The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chuntharapai, A.
Right arrow Articles by Kim, K. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chuntharapai, A.
Right arrow Articles by Kim, K. J.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2001, 166: 4891-4898.
Copyright © 2001 by The American Association of Immunologists

Isotype-Dependent Inhibition of Tumor Growth In Vivo by Monoclonal Antibodies to Death Receptor 4

Anan Chuntharapai*, Kelly Dodge*, Katharine Grimmer{dagger}, Kurt Schroeder*, Scot A. Marsters{ddagger}, Hartmut Koeppen§, Avi Ashkenazi{ddagger} and K. Jin Kim1,*

Departments of * Antibody Technology, {dagger} Cell Biology and Technology, {ddagger} Molecular Oncology, and § Pathology, Genentech, South San Francisco, CA 94080


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To explore an approach for death receptor targeting in cancer, we developed murine mAbs to human death receptor 4 (DR4). The mAb 4H6 (IgG1) competed with Apo2L/TNF-related apoptosis-inducing ligand (DR4’s ligand) for binding to DR4, whereas mAb 4G7 (IgG2a) did not. In vitro, both mAbs showed minimal intrinsic apoptosis-inducing activity, but each triggered potent apoptosis upon cross-linking. In a colon tumor nude mouse model in vivo, mAb 4H6 treatment without addition of exogenous linkers induced apoptosis in tumor cells and caused complete tumor regression, whereas mAb 4G7 partially inhibited tumor growth. An IgG2a isotype switch variant of mAb 4H6 was much less effective in vivo than the parent IgG1-4H6, despite similar binding affinities to DR4. The same conclusion was obtained by comparing other IgG1 and IgG2 mAbs to DR4 for their anti-tumor activities in vivo. Thus, the isotype of anti-DR4 mAb may be more important than DR4 binding affinity for tumor elimination in vivo. Anti-DR4 mAbs of the IgG1 isotype may provide a useful tool for investigating the therapeutic potential of death receptor targeting in cancer.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Members of the TNF family of cytokines influence a variety of immunological functions, such as cell death and cell activation. In particular, TNF, Fas ligand/Apo1 ligand (CD95 ligand), and lymphotoxin have been extensively investigated with respect to their activities in autoimmune disorders, activation-induced cell death, and apoptosis of transformed cells (1, 2, 3). Recently, the TNF homologue Apo2 ligand, also known as TNF-related apoptosis-inducing ligand (Apo2L/TRAIL),2 has been described (4, 5). To date, five distinct receptors for Apo2L/TRAIL have been identified (6): four membrane-bound receptors, DR4 (TRAIL-R1), DR5 (TRAIL-R2), DcR1 (TRAIL-R3/TRID), and DcR2 (TRAIL-R4), and one soluble receptor, osteoprotegerin (7). Both DR4 and DR5 contain cytoplasmic death domains, which mediate apoptosis in transformed cells. In contrast, DcR1 and DcR2, which lack a complete death domain, do not mediate apoptotic signals.

Soluble Apo2L/TRAIL induces apoptosis of many tumor cell lines (4, 5, 8) in vitro. Apo2L/TRAIL exhibits potent anti-tumor activity in nude mouse models of human colon and breast carcinomas (9, 10). In contrast to other apoptosis-inducing family members such as TNF and CD95 ligand (11, 12, 13), Apo2L/TRAIL did not show significant toxicity to normal tissues in pilot studies in vivo in cynomolgus monkeys and mice (9, 10). Given the established clinical efficacy of mAbs to receptor targets such as HER2/neu or CD20 in cancer treatment, we examined whether mAbs directed to DR4, one of the signaling receptors for Apo2L/TRAIL, have therapeutic potential for cancer.

In this study, we report that mAbs to DR4, which induce apoptosis activities upon cross-linking in vitro, demonstrate potent anti-tumor activities without addition of exogenous linkers in vivo. Furthermore, we report that murine IgG1 appears to be a much more effective Ig isotype than murine IgG2a in demonstrating anti-tumor activities through DR4 in xenograft nude mouse models.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of mAbs to human DR4

BALB/c mice were immunized 11 times with 0.5 µg of human DR4-IgG (14) resuspended in monophosphoryl lipid A/trehalose dicorynomycolate adjuvant (Ribi Immunochemicals, Hamilton, MT) into each hind foot pad at 3- to 4-day intervals. Three days after the final boost, popliteal lymph nodes were fused with myeloma cell line P3x63Ag.U.1 (15). Culture supernatants were initially screened for their ability to bind to hDR4-IgG but not to CD4-IgG in a capture ELISA as described previously (15). The selected mAbs were further tested for their ability to block ligand-receptor binding in a capture ELISA (16) and for their ability to recognize cell membrane receptors on 9D cells by flow cytometric analysis as described previously (16). After cloning the selected final hybridomas twice, their Ag specificity as well as their ability to induce apoptosis were determined.

To determine whether mAbs recognized overlapping or spatially distant epitopes, a competitive binding ELISA was performed using biotinylated mAbs as previously described (16). The affinities of these mAbs to DR4-IgG were determined using KinExA, an automated immunoassay system (Sapidyne Instruments, Boise, ID) as previously described (17), and the equilibrium constant was calculated using the software provided by the manufacturer.

Capture ELISA

The binding of mAbs to DR4 was initially determined using a capture ELISA as previously described (16). Briefly, microtiter plates were coated with 50 µl/well of 2 µg/ml of goat Abs specific to the Fc portion of human IgG (Cappel; ICN Pharmaceuticals, Costa Mesa, CA). After washing the plates, nonspecific binding sites were blocked with BSA, and 50 µl/well of 0.4 µg/ml of DR4-IgG was added to wells for 1 h. Plates were then incubated with 50 µl/well of 2 µg/ml of anti-DR4 mAbs (or hybridoma culture supernatants) for 1 h. The bound mAbs were then detected with 50 µl/well of HRP-goat anti-mouse IgG (Cappel), followed by addition of the substrate. Plates were then read at 490 nM with an ELISA plate reader.

Determination of blocking activities

Blocking activities of mAbs were determined in a capture ELISA as described above with a modification. Briefly, DR4-hIgG Fc was captured to goat anti-human IgG Fc Abs, and various concentrations of anti-DR4 mAbs were added. After washing 50 µl of 0.2 µg/ml of Apo2L was added. The Apo2L bound to DR4-IgG was detected by the addition of 50 µl of 1 µg/ml of biotinylated anti-Apo2L mAb 2E9, followed by the addition of HRP-goat anti-mouse IgG.

Determination of cell viability using crystal violet uptake

Adherent cells (4 x 104 cells/100 µl/well) were incubated overnight with serial dilutions of mAbs with or without goat anti-mouse IgG Fc (10 µg/ml) or rabbit complement (RC; Cedarlane Laboratories, Ontario, Canada; final 1/8 dilution). Heat-inactivated rabbit complement was prepared by incubation of rabbit serum at 56°C for 30 min. Serial dilutions of Apo2L/TRAIL (9) prepared in a final volume of 100 µl were added to each plate as a positive control. Each dilution was performed in duplicate. After incubation overnight at 37°C, the medium was removed, and viable cells were stained using crystal violet as previously described (18). The plates were read on an ELISA plate reader at 540 nM.

Flow cytometric analysis of FITC-annexin V binding

Human B lymphoid 9D cells (5 x 105 cells in 100 µl of complete RPMI 1640 medium) were plated in 48-well microplates and were incubated with 100 µl of mAb solution (10 µg/ml) for 15 min on ice. Complete RPMI 1640 medium (2 ml) plus 300 µl of RC (Microbiological Associates, Cedarlane, MD), human complement (Sigma, St. Louis, MO), or human C1q (80 µg/ml; Quidel, San Diego, CA) were added to the wells. After an overnight incubation at 37°C in 5% CO2, cells were washed in PBS and resuspended in 200 µl of binding buffer (NeXins Research, Hoeven, The Netherlands). The cells were then incubated with 10 µl of 20 µg/ml FITC-annexin V (APOPTEST-FITC; NeXins Research) plus 10 µl of 50 µg/ml propidium iodide in the dark for 15 min at room temperature, washed, and analyzed by flow cytometry.

Poly(ADP-ribose) polymerase (PARP) assay

PARP assay was performed as previously described (19). PARP was detected using HRP-rabbit anti-PARP IgG Abs (BD Biosciences, San Diego, CA). Human B lymphoid 9D cells (5 x 105 cells in 100 µl of complete medium) were treated with 100 µl of mAb solution (10 µg/ml) with or without complement as described above. The cells were harvested and washed in Tris-HCl buffer (50 mM Tris-HCl (pH 7.5), 0.15 M NaCl, 1 mM CaCl2, and 1 mM MgCl2) by microcentrifugation. The cells were then lysed in a solution containing 0.5% sodium deoxycholate, 1% Triton X-100, 5 mM EDTA, 10 µg/ml leupeptin, 10 µg/ml aprotinin, and 1 mM PMSF and mixed with an equal volume of 2x SDS buffer. After boiling, proteins were separated on 7.5% SDS-PAGE and transferred to immunoblot polyvinylidene difluoride membranes. The separated intact and cleaved polymerases were detected using HRP-rabbit anti-PARP IgG Abs (Roche, Indianapolis, IN). Bound rabbit anti-PARP IgG Abs were detected using HRP-goat anti-rabbit IgG Abs followed by the ECL detection method (15).

Generation of IgG2a isotype variant of IgG1-4H6 using Ab engineering technique

To determine the influence of different murine IgG isotypes on the anti-tumor activities of anti-DR4 mAbs, the VH and VL genes were isolated by PCR amplification of mRNA from the corresponding mAb 4H6 hybridoma as previously described (20) using Taq polymerase. N-terminal amino acid sequences of mAb 4H6 (IgG1) of the light and heavy chains were used to design the sense strand PCR primers, whereas the antisense PCR primers were based on consensus sequences of murine framework 4 of each chain. The 3' light and heavy chain primers were TGCAGCCACGGWCCGWKT AKYTCCARYTTKGTSSC and GACCGATGGGCCCGTCGTTTTGGCTGM RGARACNGTGAS (W = A/T, K = G/T, B = G/T/C, Y = C/T, R = A/G, S = G/C, M = A/C, N = A/G/T/C), respectively. The 5' light and heavy chain primers were GCTACAAATGCATACGCTGATATCCAGATGACACAG and GCTACAAACGCGTACGCTCAGGTGCAGCTGAAGGAG, respectively. Amplified DNA fragments were digested with restriction enzymes Nsi and RsrII for light chain and with MluI and ApaI for heavy chain. The variable domain cDNAs of light and heavy chains were separately assembled with the murine Ck and IgG2 CH1-CH2-CH3 domains in plasmid expression vectors. The light chain and heavy chain cDNA vectors were cotransfected into 293 cells for 7 days. Media were harvested, and the secreted IgG2a-4H6 was recovered by affinity purification using protein G.

In vivo analysis of anti-tumor activity

Experiments were conducted essentially as described previously (21). Colo 205 tumor cells were grown in DMEM/F-12 (50/50) medium supplemented with 10% FCS, 2 mM L-glutamine, and antibiotics. Female athymic nude mice (4–6 wk old, seven or eight mice per group) were injected s.c. with 5 x 106 Colo 205 cells in 0.2 ml of HBBS in the dorsal areas. Once tumors reached 50–100 mm3, the mice were grouped randomly, and mAbs were given i.p. in a volume of 0.1 ml. Arrows in figures indicate the starting date of the first mAb treatment. Tumor sizes were determined until mice had to be sacrificed due to tumor necrosis in the control group. All experiments were performed in compliance with the laws and regulations stated in the animal welfare act and the Guide for the Care and Use of Laboratory Animals. Statistical analysis was performed using the nonparametric Wilcoxon test.

Histology

Athymic nude mice bearing Colo 205 xenografts were treated i.p. with 5 mg/kg of anti-DR4 mAbs or IgG1 control mAb 3 days before tumors were excised. Three mice were used for each treatment. The frozen tumor sections were stained with hematoxylin and eosin and examined under the microscope.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In vitro apoptotic activities of anti-DR4 mAbs

Murine mAbs to the CD95 death receptor, anti-Fas (22) and anti-Apo-1 (23, 24), show potent anti-tumor activity. The anti-Fas mAb is a murine IgM, whereas the anti-Apo-1 mAb is a murine IgG3 isotype that tends to aggregate. The multivalency of IgM and aggregated IgG3 may facilitate the oligomerization of CD95, thereby inducing apoptosis of tumor cells. However, these mAbs induce lethal liver toxicity in vivo, which limits their therapeutic potential (25).

To obtain agonistic anti-DR4 mAbs, we immunized mice with a soluble DR4-Fc fusion protein as previously described (16). We screened for IgM and IgG3 mAbs as well as for agonistic activity on human B lymphoma 9D cells, which express DR4 and DR5 (data not shown). None of our DR4-specific mAbs was of the IgM or IgG3 isotype. Some of the mAbs demonstrated weak intrinsic agonistic activity; in the presence of a cross-linking agent such as goat anti-mouse IgG, the agonistic activity was dramatically enhanced. For further studies we selected two anti-DR4 mAbs on the basis of Ig isotype and ability to block Apo2L/TRAIL activity. mAb 4H6 is an IgG1 and exhibits blocking activity, whereas mAb 4G7 is an IgG2a without blocking activity (Table IGo). Both mAbs demonstrated high affinities to DR4, with Kd-1 values in the range of 5–20 pM, as determined by a KinExA solution phase assay (Sapidyne Instruments) (Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. Characteristics of anti-DR4 mAbs1

 
We investigated the cytotoxic activity of these mAbs in vitro on human Colo 205 colon carcinoma cells by crystal violet staining (Fig. 1Go). The mAb 4H6 alone demonstrated weak cytotoxic activity on Colo 205, whereas mAb 4G7 alone showed no cytotoxic activity (Fig. 1GoA). However, in the presence of goat anti-mouse IgG-Fc, which can oligomerize murine IgG molecules, both mAbs demonstrated potent agonistic activities on Colo 205 cells (Fig. 1GoB). Similar observations were made with other human tumor cell lines that express DR4, such as HCT116 colon carcinoma and SK-MES-1 lung carcinoma, but not with normal human microvascular and vascular endothelial cells, which also express DR4 (data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 1. Effect of anti-DR4 mAbs on viability of Colo 205 colon carcinoma cells. Tumor cells (4 x 104 cells/well) were incubated overnight with serial dilutions of mAbs in the presence of goat anti-mouse IgG Fc (anti-Fc), RC, or heat-inactivated RC (HIC). Cells treated with Apo2L/TRAIL, anti-Fc Abs, RC, and HIC were also included as controls. After cells were incubated overnight at 37°C, the cell viability was determined using crystal violet staining as previously described (18 ). The plates were read on a plate reader at 540 nM. A, mAb alone; B, mAb plus anti-Fc Abs (10 µg/ml); C, mAb plus RC (1/8 final dilution); and D, mAb plus HIC (1/8 final dilution).

 
The finding that induction of potent cytotoxic activity by anti-DR4 mAbs in vitro required the cross-linking with goat anti-mouse IgG suggests that oligomerization of DR4 is required for signaling, consistent with the trimeric structure of TNF-related ligands and their complexes with cognate TNF receptor family members (26, 27). To identify a natural linker that could enhance the agonistic activity of the anti-DR4 mAbs without eliciting an Ab response, we explored the possibility of complement, especially, the first complement component, C1q (28, 29, 30), as a linker.

Because complement is known to function in a species-nonspecific manner, and RC is a very effective source of complement (31, 32), we tested the Ab cross-linking ability of commercially available RC. We incubated tumor cells with anti-DR4 mAbs for 30 min and then added complement-containing rabbit serum for an overnight incubation. RC enhanced the agonistic activity of IgG2a mAb 4G7, but not that of IgG1 mAb 4H6 (Fig. 1GoC), as expected from a previous reports (33, 34) that murine IgG2 (mIgG2) is much more effective than mIgG1 in complement activation. In fact, most murine IgG1 Abs do not activate complement, as shown with mAb 4H6. The agonistic activity of mAb 4G7 was abolished when the rabbit serum was heat inactivated (Fig. 1GoD), confirming that complement present in the rabbit serum was responsible for linking mAb 4G7. Because these experiments were performed using heterologous RC, we cannot completely rule out the possibility that homologous murine complement oligomerizes mAb 4H6 molecules. We attempted to address this question using mouse sera as a source of homologous complement. Because no good commercial source of mouse complement was available, we pooled fresh sera from several nude mice to use as a source of mouse complement in our experiments. Preliminary results obtained using such mouse sera were inconsistent (data not shown). This could be due to the variation among individual mice and needs further investigation.

To determine that the agonistic activity of mAb 4G7 in the presence of RC was due to apoptosis and not to complement-mediated cytolysis, we analyzed FITC-annexin V staining and cleavage of the caspase-3 substrate PARP in 9D cells (Fig. 2Go). Approximately 70% of 9D cells treated with mAb 4G7 plus RC were FITC-annexin V positive, compared with 5% of 9D cells treated with control IgG2a plus RC (Fig. 2GoA). Consistent with this evidence for apoptosis induction, we detected a significant level of the 85-kDa caspase-cleaved product of PARP (116 kDa) in 9D cells treated with mAb 4G7 plus RC, but not in 9D cells treated with mAb 4G7 plus heat-inactivated RC (Fig. 2GoB). The maximal agonistic activity of mAb 4G7 in the presence of RC was ~70% of the agonistic activity in the presence of goat anti-mouse IgG, and the difference between them is statistically significant (p < 0.01; Fig. 2GoC). These results confirm that complement can oligomerize the IgG2a mAb 4G7 in vitro to mediate apoptosis. Our in vitro study demonstrates that complement components could enhance the apoptotic activity of mAb 4G7 (mIgG2a), but not mAb 4H6 (mIgG1), in agreement with the report by Sato et al. (30). They reported that mIgG2a, but not mIgG1 anti-Thy-1 mAb, induced apoptosis of neuronal cells in the presence of human C1q. We have also tested the effects of human complement (1/8 final dilution) and human C1q (10 µg/ml) on the apoptotic activity of mAb 4G7. The apoptotic activities detected with human complement and human C1q were 27 and 30% of the activity detected with RC, respectively (data not shown). Although the apoptosis-enhancing activities of human complement and human C1q were much weaker than that of RC, these results further suggest that C1q can induce the oligomerization of mAb 4G7.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 2. Induction of apoptosis in human B cell lymphoma 9D cells by mAb 4G7 (IgG2a) in the presence of RC as determined by FITC-annexin-V staining and PARP assay. The 9D cells were incubated with mAb 4G7 for 15 min at 4°C, followed by the addition of RC or HIC. After cells were incubated overnight at 37°C, apoptotic cells were detected by staining with FITC-annexin V and propidium iodide (A and C). As further evidence for apoptosis, cells were lysed, proteins were separated using 7.5% SDS-PAGE, and caspase-cleaved product of PARP (85 kDa) was detected using HRP-rabbit anti-PARP IgG Abs (B). In the experiments shown in A and B, 2 µg/ml of mAb 4G7 was used, whereas various concentrations of mAb 4G7 were tested in the experiment shown in C. The degree of apoptosis was determined based on the apoptosis induced by Apo2L/TRAIL (2 µg/ml) as 100%. Cells treated with mAb 4G7 plus anti-Fc Abs (10 µg/ml) were included as positive controls.

 
Previously, rabbit sera were reported to contain high levels of natural Abs reacting to human tumor cells (35). The results in Fig. 2Go demonstrated that the level of apoptosis of 9D cells incubated with IgG plus RC was similar to that in cells incubated with mAb 4G7 alone. Thus, the potent apoptotic activity of mAb 4G7 in the presence of RC does not appear to be due to the presence of natural anti-tumor Abs in the RC. At present, it is not clear why RC exhibited much higher apoptosis-enhancing activity than human complement. It is possible that human tumor cell membranes express species-specific, complement inhibitory proteins that bind to human C1q; the binding of several such inhibitory proteins to other complement components has been described (31).

Anti-tumor activity of anti-DR4 mAb in a xenograft nude mouse model

The C1q level in mouse serum is in the range of 70 µg/ml (28). We therefore reasoned that murine complement could augment the agonistic activities of anti-DR4 mAbs in vivo, especially mAb 4G7 of the IgG2a isotype, bypassing the requirement for a linker. To explore this possibility, we investigated the effect of anti-DR4 mAbs on the growth of human Colo 205 tumor xenografts in athymic nude mice (Fig. 3Go). The mice were inoculated s.c. with tumor cells and treated with mAbs i.p. when tumor size reached 50–100 mm3, as previously described (21). At the end of a 2-wk treatment with 1–10 mg/kg mAb three times per week, mAb 4G7 inhibited tumor growth by 60% compared with that in the isotype-matched control (Fig. 3GoA). The maximum effective dose of mAb 4G7 was >=2.5 mg/kg (p = 0.02 compared with the IgG2a control group). Despite its weaker agonistic activity upon cross-linking with RC in vitro, mAb 4H6 (IgG1) was much more active than mAb 4G7 (IgG2a) in vivo, causing complete Colo 205 tumor regression under the same experimental protocol. Tumor regression was achieved with as little as 1.25 mg/kg of mAb 4H6 three times per week (Fig. 3GoB; p < 0.001 compared with the control group). Treatment with mAb 4H6 at 5 mg/kg once per week was as effective as three times per week treatment (Fig. 3GoC). Some tumors reappeared after administration of mAb 4H6 was stopped, suggesting that tumor cells were not completely eliminated during treatment. A similar, although less potent, anti-tumor activity of mAb 4H6 was observed with another colon carcinoma model, HCT 116 (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 3. Inhibition of human Colo 205 tumor growth in nude mice by anti-DR4 mAbs. Experiments were conducted as described previously (21 ). Female athymic nude mice (4–6 wk old, seven or eight mice per group) were injected s.c. with 5 x 106 Colo 205 cells in the dorsal areas. Once the tumor size reached 50–100 mm3, mice were grouped randomly, and mAbs were administered i.p. using 0.1 ml/injection. {blacktriangledown}, The starting date of the first mAb treatment. Tumor sizes were measured until mice had to be sacrificed due to tumor necrosis in the control group. Each group comprised seven or eight mice. Data points represent the mean ± SEM. A, Dose effect of mAb 4G7 (IgG2a) treatment on the growth of Colo 205 tumors. Various concentrations of mAbs were given three times per week. The mAb 4G7 at 2.5 mg/kg was the most effective (p = 0.028 compared with the control group). B, Dose effect of mAb 4H6 (IgG1) treatment on the growth of Colo 205 xenografts. Various concentrations of mAbs were given three times per week. There were significant tumor growth inhibitions by all doses of mAb 4H6 treatment (p < 0.001 compared with the control group). C, Effect of mAb 4H6 treatment frequency on the growth of Colo 205 xenografts. Mice were treated with 5 mg/kg of mAb one, two, and three times per week. There were significant tumor growth inhibitions at all frequencies of mAb 4H6 treatment (p < 0.001 compared with the control group).

 
These in vivo results demonstrate that anti-DR4 mAbs administered in the absence of exogenous linkers or molecular modification can be active as anti-tumor agents. In contrast to our in vitro study using complement and to previous reports of IgG2a being the most effective murine Ig isotype for anti-tumor study in mice (36, 37, 38), IgG1 mAb 4H6 was much more effective at inhibiting tumor growth in vivo than was IgG2a mAb 4G7.

Potential mechanisms of the anti-tumor activity of mAb 4H6

The differences in relative activity of mAb 4G7 and mAb 4H6 in vitro and in vivo could be due to several factors, including their different isotypes and recognition of distinct epitopes. To investigate the importance of the IgG1 isotype for anti-tumor activity of mAb 4H6, we generated a murine IgG2a isotype switch variant of this Ab using protein-engineering techniques and compared its in vitro and in vivo activities with those of the parent molecule. In vitro, the two mAb 4H6 isotypes, which had similar affinities to DR4 (Table IIGo), showed similar agonistic activity upon cross-linking with goat anti-mouse IgG (Fig. 4GoA). In contrast, in vivo, there was a significant difference in the results obtained with IgG1 and IgG2a of mAb 4H6 (p < 0.001; Fig. 4GoB). At a dose of 2.5 mg/kg twice per week, IgG1-4H6 showed 96% Colo 205 tumor growth inhibition (p < 0.001 compared with the control group), whereas IgG2a-4H6 demonstrated 23% growth inhibition (p = NS) by day 21. The anti-tumor activity of IgG2a-4G7 was very similar to that of IgG2a-4H6. Thus, at least for these anti-DR4 mAbs, the isotype is more important than the target epitope for in vivo anti-tumor activity.


View this table:
[in this window]
[in a new window]
 
Table II. Comparison of mIgG1 and mIgG2a anti-DR4 mAbs

 


View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 4. Comparison of the effects of murine Ig isotypes (IgG1 vs IgG2a) on the anti-tumor activity of mAb 4H6. The IgG2a isotype variant of the parent IgG1-4H6 was generated using Ab-engineering techniques, expressed by transfecting 293 mammalian cells transiently and purified using protein G. A, Comparison of the in vitro apoptotic activities of murine IgG1-4H6, IgG2a-4H6, and IgG2a-4G7. The apoptosis-inducing ability on Colo 205 cells by these Abs was determined in the presence of goat anti-mouse IgG-Fc Abs, and the cell viability was determined using crystal violet staining as described in Fig. 1Go. B, Comparison of the in vivo anti-tumor activities of anti-DR4 mAbs. The experiment was conducted as described in Fig. 3Go. Athymic nude mice bearing Colo 205 tumors were treated with mAbs at a dose of 2.5 mg/kg twice per week. The growth inhibitory activities of IgG2a-4H6 and IgG2a-4G7 were much weaker (p = NS compared with the control group) compared with that of IgG1-4H6 (p < 0.001 compared with the control group).

 
The growth rate of the Colo 205 tumor shown in Fig. 4GoB was much slower than that in Fig. 3GoC. The Colo 205 tumor cells used in Fig. 4GoB were in culture for a brief time, whereas the tumor cells used in Fig. 3GoC were grown in culture for a long time. We postulate that the in vitro propagation of Colo 205 tumor cells may select a population of tumor cells growing much faster in vivo.

To investigate further the importance of IgG1 isotype in the anti-tumor activity in vivo, we compared the in vitro and in vivo activities of several anti-DR4 mAbs (three IgG1 mAbs: 3G1, 4E7, and 4H6; two IgG2a mAbs: 1H5 and 4G7) that demonstrated different blocking activities (Table IIGo). In vitro, upon cross-linking with anti-IgG-Fc, all mAbs except 3G1 showed similarly strong agonistic activity on SK-MES-1 cells. In vivo, all IgG1 mAbs, 3G1, 4E7, and 4H6, demonstrated stronger anti-tumor activity than the IgG2a mAbs, 1H5 and 4G7; the ranges of tumor growth inhibition by IgG1 mAbs and IgG2a mAbs were 42–99 and 27–30%, respectively. Despite weak agonistic activity upon cross-linking in vitro, mAb 3G1 inhibited the growth of Colo 205 tumor by 42% in vivo. It should also be pointed out that mAb 1H5, which is an IgG2a isotype and binds to the overlapping epitope recognized by mAb 4H6 with a similar affinity, has a significantly lower anti-tumor activity in vivo compared with mAb 4H6 (p < 0.001). These results further support the hypothesis that mIgG1 is a much more effective isotype than mIgG2a in mediating anti-tumor activity through a death receptor, DR4.

Both IgG1 mAbs, 4H6 and 4E7, showed similarly high affinities for DR4, with Kd-1 values of 5 pM and 2 pM, respectively. However, mAb 4H6, which blocked Apo2L/TRAIL binding to DR4-IgG, demonstrated a more potent anti-tumor activity than mAb 4E7, which did not block ligand binding. The degree of the anti-tumor activity by mAb 4E7 was 76% of the activity by mAb 4H6 (Table IIGo). The anti-tumor effects of mAb 4H6 and mAb 4E7 are not statistically different (p = 0.2). Thus, these results suggest that recognition of a unique epitope that overlaps with the Apo2L/TRAIL binding site, such as in the case of mAb 4H6, is not essential for anti-tumor activity. We postulate that the receptor oligomerization by high affinity IgG1 mAbs would be sufficient to mediate the death signal, resulting in tumor growth inhibition. However, the anti-tumor activity of IgG1 mAb would be further enhanced by binding to the same or an overlapping epitope recognized by the Apo2L/TRAIL, mimicking the ligand’s agonistic activity. The potent anti-tumor activity of mAb 4H6 is thought to be due to the combination of its high affinity, the IgG1 isotype structure, and its unique binding epitope.

To gain further insight into the mechanism of anti-tumor action by mAb 4H6, we examined histological sections of Colo 205 tumors 3 days after a single i. p. injection of 5 mg/kg of mAb 4H6. We observed widespread necrosis of tumor cells in mAb 4H6-treated mice, whereas tumors from mice treated with mAb 4G7 or control mAb showed very little necrosis (Fig. 5Go). These findings suggest that mAb 4H6 exerts its anti-tumor activity through direct induction of apoptosis in tumor cells, rather than indirectly through recruiting immune effector functions. However, this requires further investigation.



View larger version (158K):
[in this window]
[in a new window]
 
FIGURE 5. Histology of Colo 205 tumors after one injection of mAb 4H6. Athymic nude mice bearing Colo 205 were treated i.p. once with 5 mg/kg of mAb 4H6 or with control IgG1 mAb 3 days before tumors were excised. The frozen tumor sections were stained with hematoxylin and eosin. Magnification: upper panel, x200; lower panel, x400.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Death receptors are potentially useful as targets in cancer therapy because they trigger apoptosis. One can activate death receptors using either the cognate ligand or an agonistic mAb, as was first shown with the Apo-1 mAb (23). For the TNF receptor superfamily, receptor trimerization seems to be the minimal unit that is required for death signaling (6, 26). Consistent with the structure of TNF and the TNF-receptor complex (26), recent crystallographic study shows that a homotrimer Apo2L molecule binds to three receptor molecules (27). In agreement with the requirement of receptor oligomerization for death signaling, our in vitro study demonstrates that anti-DR4 mAbs require oligomerization through a linker to induce apoptosis of tumor cells. Similar in vitro studies with anti-DR4 mAbs were reported by Griffith et al. (39). Our study shows that anti-Fc Abs or complement could link anti-DR4 Ab molecules to enhance the apoptotic activity. In contrast to the in vitro requirement of a linker, some of the anti-DR4 mAbs, particularly mAb 4H6 of mIgG1 isotype, showed strong anti-tumor efficacy in vivo without the addition of exogenous linkers.

An important question is how mAb 4H6, administered without exogenous cross-linking agents, induces potent anti-tumor activity in vivo, considering that trimerization of death receptors is required for signaling. It is possible that oligomerization of mAb 4H6 in vivo may occur through some endogenous mechanisms. Possible mechanisms include interaction of the Fc portions of mAbs with FcR on effector cells or with complement, or interaction through spontaneous Fc-Fc self aggregation. However, we have ruled out these mechanisms as potential major mechanisms for the reasons discussed below. It has been well documented that mIgG2a isotype is much more effective than mIgG1 in mediating Fc-mediated functions, such as Ab-dependent cell-mediated cytotoxicity (36, 37, 38) and complement-dependent cytotoxicity (33, 34). In fact, most IgG1 Abs do not activate complement, as shown with mAb 4H6 of mIgG1 isotype (Fig. 1Go). If the interaction of the Fc region of Ab molecules with FcR on effector cells or with complement plays a major role in the anti-tumor activity of anti-DR4 mAbs, mIgG2a anti-DR4 mAbs should induce stronger anti-tumor activity than mIgG1 anti-DR4 mAbs. However, our in vivo studies (Figs. 3Go and 4Go) show that the mIgG1 mAb 4H6 has much more potent anti-tumor activity in vivo than the mIgG2a isotype variant of 4H6 and IgG2a mAb 4G7, which have similar agonistic activities in vitro. A similar IgG1 isotype preference was observed when we compared several IgG1 and IgG2 anti-DR4 mAbs in vivo (Table IIGo). Thus, we conclude that neither Ab-dependent cell-mediated cytotoxicity nor complement-dependent cytotoxicity may play a major role in inducing the potent anti-tumor activity of mAb 4H6. In addition, mAb 4H6 molecules are unlikely to be self aggregated in vivo, because mIgG1 is known to be relatively rigid in structure (40). We postulate that, in vivo, mAb 4H6 may induce the death signal by oligomerizing DR4 receptors, which might be overexpressed and therefore preassociated, as shown with TNF receptors (41) and Apo-1 (Fas) molecules (42). This hypothesis needs to be further investigated.

The comparison of several anti-DR4 mAbs that do or do not block ligand binding to DR4 suggested that binding to a unique epitope is not a prerequisite for the in vivo anti-tumor activity. Nonetheless, recognition of an epitope that coincides with the ligand binding site on DR4 appeared to enhance anti-tumor activity. The mAb 4H6 is a blocking mAb as determined by the ligand receptor binding ELISA. Thus, the potent anti-tumor activity of mAb 4H6 may be a combination of the mIgG1 isotypic structure of this mAb and its ability to bind the same or an overlapping epitope recognized by Apo2L/TRAIL, mimicking the ligand’s agonistic activity.

From a therapeutic point of view, the main potential advantage of anti-DR4 mAbs over Apo2L/TRAIL is the relatively long pharmacologic half-lives of these Abs, which may enable less frequent administration to achieve similar efficacy. We have found that normal human umbilical cord vascular endothelial cells and microvascular endothelial cells, which express DR4, do not undergo significant apoptosis when exposed to cross-linked anti-DR4 mAbs in vitro (data not shown). This is consistent with the finding that soluble recombinant Apo2L/TRAIL did not show any significant side effects in rodents or nonhuman primates (9, 10). Recently, Jo et al. (43) reported that the His-TRAIL/Apo2L molecule induced a significant level of apoptosis in normal human hepatocytes in vitro, raising the possibility of hepatocyte toxicity in vivo. Thus, the potential side effects of these mAbs as anti-cancer therapeutic agents need to be further investigated.

In conclusion, we have demonstrated that anti-DR4 mAbs have potent activity in a colon tumor xenograft model. We also have shown that at least for the in vivo anti-tumor efficacy of anti-DR4 mAbs, mIgG1 is superior to mIgG2 even when they have similar binding affinities. Although cross-linking of mAbs is required for in vitro apoptosis, it is not clear from our study whether cross-linking is also required for in vivo activity. The main mechanism of action of anti-DR4 mAbs appeared to be direct induction of tumor cell apoptosis rather than immune-mediated effector cell recruitment.

In summary, our findings should help to guide the choice of individual mAbs to DR5 and other death receptors for further in vivo efficacy and safety studies in cancer.


    Acknowledgments
 
We thank R. Pai for the supply of Apo2L/TRAIL, L. Presta and I. Grewal for their critical comments, William Forrest for the statistical analysis, A. Bruce for the graphics, and A. Mironov for editorial assistance.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. K. Jin Kim, Department of Antibody Technology, Genentech, 1 DNA Way, South San Francisco, CA 94080. Back

2 Abbreviations used in this paper: TRAIL, TNF-related apoptosis-inducing ligand; DR4, death receptor 4; PARP, poly(ADP-ribose) polymerase; RC, rabbit complement; mIg, murine Ig; HIC, heat-inactivated RC. Back

Received for publication September 5, 2000. Accepted for publication February 14, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cosman, D.. 1994. A family of ligands for the TNF receptor superfamily. Stem Cells 12:440.[Abstract]
  2. Nagata, S.. 1997. Apoptosis by death factor. Cell 88:355.[Medline]
  3. Smith, C., T. Farrah, R. Goodwin. 1994. The TNF receptor superfamily of cellular and viral proteins: activation, costimulation, and death. Cell 76:959.[Medline]
  4. Pitti, R., S. Marsters, S. Ruppert, C. Donahue, A. Moore, A. Ashkenazi. 1996. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor receptor family. J. Biol. Chem. 271:12687.[Abstract/Free Full Text]
  5. Wiley, S., K. Schooley, P. Smolak, W. Din, C. Huang, J. Nicholl, G. Sutherland, T. Smith, C. Rauch, C. A. Smith, R. Goodwin. 1995. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity 3:673.[Medline]
  6. Ashkenazi, A., V. Dixit. 1998. Death receptors: signaling and modulation. Science 281:1305.[Abstract/Free Full Text]
  7. Emery, J., P. McDonnell, M. Burke, K. Deen, S. Lyn, C. Silverman, E. Dul, E. Appelbaum, C. Eichman, R. DiPrinzio, et al 1998. Osteoprotegerin is a receptor for the cytotoxic ligand TRAIL. J. Biol. Chem. 273:14363.[Abstract/Free Full Text]
  8. Griffith, T., C. Rauch, P. Smolak, J. Waugh, N. Boiani, D. Lynch, C. Smith, R. Goodwin, M. Kubin. 1999. Functional analysis of TRAIL receptors using monoclonal antibodies. J. Immunol. 162:2597.[Abstract/Free Full Text]
  9. Ashkenazi, A., R. Pai, S. Fong, S. Leung, D. Lawrence, S. Marsters, C. Blackie, L. Chang, A. McMurtrey, A. Hebert, et al 1999. Safety and antitumor activity of recombinant soluble Apo2 ligand. J. Clin. Invest. 104:155.[Medline]
  10. Walczak, H., R. Miller, K. Ariail, B. Gliniak, T. Griffith, M. Kubin, W. Chin, J. Jones, A. Woodward, T. Le, et al 1999. Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo. Nat. Med. 5:157.[Medline]
  11. Tanaka, M., T. Suda, T. Yatomi, N. Nakamura, S. Nagata. 1997. Lethal effect of recombinant human Fas ligand in mice pretreated with Propionibacterium acnes. J. Immunol. 158:2303.[Abstract]
  12. Brouckaert, P., G. Leroux-Roels, Y. Guisez, J. Tavernier, W. Fiers. 1986. In vivo anti-tumour activity of recombinant human and murine TNF, alone and in combination with murine IFN-{gamma}, on a syngeneic murine melanoma. Int. J. Cancer 38:763.[Medline]
  13. Havell, E., W. Fiers, R. North. 1988. The antitumor function of tumor necrosis factor (TNF). I. Therapeutic action of TNF against an established murine sarcoma is indirect, immunologically dependent, and limited by severe toxicity. J. Exp. Med. 167:1067.[Abstract/Free Full Text]
  14. Pan, G., K. O’Rourke, A. Chinnaiyan, R. Gentz, R. Ebner, J. Ni, V. Dixit. 1997. The receptor for the cytotoxic ligand TRAIL. Science 276:111.[Abstract/Free Full Text]
  15. Chuntharapai, A., K. Kim. 1997. Generation of monoclonal antibodies to chemokine receptors. Methods Enzymol. 288:15.[Medline]
  16. Lu, J., A. Chuntharapai, J. Beck, S. Bass, A. Ow, A. De Vos, V. Gibbs, J. Kim. 1998. Structure-function study of the extracellular domain of the human IFN-{alpha} receptor (hIFNAR1) using blocking monoclonal antibodies: the role of domains 1 and 2. J. Immunol. 160:1782.[Abstract/Free Full Text]
  17. Chuntharapai, A., V. Gibbs, J. Lu, A. Ow, S. Marsters, A. Ashkenazi, A. De Vos, K. Kim. 1999. Determination of residues involved in ligand binding and signal transmission in the human IFN-{alpha} receptor 2. J. Immunol. 163:766.[Abstract/Free Full Text]
  18. Flick, D., G. Gifford. 1984. Comparison of in vitro cell cytotoxic assays for tumor necrosis factor. J. Immunol. Methods 68:167.[Medline]
  19. Whitacre, C., N. Berger. 1997. Factors affecting topotecan-induced programmed cell death: adhesion protects cells from apoptosis and impairs cleavage of poly (ADP-ribose) polymerase. Cancer Res. 57:2157.[Abstract/Free Full Text]
  20. Carter, P., L. Presta, C. Gorman, J. Ridgway, D. Henner, W. Wong, A. Rowland, C. Kotts, M. Carver, H. Shepard. 1992. Humanization of an anti-p185HER2 antibody for human cancer therapy. Proc. Natl. Acad. Sci. USA 89:4285.[Abstract/Free Full Text]
  21. Kim, K., B. Li, J. Winer, M. Armanini, N. Gillett, H. Phillips, N. Ferrara. 1993. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature 362:841.[Medline]
  22. Yonehara, S., A. Ishii, M. Yonehara. 1989. A cell-killing monoclonal antibody (anti-Fas) to a cell surface antigen co-down regulated with the receptor of tumor necrosis factor. J. Exp. Med. 169:1747.[Abstract/Free Full Text]
  23. Trauth, B., C. Klas, A. Peters, S. Matzku, P. Moller, W. Falk, K. Debatin, P. Krammer. 1989. Monoclonal antibody-mediated tumor regression by induction of apoptosis. Science 245:301.[Abstract/Free Full Text]
  24. Dhein, J., P. Daniel, B. Trauth, A. Oehm, P. Moller, P. Krammer. 1992. Induction of apoptosis by monoclonal antibody anti-Apo-1 class switch variants is dependent on cross-linking of Apo-1 cell surface antigens. J. Immunol. 149:3166.[Abstract]
  25. Ogasawara, J., R. Watanabe-Fukunaga, M. Adachi, A. Matsuzawa, T. Kasugai, Y. Kitamura, N. Itoh, T. Suda, S. Nagata. 1993. Lethal effect of the anti-Fas antibody in mice. Nature 364:806.[Medline]
  26. Banner, D., A. D’Arcy, W. Janes, R. Gentz, H.-J. Schoenfeld, C. Broger, H. Loetscher, W. Lesslauer. 1993. Crystal structure of the soluble human 55 kd TNF receptor-human TNF-{alpha} complex: implications for TNF receptor activation. Cell 73:431.[Medline]
  27. Hymowitz, S., H. Christinger, G. Fuh, M. Ultsch, M. O’Connell, R. Kelly, A. Ashkenazi, A. de Vos. 1999. Triggering cell death: the crystal structure of Apo2L/TRAIL in a complex with death receptor 5. Mol. Cell 4:1.[Medline]
  28. Brown, E., K. Joiner, M. Frank. 1984. Complement. W. Paul, ed. Fundamental Immunology 645. Raven Press, New York.
  29. Daha, M., A. Miltenburg, P. Hiemstra, N. Klar-Mohamad, L. Van Es, V. Van Hinsbergh. 1988. The complement subcomponent C1q mediates binding of immune complexes and aggregates to endothelial cells in vitro. Eur. J. Immunol. 18:783.[Medline]
  30. Sato, T., M. Van Dixhoorn, E. Heemskerk, L. Van Es, M. Daha. 1997. C1q, a subunit of the first component of complement, enhances antibody-mediated apoptosis of cultured rat glomerular mesangial cells. Clin. Exp. Immunol. 109:510.[Medline]
  31. Davies, A., D. Simmons, G. Hale, R. Harrison, H. Tighe, J. Lachmann, H. Waldmann. 1989. CD59, an Ly-6-like protein expressed in human lymphoid cells, regulates the action of the complement membrane attack complex on homologous cells. J. Exp. Med. 170:637.[Abstract/Free Full Text]
  32. Ong, G., R. Shah, M. Mattes. 1996. Rabbit complement lyses tumor cells without massive C3 deposition. Immunol. Invest. 25:215.[Medline]
  33. Neuberger, M., K. Rajewsky. 1981. Activation of mouse complement by monoclonal mouse antibodies. Eur. J. Immunol. 11:1012.[Medline]
  34. Stewart, W., A. Johnson, M. Steward, K. Whaley, M. Kerr. 1988. The activation of C3 and C4 in human serum by immune complexes containing mouse monoclonal antibodies of different isotype and affinity: effects of solubilisation. Mol. Immunol. 25:1355.[Medline]
  35. Ferrone, S., M. Pellegrino, R. Reisfeld. 1971. The lymphocytotoxic reaction: the mechanism of rabbit complement action. J. Immunol. 107:939.[Abstract/Free Full Text]
  36. Vitetta, E., J. Uhr. 1994. Monoclonal antibodies as agonists: an expanded role for their use in cancer therapy. Cancer Res. 54:5301.[Free Full Text]
  37. Ward, E., V. Ghetie. 1995. The effector functions of immunoglobulins: implications for therapy. Ther. Immunol. 2:77.[Medline]
  38. Cragg, M., R. French, M. Glennie. 1999. Signaling antibodies in cancer therapy. Curr. Opin. Immunol. 11:541.[Medline]
  39. Griffith, T., W. Chin, G. Jackson, D. Lynch, M. Kubin. 1998. Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J. Immunol. 161:2833.[Abstract/Free Full Text]
  40. Oi, V., T. Vuong, R. Hardy, J. Reidler, L. Herzenberg, L. Stryer. 1984. Correlation between segmental flexibility and effector function of antibodies. Nature 307:136.[Medline]
  41. Chan, F. K., H. J. Chun, L. Zheng, R. M. Siegel, K. L. Bui, M. J. Lenardo. 2000. A domain in TNF receptors that mediates ligand-independent receptor assembly and signaling. Science 288:2351.[Abstract/Free Full Text]
  42. Siegel, R., J. Frederiksen, D. Zacharias, F. K.-M. Chan, M. Johnson, D. Lynch, R. Tsien, M. Lenardo. 2000. Fas preassociation required for apoptosis signaling and dominant inhibition by pathogenic mutations. Science 288:2354.[Abstract/Free Full Text]
  43. Jo, M., T.-H. Kim, D.-W. Seol, J. Esplen, K. Dorko, T. R. Billiar, S. Strom. 2000. Apoptosis induced in normal human hepatocytes by tumor necrosis factor-related apoptosis-inducing ligand. Nat. Med. 6:564.[Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
X.-X. Wu and Y. Kakehi
Enhancement of Lexatumumab-Induced Apoptosis in Human Solid Cancer Cells by Cisplatin in Caspase-Dependent Manner
Clin. Cancer Res., March 15, 2009; 15(6): 2039 - 2047.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Jin, R. Yang, J. Ross, S. Fong, R. Carano, K. Totpal, D. Lawrence, Z. Zheng, H. Koeppen, H. Stern, et al.
Cooperation of the Agonistic DR5 Antibody Apomab with Chemotherapy to Inhibit Orthotopic Lung Tumor Growth and Improve Survival
Clin. Cancer Res., December 1, 2008; 14(23): 7733 - 7740.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Takeda, Y. Kojima, K. Ikejima, K. Harada, S. Yamashina, K. Okumura, T. Aoyama, S. Frese, H. Ikeda, N. M. Haynes, et al.
Death receptor 5 mediated-apoptosis contributes to cholestatic liver disease
PNAS, August 5, 2008; 105(31): 10895 - 10900.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Ashkenazi, P. Holland, and S. G. Eckhardt
Ligand-Based Targeting of Apoptosis in Cancer: The Potential of Recombinant Human Apoptosis Ligand 2/Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (rhApo2L/TRAIL)
J. Clin. Oncol., July 20, 2008; 26(21): 3621 - 3630.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Tur, A. M. van der Sloot, C. R. Reis, E. Szegezdi, R. H. Cool, A. Samali, L. Serrano, and W. J. Quax
DR4-selective Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) Variants Obtained by Structure-based Design
J. Biol. Chem., July 18, 2008; 283(29): 20560 - 20568.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Contassot, K. Kerl, S. Roques, R. Shane, O. Gaide, M. Dupuis, A. H. Rook, and L. E. French
Resistance to FasL and tumor necrosis factor-related apoptosis-inducing ligand-mediated apoptosis in Sezary syndrome T-cells associated with impaired death receptor and FLICE-inhibitory protein expression
Blood, May 1, 2008; 111(9): 4780 - 4787.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. G. Oliver, A. F. LoBuglio, K. R. Zinn, H. Kim, L. Nan, T. Zhou, W. Wang, and D. J. Buchsbaum
Treatment of Human Colon Cancer Xenografts with TRA-8 Anti-death Receptor 5 Antibody Alone or in Combination with CPT-11
Clin. Cancer Res., April 1, 2008; 14(7): 2180 - 2189.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Bin, J. Thorburn, L. R. Thomas, P. E. Clark, R. Humphreys, and A. Thorburn
Tumor-derived Mutations in the TRAIL Receptor DR5 Inhibit TRAIL Signaling through the DR4 Receptor by Competing for Ligand Binding
J. Biol. Chem., September 21, 2007; 282(38): 28189 - 28194.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. C. DeRosier, D. J. Buchsbaum, P. G. Oliver, Z.-Q. Huang, J. C. Sellers, W. E. Grizzle, W. Wang, T. Zhou, K. R. Zinn, J. W. Long, et al.
Combination Treatment with TRA-8 Anti Death Receptor 5 Antibody and CPT-11 Induces Tumor Regression in an Orthotopic Model of Pancreatic Cancer
Clin. Cancer Res., September 15, 2007; 13(18): 5535s - 5543s.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Lukashev, D. LePage, C. Wilson, V. Bailly, E. Garber, A. Lukashin, A. Ngam-ek, W. Zeng, N. Allaire, S. Perrin, et al.
Targeting the Lymphotoxin-{beta} Receptor with Agonist Antibodies as a Potential Cancer Therapy
Cancer Res., October 1, 2006; 66(19): 9617 - 9624.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. Cheng, B. L. Hylander, M. R. Baer, X. Chen, and E. A. Repasky
Multiple mechanisms underlie resistance of leukemia cells to Apo2 Ligand/TRAIL.
Mol. Cancer Ther., July 1, 2006; 5(7): 1844 - 1853.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. M. McCarthy, K. A. DiVito, M. Sznol, D. Kovacs, R. Halaban, A. J. Berger, K. T. Flaherty, R. L. Camp, R. Lazova, D. L. Rimm, et al.
Expression of tumor necrosis factor-related apoptosis-inducing ligand receptors 1 and 2 in melanoma.
Clin. Cancer Res., June 15, 2006; 12(12): 3856 - 3863.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. M. van der Sloot, V. Tur, E. Szegezdi, M. M. Mullally, R. H. Cool, A. Samali, L. Serrano, and W. J. Quax
Designed tumor necrosis factor-related apoptosis-inducing ligand variants initiating apoptosis exclusively via the DR5 receptor
PNAS, June 6, 2006; 103(23): 8634 - 8639.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. J. Smyth, Y. Hayakawa, E. Cretney, N. Zerafa, P. Sivakumar, H. Yagita, and K. Takeda
IL-21 Enhances Tumor-Specific CTL Induction by Anti-DR5 Antibody Therapy
J. Immunol., May 15, 2006; 176(10): 6347 - 6355.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
M. S. Ricci and W.-X. Zong
Chemotherapeutic approaches for targeting cell death pathways.
Oncologist, April 1, 2006; 11(4): 342 - 357.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Guo, C. Chen, Y. Zheng, J. Zhang, X. Tao, S. Liu, D. Zheng, and Y. Liu
A Novel Anti-human DR5 Monoclonal Antibody with Tumoricidal Activity Induces Caspase-dependent and Caspase-independent Cell Death
J. Biol. Chem., December 23, 2005; 280(51): 41940 - 41952.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. Horak, D. Pils, A. Kaider, A. Pinter, K. Elandt, C. Sax, C. C. Zielinski, R. Horvat, R. Zeillinger, A. Reinthaller, et al.
Perturbation of the Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Cascade in Ovarian Cancer: Overexpression of FLIPL and Deregulation of the Functional Receptors DR4 and DR5
Clin. Cancer Res., December 15, 2005; 11(24): 8585 - 8591.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Clancy, K. Mruk, K. Archer, M. Woelfel, J. Mongkolsapaya, G. Screaton, M. J. Lenardo, and F. K.-M. Chan
Preligand assembly domain-mediated ligand-independent association between TRAIL receptor 4 (TR4) and TR2 regulates TRAIL-induced apoptosis
PNAS, December 13, 2005; 102(50): 18099 - 18104.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. M. McCarthy, M. Sznol, K. A. DiVito, R. L. Camp, D. L. Rimm, and H. M. Kluger
Evaluating the Expression and Prognostic Value of TRAIL-R1 and TRAIL-R2 in Breast Cancer
Clin. Cancer Res., July 15, 2005; 11(14): 5188 - 5194.
[Abstract] [Full Text] [PDF]


Home page
CA Cancer J ClinHome page
I. M. Ghobrial, T. E. Witzig, and A. A. Adjei
Targeting Apoptosis Pathways in Cancer Therapy
CA Cancer J Clin, May 1, 2005; 55(3): 178 - 194.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Motoki, E. Mori, A. Matsumoto, M. Thomas, T. Tomura, R. Humphreys, V. Albert, M. Muto, H. Yoshida, M. Aoki, et al.
Enhanced Apoptosis and Tumor Regression Induced by a Direct Agonist Antibody to Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Receptor 2
Clin. Cancer Res., April 15, 2005; 11(8): 3126 - 3135.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. S. Hauptschein, K. E. Sloan, C. Torella, R. Moezzifard, M. Giel-Moloney, C. Zehetmeier, C. Unger, L. L. Ilag, and D. G. Jay
Functional Proteomic Screen Identifies a Modulating Role for CD44 in Death Receptor-Mediated Apoptosis
Cancer Res., March 1, 2005; 65(5): 1887 - 1896.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. F. Kelley, K. Totpal, S. H. Lindstrom, M. Mathieu, K. Billeci, L. DeForge, R. Pai, S. G. Hymowitz, and A. Ashkenazi
Receptor-selective Mutants of Apoptosis-inducing Ligand 2/Tumor Necrosis Factor-related Apoptosis-inducing Ligand Reveal a Greater Contribution of Death Receptor (DR) 5 than DR4 to Apoptosis Signaling
J. Biol. Chem., January 21, 2005; 280(3): 2205 - 2212.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. Takeda, N. Yamaguchi, H. Akiba, Y. Kojima, Y. Hayakawa, J. E. Tanner, T. J. Sayers, N. Seki, K. Okumura, H. Yagita, et al.
Induction of Tumor-specific T Cell Immunity by Anti-DR5 Antibody Therapy
J. Exp. Med., February 17, 2004; 199(4): 437 - 448.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Fulda and K.-M. Debatin
Sensitization for Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Induced Apoptosis by the Chemopreventive Agent Resveratrol
Cancer Res., January 1, 2004; 64(1): 337 - 346.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. J. Buchsbaum, T. Zhou, W. E. Grizzle, P. G. Oliver, C. J. Hammond, S. Zhang, M. Carpenter, and A. F. LoBuglio
Antitumor Efficacy of TRA-8 Anti-DR5 Monoclonal Antibody Alone or in Combination with Chemotherapy and/or Radiation Therapy in a Human Breast Cancer Model
Clin. Cancer Res., September 1, 2003; 9(10): 3731 - 3741.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Xu, A. J. Szalai, T. Zhou, K. R. Zinn, T. R. Chaudhuri, X. Li, W. J. Koopman, and R. P. Kimberly
Fc{gamma}Rs Modulate Cytotoxicity of Anti-Fas Antibodies: Implications for Agonistic Antibody-Based Therapeutics
J. Immunol., July 15, 2003; 171(2): 562 - 568.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Washburn, M. A. Weigand, A. Grosse-Wilde, M. Janke, H. Stahl, E. Rieser, M. R. Sprick, V. Schirrmacher, and H. Walczak
TNF-Related Apoptosis-Inducing Ligand Mediates Tumoricidal Activity of Human Monocytes Stimulated by Newcastle Disease Virus
J. Immunol., February 15, 2003; 170(4): 1814 - 1821.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Nakayama, K. Ishidoh, Y. Kojima, N. Harada, E. Kominami, K. Okumura, and H. Yagita
Fibroblast Growth Factor-Inducible 14 Mediates Multiple Pathways of TWEAK-Induced Cell Death
J. Immunol., January 1, 2003; 170(1): 341 - 348.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chuntharapai, A.
Right arrow Articles by Kim, K. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chuntharapai, A.
Right arrow Articles by Kim, K. J.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS