|
|
||||||||
B RelA (p65) Is Essential for TNF-
-Induced Fas Expression but Dispensable for Both TCR-Induced Expression and Activation-Induced Cell Death1

*
Department of Biological Sciences, Columbia University, New York, NY 10027; and
Walter and Eliza Hall Institute of Medical Research, Melbourne, Australia
| Abstract |
|---|
|
|
|---|
and IFN-
or
by signals generated after TCR engagement. Although much of our
knowledge of the Fas death pathway has been generated from murine
studies, little is known about regulatory mechanisms important for
murine Fas expression. To this end, we have molecularly cloned a region
of the murine Fas promoter that is responsible for mediating TNF-
and PMA/PHA-induced expression. We demonstrate here that induction of
Fas expression by both stimuli is critically dependent on two sites
that associate with RelA-containing NF-
B complexes. To determine
whether RelA and/or other NF-
B subunits are also important for
regulating Fas expression in primary T cells, we used CD4 T cells from
RelA-/-, c-Rel-/-, and p50-/-
mice. Although proliferative responses were significantly impaired,
expression of Fas and activation-induced cell death was unaffected in T
cells obtained from these different mice. Importantly, we show that
unlike fibroblasts, which consist primarily of RelA-containing NF-
B
complexes, T cells have high levels of both RelA and c-Rel complexes,
suggesting that Fas expression in T cells may be dependent on redundant
functions of these NF-
B subunits. | Introduction |
|---|
|
|
|---|
Besides their crucial role in T cell homeostasis, FasL-expressing NK
cells and CTLs can mediate killing of Fas-expressing target cells
(9, 10, 11). Recent studies have also shown that Fas is
important for tumor surveillance by CTLs and NK cells
(12). However, under normal conditions, Fas expression on
most cells may not be sufficient to induce cytotoxicity. We have
recently found that Fas expression is strongly induced in mouse
embryonic fibroblasts (MEFs) by the inflammatory cytokines TNF-
and
IFN-
(13). Such enhancement of expression was necessary
for induction of cell death after Fas ligation. Both TNF-
and
IFN-
are also potent inducers of MHC class I expression. Thus,
concerted cytokine-dependent induction of both MHC class I and Fas
expression may significantly enhance susceptibility of target cells to
CTL killing. Importantly, TNF-
(and LPS)-induced expression of both
MHC class I and Fas was compromised in fibroblasts deficient in the
RelA subunit of NF-
B (13). Reduced Fas expression in
RelA-/- MEFs significantly enhanced their
resistance to Fas-induced killing (13).
The NF-
B transcription factors participate in both innate and
adaptive immune responses (14, 15). Members of the NF-
B
family include several distinct subunits including c-Rel, RelB, p52,
and the most ubiquitous proteins in the family, RelA (p65) and p50
(14, 15, 16). Among these subunits, RelA, c-Rel, and RelB
contain transcription activation domains. Under normal conditions,
dimeric NF-
B proteins typically reside in the cytoplasm in a complex
with inhibitory I
B proteins. When cells are treated with certain
cytokines (TNF-
) or bacterial products (LPS), a signal transduction
pathway activates I
B kinases to phosphorylate I
B (14, 17). Phosphorylated I
B is then degraded, which is followed by
nuclear translocation of NF-
B and activation of expression of target
genes involved primarily in inflammatory and immune responses
(14). Studies with p50-/- and
c-Rel-/- mice have also shown that NF-
B
activation after B cell receptor and TCR engagement is important for
mediating proliferative responses (18, 19). Importantly,
adoptive transfer experiments have demonstrated impaired lymphopoiesis
in mice transplanted with p50-/-
RelA-/- fetal liver cells (20). In
addition, RelA-/-
c-Rel-/- fetal liver-transplanted mice also
exhibited defects in hemopoiesis and both
p50-/- RelA-/- and
RelA-/- c-Rel-/- fetal
liver-transplanted mice exhibited impaired long term survival
(20, 21). These studies indicate an important role for
NF-
B proteins in regulation of hemopoiesis.
Recent studies have demonstrated an essential role for NF-
B in
inhibition of cell death induced by multiple agents, including TNF-
,
through enhanced expression of antiapoptotic genes
(22, 23, 24, 25, 26). However, we have recently found that the RelA
subunit of NF-
B is also important for regulation of the
apoptosis-inducing Fas death receptor (13). To further
characterize this unique function of NF-
B proteins, we have cloned
the promoter of the mouse Fas gene, and we demonstrate here that
TNF-
and PMA/PHA-induced Fas expression is dependent on two
B
elements present in the Fas promoter. To examine a possible role for
the RelA subunit of NF-
B in Fas/FasL-dependent AICD, we obtained
RelA-/- CD4 T cells after adoptive transfer of
fetal liver cells. We show here that proliferative responses of
RelA-/- as well as
p50-/- and c-Rel-/- CD4
T cells are partially impaired, but virtually abolished in
p50-/- c-Rel-/- CD4 T
cells. These results thus demonstrate a key role for these NF-
B
subunits in regulation of CD4 T cell proliferation. In contrast, we
observed normal up-regulation of Fas/FasL expression and AICD in
RelA-/-, p50-/-, and
c-Rel-/- CD4 T cells. Our results indicate that
T cells have high levels of both RelA and c-Rel complexes and that Fas
expression in T cells may be dependent on redundant functions of these
NF-
B subunits.
| Materials and Methods |
|---|
|
|
|---|
A high density mouse genomic DNA filter library (BAC library; Genome Systems, St. Louis, MO) was screened using a mouse Fas cDNA fragment. A positive BAC clone was used to isolate an 8.6-kb XhoI fragment that contained a 4.5-kb sequence upstream of the translational start site ATG, the first exon, and 4 kb of the first intron. This XhoI fragment was subcloned into pBluescript II SK vector, and 1.3 kb of DNA upstream of the ATG were sequenced (GenBank accession number AY027814).
Serial deletion constructs were generated by PCR using the BAC clone
DNA as template. The primers used are shown in Fig. 1
B. Faspro1 was the primer
used for the 3'-end of the promoter which also contained a
HindIII site; Faspro2 to Faspro9 were the eight primers used
for hybridization to the 5'-end and also carried an XhoI
site. PCR products were digested with HindIII +
XhoI and subcloned into pGL3-Basic plasmid (Promega,
Madison, WI) using the corresponding restriction sites. The 4.5-kb Fas
promoter fragment was generated by PCR using primer Faspro1 and a
primer corresponding to the T7 promoter in pBluescript II. The PCR
product was digested with XhoI and subcloned into
pGL3-Basic.
|
B sites was conducted using QuikChange
Site-Directed Mutagenesis according to the manufactures instructions
(Stratagene, La Jolla, CA). The template used for mutagenesis was
pGL3-Faspro1.4. The primers used for site A were
5'-GAAGCGCCCAGGATGGTCTAGACCCATTTATGCAATC-3' and its
anti-parallel sequence. The primers used for site B were
CAGTGGTGAGTCAGTTCTAGACCCCGGGAGACCAGC and its antiparallel
sequence. Fibroblast culture, luciferase assays, and EMSA
NIH-3T3 fibroblasts (American Type Culture Collection, Manassas,
VA) were cultured in DMEM containing 10% calf serum, penicillin (100
U/ml), streptomycin (100 U/ml), and L-glutamine (2 mM).
Jurkat cells were cultured in RPMI containing 10% FBS, penicillin (100
U/ml), streptomycin (100 U/ml), and L-glutamine (2 mM).
Transfections were performed using Fugene 6 (Roche Diagnostic Systems,
Somerville, NJ). Twenty-four hours after transfection, cells were
either treated with TNF-
(R&D Systems, Minneapolis, MN) for 6 h
(NIH-3T3) or treated with PMA (100 ng/ml) and PHA (2 µg/ml) for
6 h (Jurkat) before being assayed for luciferase activity using
the Dual-Luciferase Reporter Assay System (Promega). EMSA and
supershift assays were conducted as described (27). The
hairpin oligonucleotide probes used were
GAGAGGGGAATGCCCAATTAGCTTTTGGGCATTCCCCTCT (site A), and
GAGATGGGTTTCCCCATTAGCTTTGGGGAAACCCATCT (site B). For supershift
assays, the anti-RelA, anti-p50, and anti-cRel Abs were
obtained from Santa Cruz Biotechnology (Santa Cruz, CA).
Adoptive transfer experiments
Fetal liver cells were isolated from day 14 RelA+/+ or RelA+/- and RelA-/- embryos. Before injection, CD45.1-congenic C57BL/6 recipient mice were irradiated using a 137Cs source with two doses of 800 and 400 rads, separated by 3 h. Viable fetal liver cells (1 x 106) were injected i.v. into the irradiated recipient mice. Transplanted mice were maintained on autoclaved Sulfatrim-treated water (Alpharm, Baltimore, MD). All experiments with mice were carried-out in accordance with institutional guidelines.
Isolation of CD4 T cells
CD4 T cells were isolated from mouse spleens using CD4 Dynabeads (Dynal, Great Neck, NY). CD4 T cells prepared in this manner were typically >98% pure by FACS analysis. To separate recipient CD45.1 T cells from donor CD45.2 T cells, purified CD4 T cells were further incubated with a CD45.1 Ab (PharMingen) conjugated to Pan Mouse IgG Dynabeads (Dynal) at 4°C for 30 min. Greater than 90% cells were CD45.2 positive after this procedure as determined by FACS analysis.
In vitro proliferation assays
CD4 T cells were cultured in RPMI containing 10% FBS,
penicillin (100 U/ml), streptomycin (100 U/ml), L-glutamine
(2 mM), and 2-ME (50 µM). Round-bottom 96-well plates were treated
with anti-CD3
Ab or anti-CD3
and anti-CD28
(PharMingen, San Diego, CA) at 1 µg/ml. Mouse IL-2 (R&D Systems) was
used at 60 ng/ml. T cells (1 x 105) were
plated in triplicate for 2 days under the different conditions
described in the text before [3H]thymidine
(NEN, Boston, MA) was added (1 µCi/well) for 16 h.
[3H]Thymidine incorporation was determined by
scintillation counting. All experiments were conducted in triplicate
and SDs are indicated in the figures.
FACS analysis
CD4 T cells were either stained immediately after isolation or cultured with anti-CD3 + anti-CD28 in the presence of IL-2 (60 ng/ml) for 3 days. Viable cells were separated from dead cells on a Ficoll-Paque Plus density gradient (Amersham-Pharmacia Biotech, Piscataway, NJ). Cell surface Fas expression was determined with a PE-conjugated Fas Ab (Jo2; PharMingen). FasL expression was determined by staining with FasL Ab, biotin-labeled anti-hamster IgG, and finally PE-labeled avidin (PharMingen). FACS was performed on a FACSCalibur cytometer (Becton Dickinson, Indianapolis, IN).
Apoptosis assays
Viable activated CD4 T cells were either treated with IL-2 (60 ng/ml) alone or treated with anti-Fas Jo2 (10 µg/ml) or plated-bound CD3 Ab (1 µg/ml) in the presence of IL-2 for 2024 h. Cells were fixed in 70% ethanol at 4°C for 24 h and then stained with a propidium iodide (PI) staining solution (PBS containing PI 50 µg/ml, RNase A 100 U/ml, and glucose 1 mg/ml) for 2 h at room temperature before FACS analysis. Apoptosis was determined by quantification of the sub-G0 population. All experiments were conducted in triplicate and SDs are indicated in the figures.
| Results |
|---|
|
|
|---|
Our previous studies showed that LPS or TNF-
-induced expression
of Fas was impaired in RelA-/- MEFs
(13). To further study the mechanism of Fas regulation, we
cloned a Fas genomic fragment from a mouse BAC high density filter
library using a Fas cDNA probe. This BAC clone was used to further
subclone an 8.6-kb XhoI fragment, which contained 4.5 kb DNA
upstream of the ATG translation start site, the 0.1-kb first exon, and
4 kb of the first intron (Fig. 1
A). Sequencing of
1.3 kb
upstream of the ATG revealed five potential NF-
B, as well as
putative AP-1 and NF-AT binding sites (Fig. 1
B). In
addition, a consensus STAT1 site was also found within the first
intronic sequence (not shown).
Two NF-
B binding sites are essential for TNF-
and
PMA/PHA-induced expression of Fas
To identify DNA elements, especially potential NF-
B binding
sites, responsible for Fas induction by TNF-
, we generated eight
serial deletions of Fas 5'-sequence upstream of the ATG (Fig. 1
B). These sequences were subcloned upstream of a luciferase
reporter gene. NIH-3T3 cells were transfected with these constructs,
after which they were either left untreated or treated with TNF-
for
6 h. The induction of luciferase activity by TNF-
was minimally
affected after three putative NF-
B binding sites were deleted (Fig. 2
A). However, deletion of a
putative NF-
B binding site between -347 and -358 (site A) (Fig. 1
B) dramatically reduced induction by TNF-
(Fig. 2
A). To determine whether an additional downstream putative
binding site between -249 and -258 (site B) (Fig. 1
B) was
also important for Fas regulation, we mutated sites A and B
individually within the 400-bp sequence upstream of the ATG. As shown
in Fig. 2
B, mutation of either site substantially reduced
luciferase-induction by TNF-
. These results suggest that both
putative NF-
B sites may be required for TNF-
-induced Fas
regulation.
|
B could potentially associate with site A
and/or site B, we performed EMSA with nuclear extracts from untreated
or TNF-
-treated NIH-3T3 cells using binding site probes
corresponding to sequences of site A and site B. As shown in Fig. 2
.
Importantly, DNA-protein complexes formed with either site could
be specifically supershifted by Abs against RelA. These results
demonstrate direct association of RelA-containing NF-
B complexes to
DNA elements critical for TNF-
-induced Fas expression.
To test whether these NF-
B sites were also important for regulating
Fas expression in T cells, we performed similar transfections
experiments in the Jurkat T cell line. Significant induction of
luciferase activity was observed after a 6-h treatment of Jurkat T
cells with PMA/PHA (PMA/PHA treatment is widely used to induce T cell
activation events in T cell lines). Importantly, PMA/PHA-induced
activity was abolished when sites A and B were mutated (Fig. 2
, D and E). Furthermore, both sites also associated
with RelA-containing complexes present in nuclear extracts of Jurkat T
cells stimulated with PMA/PHA for 6 h (data not shown), the same
length of time after which luciferase assays were performed. These
results suggest that NF-
B sites are essential for both TNF-
- and
PMA/PHA-mediated induction of Fas promoter activity in fibroblasts and
T cells, respectively. Interestingly, TNF-
could not induce Fas
reporter activity in Jurkat cells but strongly induced a reporter
construct containing a tandem
B site from the Ig
chain promoter
(data not shown). Thus NF-
B activation, although necessary, may not
be sufficient for induction of Fas expression in T cells.
Reduced proliferative responses but normal Fas and FasL expression in RelA-/- CD4 T cells.
Expression of Fas and FasL is required for AICD of T cells. To directly determine a possible role for RelA in regulation of Fas and FasL expression in T cells, we used RelA-/- splenic CD4 T cells. Because RelA-/- mice die prenatally (27, 28), we transplanted RelA+/+ and RelA-/- embryonic day 14 fetal liver cells into lethally irradiated C57BL/6 congenic mice expressing the CD45.1 isoform of the membrane-associated CD45 phosphatase (20, 28). Thus, we were able to readily discriminate donor CD45.2 from residual CD45.1-expressing recipient cells. After isolation of CD4 T cells from the transplanted mice, residual recipient T cells were depleted with a CD45.1 Ab linked to magnetic beads.
Because T cell activation enhances Fas/FasL expression and predisposes
T cells to AICD, we first determined whether RelA was required for T
cell activation and proliferative responses.
RelA+/- and RelA-/- CD4
T cells were treated with combinations of anti-CD3, anti-CD28,
and IL-2. T cell proliferation was measured by
[3H]thymidine incorporation. As shown in Fig. 3
A, proliferative responses of
RelA-/- T cells were
50% lower than those
in similarly treated RelA+/- T cells under the
various activation conditions tested. These results suggest that RelA
is important, but not essential, for CD4 T cell proliferative
responses. To determine a possible role for RelA in regulation of
Fas/FasL expression in activated T cells, RelA+/+
and RelA-/- T cells stimulated with CD3/CD28
Abs in the presence of IL-2 were used. However, FACS analysis showed
that both Fas and FasL expression was significantly and similarly
enhanced in RelA+/+ and
RelA-/- T cells after stimulation (Fig. 3
, B and C). Therefore, and unlike fibroblasts, the
absence of RelA does not affect Fas (or FasL) expression in T
cells.
|
Because RelA was not required for Fas/FasL expression in T
cells, we tested whether such a function was dependent on the c-Rel and
p50 subunits of NF-
B. For these studies, we used CD4 T cells from
c-Rel-/-, p50-/-, and
p50-/- c-Rel-/- mice
(18, 19). We first determined the proliferative potential
of CD4 T cells from these mice. After stimulation with anti-CD3,
proliferation of c-Rel-/- T cells was reduced
30% compared with c-Rel+/- T cells, but
CD3 +
CD28 treatment induced similar levels of proliferation in
both cell types (Fig. 4
A).
Proliferation of p50-/- T cells was reduced
50% under the different conditions tested compared with
p50+/+ T cells (Fig. 4
B).
Interestingly, proliferation of
p50+/-c-Rel+/- T cells
was significantly reduced compared with
p50+/+c-Rel+/+ T cells.
However, proliferative responses in p50-/-
c-Rel-/- cells were almost completely abolished
(only
10% of
p50+/+c-Rel+/+ T cells) and
could not be rescued in the presence of IL-2 (Fig. 4
B).
Impaired proliferation of p50-/-
c-Rel-/- T cells was also evident by a
significant reduction in blast transformation (data not shown). These
results suggest that loss of a single subunit of NF-
B (RelA, c-Rel
or p50) only moderately affects CD4 T cell proliferation, but loss of 2
subunits (p50 and Rel) results in severely impaired proliferative
responses.
|
B single or double-knockout mice after
TCR/CD3 engagement.
AICD in NF-
B-deficient CD4 T cells
A recent study has suggested an antiapoptotic function for NF-
B
in AICD (29), similar to that seen in other systems.
Fas/FasL-dependent AICD can be induced both by direct ligation of Fas
or by reengagement of TCR/CD3 (3). CD4 T cells deficient
in RelA, c-Rel, or p50 were first activated as described above, after
which they were incubated with IL-2 or IL-2 in the presence of the Fas
Jo2 Ab or in the presence of CD3 Ab. The sub-G0
DNA content was then used to determine the apoptotic population after
different treatments. Both Jo2 and CD3 Ab treatment of
RelA-/- or c-Rel-/- CD4
T cells resulted in similar levels of apoptosis compared with control T
cells (Fig. 5
, A and
B). Although p50-/- T cells showed a
slightly higher apoptotic population after Jo2 or anti-CD3
treatments, they also displayed a higher spontaneous cell death rate in
the presence of IL-2 (Fig. 5
C). Thus, Jo2 or CD3-specific
apoptosis of p50-/- T cells was similar to that
of p50+/+ cells. These results demonstrate that
CD4 T cells deficient in RelA, c-Rel, or p50 are neither more resistant
nor more susceptible to Fas/FasL-dependent AICD. Interestingly,
p50-/- c-Rel-/- T cells
showed a significantly enhanced rate of cell death after stimulation
with inducers of T cell proliferation (data not shown). Due to both the
diminished proliferative responses and high cell death of
p50-/- c-Rel-/- T cells
after activation, we have not been able to unambiguously determine
whether Fas-dependent AICD was affected in these
cells.
|
B compositions in fibroblasts and CD4 T cells
Although Jurkat T cell transfection experiments indicate that
induction of Fas expression is dependent on NF-
B binding sites, we
were not able to detect significant reduction in Fas expression in
splenic CD4 T cells obtained from NF-
B knockout mice, including
RelA. As previously reported, RelA was essential for induction of Fas
expression in fibroblasts (13). To determine possible
reasons for differences in Fas regulation between fibroblasts and T
cells, we performed EMSA analysis of nuclear extracts from MEFs treated
with TNF-
for 2 h and CD4 T cells activated for 3 days with
anti-CD3 + anti-CD28 + IL-2 (significant induction of Fas
expression was seen in these cell types after these treatments). We
were especially interested in determining the levels of the two major
transcriptional activators of the NF-
B family, RelA and c-Rel, in
these cell types. Previous studies (19) and our
unpublished results have indicated that the RelB subunit is not present
in T cells. We detected specific NF-
B subunits that associated with
Fas site B using antisera generated against these subunits (results
similar to those shown below were also obtained with Fas site A). As
shown in Fig. 6
A, in the
presence of RelA antisera (this antisera inhibits binding of
RelA-containing complexes to DNA without causing a significant
supershift) or p50 antisera, TNF-
-induced NF-
B activity was
significantly reduced in wild-type (WT) MEFs, whereas c-Rel antisera
had no significant effect. Consistent with these and previous results
(27), NF-
B activity was strongly reduced in
RelA-/- MEFs. However, the low level
DNA-binding activity present in RelA-/- MEFs
was supershifted by p50 and c-Rel antisera. In contrast to WT MEFs,
NF-
B complexes from activated WT CD4 T cells contained significant
amounts of not only p50 and RelA (evident by a reproducible decrease of
binding activity in the presence of RelA antisera) but also c-Rel (Fig. 6
B; nuclear extracts from naive/unstimulated T cells contain
faster migrating activities that likely represent nonspecific
DNA-binding proteins that decrease in activated T cells). Importantly,
both activated RelA-/- and
c-Rel-/- CD4 T cells contained significant
amounts of NF-
B complexes containing p50 and c-Rel or p50 and
RelA, respectively (Fig. 6
B). These results indicate
that significantly higher amounts of c-Rel are present in
RelA-/- CD4 T cells than in
RelA-/- fibroblasts and may thus provide an
explanation of why regulation of Fas expression in fibroblasts, but not
in T cells, is dependent on the RelA subunit of NF-
B.
|
| Discussion |
|---|
|
|
|---|
B proteins in regulation of Fas expression both by
cytokines and TCR-generated signals. We demonstrate here an essential
role for NF-
B in regulation of TNF-
-induced Fas expression.
Although our previous studies showed impaired induction of Fas
expression in RelA-/- MEFs (13),
the results presented here demonstrate that RelA-containing NF-
B
complexes directly associate with DNA-binding elements critical for
TNF-
-induced Fas expression. In addition to NF-
B sites, AP-1
sites, which can also confer TNF-
inducibility (30),
were found within the Fas-regulatory region. Our results, however,
indicate that AP-1 sites are not sufficient for TNF-
-induced Fas
expression because deletion of AP-1 sites in the Fas promoter did not
affect reporter activity. Previously, IFN-
and TNF-
were found to
synergistically induce Fas expression in fibroblasts (13).
Interestingly, STAT1-/- fibroblasts
(31) failed to induce Fas expression after IFN-
treatment, but induced normal expression after LPS treatment (our
unpublished observations). Consistent with an important role for
STAT1 in mediating IFN-
-inducible Fas expression, a perfect
consensus STAT1-binding site was found in the first intron of Fas.
Thus, synergistic expression of Fas induced by IFN-
and TNF-
could be mediated by promoter-specific interactions between STAT1 and
RelA-containing NF-
B complexes. Elevated Fas expression has been
associated with pathological complications in inflammatory and
autoimmune diseases (32, 33, 34). The identification of
NF-
B as a key regulator of Fas expression should thus help us to
understand mechanisms responsible for elevating Fas expression under
pathological conditions.
T cell activation enhances expression of Fas and FasL. To
determine a possible role for NF-
B proteins in Fas and FasL
expression in T cells, we first determined proliferative responses of
CD4 T cells from RelA-/-,
c-Rel-/-, p50-/-, and
p50-/-c-Rel-/- mice.
Interestingly, proliferative responses of both
p50-/- and RelA-/- CD4
T cells were reduced, suggesting that these subunits, at least in part,
play nonredundant roles in proliferation. Previously, total
c-Rel-/- T cells (CD4+
and CD8+) were found to have significantly
compromised proliferative responses, which could be corrected by
addition of exogenous IL-2 (19, 35). Using CD4 T cells, we
have found only moderately reduced proliferation of
c-Rel-/- compared with
c-Rel+/+ CD4 T cells, although the reasons for
differences in proliferative responses of these two T cell populations
are presently unclear. Our results also show that the reduced
proliferation of c-Rel-/- and
p50-/- T cells was virtually abolished in
p50-/-c-Rel-/- T cells
which could not be rescued by addition of exogenous IL-2. As mentioned
before, reduced proliferative responses of
p50-/-c-Rel-/- T cells
may result in part from a greater susceptibility to cell death.
Our results
withp50-/-c-Rel-/- T
cells are remarkably similar to those obtained with T cells from
transgenic mice expressing a "superrepressor" I
B
protein
using a T cell-specific promoter, and thus resulting in inhibition of
multiple NF-
B subunits (36). Thus, T cells from these
transgenic mice also have significantly reduced proliferation, which
cannot be rescued by IL-2 addition, and greater susceptibility to cell
death. Our results suggest that inhibition of T cell proliferation in
these transgenic T cells may result at least in part from inhibition of
the p50 and c-Rel subunits of NF-
B.
A recent study has shown that NF-
B sites are required for regulation
of the human Fas promoter in Jurkat T cells stimulated with PMA and
ionomycin (37). Our results also show a critical role of
NF-
B for mouse Fas promoter regulation in PMA/PHA-treated Jurkat
cells. Although it was proposed that the p50 and RelA subunits of
NF-
B are important for regulation of human Fas expression, we have
found no impairment of Fas expression in p50-/-
or RelA-/- CD4 T cells. Consistent with
previous studies using total (CD4+ and
CD8+) c-Rel-/- T cells
(38), we have also found normal expression of Fas in
c-Rel-/- CD4 T cells (and AICD; see below). In
fibroblasts, however, RelA was essential for regulating TNF-
-induced
expression of Fas. Our results indicate that unlike fibroblasts,
activated T cells contain high levels of c-Rel, which may play an
important role in regulation of Fas expression in the absence of RelA.
Interestingly, TNF-
treatment did not induce Fas reporter expression
in Jurkat cells, even though NF-
B nuclear translocation and
B-luciferase reporter expression were enhanced in the presence of
TNF-
. Similarly, TNF-
treatment did not result in up-regulation
of Fas expression in splenic CD4 T cells (data not shown). These
results suggest that NF-
B activation may not be sufficient for Fas
expression in T cells but that additional events (e.g.,
posttranslational modifications or transcriptional coactivator
expression) may also be required to induce Fas expression in T cells.
Previous studies have also suggested that NF-
B proteins, in
particular RelA, are important for regulation of FasL expression
(39, 40, 41). Similar to Fas, normal up-regulation of FasL
expression in the absence of RelA, p50, or c-Rel may also indicate
redundant functions for these NF-
B subunits in regulation of FasL
expression.
Recent studies have indicated both proapoptotic and antiapoptotic
functions for NF-
B proteins in T cells (29, 42). In
transgenic mice expressing a "superrepressor" I
B
protein
using a T cell-specific promoter, it was shown that NF-
B proteins
are required for double-positive thymocyte apoptosis (42).
Using a similarly generated transgenic system described above, it has
also been shown that NF-
B inhibition results in enhanced
Fas-mediated killing of mature T cells (29, 36). The
latter results are consistent with studies indicating an important
antiapoptotic function for NF-
B. However, in
RelA-/-, p50-/-, and
c-Rel-/- single knockout CD4 T cells, no
enhancement of AICD was noticed compared with control T cells. Our
results indicate that the absence of these individual NF-
B subunits
results in impaired T cell proliferation but does not enhance
susceptibility to AICD. The results presented here thus indicate that
the primary function of NF-
B proteins in the Fas pathway may be to
promote Fas-induced cell death through enhancement of Fas expression
rather than inhibit such cell death through expression of survival
genes.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Amer A. Beg, 1110 Fairchild Center, Department of Biological Sciences, 1212 Amsterdam Avenue, Columbia University, New York, NY 10027. ![]()
3 Abbreviations used in this paper: FasL, Fas ligand; AICD, activation-induced cell death; MEFs, mouse embryonic fibroblasts; PI, propidium iodide; WT, wild-type. ![]()
Received for publication June 15, 2000. Accepted for publication February 5, 2001.
| References |
|---|
|
|
|---|
B in regulation of multiple immune-response genes and in Fas-induced cell death. J. Exp. Med. 189:999.
B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]
B and I
B proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
B in the immune system. Annu. Rev. Immunol. 12:141.[Medline]
B kinase (IKK) and NF-
B: key elements of proinflammatory signalling. Semin. Immunol. 12:85.[Medline]
B leads to multifocal defects in immune responses. Cell 80:321.[Medline]
B-deficient fetal liver cells. Immunity 6:765.[Medline]
B in preventing TNF-
-induced cell death. Science 274:782.
B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c- IAP2 to suppress caspase-8 activation. Science 281:1680.
B or die?. Curr. Biol. 7:R94.[Medline]
B control. Proc. Natl. Acad. Sci. USA 94:10057.
B. Nature 376:167.[Medline]
appa B RelA-deficient lymphocytes: normal development of T cells and B cells, impaired production of IgA and IgG1 and reduced proliferative responses. J. Exp. Med. 185:953.
B regulates Fas/APO-1/CD95- and TCR- mediated apoptosis of T lymphocytes. Eur. J. Immunol. 29:878.[Medline]
B. J. Exp. Med. 185:1897.
B p50p65 recruitment. Mol. Cell Biol. 19:2098.
B sites in mouse CD95 ligand (Fas ligand) promoter: functional analysis in T cell hybridoma. J. Immunol. 161:3469.
B and AP-1. Mol. Cell 1:543.[Medline]
B in promoting double positive thymocyte apoptosis. J. Exp. Med. 189:145.This article has been cited by other articles:
![]() |
T. Copetti, C. Bertoli, E. Dalla, F. Demarchi, and C. Schneider p65/RelA Modulates BECN1 Transcription and Autophagy Mol. Cell. Biol., May 15, 2009; 29(10): 2594 - 2608. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mise-Omata, E. Kuroda, T. Sugiura, U. Yamashita, Y. Obata, and T. S. Doi The NF-{kappa}B RelA Subunit Confers Resistance to Leishmania major by Inducing Nitric Oxide Synthase 2 and Fas Expression but Not Th1 Differentiation J. Immunol., April 15, 2009; 182(8): 4910 - 4916. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fan, Q. Meng, J. J. Laterra, and E. M. Rosen Role of Src Signal Transduction Pathways in Scatter Factor-mediated Cellular Protection J. Biol. Chem., March 20, 2009; 284(12): 7561 - 7577. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Singh, M. Nagarkatti, and P. S. Nagarkatti Role of Dioxin Response Element and Nuclear Factor-{kappa}B Motifs in 2,3,7,8-Tetrachlorodibenzo-p-dioxin-Mediated Regulation of Fas and Fas Ligand Expression Mol. Pharmacol., January 1, 2007; 71(1): 145 - 157. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zetterberg, W. A. Campbell, H. W. Yang, and W. Xia The Cytosolic Loop of the {gamma}-Secretase Component Presenilin Enhancer 2 Protects Zebrafish Embryos from Apoptosis J. Biol. Chem., April 28, 2006; 281(17): 11933 - 11939. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mittal, S. Papa, G. Franzoso, and R. Sen NF-{kappa}B-Dependent Regulation of the Timing of Activation-Induced Cell Death of T Lymphocytes J. Immunol., February 15, 2006; 176(4): 2183 - 2189. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. N. Ivanov, Z. Ronai, and T. K. Hei Opposite Roles of FAP-1 and Dynamin in the Regulation of Fas (CD95) Translocation to the Cell Surface and Susceptibility to Fas Ligand-mediated Apoptosis J. Biol. Chem., January 20, 2006; 281(3): 1840 - 1852. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Abe, K. Kohu, H. Ohmori, K. Hayashi, T. Watanabe, K. Hozumi, T. Sato, S. Habu, and M. Satake Reduction of Runx1 Transcription Factor Activity Up-Regulates Fas and Bim Expression and Enhances the Apoptotic Sensitivity of Double Positive Thymocytes J. Immunol., October 1, 2005; 175(7): 4475 - 4482. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. Jones, S. D. Saibil, J. M. Pun, A. R. Elford, M. Bonnard, M. Pellegrini, S. Arya, M. E. Parsons, C. M. Krawczyk, S. Gerondakis, et al. NF-{kappa}B Couples Protein Kinase B/Akt Signaling to Distinct Survival Pathways and the Regulation of Lymphocyte Homeostasis In Vivo J. Immunol., September 15, 2005; 175(6): 3790 - 3799. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Ross, S. Martinka, V. D. D'Agati, and L. A. Bruggeman NF-{kappa}B Regulates Fas-Mediated Apoptosis in HIV-Associated Nephropathy J. Am. Soc. Nephrol., August 1, 2005; 16(8): 2403 - 2411. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Drynda, P. H. A. Quax, M. Neumann, W. H. van der Laan, G. Pap, S. Drynda, I. Meinecke, J. Kekow, W. Neumann, T. W. J. Huizinga, et al. Gene Transfer of Tissue Inhibitor of Metalloproteinases-3 Reverses the Inhibitory Effects of TNF-{alpha} on Fas-Induced Apoptosis in Rheumatoid Arthritis Synovial Fibroblasts J. Immunol., May 15, 2005; 174(10): 6524 - 6531. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hu and M. M. Sayeed Activation of PI3-kinase/PKB contributes to delay in neutrophil apoptosis after thermal injury Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1171 - C1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Do, R. J. McKallip, M. Nagarkatti, and P. S. Nagarkatti Activation through Cannabinoid Receptors 1 and 2 on Dendritic Cells Triggers NF-{kappa}B-Dependent Apoptosis: Novel Role for Endogenous and Exogenous Cannabinoids in Immunoregulation J. Immunol., August 15, 2004; 173(4): 2373 - 2382. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schmidt-Supprian, J. Tian, H. Ji, C. Terhorst, A. K. Bhan, E. P. Grant, M. Pasparakis, S. Casola, A. J. Coyle, and K. Rajewsky I{kappa}B Kinase 2 Deficiency in T Cells Leads to Defects in Priming, B Cell Help, Germinal Center Reactions, and Homeostatic Expansion J. Immunol., August 1, 2004; 173(3): 1612 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kanters, M. J.J. Gijbels, I. van der Made, M. N. Vergouwe, P. Heeringa, G. Kraal, M. H. Hofker, and M. P. J. de Winther Hematopoietic NF-{kappa}B1 deficiency results in small atherosclerotic lesions with an inflammatory phenotype Blood, February 1, 2004; 103(3): 934 - 940. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-M. Park, H.-Y. Park, and T. H. Lee Functional Effects of TNF-{alpha} on a Human Follicular Dendritic Cell Line: Persistent NF-{kappa}B Activation and Sensitization for Fas-Mediated Apoptosis J. Immunol., October 15, 2003; 171(8): 3955 - 3962. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Prendes, Y. Zheng, and A. A. Beg Regulation of Developing B Cell Survival by RelA-Containing NF-{kappa}B Complexes J. Immunol., October 15, 2003; 171(8): 3963 - 3969. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Malewicz, N. Zeller, Z. B. Yilmaz, and F. Weih NF{kappa}B Controls the Balance between Fas and Tumor Necrosis Factor Cell Death Pathways during T Cell Receptor-induced Apoptosis Via the Expression of Its Target Gene A20 J. Biol. Chem., August 29, 2003; 278(35): 32825 - 32833. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kuenzi, P. Schneider, and D. A. E. Dobbelaere Theileria parva-Transformed T Cells Show Enhanced Resistance to Fas/Fas Ligand-Induced Apoptosis J. Immunol., August 1, 2003; 171(3): 1224 - 1231. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zheng, M. Vig, J. Lyons, L. Van Parijs, and A. A. Beg Combined Deficiency of p50 and cRel in CD4+ T Cells Reveals an Essential Requirement for Nuclear Factor {kappa}B in Regulating Mature T Cell Survival and In Vivo Function J. Exp. Med., April 7, 2003; 197(7): 861 - 874. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Fanzo, C.-M. Hu, S. Y. Jang, and A. B. Pernis Regulation of Lymphocyte Apoptosis by Interferon Regulatory Factor 4 (IRF-4) J. Exp. Med., February 3, 2003; 197(3): 303 - 314. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Caamano and C. A. Hunter NF-{kappa}B Family of Transcription Factors: Central Regulators of Innate and Adaptive Immune Functions Clin. Microbiol. Rev., July 1, 2002; 15(3): 414 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Pohl, R. Gugasyan, R. J. Grumont, A. Strasser, D. Metcalf, D. Tarlinton, W. Sha, D. Baltimore, and S. Gerondakis The combined absence of NF-kappa B1 and c-Rel reveals that overlapping roles for these transcription factors in the B cell lineage are restricted to the activation and function of mature cells PNAS, April 2, 2002; 99(7): 4514 - 4519. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lorenzo, C. Ruiz-Ruiz, A. J. Quesada, G. Hernandez, A. Rodriguez, A. Lopez-Rivas, and J. M. Redondo Doxorubicin Induces Apoptosis and CD95 Gene Expression in Human Primary Endothelial Cells through a p53-dependent Mechanism J. Biol. Chem., March 22, 2002; 277(13): 10883 - 10892. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Aringer, E Feierl, G Steiner, G H Stummvoll, E Hofler, C W Steiner, I Radda, J S Smolen, and W B Graninger Increased bioactive TNF in human systemic lupus erythematosus: associations with cell death Lupus, February 1, 2002; 11(2): 102 - 108. [Abstract] [PDF] |
||||
![]() |
A. M. Owyang, J. R. Tumang, B. R. Schram, C. Y. Hsia, T. W. Behrens, T. L. Rothstein, and H.-C. Liou c-Rel Is Required for the Protection of B Cells from Antigen Receptor-Mediated, But Not Fas-Mediated, Apoptosis J. Immunol., November 1, 2001; 167(9): 4948 - 4956. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bryder, V. Ramsfjell, I. Dybedal, K. Theilgaard-Monch, C.-M. Hogerkorp, J. Adolfsson, O. J. Borge, and S. E. W. Jacobsen Self-Renewal of Multipotent Long-Term Repopulating Hematopoietic Stem Cells Is Negatively Regulated by Fas and Tumor Necrosis Factor Receptor Activation J. Exp. Med., October 1, 2001; 194(7): 941 - 952. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |