The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ariga, T.
Right arrow Articles by Sakiyama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ariga, T.
Right arrow Articles by Sakiyama, Y.
The Journal of Immunology, 2001, 166: 5245-5249.
Copyright © 2001 by The American Association of Immunologists

Spontaneous In Vivo Reversion of an Inherited Mutation in the Wiskott-Aldrich Syndrome1

Tadashi Ariga2,*, Tatsuro Kondoh{ddagger}, Koji Yamaguchi*, Masafumi Yamada{dagger}, Satoshi Sasaki{dagger}, David L. Nelson§, Hisami Ikeda, Kunihiko Kobayashi{dagger}, Hiroyuki Moriuchi{ddagger} and Yukio Sakiyama*

Departments of * Human Gene Therapy and {dagger} Pediatrics, Hokkaido University School of Medicine, Sapporo, Japan; {ddagger} Department of Pediatrics, Nagasaki University School of Medicine, Nagasaki, Japan; § The Metabolism Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; and Hokkaido Red Cross Blood Center, Sapporo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Wiskott-Aldrich syndrome (WAS) is an X-linked primary immunodeficiency disease, arising from mutations of the WAS-protein (WASP) gene. Previously, we have reported that mononuclear cells from WAS patients showed lack/reduced of the intracellular WASP (WASPdim) by flow cytometric analysis, and analysis of WASP by flow cytometry (FCM-WASP) was useful for WAS diagnosis. In this study, we report a WAS patient who showed the unique pattern of FCM-WASP. The patient had the small population of normal expression of WASP (WASPbright) mononuclear cells together with the major WASPdim population. The WASPbright cells were detected in T cells, not in B cells or in monocytes. Surprisingly, the molecular studies of the WASPbright cells revealed that the inherited mutation of WASP gene was reversed to normal. His mother was proved as a WAS carrier, and HLA studies and microsatellite polymorphic studies proved that the WASPbright cells were derived from the patient himself. Therefore, we concluded that the WASPbright cells were resulted from spontaneous in vivo reversion of the inherited mutation. Furthermore, the scanning electron microscopic studies indicated that WASP-positive cells from the patient restored the dense microvillus surface projections that were hardly observed in the WASPdim cells. This case might have significant implications regarding the prospects of the future gene therapy for WAS patients.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Wiskott-Aldrich syndrome (WAS),3 (MIM 301000) is an X-linked primary immunodeficiency disease characterized by thrombocytopenia, immunodeficiency, eczema, and susceptibility of lymphoreticular malignancy (1, 2, 3). Varied immunological abnormalities in cellular and humoral immune systems were observed (4). In addition to the functional abnormalities, lymphocytes from WAS patients showed the morphological abnormalities of reduced number of microvilli on the surface examined by scanning electron microscopy (SEM) (5). The gene defective in WAS has been identified by the linkage studies (6) and subsequent positional cloning (7). The gene product, termed as WAS protein (WASP), was expressed mainly in all nonerythroid hemopoietic cells (8) and was characterized to play roles in signal transduction pathway for cell growth (9) and in cytoskeletal organization in response to activation (10), although the definite WASP function remains to be determined.

WAS patients show the abnormal level of WASP expression in their hemopoietic cells (9). Previously, we reported that flow cytometric analysis for intracellular WASP expression (FCM-WASP) was useful for the diagnosis of WAS patients (11), as well as WAS carriers (12). None of WAS patients to date showed normal expression of WASP (WASPbright) in lymphocytes or monocytes. In this study, we show a WAS patient who has the small population of WASPbright lymphocytes together with the major population of reduced WASP expression (WASPdim). Characterization of the WASPbright population from the patient indicated that the WASPbright cells originated from himself and the reversion of an inherited mutation in the WASP gene had taken place in vivo. Furthermore, SEM study revealed that the WASPbright cells from the patient restored the dense microvillus surface projections that were hardly observed in the WASPdim cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patient

The patient was a 32-year-old male, whose clinical feature will be described in detail elsewhere (T. Kondoh and H. Moriuchi, manuscript in preparation). WAS diagnosis was made from the clinical evaluation when he was 1 year old and was confirmed by molecular studies at 29 years of age. The WASP mutation of the patient was A to G conversion at the nucleotide 354, which would change tyrosine 107 to cysteine. The same mutation was reported in another WAS patient (13). Our patient’s clinical grading score for WAS (14) got worse with aging, scoring 2 at the diagnosis at 2 years old, 3 at 7 years old, 4 at 11 years old, and 5 at 25 years old. During this study, he died from progression of lymphoma and severe infectious episodes. His mother was diagnosed as a WAS carrier by genetic studies as having the same mutant WASP allele as the patient’s.

Cell lines

T cell lines were established using herpes virus saimiri, as described (15). Established lines were CD8+ predominately (95% were CD8+: referred as CD8+ line). We separated CD4+ cells from the line using MACS cell separation system (Miltenyi Biotec, Bergisch Gladbach, Germany), and subsequently established CD4+ line (98% were CD4+). Purity of each line was repeatedly confirmed. EBV-transformed B cell line was also established by a standard procedure.

FCM-WASP

FCM-WASP was performed as previously described (11, 12) with minor modification. In brief, cells washed in PBS containing 1% FBS were treated with Cytofix/Cytoperm solution from CytoStain kit (PharMingen, San Diego, CA) at 4°C for 20 min. After washing twice with Perm/Wash solution, they were reacted with 1/200 diluted mouse anti-WASP mAb (3F3-A54) (16) or 1/5 diluted mouse IgG1 Ab (Becton Dickinson, San Jose, CA) at 4°C for 30 min. They were then reacted with FITC-labeled goat anti-mouse IgG1 Ab (Southern Biotechnology Associates, Birmingham, AL). For the surface/intracellular dual staining, we first stained the cell surface, followed by washing twice before intracellular staining. Abs used for surface staining were as follows: PE conjugate anti-human CD3, PE conjugate anti-human CD4, PE conjugate anti-human CD8 (Southern Biotechnology Associates), PE conjugate anti-human CD20 (Beckman-Coulter, Fullerton, CA). Because 3F3-A54 Ab belongs to murine IgG1 subclass, all murine Abs used for cell surface staining were IgG2a to prevent a crossing reaction. To examine the clonality of established T cell lines, murine mAbs to human {alpha}{beta} TCR V regions (Endogen, Cambridge, MA) were used.

Detection of the reverse mutation

The fragment including the WASP exons 3 and 4, in which the patient’s mutation was located, was PCR amplified with the primers (TGAAAATCTCCAAACCAGAC, ACTCACCTCTGCCCAACTTC), as described previously (17). The purified fragment was directly sequenced using an ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA) and an automated ABI 373A DNA sequencer. The mutation eliminates the AccI recognition site in the fragment. Then the different PCR products were digested with restriction enzyme AccI (Takara Shuzo, Kyoto, Japan) and were electrophoresed on the agarose gel.

HLA typing studies

DNA typing for identification of HLA class I and DRB1 alleles was performed by PCR sequence-specific primer methods and PCR microtiter plate hybridization methods (18), respectively. Type of HLA class I was determined using Micro SSP class I Generic Typing Kit (Veritas, Tokyo, Japan), and type of HLA-DRB1 was determined using a kit for HLA-DR typing (purchased from Wakunaga Pharmaceutical, Hirosima, Japan, and was licensed by Hoffmann-LaRoche, Nutley, NJ, and Roche Molecular Systems, Tutzing, Germany). The detection sensitivity of this method was reported (19) as 1:105.

Microsatellite polymorphic analysis

Microsatellite polymorphic markers in six individual loci (20, 21, 22, 23, 24, 25), HGH (17q22–24), INT2 (11q13), D6S89 (6p), GCG (2q36–37), AluVpA (1q32), and ACTBp2 (6), were used. After PCR amplification with specific primers reported, the products were elctrophoresed on 10% polyacrylamide gel, and visualized by silver staining.

SEM studies

T cell lines from the patient, another WAS patient, and a normal control were subjected for SEM studies, as previously described (26). Briefly, the cells were washed in Ca2+/Mg2+-free PBS and allowed to bind to 3-aminopropyl-triethoxysilane (Sigma, St. Louis, MO)-coated slides before fixation in 1.25% of glutaraldehyde in PBS for 30 min. The cells postfixed in 1% osmium tetroxide for 30 min, were dehydrated with graded ethanols, subjected to critical point drying from carbon dioxide, and finally coated with gold. Specimens were visualized in a scanning electron microscope S-4500 (Hitachi, Tokyo, Japan), and photographed at a magnification of 7,000 to 10,000.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The WASPbright cells belong to CD3+/CD8+ and CD3+/CD4+ population

We found a WAS patient who possessed the small population of intracellular WASPbright lymphocytes by FCM-WASP (Fig. 1GoA), which was a very unique finding we have never observed (11). The population was ~10% of lymphocytes. When monocytes were gated and analyzed, we could not detect a definite number of the WASPbright cells. To characterize which class of lymphocytes was involved, the surface/intracellular dual staining was performed. The WASPbright cells belong to CD3+/CD8+, but not to the CD20+ population cells (Fig. 1GoB). Although a few numbers of CD3+/CD4+ cells seemed to be WASPbright, this could not be unequivocally established. Then we established CD3+/CD8+ and CD3+/CD4+ lines and examined whether the WASPbright cells were detectable or not in the lines. Just after establishment of each cell line, the WASPbright population was detected in ~60% of the CD3+/CD8+ line, but 0.5% in the CD3+/CD4+ line. However, the WASPbright cells in the CD3+/CD4+ line rapidly expanded to 80% after 2 wk of cultivation (Fig. 2Go). No WASPbright cell was detected in established EBV-transformed B cell line (data not shown). The clonality study of the established CD3+/CD8+/WASPbright cell line indicated polyclonal character (Table IGo).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 1. Detection of the WASPbright population in the patient with WAS. A, FCM-WASP of PBMC from the patient. Solid lines and shaded areas indicate stained with isotypic control Abs and with anti-WASP Abs, respectively. The WASPbright cells were detected in some population of lymphocytes, but not in monocytes from the patient’s samples. All of lymphocytes (which showed double peaks) and monocytes from a normal control revealed WASPbright. B, The surface/intracellular dual staining studies of the patient’s lymphocytes with the surface Ags and the intracellular WASP. The WASPbright population was definitely observed in CD3+/CD8+ cells, not in CD20+ cells. A few numbers of the WASPbright cells seemed to be present in CD4+ cells. Most of the cells visible in linearly pattern were dead cells.

 


View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. FCM-WASP of the patient’s T cell lines. Solid lines and shaded areas indicate stained with isotypic control Abs and with anti-WASP Abs, respectively. Just after the establishment (A), the WASPbright cells were detected ~60% in CD8+ cells, but only 0.5% in CD4+ cells. However, after 2 wk of cultivation (B), the WASPbright cells in CD4+ line expanded to ~80% in population. There was no remarkable change of the WASPbright population in CD8+.

 

View this table:
[in this window]
[in a new window]
 
Table I. Results of T cell {alpha}{beta} receptor panel analysis1

 
Detection of the reverse mutation in the WASPbright cells

Sequencing results of the mutation site, using DNAs from the varied WASPbright populations from the patient, are shown (Fig. 3GoA). When DNA from the patient’s PBMC (mixture of lymphocytes and monocytes) was examined, the mutation of A354G was repeatedly observed. With a careful observation, however, a small peak of "A" was seen under a big peak of "G." It turned out that the small "A" was not a noisy signal, because when DNA from the T cell lines of the 60% WASPbright population was examined, the "A and G" were almost equal level just like the results of the patient’s mother. With DNA from the 80% WASPbright population, the "G" was dominated by the "A." The ratio of the WASPbright/WASPdim population was correlated with the nucleotide peaks of "A/G" ratio. The same results were obtained with the AccI digestion studies of the PCR fragment including the mutation site (Fig. 3GoB). Because the AccI cut the normal PCR fragment into two small pieces, the detection of the small pieces represents the normal "A" nucleotide at the mutation site. The very faint small pieces were seen with the digestion of the fragment derived from the patient’s PBMC. When the fragment from the T cell lines with 40% or 80% WASPbright population was digested, the digested small pieces were clearly observed. The amount of the small pieces increased in proportion to the WASPbright population.



View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 3. Detection of the reversion of the inherited mutation inthe WASPbright cells. A, Sequencing results of varied population of theWASPbright T lines of the patient. Each arrow indicates the mutation site. The normal peak of "A" increases and overcomes the mutant "G" peak and correlated with the increment of the WASPbright population. B, Results of AccI digestion of the PCR fragment including the mutation site. The very faint small pieces were seen with the digestion of the fragment derived from the patient’s PBMC. When the fragment from the T cell lines with 40 or 80% WASPbright population was digested, the digested small pieces were clearly observed. Amount of the small pieces increased in proportion to the WASPbright population. Molecular marker used; {Phi}X174 HaeIII digested.

 
Studies for the origin of the WASPbright cells

HLA DNA typing studies and DNA microsatellite studies were performed using both the WASPbright (T cell line) and theWASPdim (B cell line) populations. No HLA class I or HLA DRB1 alleles other than the patient’s own type were detected using the WASPbright samples (data not shown). Moreover, the identical pattern between the WASPbright and the WASPdim populations was observed in six microsatellite polymorphic loci (Fig. 4Go). These results clearly prove that the WASPbright cells were derived from the patient himself.



View larger version (91K):
[in this window]
[in a new window]
 
FIGURE 4. Microsatellite polymorphic analysis for six independent loci using the WASPbright T cell line and the WASPdim B cell lines. The identical pattern between the WASPbright T line (lane 1) and the WASPdim B line (lane 2) was observed in the six independent microsatellite polymorphic loci. HGH, the human growth hormone locus; INT2, the int-2 protooncogene locus; D6S89, the D6S89 locus; GCG, the human preproglucagone gene; AluVpA, an Alu variable poly(A); ACTBP2, the human {beta}-actin-related pseudogene H-{beta}-Ac-psi-2. Molecular marker used; {Phi}X174 HaeIII digested.

 
Structural abnormality was corrected in some cells from the patient’s WASPbright T cell lines

The results of the SEM studies of the patient T cell lines, the T cell lines from another WAS patient, and a normal individual were shown (Fig. 5GoA–D). The cells with dense microvillus surface projections were frequently observed in the patient T cell lines of the 80% WASPbright population (Fig. 5GoA) just like normal T cell lines (Fig. 5GoD). However, some cells with ruffled or ridgelike surface projections, which was reported as the characteristic abnormality of WAS lymphocytes (5) (Fig. 5GoC), were also detected in the patient T lines (Fig. 5GoB).



View larger version (137K):
[in this window]
[in a new window]
 
FIGURE 5. SEM studies for the WASPbright T cell lines from the patient. The cells with dense microvilli surface projections were frequently observed in the patient’s T cell lines (A) just like normal T cell lines (D). However, some cells with ruffled or ridgelike surface projections, which was reported as the characteristic abnormality of WAS lymphocytes (4 ) (C), were still detected in the patient T lines (B). These photographs were at x7,000 to x10,000 magnification.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we report a WAS patient who had some T cells with spontaneous in vivo reversion of an inherited mutation. The unusual FCM-WASP finding (Fig. 1Go) forced us to study the small population of WASPbright mononuclear cells from the patients, and the molecular analysis of these cells revealed that the mutation was disappeared (Fig. 3Go, A and B). We attempted to define the mechanism of how the WASPbright cells occurred in the patient. His mother had been molecularly diagnosed as a WAS carrier in a previous study, and we again verified that she had the mutant allele of nucleotide A354G. Thus, the possibility that the WASPbright cells resulted from somatic mosaicism due to de novo mutation during the embryogenesis was ruled out. The WASPbright cells were identified to originate exclusively in the patient himself by a HLA typing study. No HLA class I or HLA DRB1 alleles other than the patient’s own type was detected (data not shown). We further confirmed it by analysis of six microsatellite polymorphic loci (Fig. 4Go). The identical pattern in the six loci between the WASPbright and WASPdim cells indicated that both the cells were the same origin. Therefore, the possibility of the engraftment of his mother’s cells in utero or other individuals’ cells by blood transfusions, was excluded. The possibility of mosaicism of XY/XXY in the patient may be proposed. However, this is not the case, because when we studied the patient’s cells with almost 100% WASPbright, the mutation signal of the "G" was hardly detected. Mixture of the "A/G" should be equally shown if WASPbright cells consisted of XXY in the case. Finally, although in vitro reversion detected in cell lines from a WAS patient had been reported (27), this is not our case, because we detected the WASPbright cells before in vitro culture. The observation that the WASPbright cell population exhibited the polyclonal phenotype by TCR panel analysis also argues against an in vitro reversion (Table IGo). Taking these results together, we conclude that the WASPbright cells originated from his own hemopoietic cells with spontaneous in vivo reversion of an inherited mutation in the WASP gene.

Then, which hemopoietic cell was implicated for the event of the reverse mutation? We detected the WASPbright cells in T cells, CD3+/CD4+, and CD3+/CD8+ cells, but not in CD20+ B cells or in monocytes (Fig. 1GoB). The clonality study of the WASPbright cell line also indicated polyclonal character. Therefore, the reversion in a pre-T cell precursor could account for these unusual findings; however, we think a more primitive progenitor cell could be responsible. The reversion event probably took place at the level of a single cell. We were only able to identify this event when the reverted cells could gain a growth advantage over the mutant cells and expand in vivo. Recently, we suggested that the WASP had a more critical role in growth and development of lymphocytes (T cells) than those of monocytes (12). Although we do not know whether the WASP also has the critical role for B cells as it does for T cells, a study on WASP-deficient mice revealed a critical role for WASP in T cell but not B cell activation (28). Therefore, our inability to find WASPbright B cells and monocytes might come from a lack of a critical growth advantage in the WASPbright B cells and monocytes. The WASPbright T cells, moreover, showed a growth advantage during in vitro culture. Established T cell lines showed dominant for CD8+ cells, which already consisted of the 60% WASPbright cells. As for CD4+ line, it dramatically changed its WASPbright population from 0.5% to 80% during 2 wk of cultivation (Fig. 2Go). However, we do not know why CD4+ cells showed such a low number of the WASPbright cells in vivo. Another possibility is that the WASP may contribute to T cell transformation process in vitro.

We were curious whether there might be a structural change of the WASPbright cells from the patient. It has been shown previously that lymphocytes from WAS patients show the abnormalities on SEM studies (5). Lymphocytes from WAS patients were devoid of fine cell surface microvilli that were densely observed on cells from normal individuals. The results of the morphological studies on SEM of the patient’s T cell lines, the T cell lines from another WAS patient, and a normal individual are shown (Fig. 5GoA–D). The cells with dense microvillus surface projections were frequently observed in the patient’s T cell lines containing the 80% WASPbright population (Fig. 5GoA), just like normal T cell lines (Fig. 5GoD). However, some cells with ruffled or ridgelike surface projections, which were reported as the characteristic abnormalities of WAS lymphocytes (5) (Fig. 5GoC), were still detected in the patient’s T lines (Fig. 5GoB). Thus, it was shown that the spontaneous reverse mutation resulted in a restoration of the structural abnormalities of the patient’s cells.

Spontaneous in vivo reversion of mutation has been reported in a patient with adenosine deaminase deficiency (29) and a patient with X-linked SCID (30). Both the patients were characterized with their progressive mild clinical course probably due to the reverse mutation in some lineage cells. Recently, we also detected reverse mutation in T cell lines from two patients with adenosine deaminase deficiency (31). In this study, the patient could survive >30 years without receiving bone marrow transplantation. Because few WAS patients survived such a long period without bone marrow transplantation, the reversion event may have some beneficial effects on the patient’s clinical course. However, the effects were not enough because he died from progression of lymphoma and severe infectious episodes at 32 years old. We cannot estimate when the reversion event occurred in the patient; thus, it could be too late for him to get a sufficient benefit from it. Alternatively, the normalization of some of the T cells might not be enough. In fact, the WASP-deficient macrophages/monocytes may be responsible for the most critical immune defects observed in WAS patients (32).

The present studies may have significant implications regarding the prospects of the future gene therapy for WAS patients. First, it was shown that the gene-corrected T cells perhaps revealed growth advantage over other cells. Our findings also indicate that if only the WASP gene is introduced into a single progenitor cell and is expressed, it will make a significant population of T cells in vivo. We previously reported a WAS patient with dual mutations, an inherited and a de novo mutation (33). We found that the patient had major population of mononuclear cells with the dual mutations because additional de novo mutation could partially restore the WASP function and make a growth advantage in preference to the cells with the single mutation. Second, the WASP may not contribute to growth and development of B cells or monocytes as much as of T cells. If it is the case, the expansion of gene-introduced B cells or monocytes will be delayed in a gene therapy with targeting hemopoietic stem cells. The conditioning to provide advantage for the gene-introduced cells of both lineages may be required. Finally, because of the complexity of the WASP function in vivo, it may be difficult to assess the function of gene-introduced cells. In this regard, SEM studies could be useful for evaluating the efficacy of the gene therapy (34).


    Acknowledgments
 
We thank Dr. Hideaki Kikuta (Department of Pediatrics, Hokkaido University School of Medicine) for providing us with herpes virus saimiri.


    Footnotes
 
1 This work was supported by a Health Science Research Grant from Ministry of Health and Welfare of Japan, Genome Project 029. Back

2 Address correspondence and reprint requests to Dr. Tadashi Ariga, Department of Human Gene Therapy, Hokkaido University School of Medicine, N-14, W-5, Kita-ku, Sapporo, 060-8638, Japan. Back

3 Abbreviations used in this paper: WAS, Wiskott-Aldrich syndrome; WASP, WAS protein; FCM-WASP, flow cytometric analysis for intracellular WASP expression; SEM, scanning electron microscopy; R-PE, R-phycoerythrin. Back

Received for publication November 13, 2000. Accepted for publication February 12, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wiskott, A.. 1937. Familiarer, angeborener Moubus Werlhofii?. Mschr. Kinderheilk. 68:212.
  2. Aldrich, R. A., A. G. Steinber, D. C. Campbell. 1954. Pedigree demonstrating a sex-linked recessive condition characterized by draining ears, eczematoid dermatitis and bloody diarrhea. Pediatrics 13:133.[Abstract/Free Full Text]
  3. Sullivan, K. E., C. A. Mullen, R. M. Blaese, J. A. Winkelstein. 1994. A multi-institutional survey of the Wiskott-Aldrich syndrome. J. Pediatr. 125:876.[Medline]
  4. Remold-O’Donnell, E., F. S. Rosen, D. M. Kenney. 1996. Defects in Wiskott-Aldrich syndrome blood cells. Blood 87:2621.[Free Full Text]
  5. Kenney, D. M., L. Cairns, E. Remold-O’Donnell, J. Peterson, F. S. Rosen, R. Parkman. 1986. Morphological abnormalities in the lymphocytes of patients with the Wiskott-Aldrich syndrome. Blood 68:1329.[Abstract/Free Full Text]
  6. Greer, W. L., A.-K. Somani, P. C. Kwong, M. Peacocke, L. A. Rubin, K. A. Siminovitch. 1990. Linkage relationships of the Wiskott-Aldrich syndrome to 10 loci in the pericentromeric region of the human X chromosome. Genomics 6:568.[Medline]
  7. Derry, J. M. J., H. D. Ochs, U. Francke. 1994. Isolation of a novel gene mutated in Wiskott-Aldrich syndrome. Cell 78:635.[Medline]
  8. Shcherbina, A., F. R. Rosen, E. Remold-O’Donell. 1999. WASP levels in platelets and lymphocytes of Wiskott-Aldrich syndrome patients correlate with cell dysfunction. J. Immunol. 163:6314.[Abstract/Free Full Text]
  9. Cory, G. O. C., L. MacCarthy-Morrogh, S. Banin, I. Gout, P. M. Brickell, R. I. Levinsky, C. Kinnon, R. C. Lovering. 1996. Evidence that the Wiskott-Aldrich syndrome protein may be involved in lymphoid cell signaling pathways. J. Immunol. 157:3791.[Abstract]
  10. Symons, M., J. M. J. Derry, B. Karlak, S. Jiang, V. Lemahieu, F. McCormick, U. Francke, A. Abo. 1996. Wiskott-Aldrich syndrome protein, a novel effector for the GTPase CDC42Hs, is implicated in actin polymerization. Cell 84:723.[Medline]
  11. Yamada, M., M. Ohtsu, I. Kobayashi, N. Kawamura, K. Kobayashi, T. Ariga, Y. Sakiyama, D. L. Nelson. S. Tsuruta, M. Anakura, N. Ishikawa. 1999. Flow cytometric analysis of Wiskott-Aldrich syndrome (WAS) protein in lymphocytes from WAS patients and their familial carriers. Blood 93:756.[Free Full Text]
  12. Yamada, M., T. Ariga, N. Kawamura, K. Yamaguchi, M. Ohtsu, D. L. Nelson, T. Kondoh, I. Kobayashi, M. Okano, K. Kobayashi, Y. Sakiyama. 2000. Determination of carrier status for Wiskott-Aldrich syndrome (WAS) by flow cytometric analysis of WASP expression in peripheral blood mononuclear cells. J. Immunol. 165:1119.[Abstract/Free Full Text]
  13. Zhu, Q., C. Watanabe, T. Liu, D. Hollenbaugh, R. M. Blaese, S. B. Kanner, A. Aruffo, H. D. Ochs. 1997. Wiskott-Aldrich syndrome/X-linked thrombocytopenia: WASP gene mutations, protein expression, and phenotype. Blood 90:2680.[Abstract/Free Full Text]
  14. Zhu, Q., M. Zhang, R. M. Blaese, J. M. J. Derry, A. Junker, U. Franke, S. H. Chen, H. D. Ochs. 1995. The Wiskott-Aldrich syndrome and X-linked congenital thrombocytopenia are caused by mutations of the same gene. Blood 86:3797.[Abstract/Free Full Text]
  15. Biesinger, B., I. Müller-Fleckensstein, B. Simmer, G. Lang, S. Wittmann, E. Platzer, R. C. Desrosiers, B. Fleckenstein. 1992. Stable growth transformation of human T lymphocytes by herpes virus saimiri. Proc. Natl. Acad. Sci. USA 89:3116.[Abstract/Free Full Text]
  16. Stewart, D. M., S. Treiber-Held, C. C. Kurman, F. Facchetti, L. D. Notarangelo, D. L. Nelson. 1996. Studies of the expression of the Wiskott-Aldrich syndrome protein. J. Clin. Invest. 97:2627.[Medline]
  17. Ariga, T., M. Yamada, Y. Sakiyama. 1997. Mutation analysis of five Japanese families with Wiskott-Aldrich syndrome and determination of the family members’ carrier status using three different methods. Pediatr. Res. 41:535.[Medline]
  18. Kawai, S., S. Maekawajiri, K. Tokunaga, T. Juji, A. Yamane. 1996. Routine low and high resolution typing of HLA-DRB gene using PCR-MPH (Microtitier Plate Hybridization) methods. Eur. J. Immunogenet. 23:471.[Medline]
  19. Scaradavou, A., C. Carier, N. Mollen, C. Stevens, P. Rubinstein. 1996. Detection of maternal DNA in placental/umbilical cord blood by locus-specific amplification of the noninherited maternal HLA gene. Blood 88:1494.[Abstract/Free Full Text]
  20. Polymeropoulos, M. H., D. S. Rath, H. Xiao, C. R. Merril. 1991. A simple sequence repeat polymorphism at the human growth hormone locus. Nucleic Acids Res. 19:689.[Free Full Text]
  21. Polymeropoulos, M. H., H. Xiao, D. S. Rath, C. R. Merril. 1990. Dinucleotide repeat polymorphism at the int-2 proto-oncogene locus (INT2). Nucleic Acids Res. 18:7468.[Free Full Text]
  22. Lit, M., J. A. Luty. 1990. Dinucleotide repeat polymorphism at the D6S89 locus. Nucleic Acids Res. 18:4301.[Free Full Text]
  23. Polymeropoulos, M. H., D. S. Rath, H. Xiao, C. R. Merril. 1991. Dinucleotide repeat polymorphism at the human preproglucagon gene. Nucleic Acids Res. 19:688.[Free Full Text]
  24. Mäkelä, T. P., E. Hellsten, J. Vesa, K. Alitalo, L. Peltonen. 1992. An Alu variable poly A repeat polymorphism upstream of L-myc at 1p32. Hum. Mol. Genet. 1:217.[Free Full Text]
  25. Polymeropoulos, M. H., D. S. Rath, H. Xiao, C. R. Merril. 1992. Tetranucleotide repeat polymorphism at the human {beta}-actin related pseudogene H-{beta}-Ac-Psi-2 (ACTBP2). Nucleic Acids Res. 20:1432.[Free Full Text]
  26. Molina, I. J., D. M. Kenney, F. S. Rosen, E. Remold-O’Donnel. 1992. T cell lines characterize events in the pathogenesis of Wiskott-Aldrich syndrome. J. Exp. Med. 176:867.[Abstract/Free Full Text]
  27. Derry, J. M. J., J. A. Kerns, K. I. Weinberg, H. D. Ochs, V. Volpini, X. Estivill, A. P. Walker, U. Franke. 1995. WASP gene mutations in Wiskott-Aldrich syndrome and X-linked thrombocytopenia. Hum. Mol. Genet. 4:1127.[Abstract/Free Full Text]
  28. Snapper, S. B., F. S. Rosen, E. Mizoguchi, P. Cohen, W. Khan, C. H. Liu, T. L. Hangemann, S. P. Kwan, R. Ferrini, L. Davidson, A. K. Bhan, F. W. Alt. 1998. Wiskott-Aldrich syndrome protein-deficient mice reveal a role for WASP in T but not B cell activation. Immunity 9:81.[Medline]
  29. Hirschhorn, R., D. R. Yang, J. M. Puck, M. L. Huie, C.-K. Jiang, L. E. Kurlandsky. 1996. Spontaneous in vivo reversion to normal of an inherited mutation in a patient with adenosine deaminase deficiency. Nat. Genet. 13:290.[Medline]
  30. Stephan, V., V. Wahn, F. Le Deist. 1996. Atypical X-linked severe combined immunodeficiency due to possible spontaneous reversion of the genetic defect in T cells. N. Engl. J. Med. 335:1563.[Free Full Text]
  31. Ariga, T., N. Oda, K. Yamaguchi, N. Kawamura, H. Kikuta, S. Taniuchi, Y. Kobayashi, K. Terada, H. Ikeda, M. S. Hershfield, et al. T cell lines from two patients with adenosine deaminase (ADA) deficiency showed the restration of ADA activity resulted from the reversion of an inherited mutation. Blood. In press.
  32. Linder, S., D. L. Nelson, M. Weiss, M. Aepfelbacher. 1999. Wiskott-Aldrich syndrome protein regulates podosomes in primary human macrophages. Proc. Natl. Acad. Sci. USA 96:9648.[Abstract/Free Full Text]
  33. Ariga, T., M. Yamada, Y. Sakiyama, O. Tatsuzawa. 1998. A case of Wiskott-Aldrich syndrome with dual mutations in exon 10 of the WASP gene: an additional de novo one-base insertion, which restores frame shift due to an inherent one-base deletion, detected in the major population of the patient’s peripheral blood lymphocytes. Blood 92:699.[Free Full Text]
  34. Candotti, F., F. Facchetti, L. Blanzuoli, D. M. Stewart, D. L. Nelson, R. M. Blaese. 1999. Retrovirus-mediated WASP gene transfer corrects defective actin polymerization in cell lines from Wiskott-Aldrich syndrome patients carrying ‘null’ mutations. Gene Ther. 6:1170.[Medline]



This article has been cited by other articles:


Home page
PediatricsHome page
W. Qasim, M. Cavazzana-Calvo, E. G. Davies, J. Davis, M. Duval, G. Eames, N. Farinha, A. Filopovich, A. Fischer, W. Friedrich, et al.
Allogeneic Hematopoietic Stem-Cell Transplantation for Leukocyte Adhesion Deficiency
Pediatrics, March 1, 2009; 123(3): 836 - 840.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. R. Davis, M. J. DiCola, N. L. Prokopishyn, J. B. Rosenberg, D. Moratto, L. M. Muul, F. Candotti, and R. Michael Blaese
Unprecedented diversity of genotypic revertants in lymphocytes of a patient with Wiskott-Aldrich syndrome
Blood, May 15, 2008; 111(10): 5064 - 5067.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Uzel, E. Tng, S. D. Rosenzweig, A. P. Hsu, J. M. Shaw, M. E. Horwitz, G. F. Linton, S. M. Anderson, M. R. Kirby, J. B. Oliveira, et al.
Reversion mutations in patients with leukocyte adhesion deficiency type-1 (LAD-1)
Blood, January 1, 2008; 111(1): 209 - 218.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
K. Boztug, U. Baumann, M. Ballmaier, D. Webster, I. Sandrock, R. Jacobs, T. Lion, S. Preuner, M. Germeshausen, G. Hansen, et al.
Large granular lymphocyte proliferation and revertant mosaicism: two rare events in a Wiskott-Aldrich syndrome patient
Haematologica, March 1, 2007; 92(3): e43 - e45.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
F. Rieux-Laucat, C. Hivroz, A. Lim, V. Mateo, I. Pellier, F. Selz, A. Fischer, and F. Le Deist
Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency.
N. Engl. J. Med., May 4, 2006; 354(18): 1913 - 1921.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. I. Lutskiy, D. S. Beardsley, F. S. Rosen, and E. Remold-O'Donnell
Mosaicism of NK cells in a patient with Wiskott-Aldrich syndrome
Blood, October 15, 2005; 106(8): 2815 - 2817.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Burns, G. O. Cory, W. Vainchenker, and A. J. Thrasher
Mechanisms of WASp-mediated hematologic and immunologic disease
Blood, December 1, 2004; 104(12): 3454 - 3462.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Wada, S. H. Schurman, G. J. Jagadeesh, E. K. Garabedian, D. L. Nelson, and F. Candotti
Multiple patients with revertant mosaicism in a single Wiskott-Aldrich syndrome family
Blood, September 1, 2004; 104(5): 1270 - 1272.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Nishikomori, H. Akutagawa, K. Maruyama, M. Nakata-Hizume, K. Ohmori, K. Mizuno, A. Yachie, T. Yasumi, T. Kusunoki, T. Heike, et al.
X-linked ectodermal dysplasia and immunodeficiency caused by reversion mosaicism of NEMO reveals a critical role for NEMO in human T-cell development and/or survival
Blood, June 15, 2004; 103(12): 4565 - 4572.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Imai, T. Morio, Y. Zhu, Y. Jin, S. Itoh, M. Kajiwara, J.-i. Yata, S. Mizutani, H. D. Ochs, and S. Nonoyama
Clinical course of patients with WASP gene mutations
Blood, January 15, 2004; 103(2): 456 - 464.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Konno, T. Wada, S. H. Schurman, E. K. Garabedian, M. Kirby, S. M. Anderson, and F. Candotti
Differential contribution of Wiskott-Aldrich syndrome protein to selective advantage in T- and B-cell lineages
Blood, January 15, 2004; 103(2): 676 - 678.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. S. Strom, S. J. Turner, S. Andreansky, H. Liu, P. C. Doherty, D. K. Srivastava, J. M. Cunningham, and A. W. Nienhuis
Defects in T-cell-mediated immunity to influenza virus in murine Wiskott-Aldrich syndrome are corrected by oncoretroviral vector-mediated gene transfer into repopulating hematopoietic cells
Blood, November 1, 2003; 102(9): 3108 - 3116.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
R Hirschhorn
In vivo reversion to normal of inherited mutations in humans
J. Med. Genet., October 1, 2003; 40(10): 721 - 728.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Klein, D. Nguyen, C.-H. Liu, A. Mizoguchi, A. K. Bhan, H. Miki, T. Takenawa, F. S. Rosen, F. W. Alt, R. C. Mulligan, et al.
Gene therapy for Wiskott-Aldrich syndrome: rescue of T-cell signaling and amelioration of colitis upon transplantation of retrovirally transduced hematopoietic stem cells in mice
Blood, March 15, 2003; 101(6): 2159 - 2166.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Yamaguchi, T. Ariga, M. Yamada, D. L. Nelson, R. Kobayashi, C. Kobayashi, Y. Noguchi, Y. Ito, K. Katamura, Y. Nagatoshi, et al.
Mixed chimera status of 12 patients with Wiskott-Aldrich syndrome (WAS) after hematopoietic stem cell transplantation: evaluation by flow cytometric analysis of intracellular WAS protein expression
Blood, July 30, 2002; 100(4): 1208 - 1214.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. X. Arredondo-Vega, I. Santisteban, E. Richard, P. Bali, M. Koleilat, M. Loubser, A. Al-Ghonaium, M. Al-Helali, and M. S. Hershfield
Adenosine deaminase deficiency with mosaicism for a "second-site suppressor" of a splicing mutation: decline in revertant T lymphocytes during enzyme replacement therapy
Blood, February 1, 2002; 99(3): 1005 - 1013.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Wada, S. H. Schurman, M. Otsu, E. K. Garabedian, H. D. Ochs, D. L. Nelson, and F. Candotti
Somatic mosaicism in Wiskott-Aldrich syndrome suggests in vivo reversion by a DNA slippage mechanism
PNAS, July 5, 2001; (2001) 151260498.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Wada, S. H. Schurman, M. Otsu, E. K. Garabedian, H. D. Ochs, D. L. Nelson, and F. Candotti
Somatic mosaicism in Wiskott-Aldrich syndrome suggests in vivo reversion by a DNA slippage mechanism
PNAS, July 17, 2001; 98(15): 8697 - 8702.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ariga, T.
Right arrow Articles by Sakiyama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ariga, T.
Right arrow Articles by Sakiyama, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS