7 both DCimm and DCmat were infected with a vaccinia virus for 8 h, and viral replication was halted by 4-min exposure to UV light (254 nm wavelength). A UV light in a Naui Bio-safety cabinet (NU-425-400; Nuaire, Plymouth, MN) was used as a UV source. Infected cells were placed at 3 cm from the UV source and were exposed to 3.06 mJ/cm2 (0.76 mJ/min/cm2). Noninfected DC, used as a control, were also exposed to UV light.
Induction of pp65-specific CD8+ CTL lines. Nonadherent cells were CD4 depleted by incubation with anti-CD4 Ab conjugated to Dynabeads (Dynal, Lake Success, NY) at a 1/5 cell/bead ratio and removed by a magnet. The rVV-pp65 infected DC (105) were used to stimulate 2 x 106 autologous CD8+ T cells from a CMV+ donor in RPMI 1640 supplemented with 10% FCS and 5 U/ml IL-2 (Cetus, Emeryville, CA) in 24-well culture plates. IL-2 was supplemented every 3–4 days. On day 7 the cells were restimulated with the same culture conditions. After two rounds of in vitro stimulation, standard 4-h 51Cr release assays were performed in triplicate using EBV-transformed B cell lines (EBV-LCL) infected with rVV-pp65 or with vacwt as target cells. The percent specific lysis was calculated using the standard formula.
Stimulation of pp65-specific CD4+ T cell clones. The pp65-specific CD4+ T cell clones (2 x 105) generated by limiting dilution cloning from CMV+ donors were stimulated in vitro by incubation with 104 autologous immature or activated DC infected with rVV-pp65, rVV-Sig-pp65-LAMP1, or vacwt at 37°C in triplicate. After 56 h 100 µCi of [3H]TdR was added to each well, and the counts per minute were determined at 72 h. The proliferative response was expressed as the total counts per minute.
Determination of pp65-specific CD4+ precursor frequency. Nonadherent cells were CD8 depleted by incubation with anti-CD8 Abs conjugated to Dynabeads at a 1/5 cell/bead ratio and removed by a magnet. CD4+ T cells (2 x 106) were stimulated by incubation in RPMI 1640 supplemented with 10% HS with 105 autologous immature or activated DC infected with rVV-pp65 or rVV-Sig-pp65-LAMP1 or were pulsed for 4 h with a CMV Ag preparation prepared by glycine extraction (28). After 7 days the CD4+ T cell lines were plated in limiting dilution in replicates of 12 in the presence of 2 x 104 autologous PBMC irradiated at 3000 rad and infected with rVV-pp65 or rVV-Sig-pp65-LAMP1 or were pulsed for 4 h with a CMV Ag. IL-2 (50 U/ml) was added every 3–4 days. After 10 days cells were stimulated in vitro by incubation with 2 x 104 autologous EBV-LCL infected with rVV-Sig-pp65-LAMP1 or vacwt at 37°C in triplicate. After 56 h 100 µCi of [3H]TdR was added to each well, and the counts per minute were determined at 72 h. The proliferative response was expressed as the total counts per minute. Wells with [3H]TdR incorporation in the presence of pp65 at least three times higher than that in the presence of only vacwt were considered positive. Regression curves were interpolated, and precursor frequencies were determined according to Poisson statistics.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A rVV coding for GFP (rVV-GFP) was used to analyze the ability of
rVV to infect DCimm. DCimm, generated from PBMC
as previously described, were infected at varying multiplicity of
infection (MOI) for 8 h. An MOI of 10:1 reproducibly resulted in
the highest infection efficiency (50–85%) and was used for additional
experiments (Fig. 1
A).
|
, B and
C). This result was confirmed by analysis at earlier (12 h)
and later (48 h) time points after rVV infection (data not shown).
It has been recently reported that exposure to MCM fails to
induce activation of DCimm infected with rVV
(14). However, there are many alternative pathways by
which DC can be activated. Since such activation is required for
optimal stimulation of T cell responses, we examined the effect on
DCimm of additional activation signals provided 4 h
after infection with vaccinia, including LPS, mAb to CD40, TNF-, and
poly(I:C). At 12 h postinfection cells were exposed to UV
irradiation to halt viral replication. Control DCimm were
mock infected, exposed to the activation signals, and subsequently
exposed to UV irradiation. Since most activation signals induce
detectable responses in 24 h, the maturation status of
vaccinia-infected DC was analyzed 24 h after exposure to the
activation signal. None of the signals examined, including MCM, induced
up-regulation of activation markers such as CD80 and CD83 on
vaccinia-infected DC (Fig. 2). By
contrast, all the signals induced activation of uninfected immature DC,
although with differing efficiencies. Since CD40 is a crucial molecule
for DC maturation, CD40 expression was analyzed in rVV-infected
DCimm. The level of CD40 on infected cells showed a pattern
of expression very similar to that showed by the other activation
markers tested. In fact, although rVV infection did not down-regulate
the low levels of CD40 detected in DCimm, rVV-infected
DCimm exposed to activation signals failed to up-regulate
CD40. The block of activation of rVV-infected DC was not due to a
delayed kinetics of activation, since no changes were detectable for up
to 48 h after infection (data not shown).
|
DC that have been activated by exposure to reagents such as LPS
are significantly more resistant than immature DC to influenza virus
infection (29). Therefore, the susceptibility of activated
DC to vaccinia virus infection was assessed. Immature DC were exposed
to MCM or LPS for 16 h and then infected with rVV-GFP at an MOI of
10:1 for 8 h. DCmat were still susceptible to vaccinia
virus infection (Fig. 3). Additionally,
the infected activated DC were more resistant to the cytopathic effects
of vaccinia virus than immature DC, with virtually all of the infected,
GFP+ activated DC remaining viable at 48 h
after infection compared with only 37% of infected
GFP+ immature DC (data not shown). Analysis of
DCmat that had been matured with different activation
signals before infection revealed that vaccinia infection did not
interfere with continued expression of maturation and costimulatory
markers (Fig. 3). The level of expression of CD80 and CD83 in
rVV-infected DCmat was significantly higher than that in
rVV-infected DCimm. However, the level of expression of CD80
in rVV-infected DCmat was slightly lower than that in
noninfected DCmat. This effect could be one of the
manifestations of vaccinia virus infection, such as the reduction in
protein synthesis often observed after viral infection
(30). This phenomenon seems to be independent from the
activation status of the cells, since the level of expression of the
activation molecule CD83 was similar in rVV-infected and noninfected
DCmat.
|
The abilities of DCimm and DCmat to
stimulate a CD8+ T cell response after rVV
infection were compared in vitro. The matrix protein pp65 of CMV was
selected as a model Ag in part for its ability to induce an
immunodominant CD8+ T cell response in
CMV-seropositive individuals (28, 31).
DCimm generated from PBMC of CMV-positive,
non-smallpox-vaccinated, healthy individuals were infected with a
vaccinia virus coding for pp65 (rVV-pp65) at an MOI of 10:1 for 8
h. Aliquots of DC from the same donor were activated for 16 h with
LPS and subsequently infected with rVV-pp65 at an MOI of 10:1 for
8 h. After 4 min of UV irradiation to inactivate the virus,
infected DC were used to stimulate autologous
CD8+ T cells at a responder/stimulator
(R/S) ratio of 20/1 as described in Materials and
Methods. After two 7-day cycles of in vitro stimulation, the
responding CD8+ T cell lines were assayed for
cytolytic activity with autologous EBV-LCL infected with rVV-pp65 or
vacwt. Weak cytolytic responses were observed
following stimulation with rVV-pp65-infected DCimm, whereas
DCmat stimulators induced a more robust response from the
same initial responding population (Fig. 4). Comparable results were obtained with
an anti-CD40 mAb or TNF- to activate DC, suggesting that the
improved ability of DCmat to induce
CD8+ T cell responses is independent of the
activation signal (data not shown).
|
Since pp65 is a nonsecreted cytoplasmic protein, the transfer of newly synthesized pp65 in infected cells into the lysosomal/endosomal compartment is likely to be inefficient. Although DCimm can take up exogenous Ag for entry into the class II presentation pathway, activation of DC results in the loss of phagocytic activity and a rapid, but transient, boost of MHC class II synthesis followed by formation of peptide-MHC class II complexes characterized by a particularly long half-life and decreased new class II synthesis (32, 33). Thus, DC infected with rVV after activation may be effective for inducing CD8+ T cell responses to proteins such as pp65, but poor in inducing CD4+ responses.
To assess the presentation by DC of Ag in the context of class II, a
sensitive assay measuring the recognition by high affinity T cell
clones was employed. A pp65-specific CD4+ T cell
clone was stimulated by autologous DCimm infected with
rVV-pp65 or vacwt and autologous DCmat
infected with rVV-pp65 or vacwt at an R/S ratio
of 20/1, and [3H]TdR incorporation was assessed
72 h later. The rVV-pp65-infected DCimm induced strong
proliferative responses by the pp65-specific CD4+
T cell clone (Fig. 5). This result could
reflect either direct processing of an endogenously expressed cytosolic
protein or, more likely, phagocytosis of the pp65 protein from infected
dying cells and processing via the conventional exogenous processing
pathway. By contrast, rVV-pp65-infected DCmat induced a very
low level of proliferation by the pp65-specific
CD4+ T cell clone (Fig. 5). This low, but still
detectable, level of proliferation could reflect either contamination
of the DCmat cell population with a small number of
DCimm, as suggested by flow cytometry studies (Fig. 1), or
the fact that the class II processing machinery is intact in
DCmat, and CD4+ proliferation resulted
from processing of cytoplasmic pp65 protein in DCmat through
unconventional MHC class II processing pathways that are less efficient
than the exogenous pathway. Since these two alternatives have distinct
implications for designing a DC-based vaccine, the experiments
described below were designed to assess class II processing of
DCmat.
|
A chimeric Sig-pp65-LAMP1 gene, containing the 5' sorting signal of the mouse LAMP1 (to mediate translocation of the nascent protein to the lumen of the endoplasmic reticulum) encoded in-frame with pp65 and the 3' transmembrane and cytoplasmic tail of the mouse LAMP1 for lysosomal targeting of the protein, was constructed to facilitate class II processing. To accurately compare rVV-pp65 with rVV-Sig-pp65-LAMP1, the viral titers of rVV-pp65 and rVV-Sig-pp65-LAMP1 were measured simultaneously three times. The level of Ag expression was evaluated by Western blot on LCL infected with rVV-pp65 and rVV-Sig-pp65-LAMP1 at an MOI of 10:1. The blot was probed with the C10C11 mAb specific for pp65 and showed that the same level of Ag expression was conferred by infection with rVV-pp65 or rVV-Sig-pp65-LAMP1 (data not shown). Intracellular trafficking of the pp65 protein to the appropriate compartment was confirmed by immunofluorescence. EBV-LCL were infected with rVV containing the chimeric and wild-type pp65 constructs at an MOI of 10:1 for 8 h and were stained with the C10C11 mAb and a secondary Ab conjugated with FITC. Lysosomal-targeted protein Sig-pp65-LAMP1 exhibited a cytoplasmic vesicular staining pattern, whereas wild-type pp65 demonstrated intranuclear localization (data not shown).
DCmat were infected with rVV-pp65 or rVV-Sig-pp65-LAMP1 and
used to stimulate autologous CD8+-depleted,
CD4+ T cells from a CMV-positive smallpox-naive
donor. DCimm infected with rVV-pp65 and DCimm
pulsed with a CMV Ag preparation obtained by glycine extraction of
CMV-infected fibroblasts (28) were used as positive
controls. All DC were exposed to 4 min of UV irradiation before the
addition of T cells. After one cycle of stimulation the
CD4+ T cell lines were plated in limiting
dilution to quantify the number of responding cells. After 10 days,
wells were split in two and stimulated with 2 x
104 autologous EBV-LCL infected with either
rVV-Sig-pp65-LAMP1 or vacwt, and
[3H]TdR incorporation was assessed 72 h
later. A proliferation index >3 was interpreted as a positive well,
and the frequency of pp65-specific CD4+ T cells
elicited by the different APC during the initial in vitro stimulation
was calculated by Poisson distribution (Fig. 6). Consistent with the results observed
using pp65-specific CD4+ T cell clones,
DCimm infected with rVV-pp65 was significantly more
efficient than DCmat infected with rVV-pp65 at inducing an
in vitro pp65-specific CD4+ T cell response from
PBMC of the CMV-immune donor. However, DCmat infected with
rVV-Sig-pp65-LAMP1 were significantly more efficient than
DCmat infected with rVV-pp65 at inducing a pp65-specific
CD4+ T cell response. The frequency of
CD4+ T cells elicited by
rVV-Sig-pp65-LAMP1-infected DCmat was similar to the
frequency obtained with DCimm infected with rVV-pp65 or
pulsed with CMV Ag. These results suggest that the intracellular
processing machinery for class II remains intact for at least 16 h
after activation, and that the poor Ag uptake by DCmat can
be completely overcome by intracellular targeting of the Ag to the MHC
class II compartment. Furthermore, the similar frequency of
CD4+ T cells elicited by rVV-infected DC and
Ag-pulsed DC suggest that rVV infection does not inherently diminish
the immunostimulatory capacity of DC.
|
LAMP1 sequences targeting pp65 to the class II processing pathway
could potentially interfere with class I processing and presentation of
the same Ag by DCmat by reducing the amount of Ag reaching
the proteasome. To assess this potential obstacle, EBV-LCL were
infected with rVV-pp65 or rVV-Sig-pp65-LAMP1 at an MOI of 10:1 for
8 h and were used as targets for autologous pp65-specific
CD8+ clones. EBV-LCL infected with
rVV-Sig-pp65-LAMP1 were killed equivalently to EBV-LCL expressing
wild-type pp65, suggesting that the presence of a lysosomal-targeting
sequence does not preclude sufficient class I processing (Fig. 7A). Since settings with more
limited protein production might more effectively reveal differences in
MHC class I processing, EBV-LCL were infected at an MOI of 10:1 for
4 h (Fig. 7B) or at an MOI of 1:1 for 8 h (Fig. 7C) and used as targets. Surprisingly, in both conditions
infection of EBV-LCL with rVV-Sig-pp65-LAMP1 resulted in better
presentation to pp65-specific CD8+ T cell clones
than infection with rVV-pp65, suggesting that the presence of the
lysosomal-targeting sequence might actively enhance class I processing
of the protein, perhaps by promoting degradation due to some improper
folding.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Viral vectors can be used to efficiently introduce genes encoding an Ag
of interest into DC. Although some viruses, such as influenza, may
directly promote DC maturation, it has been recently reported that
pathogens, including viruses, can block maturation of immature DC
(14, 38). Such disruption of DC maturation may represent
an important mechanism by which these pathogens evade rapid elimination
by the immune system (38, 39, 40). For example, erythrocytes
infected by Plasmodium falciparum bind immature
DC and inhibit LPS-induced maturation (39),
Trypanosome cruzi produce soluble factors that inhibit DC
maturation (40), herpes simplex virus infection of
immature DC blocks LPS-induced DC maturation (38), and
vaccinia virus infection of immature DC blocks MCM-induced DC
maturation (14). Our results with a recombinant vaccinia
vector reveal that the mechanism responsible for the block of DC
maturation by vaccinia globally impairs the response to maturation
signals, since it could not be overcome by alternative known DC
activators, such as a ligand for CD40, TNF-, LPS, and poly(I:C).
The host has many mechanisms in vivo with which to ultimately overcome this viral evasion strategy. Infected immature DC would not be expected to efficiently induce CD4+ or CD8+ responses, but the lytic infection should lead to the release of viral proteins that could be phagocytosed by immature uninfected DC, which are capable of processing proteins in the class II pathway and responding to maturation signals. This is consistent with our observation that the intracellular nuclear/cytoplasmic protein pp65 can be presented to CD4+ T cells following expression in vaccinia-infected immature DC, but not following infection of a mature nonphagocytic DC population. The induction of CD8+ responses could also result from uptake of exogenous Ag or phagocytosis of apoptotic infected cells by immature DC, which could then mature and process the Ag in the class I pathway via a process called cross-presentation (41, 42, 43, 44). Alternatively, CD8+ responses could result from direct infection of DC that have already been induced to mature by the local inflammatory response. Indeed, DCmat infected with vaccinia maintain a functional mature phenotype, as recently reported (14), and we observed that DCmat are less sensitive that DCimm to the cytopathic effects of rVV.
These differing requirements for efficient presentation by DC of distinct maturation states significantly complicate the use of rVV as a vector for introducing Ags in a DC-based vaccine for induction of both CD4+ and CD8+ responses. Therefore, we pursued alternative methods to establish a single rVV vector capable of infecting a single DC population capable of stimulating both CD4+ and CD8+ T cells. Using a molecular approach that directly targeted pp65 into the lysosomal compartment to facilitate presentation in the context of MHC class II (17, 18, 19, 20, 21, 22), we observed that the intracellular processing machinery for the class II pathway in DC remains intact for at least 16 h after the delivery of a maturation signal, and that such mature infected DC can effectively induce CD4+ T cell responses. Moreover, the hybrid pp65 protein fused to both the LAMP1 transmembrane-cytoplasmic tail and an ER sorting signal did not interfere with concurrent processing of the protein via the class I pathway. Such class I presentation of the hybrid protein was observed with multiple CD8+ clones recognizing different pp65 epitopes and using different restriction elements (data not shown). Preliminary results suggest that the MHC class I processing of LAMP1-targeted hybrid proteins is TAP dependant (data no shown), implying that cytosolic degradation of the protein, rather than ER retention, is responsible for this effect (45, 46, 47). Regardless, the results suggest that this strategy can be employed to express hybrid proteins in mature DC and effectively stimulate both CD4+ and CD8+ T cells.
There are many settings in which the use of DC that have processed Ags in the context of both class I and class II molecules might be employed. CMV infection represents a significant cause of morbidity and mortality in individuals undergoing hemopoietic stem cell transplantation (48, 49). The administration of donor-derived CMV-specific T cells has been shown to prevent the development of disease, and alternative strategies to increase the number of virus-specific T cells contained in the donor stem cell inoculum by intentional immunization of the donor are being pursued (28, 31, 50, 51). The CMV protein described in our studies, pp65, is the most abundant in virus particles and has been shown to elicit both CD4+ and the immunodominant protective CD8+ T cell response to CMV (52, 53). The reagents described here could prove useful for inducing/augmenting responses to pp65 in stem cell donors. Similarly, T cell transfer has been shown to be effective in the therapy of melanoma, and vaccine approaches have being pursued as a more feasible alternative (54). For melanoma Ags such as tyrosinase, which has been shown to induce both CD4+ and CD8+ responses (55), vaccination with DC expressing a hybrid-targeted protein rather than peptide-loaded DC might prove more efficient at inducing a broader and more effective repertoire of T cell responses. In vivo studies should elucidate the added benefit of this approach.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Philip D. Greenberg, Department of Immunology and Medicine, University of Washington, Box 356527, Seattle, WA 98195.
3 Abbreviations used in this paper: DC, dendritic cells; DCimm, immature DC; DCmat, mature DC; LAMP-1, lysosomal-associated membrane protein 1; HS, human serum; rVV, recombinant vaccinia viruses; vacwt, wild-type vaccinia; GFP, green fluorescence protein; MOI, multiplicity of infection; MCM, monocyte-conditioned medium; EBV-LCL, EBV-transformed B cell lines; ER, endoplasmic reticulum; R/S, responder/stimulator.
Received for publication September 5, 2000. Accepted for publication February 2, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. J. Exp. Med. 179:1109.v5 and CD36, and cross-present antigens to cytotoxic T lymphocytes. J. Exp. Med. 188:1359.This article has been cited by other articles:
|
|
 |
|
  S. Kreiter, A. Selmi, M. Diken, M. Sebastian, P. Osterloh, H. Schild, C. Huber, O. Tureci, and U. Sahin Increased Antigen Presentation Efficiency by Coupling Antigens to MHC Class I Trafficking Signals J. Immunol., January 1, 2008; 180(1): 309 - 318. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Fernandez-Borges, A. Brun, J. L. Whitton, B. Parra, F. Diaz-San Segundo, F. J. Salguero, J. M. Torres, and F. Rodriguez DNA Vaccination Can Break Immunological Tolerance to PrP in Wild-Type Mice and Attenuates Prion Disease after Intracerebral Challenge. J. Virol., October 1, 2006; 80(20): 9970 - 9976. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. S. Taylor, H. M. Long, T. A. Haigh, M. Larsen, J. Brooks, and A. B. Rickinson A Role for Intercellular Antigen Transfer in the Recognition of EBV-Transformed B Cell Lines by EBV Nuclear Antigen-Specific CD4+ T Cells J. Immunol., September 15, 2006; 177(6): 3746 - 3756. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. G. Kavanagh, D. E. Kaufmann, S. Sunderji, N. Frahm, S. Le Gall, D. Boczkowski, E. S. Rosenberg, D. R. Stone, M. N. Johnston, B. S. Wagner, et al. Expansion of HIV-specific CD4+ and CD8+ T cells by dendritic cells transfected with mRNA encoding cytoplasm- or lysosome-targeted Nef Blood, March 1, 2006; 107(5): 1963 - 1969. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Oseroff, F. Kos, H.-H. Bui, B. Peters, V. Pasquetto, J. Glenn, T. Palmore, J. Sidney, D. C. Tscharke, J. R. Bennink, et al. HLA class I-restricted responses to vaccinia recognize a broad array of proteins mainly involved in virulence and viral gene regulation PNAS, September 27, 2005; 102(39): 13980 - 13985. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Liu, Z. Xu, R. C. Fuhlbrigge, V. Pena-Cruz, J. Lieberman, and T. S. Kupper Vaccinia Virus Induces Strong Immunoregulatory Cytokine Production in Healthy Human Epidermal Keratinocytes: a Novel Strategy for Immune Evasion J. Virol., June 15, 2005; 79(12): 7363 - 7370. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Muraro, A. Bondanza, M. Bellone, P. D. Greenberg, and C. Bonini Molecular modification of idiotypes from B-cell lymphomas for expression in mature dendritic cells as a strategy to induce tumor-reactive CD4+ and CD8+ T-cell responses Blood, May 1, 2005; 105(9): 3596 - 3604. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. B. Villada, M. M. Barracco, M. Ziol, A. Chaboissier, N. Barget, S. Berville, B. Paniel, E. Jullian, T. Clerici, B. Maillere, et al. Spontaneous Regression of Grade 3 Vulvar Intraepithelial Neoplasia Associated with Human Papillomavirus-16-Specific CD4+ and CD8+ T-Cell Responses Cancer Res., December 1, 2004; 64(23): 8761 - 8766. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Liu, H. Ying, G. Zeng, C. J. Wheeler, K. L. Black, and J. S. Yu HER-2, gp100, and MAGE-1 Are Expressed in Human Glioblastoma and Recognized by Cytotoxic T Cells Cancer Res., July 15, 2004; 64(14): 4980 - 4986. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bonehill, C. Heirman, S. Tuyaerts, A. Michiels, K. Breckpot, F. Brasseur, Y. Zhang, P. van der Bruggen, and K. Thielemans Messenger RNA-Electroporated Dendritic Cells Presenting MAGE-A3 Simultaneously in HLA Class I and Class II Molecules J. Immunol., June 1, 2004; 172(11): 6649 - 6657. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Li Pira, L. Bottone, F. Ivaldi, R. Pelizzoli, F. Del Galdo, L. Lozzi, L. Bracci, A. Loregian, G. Palu, R. De Palma, et al. Identification of new Th peptides from the cytomegalovirus protein pp65 to design a peptide library for generation of CD4 T cell lines for cellular immunoreconstitution Int. Immunol., May 1, 2004; 16(5): 635 - 642. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Worgall, A. Busch, M. Rivara, D. Bonnyay, P. L. Leopold, R. Merritt, N. R. Hackett, P. W. Rovelink, J. T. Bruder, T. J. Wickham, et al. Modification to the Capsid of the Adenovirus Vector That Enhances Dendritic Cell Infection and Transgene-Specific Cellular Immune Responses J. Virol., March 1, 2004; 78(5): 2572 - 2580. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. T. A. Marques Jr., P. Chikhlikar, L. B. de Arruda, I. C. Leao, Y. Lu, J. Wong, J.-S. Chen, B. Byrne, and J. T. August HIV-1 p55Gag Encoded in the Lysosome-associated Membrane Protein-1 as a DNA Plasmid Vaccine Chimera Is Highly Expressed, Traffics to the Major Histocompatibility Class II Compartment, and Elicits Enhanced Immune Responses J. Biol. Chem., September 26, 2003; 278(39): 37926 - 37936. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bonehill, C. Heirman, S. Tuyaerts, A. Michiels, Y. Zhang, P. van der Bruggen, and K. Thielemans Efficient Presentation of Known HLA Class II-restricted MAGE-A3 Epitopes by Dendritic Cells Electroporated with Messenger RNA Encoding an Invariant Chain with Genetic Exchange of Class II-associated Invariant Chain Peptide Cancer Res., September 1, 2003; 63(17): 5587 - 5594. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. J. Glew, B. V. Carr, L. S. Brackenbury, J. C. Hope, B. Charleston, and C. J. Howard Differential effects of bovine viral diarrhoea virus on monocytes and dendritic cells J. Gen. Virol., July 1, 2003; 84(7): 1771 - 1780. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Castiglioni, C. Lu, D. Lo, M. Croft, P. Langlade-Demoyen, M. Zanetti, and M. Gerloni CD4 T cell priming in dendritic cell-deficient mice Int. Immunol., January 1, 2003; 15(1): 127 - 136. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Stift, J. Friedl, P. Dubsky, T. Bachleitner-Hofmann, G. Schueller, T. Zontsich, T. Benkoe, K. Radelbauer, C. Brostjan, R. Jakesz, et al. Dendritic Cell-Based Vaccination in Solid Cancer J. Clin. Oncol., January 1, 2003; 21(1): 135 - 142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Hel, J. Nacsa, E. Tryniszewska, W.-P. Tsai, R. W. Parks, D. C. Montefiori, B. K. Felber, J. Tartaglia, G. N. Pavlakis, and G. Franchini Containment of Simian Immunodeficiency Virus Infection in Vaccinated Macaques: Correlation with the Magnitude of Virus-Specific Pre- and Postchallenge CD4+ and CD8+ T Cell Responses J. Immunol., November 1, 2002; 169(9): 4778 - 4787. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Kondo, M. S. Topp, H.-P. Kiem, Y. Obata, Y. Morishima, K. Kuzushima, M. Tanimoto, M. Harada, T. Takahashi, and Y. Akatsuka Efficient Generation of Antigen-Specific Cytotoxic T Cells Using Retrovirally Transduced CD40-Activated B Cells J. Immunol., August 15, 2002; 169(4): 2164 - 2171. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. F. Lipscomb and B. J. Masten Dendritic Cells: Immune Regulators in Health and Disease Physiol Rev, January 1, 2002; 82(1): 97 - 130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Hel, W.-P. Tsai, A. Thornton, J. Nacsa, L. Giuliani, E. Tryniszewska, M. Poudyal, D. Venzon, X. Wang, J. Altman, et al. Potentiation of Simian Immunodeficiency Virus (SIV)-Specific CD4+ and CD8+ T Cell Responses by a DNA-SIV and NYVAC-SIV Prime/Boost Regimen J. Immunol., December 15, 2001; 167(12): 7180 - 7191. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or with
vacwt (
) in a 51Cr release assay.
