|
|
||||||||






Departments of
*
Human Gene Therapy and
Pediatrics, Hokkaido University School of Medicine, Sapporo, Japan;
Department of Pediatrics, Nagasaki University School of Medicine, Nagasaki, Japan;
The Metabolism Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; and
¶ Hokkaido Red Cross Blood Center, Sapporo, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
WAS patients show the abnormal level of WASP expression in their hemopoietic cells (9). Previously, we reported that flow cytometric analysis for intracellular WASP expression (FCM-WASP) was useful for the diagnosis of WAS patients (11), as well as WAS carriers (12). None of WAS patients to date showed normal expression of WASP (WASPbright) in lymphocytes or monocytes. In this study, we show a WAS patient who has the small population of WASPbright lymphocytes together with the major population of reduced WASP expression (WASPdim). Characterization of the WASPbright population from the patient indicated that the WASPbright cells originated from himself and the reversion of an inherited mutation in the WASP gene had taken place in vivo. Furthermore, SEM study revealed that the WASPbright cells from the patient restored the dense microvillus surface projections that were hardly observed in the WASPdim cells.
| Materials and Methods |
|---|
|
|
|---|
The patient was a 32-year-old male, whose clinical feature will be described in detail elsewhere (T. Kondoh and H. Moriuchi, manuscript in preparation). WAS diagnosis was made from the clinical evaluation when he was 1 year old and was confirmed by molecular studies at 29 years of age. The WASP mutation of the patient was A to G conversion at the nucleotide 354, which would change tyrosine 107 to cysteine. The same mutation was reported in another WAS patient (13). Our patients clinical grading score for WAS (14) got worse with aging, scoring 2 at the diagnosis at 2 years old, 3 at 7 years old, 4 at 11 years old, and 5 at 25 years old. During this study, he died from progression of lymphoma and severe infectious episodes. His mother was diagnosed as a WAS carrier by genetic studies as having the same mutant WASP allele as the patients.
Cell lines
T cell lines were established using herpes virus saimiri, as described (15). Established lines were CD8+ predominately (95% were CD8+: referred as CD8+ line). We separated CD4+ cells from the line using MACS cell separation system (Miltenyi Biotec, Bergisch Gladbach, Germany), and subsequently established CD4+ line (98% were CD4+). Purity of each line was repeatedly confirmed. EBV-transformed B cell line was also established by a standard procedure.
FCM-WASP
FCM-WASP was performed as previously described (11, 12) with minor modification. In brief, cells washed in PBS
containing 1% FBS were treated with Cytofix/Cytoperm solution from
CytoStain kit (PharMingen, San Diego, CA) at 4°C for 20 min. After
washing twice with Perm/Wash solution, they were reacted with 1/200
diluted mouse anti-WASP mAb (3F3-A54) (16) or 1/5
diluted mouse IgG1 Ab (Becton Dickinson, San Jose, CA) at 4°C for 30
min. They were then reacted with FITC-labeled goat anti-mouse IgG1
Ab (Southern Biotechnology Associates, Birmingham, AL). For the
surface/intracellular dual staining, we first stained the cell surface,
followed by washing twice before intracellular staining. Abs used for
surface staining were as follows: PE conjugate anti-human
CD3, PE conjugate anti-human CD4, PE conjugate anti-human CD8
(Southern Biotechnology Associates), PE conjugate anti-human CD20
(Beckman-Coulter, Fullerton, CA). Because 3F3-A54 Ab belongs to murine
IgG1 subclass, all murine Abs used for cell surface staining were IgG2a
to prevent a crossing reaction. To examine the clonality of established
T cell lines, murine mAbs to human 
TCR V regions (Endogen,
Cambridge, MA) were used.
Detection of the reverse mutation
The fragment including the WASP exons 3 and 4, in which the patients mutation was located, was PCR amplified with the primers (TGAAAATCTCCAAACCAGAC, ACTCACCTCTGCCCAACTTC), as described previously (17). The purified fragment was directly sequenced using an ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA) and an automated ABI 373A DNA sequencer. The mutation eliminates the AccI recognition site in the fragment. Then the different PCR products were digested with restriction enzyme AccI (Takara Shuzo, Kyoto, Japan) and were electrophoresed on the agarose gel.
HLA typing studies
DNA typing for identification of HLA class I and DRB1 alleles was performed by PCR sequence-specific primer methods and PCR microtiter plate hybridization methods (18), respectively. Type of HLA class I was determined using Micro SSP class I Generic Typing Kit (Veritas, Tokyo, Japan), and type of HLA-DRB1 was determined using a kit for HLA-DR typing (purchased from Wakunaga Pharmaceutical, Hirosima, Japan, and was licensed by Hoffmann-LaRoche, Nutley, NJ, and Roche Molecular Systems, Tutzing, Germany). The detection sensitivity of this method was reported (19) as 1:105.
Microsatellite polymorphic analysis
Microsatellite polymorphic markers in six individual loci (20, 21, 22, 23, 24, 25), HGH (17q2224), INT2 (11q13), D6S89 (6p), GCG (2q3637), AluVpA (1q32), and ACTBp2 (6), were used. After PCR amplification with specific primers reported, the products were elctrophoresed on 10% polyacrylamide gel, and visualized by silver staining.
SEM studies
T cell lines from the patient, another WAS patient, and a normal control were subjected for SEM studies, as previously described (26). Briefly, the cells were washed in Ca2+/Mg2+-free PBS and allowed to bind to 3-aminopropyl-triethoxysilane (Sigma, St. Louis, MO)-coated slides before fixation in 1.25% of glutaraldehyde in PBS for 30 min. The cells postfixed in 1% osmium tetroxide for 30 min, were dehydrated with graded ethanols, subjected to critical point drying from carbon dioxide, and finally coated with gold. Specimens were visualized in a scanning electron microscope S-4500 (Hitachi, Tokyo, Japan), and photographed at a magnification of 7,000 to 10,000.
| Results |
|---|
|
|
|---|
We found a WAS patient who possessed the small population of
intracellular WASPbright lymphocytes by FCM-WASP
(Fig. 1
A), which was a very
unique finding we have never observed (11). The population
was
10% of lymphocytes. When monocytes were gated and analyzed, we
could not detect a definite number of the
WASPbright cells. To characterize which class of
lymphocytes was involved, the surface/intracellular dual staining was
performed. The WASPbright cells belong to
CD3+/CD8+, but not to the
CD20+ population cells (Fig. 1
B).
Although a few numbers of
CD3+/CD4+ cells seemed to
be WASPbright, this could not be unequivocally
established. Then we established
CD3+/CD8+ and
CD3+/CD4+ lines and
examined whether the WASPbright cells were
detectable or not in the lines. Just after establishment of each cell
line, the WASPbright population was detected in
60% of the CD3+/CD8+
line, but 0.5% in the
CD3+/CD4+ line. However,
the WASPbright cells in the
CD3+/CD4+ line rapidly
expanded to 80% after 2 wk of cultivation (Fig. 2
). No WASPbright
cell was detected in established EBV-transformed B cell line (data not
shown). The clonality study of the established
CD3+/CD8+/WASPbright
cell line indicated polyclonal character (Table I
).
|
|
|
Sequencing results of the mutation site, using DNAs from the
varied WASPbright populations from the patient,
are shown (Fig. 3
A). When DNA
from the patients PBMC (mixture of lymphocytes and
monocytes) was examined, the mutation of A354G was repeatedly observed.
With a careful observation, however, a small peak of "A" was seen
under a big peak of "G." It turned out that the small "A" was
not a noisy signal, because when DNA from the T cell lines of the 60%
WASPbright population was examined, the "A and
G" were almost equal level just like the results of the patients
mother. With DNA from the 80% WASPbright
population, the "G" was dominated by the "A." The ratio of the
WASPbright/WASPdim
population was correlated with the nucleotide peaks of "A/G" ratio.
The same results were obtained with the AccI digestion
studies of the PCR fragment including the mutation site (Fig. 3
B). Because the AccI cut the normal
PCR fragment into two small pieces, the detection of the small pieces
represents the normal "A" nucleotide at the mutation site.
The very faint small pieces were seen with the digestion of the
fragment derived from the patients PBMC. When the fragment from the T
cell lines with 40% or 80% WASPbright
population was digested, the digested small pieces were clearly
observed. The amount of the small pieces increased in proportion to the
WASPbright population.
|
HLA DNA typing studies and DNA microsatellite studies were
performed using both the WASPbright (T cell
line) and theWASPdim (B cell line)
populations. No HLA class I or HLA DRB1 alleles other than the
patients own type were detected using the
WASPbright samples (data not shown). Moreover,
the identical pattern between the WASPbright and
the WASPdim populations was observed in six
microsatellite polymorphic loci (Fig. 4
).
These results clearly prove that the WASPbright
cells were derived from the patient himself.
|
The results of the SEM studies of the patient T cell lines, the T
cell lines from another WAS patient, and a normal individual were shown
(Fig. 5
AD). The cells with
dense microvillus surface projections were frequently observed in the
patient T cell lines of the 80% WASPbright
population (Fig. 5
A) just like normal T cell lines (Fig. 5
D). However, some cells with ruffled or ridgelike surface
projections, which was reported as the characteristic abnormality of
WAS lymphocytes (5) (Fig. 5
C), were also
detected in the patient T lines (Fig. 5
B).
|
| Discussion |
|---|
|
|
|---|
Then, which hemopoietic cell was implicated for the event of the
reverse mutation? We detected the WASPbright
cells in T cells,
CD3+/CD4+, and
CD3+/CD8+ cells, but not in
CD20+ B cells or in monocytes (Fig. 1
B). The clonality study of the
WASPbright cell line also indicated polyclonal
character. Therefore, the reversion in a pre-T cell precursor could
account for these unusual findings; however, we think a more primitive
progenitor cell could be responsible. The reversion event probably took
place at the level of a single cell. We were only able to identify this
event when the reverted cells could gain a growth advantage over the
mutant cells and expand in vivo. Recently, we suggested that the WASP
had a more critical role in growth and development of lymphocytes (T
cells) than those of monocytes (12). Although we do not
know whether the WASP also has the critical role for B cells as it does
for T cells, a study on WASP-deficient mice revealed a critical role
for WASP in T cell but not B cell activation (28).
Therefore, our inability to find WASPbright B
cells and monocytes might come from a lack of a critical growth
advantage in the WASPbright B cells and
monocytes. The WASPbright T cells, moreover,
showed a growth advantage during in vitro culture. Established T cell
lines showed dominant for CD8+ cells, which
already consisted of the 60% WASPbright cells.
As for CD4+ line, it dramatically changed its
WASPbright population from 0.5% to 80% during 2
wk of cultivation (Fig. 2
). However, we do not know why
CD4+ cells showed such a low number of the
WASPbright cells in vivo. Another possibility is
that the WASP may contribute to T cell transformation process in
vitro.
We were curious whether there might be a structural change of the
WASPbright cells from the patient. It has been
shown previously that lymphocytes from WAS patients show the
abnormalities on SEM studies (5). Lymphocytes from WAS
patients were devoid of fine cell surface microvilli that were densely
observed on cells from normal individuals. The results of the
morphological studies on SEM of the patients T cell lines, the T cell
lines from another WAS patient, and a normal individual are shown (Fig. 5
AD). The cells with dense microvillus surface projections
were frequently observed in the patients T cell lines containing the
80% WASPbright population (Fig. 5
A),
just like normal T cell lines (Fig. 5
D). However, some cells
with ruffled or ridgelike surface projections, which were reported as
the characteristic abnormalities of WAS lymphocytes (5)
(Fig. 5
C), were still detected in the patients T lines
(Fig. 5
B). Thus, it was shown that the spontaneous reverse
mutation resulted in a restoration of the structural abnormalities of
the patients cells.
Spontaneous in vivo reversion of mutation has been reported in a patient with adenosine deaminase deficiency (29) and a patient with X-linked SCID (30). Both the patients were characterized with their progressive mild clinical course probably due to the reverse mutation in some lineage cells. Recently, we also detected reverse mutation in T cell lines from two patients with adenosine deaminase deficiency (31). In this study, the patient could survive >30 years without receiving bone marrow transplantation. Because few WAS patients survived such a long period without bone marrow transplantation, the reversion event may have some beneficial effects on the patients clinical course. However, the effects were not enough because he died from progression of lymphoma and severe infectious episodes at 32 years old. We cannot estimate when the reversion event occurred in the patient; thus, it could be too late for him to get a sufficient benefit from it. Alternatively, the normalization of some of the T cells might not be enough. In fact, the WASP-deficient macrophages/monocytes may be responsible for the most critical immune defects observed in WAS patients (32).
The present studies may have significant implications regarding the prospects of the future gene therapy for WAS patients. First, it was shown that the gene-corrected T cells perhaps revealed growth advantage over other cells. Our findings also indicate that if only the WASP gene is introduced into a single progenitor cell and is expressed, it will make a significant population of T cells in vivo. We previously reported a WAS patient with dual mutations, an inherited and a de novo mutation (33). We found that the patient had major population of mononuclear cells with the dual mutations because additional de novo mutation could partially restore the WASP function and make a growth advantage in preference to the cells with the single mutation. Second, the WASP may not contribute to growth and development of B cells or monocytes as much as of T cells. If it is the case, the expansion of gene-introduced B cells or monocytes will be delayed in a gene therapy with targeting hemopoietic stem cells. The conditioning to provide advantage for the gene-introduced cells of both lineages may be required. Finally, because of the complexity of the WASP function in vivo, it may be difficult to assess the function of gene-introduced cells. In this regard, SEM studies could be useful for evaluating the efficacy of the gene therapy (34).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Tadashi Ariga, Department of Human Gene Therapy, Hokkaido University School of Medicine, N-14, W-5, Kita-ku, Sapporo, 060-8638, Japan. ![]()
3 Abbreviations used in this paper: WAS, Wiskott-Aldrich syndrome; WASP, WAS protein; FCM-WASP, flow cytometric analysis for intracellular WASP expression; SEM, scanning electron microscopy; R-PE, R-phycoerythrin. ![]()
Received for publication November 13, 2000. Accepted for publication February 12, 2001.
| References |
|---|
|
|
|---|
-actin related pseudogene H-
-Ac-Psi-2 (ACTBP2). Nucleic Acids Res. 20:1432.This article has been cited by other articles:
![]() |
W. Qasim, M. Cavazzana-Calvo, E. G. Davies, J. Davis, M. Duval, G. Eames, N. Farinha, A. Filopovich, A. Fischer, W. Friedrich, et al. Allogeneic Hematopoietic Stem-Cell Transplantation for Leukocyte Adhesion Deficiency Pediatrics, March 1, 2009; 123(3): 836 - 840. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Davis, M. J. DiCola, N. L. Prokopishyn, J. B. Rosenberg, D. Moratto, L. M. Muul, F. Candotti, and R. Michael Blaese Unprecedented diversity of genotypic revertants in lymphocytes of a patient with Wiskott-Aldrich syndrome Blood, May 15, 2008; 111(10): 5064 - 5067. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Uzel, E. Tng, S. D. Rosenzweig, A. P. Hsu, J. M. Shaw, M. E. Horwitz, G. F. Linton, S. M. Anderson, M. R. Kirby, J. B. Oliveira, et al. Reversion mutations in patients with leukocyte adhesion deficiency type-1 (LAD-1) Blood, January 1, 2008; 111(1): 209 - 218. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Boztug, U. Baumann, M. Ballmaier, D. Webster, I. Sandrock, R. Jacobs, T. Lion, S. Preuner, M. Germeshausen, G. Hansen, et al. Large granular lymphocyte proliferation and revertant mosaicism: two rare events in a Wiskott-Aldrich syndrome patient Haematologica, March 1, 2007; 92(3): e43 - e45. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Rieux-Laucat, C. Hivroz, A. Lim, V. Mateo, I. Pellier, F. Selz, A. Fischer, and F. Le Deist Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency. N. Engl. J. Med., May 4, 2006; 354(18): 1913 - 1921. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Lutskiy, D. S. Beardsley, F. S. Rosen, and E. Remold-O'Donnell Mosaicism of NK cells in a patient with Wiskott-Aldrich syndrome Blood, October 15, 2005; 106(8): 2815 - 2817. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Burns, G. O. Cory, W. Vainchenker, and A. J. Thrasher Mechanisms of WASp-mediated hematologic and immunologic disease Blood, December 1, 2004; 104(12): 3454 - 3462. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wada, S. H. Schurman, G. J. Jagadeesh, E. K. Garabedian, D. L. Nelson, and F. Candotti Multiple patients with revertant mosaicism in a single Wiskott-Aldrich syndrome family Blood, September 1, 2004; 104(5): 1270 - 1272. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nishikomori, H. Akutagawa, K. Maruyama, M. Nakata-Hizume, K. Ohmori, K. Mizuno, A. Yachie, T. Yasumi, T. Kusunoki, T. Heike, et al. X-linked ectodermal dysplasia and immunodeficiency caused by reversion mosaicism of NEMO reveals a critical role for NEMO in human T-cell development and/or survival Blood, June 15, 2004; 103(12): 4565 - 4572. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Imai, T. Morio, Y. Zhu, Y. Jin, S. Itoh, M. Kajiwara, J.-i. Yata, S. Mizutani, H. D. Ochs, and S. Nonoyama Clinical course of patients with WASP gene mutations Blood, January 15, 2004; 103(2): 456 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Konno, T. Wada, S. H. Schurman, E. K. Garabedian, M. Kirby, S. M. Anderson, and F. Candotti Differential contribution of Wiskott-Aldrich syndrome protein to selective advantage in T- and B-cell lineages Blood, January 15, 2004; 103(2): 676 - 678. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. S. Strom, S. J. Turner, S. Andreansky, H. Liu, P. C. Doherty, D. K. Srivastava, J. M. Cunningham, and A. W. Nienhuis Defects in T-cell-mediated immunity to influenza virus in murine Wiskott-Aldrich syndrome are corrected by oncoretroviral vector-mediated gene transfer into repopulating hematopoietic cells Blood, November 1, 2003; 102(9): 3108 - 3116. [Abstract] [Full Text] [PDF] |
||||
![]() |
R Hirschhorn In vivo reversion to normal of inherited mutations in humans J. Med. Genet., October 1, 2003; 40(10): 721 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Klein, D. Nguyen, C.-H. Liu, A. Mizoguchi, A. K. Bhan, H. Miki, T. Takenawa, F. S. Rosen, F. W. Alt, R. C. Mulligan, et al. Gene therapy for Wiskott-Aldrich syndrome: rescue of T-cell signaling and amelioration of colitis upon transplantation of retrovirally transduced hematopoietic stem cells in mice Blood, March 15, 2003; 101(6): 2159 - 2166. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamaguchi, T. Ariga, M. Yamada, D. L. Nelson, R. Kobayashi, C. Kobayashi, Y. Noguchi, Y. Ito, K. Katamura, Y. Nagatoshi, et al. Mixed chimera status of 12 patients with Wiskott-Aldrich syndrome (WAS) after hematopoietic stem cell transplantation: evaluation by flow cytometric analysis of intracellular WAS protein expression Blood, July 30, 2002; 100(4): 1208 - 1214. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. X. Arredondo-Vega, I. Santisteban, E. Richard, P. Bali, M. Koleilat, M. Loubser, A. Al-Ghonaium, M. Al-Helali, and M. S. Hershfield Adenosine deaminase deficiency with mosaicism for a "second-site suppressor" of a splicing mutation: decline in revertant T lymphocytes during enzyme replacement therapy Blood, February 1, 2002; 99(3): 1005 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wada, S. H. Schurman, M. Otsu, E. K. Garabedian, H. D. Ochs, D. L. Nelson, and F. Candotti Somatic mosaicism in Wiskott-Aldrich syndrome suggests in vivo reversion by a DNA slippage mechanism PNAS, July 17, 2001; 98(15): 8697 - 8702. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |