The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zheng, Y.
Right arrow Articles by Beg, A. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zheng, Y.
Right arrow Articles by Beg, A. A.
The Journal of Immunology, 2001, 166: 4949-4957.
Copyright © 2001 by The American Association of Immunologists

NF-{kappa}B RelA (p65) Is Essential for TNF-{alpha}-Induced Fas Expression but Dispensable for Both TCR-Induced Expression and Activation-Induced Cell Death1

Ye Zheng*, Fateh Ouaaz*, Peter Bruzzo*, Veena Singh*, Steve Gerondakis{dagger} and Amer A. Beg2,*

* Department of Biological Sciences, Columbia University, New York, NY 10027; and {dagger} Walter and Eliza Hall Institute of Medical Research, Melbourne, Australia


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Fas death receptor plays a key role in the killing of target cells by NK cells and CTLs and in activation-induced cell death of mature T lymphocytes. These cytotoxic pathways are dependent on induction of Fas expression by cytokines such as TNF-{alpha} and IFN-{gamma} or by signals generated after TCR engagement. Although much of our knowledge of the Fas death pathway has been generated from murine studies, little is known about regulatory mechanisms important for murine Fas expression. To this end, we have molecularly cloned a region of the murine Fas promoter that is responsible for mediating TNF-{alpha} and PMA/PHA-induced expression. We demonstrate here that induction of Fas expression by both stimuli is critically dependent on two sites that associate with RelA-containing NF-{kappa}B complexes. To determine whether RelA and/or other NF-{kappa}B subunits are also important for regulating Fas expression in primary T cells, we used CD4 T cells from RelA-/-, c-Rel-/-, and p50-/- mice. Although proliferative responses were significantly impaired, expression of Fas and activation-induced cell death was unaffected in T cells obtained from these different mice. Importantly, we show that unlike fibroblasts, which consist primarily of RelA-containing NF-{kappa}B complexes, T cells have high levels of both RelA and c-Rel complexes, suggesting that Fas expression in T cells may be dependent on redundant functions of these NF-{kappa}B subunits.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Fas receptor (Apo-1, CD95) is an apoptosis-inducing molecule that belongs to the TNF receptor superfamily (1, 2). Interaction between Fas and its ligand (FasL)3 triggers a complex cascade of intracellular events that require the Fas-associated death domain adapter protein and result in activation of caspase 8 (3, 4). Caspase 8 mediates proteolysis-dependent activation of downstream effector caspases, which are responsible for induction of apoptosis (3). Mutations in Fas or FasL result in systemic autoimmune disease, characterized by splenomegaly and glomerulonephritis, in both mice and humans (1, 3). These observations have indicated a potentially important role for Fas and FasL in the maintenance of lymphocyte homeostasis (3, 5). Recent studies have demonstrated a key role for these proteins in deletion of activated CD4 T cells (3, 5, 6). Such activation-induced cell death (AICD) is dependent on induction of expression of Fas/FasL after TCR engagement and suppression of expression of apoptosis inhibitors, both of which require the IL-2 mitogen (1, 3, 7, 8). Thus autoimmune disease in Fas-/- or FasL-/- mice may involve accumulation of autoreactive T cells because of impaired AICD.

Besides their crucial role in T cell homeostasis, FasL-expressing NK cells and CTLs can mediate killing of Fas-expressing target cells (9, 10, 11). Recent studies have also shown that Fas is important for tumor surveillance by CTLs and NK cells (12). However, under normal conditions, Fas expression on most cells may not be sufficient to induce cytotoxicity. We have recently found that Fas expression is strongly induced in mouse embryonic fibroblasts (MEFs) by the inflammatory cytokines TNF-{alpha} and IFN-{gamma} (13). Such enhancement of expression was necessary for induction of cell death after Fas ligation. Both TNF-{alpha} and IFN-{gamma} are also potent inducers of MHC class I expression. Thus, concerted cytokine-dependent induction of both MHC class I and Fas expression may significantly enhance susceptibility of target cells to CTL killing. Importantly, TNF-{alpha} (and LPS)-induced expression of both MHC class I and Fas was compromised in fibroblasts deficient in the RelA subunit of NF-{kappa}B (13). Reduced Fas expression in RelA-/- MEFs significantly enhanced their resistance to Fas-induced killing (13).

The NF-{kappa}B transcription factors participate in both innate and adaptive immune responses (14, 15). Members of the NF-{kappa}B family include several distinct subunits including c-Rel, RelB, p52, and the most ubiquitous proteins in the family, RelA (p65) and p50 (14, 15, 16). Among these subunits, RelA, c-Rel, and RelB contain transcription activation domains. Under normal conditions, dimeric NF-{kappa}B proteins typically reside in the cytoplasm in a complex with inhibitory I{kappa}B proteins. When cells are treated with certain cytokines (TNF-{alpha}) or bacterial products (LPS), a signal transduction pathway activates I{kappa}B kinases to phosphorylate I{kappa}B (14, 17). Phosphorylated I{kappa}B is then degraded, which is followed by nuclear translocation of NF-{kappa}B and activation of expression of target genes involved primarily in inflammatory and immune responses (14). Studies with p50-/- and c-Rel-/- mice have also shown that NF-{kappa}B activation after B cell receptor and TCR engagement is important for mediating proliferative responses (18, 19). Importantly, adoptive transfer experiments have demonstrated impaired lymphopoiesis in mice transplanted with p50-/- RelA-/- fetal liver cells (20). In addition, RelA-/- c-Rel-/- fetal liver-transplanted mice also exhibited defects in hemopoiesis and both p50-/- RelA-/- and RelA-/- c-Rel-/- fetal liver-transplanted mice exhibited impaired long term survival (20, 21). These studies indicate an important role for NF-{kappa}B proteins in regulation of hemopoiesis.

Recent studies have demonstrated an essential role for NF-{kappa}B in inhibition of cell death induced by multiple agents, including TNF-{alpha}, through enhanced expression of antiapoptotic genes (22, 23, 24, 25, 26). However, we have recently found that the RelA subunit of NF-{kappa}B is also important for regulation of the apoptosis-inducing Fas death receptor (13). To further characterize this unique function of NF-{kappa}B proteins, we have cloned the promoter of the mouse Fas gene, and we demonstrate here that TNF-{alpha} and PMA/PHA-induced Fas expression is dependent on two {kappa}B elements present in the Fas promoter. To examine a possible role for the RelA subunit of NF-{kappa}B in Fas/FasL-dependent AICD, we obtained RelA-/- CD4 T cells after adoptive transfer of fetal liver cells. We show here that proliferative responses of RelA-/- as well as p50-/- and c-Rel-/- CD4 T cells are partially impaired, but virtually abolished in p50-/- c-Rel-/- CD4 T cells. These results thus demonstrate a key role for these NF-{kappa}B subunits in regulation of CD4 T cell proliferation. In contrast, we observed normal up-regulation of Fas/FasL expression and AICD in RelA-/-, p50-/-, and c-Rel-/- CD4 T cells. Our results indicate that T cells have high levels of both RelA and c-Rel complexes and that Fas expression in T cells may be dependent on redundant functions of these NF-{kappa}B subunits.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of the mouse Fas promoter, reporter constructs, and site-directed mutagenesis

A high density mouse genomic DNA filter library (BAC library; Genome Systems, St. Louis, MO) was screened using a mouse Fas cDNA fragment. A positive BAC clone was used to isolate an 8.6-kb XhoI fragment that contained a 4.5-kb sequence upstream of the translational start site ATG, the first exon, and 4 kb of the first intron. This XhoI fragment was subcloned into pBluescript II SK vector, and 1.3 kb of DNA upstream of the ATG were sequenced (GenBank accession number AY027814).

Serial deletion constructs were generated by PCR using the BAC clone DNA as template. The primers used are shown in Fig. 1GoB. Faspro1 was the primer used for the 3'-end of the promoter which also contained a HindIII site; Faspro2 to Faspro9 were the eight primers used for hybridization to the 5'-end and also carried an XhoI site. PCR products were digested with HindIII + XhoI and subcloned into pGL3-Basic plasmid (Promega, Madison, WI) using the corresponding restriction sites. The 4.5-kb Fas promoter fragment was generated by PCR using primer Faspro1 and a primer corresponding to the T7 promoter in pBluescript II. The PCR product was digested with XhoI and subcloned into pGL3-Basic.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 1. Mouse Fas promoter. A, Restriction map of an 8.6-kb XhoI fragment from the Fas genomic locus. B, BamHI; EI, EcoRI; EV, EcoRV; H, HindIII; X, XhoI. B, Sequence of a 1.3-kb DNA fragment upstream of the Fas translational start site. NF-{kappa}B-, AP-1-, and NF-AT-binding sites are indicated in bold. The primers (Faspro1 to Faspro9) used for serial deletions are shown by arrows.

 
Mutagenesis of the {kappa}B sites was conducted using QuikChange Site-Directed Mutagenesis according to the manufacture’s instructions (Stratagene, La Jolla, CA). The template used for mutagenesis was pGL3-Faspro1.4. The primers used for site A were 5'-GAAGCGCCCAGGATGGTCTAGACCCATTTATGCAATC-3' and its anti-parallel sequence. The primers used for site B were CAGTGGTGAGTCAGTTCTAGACCCCGGGAGACCAGC and its antiparallel sequence.

Fibroblast culture, luciferase assays, and EMSA

NIH-3T3 fibroblasts (American Type Culture Collection, Manassas, VA) were cultured in DMEM containing 10% calf serum, penicillin (100 U/ml), streptomycin (100 U/ml), and L-glutamine (2 mM). Jurkat cells were cultured in RPMI containing 10% FBS, penicillin (100 U/ml), streptomycin (100 U/ml), and L-glutamine (2 mM). Transfections were performed using Fugene 6 (Roche Diagnostic Systems, Somerville, NJ). Twenty-four hours after transfection, cells were either treated with TNF-{alpha} (R&D Systems, Minneapolis, MN) for 6 h (NIH-3T3) or treated with PMA (100 ng/ml) and PHA (2 µg/ml) for 6 h (Jurkat) before being assayed for luciferase activity using the Dual-Luciferase Reporter Assay System (Promega). EMSA and supershift assays were conducted as described (27). The hairpin oligonucleotide probes used were GAGAGGGGAATGCCCAATTAGCTTTTGGGCATTCCCCTCT (site A), and GAGATGGGTTTCCCCATTAGCTTTGGGGAAACCCATCT (site B). For supershift assays, the anti-RelA, anti-p50, and anti-cRel Abs were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

Adoptive transfer experiments

Fetal liver cells were isolated from day 14 RelA+/+ or RelA+/- and RelA-/- embryos. Before injection, CD45.1-congenic C57BL/6 recipient mice were irradiated using a 137Cs source with two doses of 800 and 400 rads, separated by 3 h. Viable fetal liver cells (1 x 106) were injected i.v. into the irradiated recipient mice. Transplanted mice were maintained on autoclaved Sulfatrim-treated water (Alpharm, Baltimore, MD). All experiments with mice were carried-out in accordance with institutional guidelines.

Isolation of CD4 T cells

CD4 T cells were isolated from mouse spleens using CD4 Dynabeads (Dynal, Great Neck, NY). CD4 T cells prepared in this manner were typically >98% pure by FACS analysis. To separate recipient CD45.1 T cells from donor CD45.2 T cells, purified CD4 T cells were further incubated with a CD45.1 Ab (PharMingen) conjugated to Pan Mouse IgG Dynabeads (Dynal) at 4°C for 30 min. Greater than 90% cells were CD45.2 positive after this procedure as determined by FACS analysis.

In vitro proliferation assays

CD4 T cells were cultured in RPMI containing 10% FBS, penicillin (100 U/ml), streptomycin (100 U/ml), L-glutamine (2 mM), and 2-ME (50 µM). Round-bottom 96-well plates were treated with anti-CD3{epsilon} Ab or anti-CD3{epsilon} and anti-CD28 (PharMingen, San Diego, CA) at 1 µg/ml. Mouse IL-2 (R&D Systems) was used at 60 ng/ml. T cells (1 x 105) were plated in triplicate for 2 days under the different conditions described in the text before [3H]thymidine (NEN, Boston, MA) was added (1 µCi/well) for 16 h. [3H]Thymidine incorporation was determined by scintillation counting. All experiments were conducted in triplicate and SDs are indicated in the figures.

FACS analysis

CD4 T cells were either stained immediately after isolation or cultured with anti-CD3 + anti-CD28 in the presence of IL-2 (60 ng/ml) for 3 days. Viable cells were separated from dead cells on a Ficoll-Paque Plus density gradient (Amersham-Pharmacia Biotech, Piscataway, NJ). Cell surface Fas expression was determined with a PE-conjugated Fas Ab (Jo2; PharMingen). FasL expression was determined by staining with FasL Ab, biotin-labeled anti-hamster IgG, and finally PE-labeled avidin (PharMingen). FACS was performed on a FACSCalibur cytometer (Becton Dickinson, Indianapolis, IN).

Apoptosis assays

Viable activated CD4 T cells were either treated with IL-2 (60 ng/ml) alone or treated with anti-Fas Jo2 (10 µg/ml) or plated-bound CD3 Ab (1 µg/ml) in the presence of IL-2 for 20–24 h. Cells were fixed in 70% ethanol at 4°C for 24 h and then stained with a propidium iodide (PI) staining solution (PBS containing PI 50 µg/ml, RNase A 100 U/ml, and glucose 1 mg/ml) for 2 h at room temperature before FACS analysis. Apoptosis was determined by quantification of the sub-G0 population. All experiments were conducted in triplicate and SDs are indicated in the figures.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of the mouse Fas promoter

Our previous studies showed that LPS or TNF-{alpha}-induced expression of Fas was impaired in RelA-/- MEFs (13). To further study the mechanism of Fas regulation, we cloned a Fas genomic fragment from a mouse BAC high density filter library using a Fas cDNA probe. This BAC clone was used to further subclone an 8.6-kb XhoI fragment, which contained 4.5 kb DNA upstream of the ATG translation start site, the 0.1-kb first exon, and 4 kb of the first intron (Fig. 1GoA). Sequencing of ~1.3 kb upstream of the ATG revealed five potential NF-{kappa}B, as well as putative AP-1 and NF-AT binding sites (Fig. 1GoB). In addition, a consensus STAT1 site was also found within the first intronic sequence (not shown).

Two NF-{kappa}B binding sites are essential for TNF-{alpha} and PMA/PHA-induced expression of Fas

To identify DNA elements, especially potential NF-{kappa}B binding sites, responsible for Fas induction by TNF-{alpha}, we generated eight serial deletions of Fas 5'-sequence upstream of the ATG (Fig. 1GoB). These sequences were subcloned upstream of a luciferase reporter gene. NIH-3T3 cells were transfected with these constructs, after which they were either left untreated or treated with TNF-{alpha} for 6 h. The induction of luciferase activity by TNF-{alpha} was minimally affected after three putative NF-{kappa}B binding sites were deleted (Fig. 2GoA). However, deletion of a putative NF-{kappa}B binding site between -347 and -358 (site A) (Fig. 1GoB) dramatically reduced induction by TNF-{alpha} (Fig. 2GoA). To determine whether an additional downstream putative binding site between -249 and -258 (site B) (Fig. 1GoB) was also important for Fas regulation, we mutated sites A and B individually within the 400-bp sequence upstream of the ATG. As shown in Fig. 2GoB, mutation of either site substantially reduced luciferase-induction by TNF-{alpha}. These results suggest that both putative NF-{kappa}B sites may be required for TNF-{alpha}-induced Fas regulation.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. Two NF-{kappa}B sites mediate Fas expression in NIH-3T3 and Jurkat cells. A, Transfection experiments using serial deletion constructs of the mouse Fas promoter. pGL3 is the negative control. Faspro1.2 was generated from primer 1 and primer 2 of the mouse Fas promoter, and Faspro1.3 was generated from primer 1 and primer 3, etc. Faspro4k was generated from the 4-kb mouse Fas promoter. The control vector {kappa}b-luc, contains 2 {kappa}B sites from the Ig{kappa} chain enhancer. NIH-3T3 cells were cotransfected with serial deletion constructs and a pRL-TK control plasmid. Luciferase (luc) activity was normalized using the control vector and then compared with cells transfected with pGL3-Basic to calculate fold increase. B, Mutations of the NF-{kappa}B sites in the Fas promoter abolish TNF-{alpha}-induction of the reporter gene in NIH-3T3 cells. Transfections were conducted as in A with site A or B mutant constructs. Fold increase was calculated based on the luciferase activity of untreated cells (UT) transfected with faspro1.4 construct. C, EMSA analysis of site A and site B. NIH-3T3 cells were left untreated or treated with TNF-{alpha} after which nuclear extracts were made. EMSA were performed with the DNA sequence of site A or site B. RelA Ab was used to supershift NF-{kappa}B-DNA complexes. Arrow 1, NF-{kappa}B-DNA complexes; arrow 2, supershifted complexes. D, Transfections using Fas promoter serial deletion constructs in Jurkat cells. Jurkat cells were transfected as in A. Fold increase was calculated as in A. E, Mutations of the NF-{kappa}B sites in the Fas promoter abolish PMA/PHA induction of the reporter gene in Jurkat cells. Jurkat cells were transfected as in B with site A, site B, or site A + site B mutant constructs. Fold increase was calculated as in B. All transfection experiments were conducted in duplicate.

 
To determine whether NF-{kappa}B could potentially associate with site A and/or site B, we performed EMSA with nuclear extracts from untreated or TNF-{alpha}-treated NIH-3T3 cells using binding site probes corresponding to sequences of site A and site B. As shown in Fig. 2GoC, both sites bound complexes induced by TNF-{alpha}. Importantly, DNA-protein complexes formed with either site could be specifically supershifted by Abs against RelA. These results demonstrate direct association of RelA-containing NF-{kappa}B complexes to DNA elements critical for TNF-{alpha}-induced Fas expression.

To test whether these NF-{kappa}B sites were also important for regulating Fas expression in T cells, we performed similar transfections experiments in the Jurkat T cell line. Significant induction of luciferase activity was observed after a 6-h treatment of Jurkat T cells with PMA/PHA (PMA/PHA treatment is widely used to induce T cell activation events in T cell lines). Importantly, PMA/PHA-induced activity was abolished when sites A and B were mutated (Fig. 2Go, D and E). Furthermore, both sites also associated with RelA-containing complexes present in nuclear extracts of Jurkat T cells stimulated with PMA/PHA for 6 h (data not shown), the same length of time after which luciferase assays were performed. These results suggest that NF-{kappa}B sites are essential for both TNF-{alpha}- and PMA/PHA-mediated induction of Fas promoter activity in fibroblasts and T cells, respectively. Interestingly, TNF-{alpha} could not induce Fas reporter activity in Jurkat cells but strongly induced a reporter construct containing a tandem {kappa}B site from the Ig{kappa} chain promoter (data not shown). Thus NF-{kappa}B activation, although necessary, may not be sufficient for induction of Fas expression in T cells.

Reduced proliferative responses but normal Fas and FasL expression in RelA-/- CD4 T cells.

Expression of Fas and FasL is required for AICD of T cells. To directly determine a possible role for RelA in regulation of Fas and FasL expression in T cells, we used RelA-/- splenic CD4 T cells. Because RelA-/- mice die prenatally (27, 28), we transplanted RelA+/+ and RelA-/- embryonic day 14 fetal liver cells into lethally irradiated C57BL/6 congenic mice expressing the CD45.1 isoform of the membrane-associated CD45 phosphatase (20, 28). Thus, we were able to readily discriminate donor CD45.2 from residual CD45.1-expressing recipient cells. After isolation of CD4 T cells from the transplanted mice, residual recipient T cells were depleted with a CD45.1 Ab linked to magnetic beads.

Because T cell activation enhances Fas/FasL expression and predisposes T cells to AICD, we first determined whether RelA was required for T cell activation and proliferative responses. RelA+/- and RelA-/- CD4 T cells were treated with combinations of anti-CD3, anti-CD28, and IL-2. T cell proliferation was measured by [3H]thymidine incorporation. As shown in Fig. 3GoA, proliferative responses of RelA-/- T cells were ~50% lower than those in similarly treated RelA+/- T cells under the various activation conditions tested. These results suggest that RelA is important, but not essential, for CD4 T cell proliferative responses. To determine a possible role for RelA in regulation of Fas/FasL expression in activated T cells, RelA+/+ and RelA-/- T cells stimulated with CD3/CD28 Abs in the presence of IL-2 were used. However, FACS analysis showed that both Fas and FasL expression was significantly and similarly enhanced in RelA+/+ and RelA-/- T cells after stimulation (Fig. 3Go, B and C). Therefore, and unlike fibroblasts, the absence of RelA does not affect Fas (or FasL) expression in T cells.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 3. Proliferation and Fas/FasL expression of RelA-/- CD4 T cells. A, Proliferation of RelA+/- and RelA-/- CD4 T cells under the different activation conditions indicated. Each assay was conducted in triplicate. Error bars, SDs. B and C, FACS analysis of Fas (B) or FasL (C) expression in naive (solid line) or anti-CD3 + anti-CD28 + IL-2 activated (dashed line) RelA+/- and RelA-/- CD4 T cells. Dotted line, Unstained naive T cells (UT) used as control.

 
Proliferative responses and Fas/FasL expression in c-Rel-/-, p50-/-, and p50-/- c-Rel-/- CD4 T cells

Because RelA was not required for Fas/FasL expression in T cells, we tested whether such a function was dependent on the c-Rel and p50 subunits of NF-{kappa}B. For these studies, we used CD4 T cells from c-Rel-/-, p50-/-, and p50-/- c-Rel-/- mice (18, 19). We first determined the proliferative potential of CD4 T cells from these mice. After stimulation with anti-CD3, proliferation of c-Rel-/- T cells was reduced ~30% compared with c-Rel+/- T cells, but {alpha}CD3 + {alpha}CD28 treatment induced similar levels of proliferation in both cell types (Fig. 4GoA). Proliferation of p50-/- T cells was reduced ~50% under the different conditions tested compared with p50+/+ T cells (Fig. 4GoB). Interestingly, proliferation of p50+/-c-Rel+/- T cells was significantly reduced compared with p50+/+c-Rel+/+ T cells. However, proliferative responses in p50-/- c-Rel-/- cells were almost completely abolished (only ~10% of p50+/+c-Rel+/+ T cells) and could not be rescued in the presence of IL-2 (Fig. 4GoB). Impaired proliferation of p50-/- c-Rel-/- T cells was also evident by a significant reduction in blast transformation (data not shown). These results suggest that loss of a single subunit of NF-{kappa}B (RelA, c-Rel or p50) only moderately affects CD4 T cell proliferation, but loss of 2 subunits (p50 and Rel) results in severely impaired proliferative responses.



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 4. Proliferation and Fas/FasL expression in NF-{kappa}B knockout CD4 T cells. A and B, Proliferation of c-Rel+/-, c-Rel-/- (A), p50+/+, p50-/-, c-Rel+/- p50+/-, and c-Rel-/-p50-/- (B) CD4 T cells under the different activation conditions indicated. Each assay was conducted in triplicate. Error bars, SDs. C and D, FACS analysis of Fas (C) or FasL (D) expression in naive (solid line) or anti-CD3 + anti-CD28 + IL-2 activated (dashed line) CD4 T cells. Dotted line, Unstained naive T cells (UT) used as control.

 
We then determined Fas and FasL expression in T cells from these mice. As shown in Fig. 4GoC, c-Rel-/-, p50-/-, and p50+/-c-Rel+/- T cells expressed similar levels of Fas compared with T cells from control mice. Fas expression in p50-/- c-Rel-/- T cells was also significantly induced, even though their proliferative response was severely impaired. FasL expression was also significantly induced in c-Rel-/-, p50-/-, and p50-/- c-Rel-/- T cells (Fig. 4GoD). Taken together, these results indicate impairment of proliferative responses, but significant induction of Fas and FasL expression in T cells from NF-{kappa}B single or double-knockout mice after TCR/CD3 engagement.

AICD in NF-{kappa}B-deficient CD4 T cells

A recent study has suggested an antiapoptotic function for NF-{kappa}B in AICD (29), similar to that seen in other systems. Fas/FasL-dependent AICD can be induced both by direct ligation of Fas or by reengagement of TCR/CD3 (3). CD4 T cells deficient in RelA, c-Rel, or p50 were first activated as described above, after which they were incubated with IL-2 or IL-2 in the presence of the Fas Jo2 Ab or in the presence of CD3 Ab. The sub-G0 DNA content was then used to determine the apoptotic population after different treatments. Both Jo2 and CD3 Ab treatment of RelA-/- or c-Rel-/- CD4 T cells resulted in similar levels of apoptosis compared with control T cells (Fig. 5Go, A and B). Although p50-/- T cells showed a slightly higher apoptotic population after Jo2 or anti-CD3 treatments, they also displayed a higher spontaneous cell death rate in the presence of IL-2 (Fig. 5GoC). Thus, Jo2 or CD3-specific apoptosis of p50-/- T cells was similar to that of p50+/+ cells. These results demonstrate that CD4 T cells deficient in RelA, c-Rel, or p50 are neither more resistant nor more susceptible to Fas/FasL-dependent AICD. Interestingly, p50-/- c-Rel-/- T cells showed a significantly enhanced rate of cell death after stimulation with inducers of T cell proliferation (data not shown). Due to both the diminished proliferative responses and high cell death of p50-/- c-Rel-/- T cells after activation, we have not been able to unambiguously determine whether Fas-dependent AICD was affected in these cells.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 5. AICD of NF-{kappa}B knockout CD4 T cells. RelA+/-, RelA-/- (A), c-Rel+/+, c-Rel-/- (B), p50+/+, p50-/- (C) CD4 T cells were activated with anti-CD3 + anti-CD28 + IL-2 for 3 days and then treated with IL-2 alone or IL-2 + Jo2 or IL-2 + anti-CD3 for 20–24 h before the percentage of apoptotic cells was determined by FACS. Each assay was conducted in triplicate. UT, Untreated T cells. Error bars, SDs.

 
Distinct NF-{kappa}B compositions in fibroblasts and CD4 T cells

Although Jurkat T cell transfection experiments indicate that induction of Fas expression is dependent on NF-{kappa}B binding sites, we were not able to detect significant reduction in Fas expression in splenic CD4 T cells obtained from NF-{kappa}B knockout mice, including RelA. As previously reported, RelA was essential for induction of Fas expression in fibroblasts (13). To determine possible reasons for differences in Fas regulation between fibroblasts and T cells, we performed EMSA analysis of nuclear extracts from MEFs treated with TNF-{alpha} for 2 h and CD4 T cells activated for 3 days with anti-CD3 + anti-CD28 + IL-2 (significant induction of Fas expression was seen in these cell types after these treatments). We were especially interested in determining the levels of the two major transcriptional activators of the NF-{kappa}B family, RelA and c-Rel, in these cell types. Previous studies (19) and our unpublished results have indicated that the RelB subunit is not present in T cells. We detected specific NF-{kappa}B subunits that associated with Fas site B using antisera generated against these subunits (results similar to those shown below were also obtained with Fas site A). As shown in Fig. 6GoA, in the presence of RelA antisera (this antisera inhibits binding of RelA-containing complexes to DNA without causing a significant supershift) or p50 antisera, TNF-{alpha}-induced NF-{kappa}B activity was significantly reduced in wild-type (WT) MEFs, whereas c-Rel antisera had no significant effect. Consistent with these and previous results (27), NF-{kappa}B activity was strongly reduced in RelA-/- MEFs. However, the low level DNA-binding activity present in RelA-/- MEFs was supershifted by p50 and c-Rel antisera. In contrast to WT MEFs, NF-{kappa}B complexes from activated WT CD4 T cells contained significant amounts of not only p50 and RelA (evident by a reproducible decrease of binding activity in the presence of RelA antisera) but also c-Rel (Fig. 6GoB; nuclear extracts from naive/unstimulated T cells contain faster migrating activities that likely represent nonspecific DNA-binding proteins that decrease in activated T cells). Importantly, both activated RelA-/- and c-Rel-/- CD4 T cells contained significant amounts of NF-{kappa}B complexes containing p50 and c-Rel or p50 and RelA, respectively (Fig. 6GoB). These results indicate that significantly higher amounts of c-Rel are present in RelA-/- CD4 T cells than in RelA-/- fibroblasts and may thus provide an explanation of why regulation of Fas expression in fibroblasts, but not in T cells, is dependent on the RelA subunit of NF-{kappa}B.



View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 6. EMSA analysis of NF-{kappa}B composition in MEFs and primary CD4 T cells. A, WT and RelA-/- MEFs were left untreated or treated with TNF-{alpha} (10 ng/ml) for 2 h before nuclear extracts were made. EMSA were performed with site B from the Fas promoter. Nuclear extract (5 µg) was used in each reaction. Anti-RelA, anti-cRel, and anti-p50 Abs were used to supershift (or inhibit DNA binding, e.g., RelA Ab) NF-{kappa}B-DNA complexes. Arrow 1, NF-{kappa}B-DNA complexes; arrows 2 and 3, supershifted complexes. B, WT, RelA-/-, and c-Rel-/- CD4 T cells were activated with anti-CD3 + anti-CD28 + IL-2 for 3 days, after which nuclear extracts were made and tested for binding to Fas site B. EMSA and supershift assays were conducted as in A. Nuclear extract was used at 2 µg/reaction. The lane marked "naive" shows nuclear extracts from unstimulated wild-type (WT) T cells; all other lanes contain nuclear extracts from activated T cells of different genotypes, as indicated. Arrows 1 and 2, NF-{kappa}B-DNA complexes; arrow 3, supershifted complexes.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inducible regulation of Fas expression by cytokines or TCR-generated signals is important for elimination of target cells (or altered-self cells) and for AICD of T lymphocytes. Here we have studied the role of NF-{kappa}B proteins in regulation of Fas expression both by cytokines and TCR-generated signals. We demonstrate here an essential role for NF-{kappa}B in regulation of TNF-{alpha}-induced Fas expression. Although our previous studies showed impaired induction of Fas expression in RelA-/- MEFs (13), the results presented here demonstrate that RelA-containing NF-{kappa}B complexes directly associate with DNA-binding elements critical for TNF-{alpha}-induced Fas expression. In addition to NF-{kappa}B sites, AP-1 sites, which can also confer TNF-{alpha} inducibility (30), were found within the Fas-regulatory region. Our results, however, indicate that AP-1 sites are not sufficient for TNF-{alpha}-induced Fas expression because deletion of AP-1 sites in the Fas promoter did not affect reporter activity. Previously, IFN-{gamma} and TNF-{alpha} were found to synergistically induce Fas expression in fibroblasts (13). Interestingly, STAT1-/- fibroblasts (31) failed to induce Fas expression after IFN-{gamma} treatment, but induced normal expression after LPS treatment (our unpublished observations). Consistent with an important role for STAT1 in mediating IFN-{gamma}-inducible Fas expression, a perfect consensus STAT1-binding site was found in the first intron of Fas. Thus, synergistic expression of Fas induced by IFN-{gamma} and TNF-{alpha} could be mediated by promoter-specific interactions between STAT1 and RelA-containing NF-{kappa}B complexes. Elevated Fas expression has been associated with pathological complications in inflammatory and autoimmune diseases (32, 33, 34). The identification of NF-{kappa}B as a key regulator of Fas expression should thus help us to understand mechanisms responsible for elevating Fas expression under pathological conditions.

T cell activation enhances expression of Fas and FasL. To determine a possible role for NF-{kappa}B proteins in Fas and FasL expression in T cells, we first determined proliferative responses of CD4 T cells from RelA-/-, c-Rel-/-, p50-/-, and p50-/-c-Rel-/- mice. Interestingly, proliferative responses of both p50-/- and RelA-/- CD4 T cells were reduced, suggesting that these subunits, at least in part, play nonredundant roles in proliferation. Previously, total c-Rel-/- T cells (CD4+ and CD8+) were found to have significantly compromised proliferative responses, which could be corrected by addition of exogenous IL-2 (19, 35). Using CD4 T cells, we have found only moderately reduced proliferation of c-Rel-/- compared with c-Rel+/+ CD4 T cells, although the reasons for differences in proliferative responses of these two T cell populations are presently unclear. Our results also show that the reduced proliferation of c-Rel-/- and p50-/- T cells was virtually abolished in p50-/-c-Rel-/- T cells which could not be rescued by addition of exogenous IL-2. As mentioned before, reduced proliferative responses of p50-/-c-Rel-/- T cells may result in part from a greater susceptibility to cell death. Our results withp50-/-c-Rel-/- T cells are remarkably similar to those obtained with T cells from transgenic mice expressing a "superrepressor" I{kappa}B{alpha} protein using a T cell-specific promoter, and thus resulting in inhibition of multiple NF-{kappa}B subunits (36). Thus, T cells from these transgenic mice also have significantly reduced proliferation, which cannot be rescued by IL-2 addition, and greater susceptibility to cell death. Our results suggest that inhibition of T cell proliferation in these transgenic T cells may result at least in part from inhibition of the p50 and c-Rel subunits of NF-{kappa}B.

A recent study has shown that NF-{kappa}B sites are required for regulation of the human Fas promoter in Jurkat T cells stimulated with PMA and ionomycin (37). Our results also show a critical role of NF-{kappa}B for mouse Fas promoter regulation in PMA/PHA-treated Jurkat cells. Although it was proposed that the p50 and RelA subunits of NF-{kappa}B are important for regulation of human Fas expression, we have found no impairment of Fas expression in p50-/- or RelA-/- CD4 T cells. Consistent with previous studies using total (CD4+ and CD8+) c-Rel-/- T cells (38), we have also found normal expression of Fas in c-Rel-/- CD4 T cells (and AICD; see below). In fibroblasts, however, RelA was essential for regulating TNF-{alpha}-induced expression of Fas. Our results indicate that unlike fibroblasts, activated T cells contain high levels of c-Rel, which may play an important role in regulation of Fas expression in the absence of RelA. Interestingly, TNF-{alpha} treatment did not induce Fas reporter expression in Jurkat cells, even though NF-{kappa}B nuclear translocation and {kappa}B-luciferase reporter expression were enhanced in the presence of TNF-{alpha}. Similarly, TNF-{alpha} treatment did not result in up-regulation of Fas expression in splenic CD4 T cells (data not shown). These results suggest that NF-{kappa}B activation may not be sufficient for Fas expression in T cells but that additional events (e.g., posttranslational modifications or transcriptional coactivator expression) may also be required to induce Fas expression in T cells. Previous studies have also suggested that NF-{kappa}B proteins, in particular RelA, are important for regulation of FasL expression (39, 40, 41). Similar to Fas, normal up-regulation of FasL expression in the absence of RelA, p50, or c-Rel may also indicate redundant functions for these NF-{kappa}B subunits in regulation of FasL expression.

Recent studies have indicated both proapoptotic and antiapoptotic functions for NF-{kappa}B proteins in T cells (29, 42). In transgenic mice expressing a "superrepressor" I{kappa}B{alpha} protein using a T cell-specific promoter, it was shown that NF-{kappa}B proteins are required for double-positive thymocyte apoptosis (42). Using a similarly generated transgenic system described above, it has also been shown that NF-{kappa}B inhibition results in enhanced Fas-mediated killing of mature T cells (29, 36). The latter results are consistent with studies indicating an important antiapoptotic function for NF-{kappa}B. However, in RelA-/-, p50-/-, and c-Rel-/- single knockout CD4 T cells, no enhancement of AICD was noticed compared with control T cells. Our results indicate that the absence of these individual NF-{kappa}B subunits results in impaired T cell proliferation but does not enhance susceptibility to AICD. The results presented here thus indicate that the primary function of NF-{kappa}B proteins in the Fas pathway may be to promote Fas-induced cell death through enhancement of Fas expression rather than inhibit such cell death through expression of survival genes.


    Footnotes
 
1 This work was supported in part by National Institutes of Health Grant R01 CA074892 to A.A.B. Back

2 Address correspondence and reprint requests to Dr. Amer A. Beg, 1110 Fairchild Center, Department of Biological Sciences, 1212 Amsterdam Avenue, Columbia University, New York, NY 10027. Back

3 Abbreviations used in this paper: FasL, Fas ligand; AICD, activation-induced cell death; MEFs, mouse embryonic fibroblasts; PI, propidium iodide; WT, wild-type. Back

Received for publication June 15, 2000. Accepted for publication February 5, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nagata, S., P. Golstein. 1995. The Fas death factor. Science 267:1449.[Abstract/Free Full Text]
  2. Nagata, S.. 1997. Apoptosis by death factor. Cell 88:355.[Medline]
  3. Lenardo, M., K. M. Chan, F. Hornung, H. McFarland, R. Siegel, J. Wang, L. Zheng. 1999. Mature T lymphocyte apoptosis: immune regulation in a dynamic and unpredictable antigenic environment. Annu. Rev. Immunol. 17:221.[Medline]
  4. Nagata, S.. 1999. Fas ligand-induced apoptosis. Annu. Rev. Genet. 33:29.[Medline]
  5. Van Parijs, L., A. K. Abbas. 1998. Homeostasis and self-tolerance in the immune system: turning lymphocytes off. Science 280:243.[Abstract/Free Full Text]
  6. Zheng, L., G. Fisher, R. E. Miller, J. Peschon, D. H. Lynch, M. J. Lenardo. 1995. Induction of apoptosis in mature T cells by tumour necrosis factor. Nature 377:348.[Medline]
  7. Refaeli, Y., L. Van Parijs, C. A. London, J. Tschopp, A. K. Abbas. 1998. Biochemical mechanisms of IL-2-regulated Fas-mediated T cell apoptosis. Immunity 8:615.[Medline]
  8. Park, C. G., S. Y. Lee, G. Kandala, Y. Choi. 1996. A novel gene product that couples TCR signaling to Fas(CD95) expression in activation-induced cell death. Immunity 4:583.[Medline]
  9. Berke, G.. 1995. The CTL’s kiss of death. Cell 81:9.[Medline]
  10. Clark, W. R., C. M. Walsh, A. A. Glass, M. T. Huang, R. Ahmed, M. Matloubian. 1995. Cell-mediated cytotoxicity in perforin-less mice. Int. Rev. Immunol. 13:1.[Medline]
  11. Lowin, B., M. Hahne, C. Mattmann, J. Tschopp. 1994. Cytolytic T-cell cytotoxicity is mediated through perforin and Fas lytic pathways. Nature 370:650.[Medline]
  12. Rosen, D., J. H. Li, S. Keidar, I. Markon, R. Orda, G. Berke. 2000. Tumor immunity in perforin-deficient mice: a role for CD95 (Fas/APO-1). J. Immunol. 164:3229.[Abstract/Free Full Text]
  13. Ouaaz, F., M. Li, A. A. Beg. 1999. A critical role for the RelA subunit of nuclear factor {kappa}B in regulation of multiple immune-response genes and in Fas-induced cell death. J. Exp. Med. 189:999.[Abstract/Free Full Text]
  14. Ghosh, S., M. J. May, E. B. Kopp. 1998. NF-{kappa}B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]
  15. Jr Baldwin, A. S.. 1996. The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
  16. Baeuerle, P. A., T. Henkel. 1994. Function and activation of NF-{kappa}B in the immune system. Annu. Rev. Immunol. 12:141.[Medline]
  17. Karin, M., M. Delhase. 2000. The I{kappa}B kinase (IKK) and NF-{kappa}B: key elements of proinflammatory signalling. Semin. Immunol. 12:85.[Medline]
  18. Sha, W. C., H. C. Liou, E. I. Tuomanen, D. Baltimore. 1995. Targeted disruption of the p50 subunit of NF-{kappa}B leads to multifocal defects in immune responses. Cell 80:321.[Medline]
  19. Kontgen, F., R. J. Grumont, A. Strasser, D. Metcalf, R. Li, D. Tarlinton, S. Gerondakis. 1995. Mice lacking the c-rel proto-oncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin-2 expression. Genes Dev. 9:1965.[Abstract/Free Full Text]
  20. Horwitz, B. H., M. L. Scott, S. R. Cherry, R. T. Bronson, D. Baltimore. 1997. Failure of lymphopoiesis after adoptive transfer of NF-{kappa}B-deficient fetal liver cells. Immunity 6:765.[Medline]
  21. Grossmann, M., D. Metcalf, J. Merryfull, A. Beg, D. Baltimore, S. Gerondakis. 1999. The combined absence of the transcription factors Rel and RelA leads to multiple hemopoietic cell defects. Proc. Natl. Acad. Sci. USA 96:11848.[Abstract/Free Full Text]
  22. Beg, A. A., D. Baltimore. 1996. An essential role for NF-{kappa}B in preventing TNF-{alpha}-induced cell death. Science 274:782.[Abstract/Free Full Text]
  23. Wang, C. Y., M. W. Mayo, R. G. Korneluk, D. V. Goeddel, Jr A. S. Baldwin. 1998. NF-{kappa}B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c- IAP2 to suppress caspase-8 activation. Science 281:1680.[Abstract/Free Full Text]
  24. Grumont, R. J., I. J. Rourke, S. Gerondakis. 1999. Rel-dependent induction of A1 transcription is required to protect B cells from antigen receptor ligation-induced apoptosis. Genes Dev. 13:400.[Abstract/Free Full Text]
  25. Baichwal, V. R., P. A. Baeuerle. 1997. Activate NF-{kappa}B or die?. Curr. Biol. 7:R94.[Medline]
  26. Chu, Z. L., T. A. McKinsey, L. Liu, J. J. Gentry, M. H. Malim, D. W. Ballard. 1997. Suppression of tumor necrosis factor-induced cell death by inhibitor of apoptosis c-IAP2 is under NF-{kappa}B control. Proc. Natl. Acad. Sci. USA 94:10057.[Abstract/Free Full Text]
  27. Beg, A. A., W. C. Sha, R. T. Bronson, S. Ghosh, D. Baltimore. 1995. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-{kappa}B. Nature 376:167.[Medline]
  28. Doi, T. S., T. Takahashi, O. Taguchi, T. Azuma, Y. Obata. 1997. NF-{kappa}appa B RelA-deficient lymphocytes: normal development of T cells and B cells, impaired production of IgA and IgG1 and reduced proliferative responses. J. Exp. Med. 185:953.[Abstract/Free Full Text]
  29. Dudley, E., F. Hornung, L. Zheng, D. Scherer, D. Ballard, M. Lenardo. 1999. NF-{kappa}B regulates Fas/APO-1/CD95- and TCR- mediated apoptosis of T lymphocytes. Eur. J. Immunol. 29:878.[Medline]
  30. Minden, A., M. Karin. 1997. Regulation and function of the JNK subgroup of MAP kinases. Biochim. Biophys. Acta 1333:F85.[Medline]
  31. Durbin, J. E., R. Hackenmiller, M. C. Simon, D. E. Levy. 1996. Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84:443.[Medline]
  32. Chervonsky, A. V., Y. Wang, F. S. Wong, I. Visintin, R. A. Flavell, Jr C. A. Janeway, L. A. Matis. 1997. The role of Fas in autoimmune diabetes. Cell 89:17.[Medline]
  33. Waldner, H., R. A. Sobel, E. Howard, V. K. Kuchroo. 1997. Fas- and FasL-deficient mice are resistant to induction of autoimmune encephalomyelitis. J. Immunol. 159:3100.[Abstract]
  34. Benoist, C., D. Mathis. 1997. Cell death mediators in autoimmune diabetes: no shortage of suspects. Cell 89:1.[Medline]
  35. Liou, H. C., Z. Jin, J. Tumang, S. Andjelic, K. A. Smith, M. L. Liou. 1999. c-Rel is crucial for lymphocyte proliferation but dispensable for T cell effector function. Int. Immunol. 11:361.[Abstract/Free Full Text]
  36. Boothby, M. R., A. L. Mora, D. C. Scherer, J. A. Brockman, D. W. Ballard. 1997. Perturbation of the T lymphocyte lineage in transgenic mice expressing a constitutive repressor of nuclear factor (NF)-{kappa}B. J. Exp. Med. 185:1897.[Abstract/Free Full Text]
  37. Chan, H., D. P. Bartos, L. B. Owen-Schaub. 1999. Activation-dependent transcriptional regulation of the human Fas promoter requires NF-{kappa}B p50–p65 recruitment. Mol. Cell Biol. 19:2098.[Abstract/Free Full Text]
  38. Strasser, A., R. J. Grumont, M. L. Stanley, S. Gerondakis. 1999. The transcriptional regulator Rel is essential for antigen receptor-mediated stimulation of mature T cells but dispensable for positive and negative selection of thymocytes and T cell apoptosis. Eur. J. Immunol. 29:928.[Medline]
  39. Matsui, K., A. Fine, B. Zhu, A. Marshak-Rothstein, S. T. Ju. 1998. Identification of two NF-{kappa}B sites in mouse CD95 ligand (Fas ligand) promoter: functional analysis in T cell hybridoma. J. Immunol. 161:3469.[Abstract/Free Full Text]
  40. Kasibhatla, S., T. Brunner, L. Genestier, F. Echeverri, A. Mahboubi, D. R. Green. 1998. DNA damaging agents induce expression of Fas ligand and subsequent apoptosis in T lymphocytes via the activation of NF-{kappa}B and AP-1. Mol. Cell 1:543.[Medline]
  41. Kasibhatla, S., L. Genestier, D. R. Green. 1999. Regulation of Fas-ligand expression during activation-induced cell death in T lymphocytes via nuclear factor kappaB. J. Biol. Chem. 274:987.[Abstract/Free Full Text]
  42. Hettmann, T., J. DiDonato, M. Karin, J. M. Leiden. 1999. An essential role for nuclear factor {kappa}B in promoting double positive thymocyte apoptosis. J. Exp. Med. 189:145.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
N. P. Singh, M. Nagarkatti, and P. S. Nagarkatti
Role of Dioxin Response Element and Nuclear Factor-{kappa}B Motifs in 2,3,7,8-Tetrachlorodibenzo-p-dioxin-Mediated Regulation of Fas and Fas Ligand Expression
Mol. Pharmacol., January 1, 2007; 71(1): 145 - 157.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Zetterberg, W. A. Campbell, H. W. Yang, and W. Xia
The Cytosolic Loop of the {gamma}-Secretase Component Presenilin Enhancer 2 Protects Zebrafish Embryos from Apoptosis
J. Biol. Chem., April 28, 2006; 281(17): 11933 - 11939.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Mittal, S. Papa, G. Franzoso, and R. Sen
NF-{kappa}B-Dependent Regulation of the Timing of Activation-Induced Cell Death of T Lymphocytes
J. Immunol., February 15, 2006; 176(4): 2183 - 2189.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. N. Ivanov, Z. Ronai, and T. K. Hei
Opposite Roles of FAP-1 and Dynamin in the Regulation of Fas (CD95) Translocation to the Cell Surface and Susceptibility to Fas Ligand-mediated Apoptosis
J. Biol. Chem., January 20, 2006; 281(3): 1840 - 1852.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Abe, K. Kohu, H. Ohmori, K. Hayashi, T. Watanabe, K. Hozumi, T. Sato, S. Habu, and M. Satake
Reduction of Runx1 Transcription Factor Activity Up-Regulates Fas and Bim Expression and Enhances the Apoptotic Sensitivity of Double Positive Thymocytes
J. Immunol., October 1, 2005; 175(7): 4475 - 4482.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. G. Jones, S. D. Saibil, J. M. Pun, A. R. Elford, M. Bonnard, M. Pellegrini, S. Arya, M. E. Parsons, C. M. Krawczyk, S. Gerondakis, et al.
NF-{kappa}B Couples Protein Kinase B/Akt Signaling to Distinct Survival Pathways and the Regulation of Lymphocyte Homeostasis In Vivo
J. Immunol., September 15, 2005; 175(6): 3790 - 3799.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. J. Ross, S. Martinka, V. D. D'Agati, and L. A. Bruggeman
NF-{kappa}B Regulates Fas-Mediated Apoptosis in HIV-Associated Nephropathy
J. Am. Soc. Nephrol., August 1, 2005; 16(8): 2403 - 2411.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Drynda, P. H. A. Quax, M. Neumann, W. H. van der Laan, G. Pap, S. Drynda, I. Meinecke, J. Kekow, W. Neumann, T. W. J. Huizinga, et al.
Gene Transfer of Tissue Inhibitor of Metalloproteinases-3 Reverses the Inhibitory Effects of TNF-{alpha} on Fas-Induced Apoptosis in Rheumatoid Arthritis Synovial Fibroblasts
J. Immunol., May 15, 2005; 174(10): 6524 - 6531.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Z. Hu and M. M. Sayeed
Activation of PI3-kinase/PKB contributes to delay in neutrophil apoptosis after thermal injury
Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1171 - C1178.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
S. DELHALLE, R. BLASIUS, M. DICATO, and M. DIEDERICH
A Beginner's Guide to NF-{kappa}B Signaling Pathways
Ann. N.Y. Acad. Sci., December 1, 2004; 1030(1): 1 - 13.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Do, R. J. McKallip, M. Nagarkatti, and P. S. Nagarkatti
Activation through Cannabinoid Receptors 1 and 2 on Dendritic Cells Triggers NF-{kappa}B-Dependent Apoptosis: Novel Role for Endogenous and Exogenous Cannabinoids in Immunoregulation
J. Immunol., August 15, 2004; 173(4): 2373 - 2382.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Schmidt-Supprian, J. Tian, H. Ji, C. Terhorst, A. K. Bhan, E. P. Grant, M. Pasparakis, S. Casola, A. J. Coyle, and K. Rajewsky
I{kappa}B Kinase 2 Deficiency in T Cells Leads to Defects in Priming, B Cell Help, Germinal Center Reactions, and Homeostatic Expansion
J. Immunol., August 1, 2004; 173(3): 1612 - 1619.
[Abstract] [Full Text] [PDF]


Home page
Blood