| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Departments of
*
Antibody Technology,
Cell Biology and Technology,
Molecular Oncology, and
Pathology, Genentech, South San Francisco, CA 94080
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Soluble Apo2L/TRAIL induces apoptosis of many tumor cell lines (4, 5, 8) in vitro. Apo2L/TRAIL exhibits potent anti-tumor activity in nude mouse models of human colon and breast carcinomas (9, 10). In contrast to other apoptosis-inducing family members such as TNF and CD95 ligand (11, 12, 13), Apo2L/TRAIL did not show significant toxicity to normal tissues in pilot studies in vivo in cynomolgus monkeys and mice (9, 10). Given the established clinical efficacy of mAbs to receptor targets such as HER2/neu or CD20 in cancer treatment, we examined whether mAbs directed to DR4, one of the signaling receptors for Apo2L/TRAIL, have therapeutic potential for cancer.
In this study, we report that mAbs to DR4, which induce apoptosis activities upon cross-linking in vitro, demonstrate potent anti-tumor activities without addition of exogenous linkers in vivo. Furthermore, we report that murine IgG1 appears to be a much more effective Ig isotype than murine IgG2a in demonstrating anti-tumor activities through DR4 in xenograft nude mouse models.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c mice were immunized 11 times with 0.5 µg of human DR4-IgG (14) resuspended in monophosphoryl lipid A/trehalose dicorynomycolate adjuvant (Ribi Immunochemicals, Hamilton, MT) into each hind foot pad at 3- to 4-day intervals. Three days after the final boost, popliteal lymph nodes were fused with myeloma cell line P3x63Ag.U.1 (15). Culture supernatants were initially screened for their ability to bind to hDR4-IgG but not to CD4-IgG in a capture ELISA as described previously (15). The selected mAbs were further tested for their ability to block ligand-receptor binding in a capture ELISA (16) and for their ability to recognize cell membrane receptors on 9D cells by flow cytometric analysis as described previously (16). After cloning the selected final hybridomas twice, their Ag specificity as well as their ability to induce apoptosis were determined.
To determine whether mAbs recognized overlapping or spatially distant epitopes, a competitive binding ELISA was performed using biotinylated mAbs as previously described (16). The affinities of these mAbs to DR4-IgG were determined using KinExA, an automated immunoassay system (Sapidyne Instruments, Boise, ID) as previously described (17), and the equilibrium constant was calculated using the software provided by the manufacturer.
Capture ELISA
The binding of mAbs to DR4 was initially determined using a capture ELISA as previously described (16). Briefly, microtiter plates were coated with 50 µl/well of 2 µg/ml of goat Abs specific to the Fc portion of human IgG (Cappel; ICN Pharmaceuticals, Costa Mesa, CA). After washing the plates, nonspecific binding sites were blocked with BSA, and 50 µl/well of 0.4 µg/ml of DR4-IgG was added to wells for 1 h. Plates were then incubated with 50 µl/well of 2 µg/ml of anti-DR4 mAbs (or hybridoma culture supernatants) for 1 h. The bound mAbs were then detected with 50 µl/well of HRP-goat anti-mouse IgG (Cappel), followed by addition of the substrate. Plates were then read at 490 nM with an ELISA plate reader.
Determination of blocking activities
Blocking activities of mAbs were determined in a capture ELISA as described above with a modification. Briefly, DR4-hIgG Fc was captured to goat anti-human IgG Fc Abs, and various concentrations of anti-DR4 mAbs were added. After washing 50 µl of 0.2 µg/ml of Apo2L was added. The Apo2L bound to DR4-IgG was detected by the addition of 50 µl of 1 µg/ml of biotinylated anti-Apo2L mAb 2E9, followed by the addition of HRP-goat anti-mouse IgG.
Determination of cell viability using crystal violet uptake
Adherent cells (4 x 104 cells/100 µl/well) were incubated overnight with serial dilutions of mAbs with or without goat anti-mouse IgG Fc (10 µg/ml) or rabbit complement (RC; Cedarlane Laboratories, Ontario, Canada; final 1/8 dilution). Heat-inactivated rabbit complement was prepared by incubation of rabbit serum at 56°C for 30 min. Serial dilutions of Apo2L/TRAIL (9) prepared in a final volume of 100 µl were added to each plate as a positive control. Each dilution was performed in duplicate. After incubation overnight at 37°C, the medium was removed, and viable cells were stained using crystal violet as previously described (18). The plates were read on an ELISA plate reader at 540 nM.
Flow cytometric analysis of FITC-annexin V binding
Human B lymphoid 9D cells (5 x 105 cells in 100 µl of complete RPMI 1640 medium) were plated in 48-well microplates and were incubated with 100 µl of mAb solution (10 µg/ml) for 15 min on ice. Complete RPMI 1640 medium (2 ml) plus 300 µl of RC (Microbiological Associates, Cedarlane, MD), human complement (Sigma, St. Louis, MO), or human C1q (80 µg/ml; Quidel, San Diego, CA) were added to the wells. After an overnight incubation at 37°C in 5% CO2, cells were washed in PBS and resuspended in 200 µl of binding buffer (NeXins Research, Hoeven, The Netherlands). The cells were then incubated with 10 µl of 20 µg/ml FITC-annexin V (APOPTEST-FITC; NeXins Research) plus 10 µl of 50 µg/ml propidium iodide in the dark for 15 min at room temperature, washed, and analyzed by flow cytometry.
Poly(ADP-ribose) polymerase (PARP) assay
PARP assay was performed as previously described (19). PARP was detected using HRP-rabbit anti-PARP IgG Abs (BD Biosciences, San Diego, CA). Human B lymphoid 9D cells (5 x 105 cells in 100 µl of complete medium) were treated with 100 µl of mAb solution (10 µg/ml) with or without complement as described above. The cells were harvested and washed in Tris-HCl buffer (50 mM Tris-HCl (pH 7.5), 0.15 M NaCl, 1 mM CaCl2, and 1 mM MgCl2) by microcentrifugation. The cells were then lysed in a solution containing 0.5% sodium deoxycholate, 1% Triton X-100, 5 mM EDTA, 10 µg/ml leupeptin, 10 µg/ml aprotinin, and 1 mM PMSF and mixed with an equal volume of 2x SDS buffer. After boiling, proteins were separated on 7.5% SDS-PAGE and transferred to immunoblot polyvinylidene difluoride membranes. The separated intact and cleaved polymerases were detected using HRP-rabbit anti-PARP IgG Abs (Roche, Indianapolis, IN). Bound rabbit anti-PARP IgG Abs were detected using HRP-goat anti-rabbit IgG Abs followed by the ECL detection method (15).
Generation of IgG2a isotype variant of IgG1-4H6 using Ab engineering technique
To determine the influence of different murine IgG isotypes on the anti-tumor activities of anti-DR4 mAbs, the VH and VL genes were isolated by PCR amplification of mRNA from the corresponding mAb 4H6 hybridoma as previously described (20) using Taq polymerase. N-terminal amino acid sequences of mAb 4H6 (IgG1) of the light and heavy chains were used to design the sense strand PCR primers, whereas the antisense PCR primers were based on consensus sequences of murine framework 4 of each chain. The 3' light and heavy chain primers were TGCAGCCACGGWCCGWKT AKYTCCARYTTKGTSSC and GACCGATGGGCCCGTCGTTTTGGCTGM RGARACNGTGAS (W = A/T, K = G/T, B = G/T/C, Y = C/T, R = A/G, S = G/C, M = A/C, N = A/G/T/C), respectively. The 5' light and heavy chain primers were GCTACAAATGCATACGCTGATATCCAGATGACACAG and GCTACAAACGCGTACGCTCAGGTGCAGCTGAAGGAG, respectively. Amplified DNA fragments were digested with restriction enzymes Nsi and RsrII for light chain and with MluI and ApaI for heavy chain. The variable domain cDNAs of light and heavy chains were separately assembled with the murine Ck and IgG2 CH1-CH2-CH3 domains in plasmid expression vectors. The light chain and heavy chain cDNA vectors were cotransfected into 293 cells for 7 days. Media were harvested, and the secreted IgG2a-4H6 was recovered by affinity purification using protein G.
In vivo analysis of anti-tumor activity
Experiments were conducted essentially as described previously (21). Colo 205 tumor cells were grown in DMEM/F-12 (50/50) medium supplemented with 10% FCS, 2 mM L-glutamine, and antibiotics. Female athymic nude mice (4–6 wk old, seven or eight mice per group) were injected s.c. with 5 x 106 Colo 205 cells in 0.2 ml of HBBS in the dorsal areas. Once tumors reached 50–100 mm3, the mice were grouped randomly, and mAbs were given i.p. in a volume of 0.1 ml. Arrows in figures indicate the starting date of the first mAb treatment. Tumor sizes were determined until mice had to be sacrificed due to tumor necrosis in the control group. All experiments were performed in compliance with the laws and regulations stated in the animal welfare act and the Guide for the Care and Use of Laboratory Animals. Statistical analysis was performed using the nonparametric Wilcoxon test.
Histology
Athymic nude mice bearing Colo 205 xenografts were treated i.p. with 5 mg/kg of anti-DR4 mAbs or IgG1 control mAb 3 days before tumors were excised. Three mice were used for each treatment. The frozen tumor sections were stained with hematoxylin and eosin and examined under the microscope.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Murine mAbs to the CD95 death receptor, anti-Fas (22) and anti-Apo-1 (23, 24), show potent anti-tumor activity. The anti-Fas mAb is a murine IgM, whereas the anti-Apo-1 mAb is a murine IgG3 isotype that tends to aggregate. The multivalency of IgM and aggregated IgG3 may facilitate the oligomerization of CD95, thereby inducing apoptosis of tumor cells. However, these mAbs induce lethal liver toxicity in vivo, which limits their therapeutic potential (25).
To obtain agonistic anti-DR4 mAbs, we immunized mice with a soluble
DR4-Fc fusion protein as previously described (16). We
screened for IgM and IgG3 mAbs as well as for agonistic activity
on human B lymphoma 9D cells, which express DR4 and DR5 (data not
shown). None of our DR4-specific mAbs was of the IgM or IgG3 isotype.
Some of the mAbs demonstrated weak intrinsic agonistic activity; in the
presence of a cross-linking agent such as goat anti-mouse IgG, the
agonistic activity was dramatically enhanced. For further studies we
selected two anti-DR4 mAbs on the basis of Ig isotype and ability
to block Apo2L/TRAIL activity. mAb 4H6 is an IgG1 and exhibits blocking
activity, whereas mAb 4G7 is an IgG2a without blocking activity (Table I
). Both mAbs demonstrated high
affinities to DR4, with Kd-1 values in the range of 5–20 pM,
as determined by a KinExA solution phase assay (Sapidyne
Instruments) (Table I).
|
). The mAb 4H6 alone demonstrated weak
cytotoxic activity on Colo 205, whereas mAb 4G7 alone showed no
cytotoxic activity (Fig. 1A). However, in the presence of
goat anti-mouse IgG-Fc, which can oligomerize murine IgG
molecules, both mAbs demonstrated potent agonistic activities on Colo
205 cells (Fig. 1B). Similar observations were made with
other human tumor cell lines that express DR4, such as HCT116 colon
carcinoma and SK-MES-1 lung carcinoma, but not with normal human
microvascular and vascular endothelial cells, which also express DR4
(data not shown).
|
Because complement is known to function in a species-nonspecific
manner, and RC is a very effective source of complement (31, 32), we tested the Ab cross-linking ability of commercially
available RC. We incubated tumor cells with anti-DR4 mAbs for 30
min and then added complement-containing rabbit serum for an overnight
incubation. RC enhanced the agonistic activity of IgG2a mAb 4G7, but
not that of IgG1 mAb 4H6 (Fig. 1
C), as expected from a
previous reports (33, 34) that murine IgG2 (mIgG2) is much
more effective than mIgG1 in complement activation. In fact, most
murine IgG1 Abs do not activate complement, as shown with mAb 4H6. The
agonistic activity of mAb 4G7 was abolished when the rabbit serum was
heat inactivated (Fig. 1D), confirming that complement
present in the rabbit serum was responsible for linking mAb 4G7.
Because these experiments were performed using heterologous RC, we
cannot completely rule out the possibility that homologous murine
complement oligomerizes mAb 4H6 molecules. We attempted to address this
question using mouse sera as a source of homologous complement. Because
no good commercial source of mouse complement was available, we pooled
fresh sera from several nude mice to use as a source of mouse
complement in our experiments. Preliminary results obtained using such
mouse sera were inconsistent (data not shown). This could be due to the
variation among individual mice and needs further investigation.
To determine that the agonistic activity of mAb 4G7 in the presence of
RC was due to apoptosis and not to complement-mediated cytolysis, we
analyzed FITC-annexin V staining and cleavage of the caspase-3
substrate PARP in 9D cells (Fig. 2).
Approximately 70% of 9D cells treated with mAb 4G7 plus RC were
FITC-annexin V positive, compared with 5% of 9D cells treated with
control IgG2a plus RC (Fig. 2A). Consistent with this
evidence for apoptosis induction, we detected a significant level of
the 85-kDa caspase-cleaved product of PARP (116 kDa) in 9D cells
treated with mAb 4G7 plus RC, but not in 9D cells treated with mAb 4G7
plus heat-inactivated RC (Fig. 2B). The maximal agonistic
activity of mAb 4G7 in the presence of RC was 
70% of the agonistic
activity in the presence of goat anti-mouse IgG, and the difference
between them is statistically significant (p <
0.01; Fig. 2C). These results confirm that complement can
oligomerize the IgG2a mAb 4G7 in vitro to mediate apoptosis. Our in
vitro study demonstrates that complement components could enhance the
apoptotic activity of mAb 4G7 (mIgG2a), but not mAb 4H6 (mIgG1), in
agreement with the report by Sato et al. (30). They
reported that mIgG2a, but not mIgG1 anti-Thy-1 mAb, induced
apoptosis of neuronal cells in the presence of human C1q. We have also
tested the effects of human complement (1/8 final dilution) and human
C1q (10 µg/ml) on the apoptotic activity of mAb 4G7. The apoptotic
activities detected with human complement and human C1q were 27 and
30% of the activity detected with RC, respectively (data not shown).
Although the apoptosis-enhancing activities of human complement and
human C1q were much weaker than that of RC, these results further
suggest that C1q can induce the oligomerization of mAb 4G7.
|
demonstrated that the level of apoptosis of 9D cells incubated
with IgG plus RC was similar to that in cells incubated with mAb 4G7
alone. Thus, the potent apoptotic activity of mAb 4G7 in the presence
of RC does not appear to be due to the presence of natural
anti-tumor Abs in the RC. At present, it is not clear why RC
exhibited much higher apoptosis-enhancing activity than human
complement. It is possible that human tumor cell membranes express
species-specific, complement inhibitory proteins that bind to human
C1q; the binding of several such inhibitory proteins to other
complement components has been described (31). Anti-tumor activity of anti-DR4 mAb in a xenograft nude mouse model
The C1q level in mouse serum is in the range of 70
µg/ml (28). We therefore reasoned that murine complement
could augment the agonistic activities of anti-DR4 mAbs in vivo,
especially mAb 4G7 of the IgG2a isotype, bypassing the requirement for
a linker. To explore this possibility, we investigated the effect of
anti-DR4 mAbs on the growth of human Colo 205 tumor xenografts in
athymic nude mice (Fig. 3). The mice were
inoculated s.c. with tumor cells and treated with mAbs i.p. when tumor
size reached 50–100 mm3, as previously described
(21). At the end of a 2-wk treatment with 1–10 mg/kg mAb
three times per week, mAb 4G7 inhibited tumor growth by 60% compared
with that in the isotype-matched control (Fig. 3A). The
maximum effective dose of mAb 4G7 was 
2.5 mg/kg
(p = 0.02 compared with the IgG2a control
group). Despite its weaker agonistic activity upon cross-linking with
RC in vitro, mAb 4H6 (IgG1) was much more active than mAb 4G7 (IgG2a)
in vivo, causing complete Colo 205 tumor regression under the same
experimental protocol. Tumor regression was achieved with as little as
1.25 mg/kg of mAb 4H6 three times per week (Fig. 3B;
p < 0.001 compared with the control group). Treatment
with mAb 4H6 at 5 mg/kg once per week was as effective as three times
per week treatment (Fig. 3C). Some tumors reappeared after
administration of mAb 4H6 was stopped, suggesting that tumor cells were
not completely eliminated during treatment. A similar, although less
potent, anti-tumor activity of mAb 4H6 was observed with another
colon carcinoma model, HCT 116 (data not shown).
|
Potential mechanisms of the anti-tumor activity of mAb 4H6
The differences in relative activity of mAb 4G7 and mAb 4H6 in
vitro and in vivo could be due to several factors, including their
different isotypes and recognition of distinct epitopes. To investigate
the importance of the IgG1 isotype for anti-tumor activity of mAb
4H6, we generated a murine IgG2a isotype switch variant of this Ab
using protein-engineering techniques and compared its in vitro and in
vivo activities with those of the parent molecule. In vitro, the two
mAb 4H6 isotypes, which had similar affinities to DR4 (Table II), showed similar agonistic activity
upon cross-linking with goat anti-mouse IgG (Fig. 4A). In contrast, in vivo, there
was a significant difference in the results obtained with IgG1 and
IgG2a of mAb 4H6 (p < 0.001; Fig. 4B). At a dose of 2.5 mg/kg twice per week, IgG1-4H6 showed
96% Colo 205 tumor growth inhibition (p <
0.001 compared with the control group), whereas IgG2a-4H6 demonstrated
23% growth inhibition (p = NS) by day 21. The
anti-tumor activity of IgG2a-4G7 was very similar to that of
IgG2a-4H6. Thus, at least for these anti-DR4 mAbs, the isotype is
more important than the target epitope for in vivo anti-tumor
activity.
|
|
B was
much slower than that in Fig. 3C. The Colo 205 tumor cells
used in Fig. 4B were in culture for a brief time, whereas
the tumor cells used in Fig. 3C were grown in culture for a
long time. We postulate that the in vitro propagation of Colo 205 tumor
cells may select a population of tumor cells growing much faster
in vivo.
To investigate further the importance of IgG1 isotype in the
anti-tumor activity in vivo, we compared the in vitro and in vivo
activities of several anti-DR4 mAbs (three IgG1 mAbs: 3G1, 4E7, and
4H6; two IgG2a mAbs: 1H5 and 4G7) that demonstrated different blocking
activities (Table II). In vitro, upon cross-linking with
anti-IgG-Fc, all mAbs except 3G1 showed similarly strong agonistic
activity on SK-MES-1 cells. In vivo, all IgG1 mAbs, 3G1, 4E7, and 4H6,
demonstrated stronger anti-tumor activity than the IgG2a mAbs, 1H5
and 4G7; the ranges of tumor growth inhibition by IgG1 mAbs and IgG2a
mAbs were 42–99 and 27–30%, respectively. Despite weak agonistic
activity upon cross-linking in vitro, mAb 3G1 inhibited the growth of
Colo 205 tumor by 42% in vivo. It should also be pointed out that mAb
1H5, which is an IgG2a isotype and binds to the overlapping epitope
recognized by mAb 4H6 with a similar affinity, has a significantly
lower anti-tumor activity in vivo compared with mAb 4H6
(p < 0.001). These results further support the
hypothesis that mIgG1 is a much more effective isotype than mIgG2a in
mediating anti-tumor activity through a death receptor,
DR4.
Both IgG1 mAbs, 4H6 and 4E7, showed similarly high affinities for DR4,
with Kd-1 values of 5
pM and 2 pM, respectively. However, mAb 4H6, which blocked Apo2L/TRAIL
binding to DR4-IgG, demonstrated a more potent anti-tumor activity
than mAb 4E7, which did not block ligand binding. The degree of the
anti-tumor activity by mAb 4E7 was 76% of the activity by mAb 4H6
(Table II). The anti-tumor effects of mAb 4H6 and mAb 4E7 are not
statistically different (p = 0.2). Thus, these
results suggest that recognition of a unique epitope that overlaps with
the Apo2L/TRAIL binding site, such as in the case of mAb 4H6, is not
essential for anti-tumor activity. We postulate that the receptor
oligomerization by high affinity IgG1 mAbs would be sufficient to
mediate the death signal, resulting in tumor growth inhibition.
However, the anti-tumor activity of IgG1 mAb would be further
enhanced by binding to the same or an overlapping epitope recognized by
the Apo2L/TRAIL, mimicking the ligand’s agonistic activity. The potent
anti-tumor activity of mAb 4H6 is thought to be due to the
combination of its high affinity, the IgG1 isotype structure, and its
unique binding epitope.
To gain further insight into the mechanism of anti-tumor action by
mAb 4H6, we examined histological sections of Colo 205 tumors 3 days
after a single i. p. injection of 5 mg/kg of mAb 4H6. We observed
widespread necrosis of tumor cells in mAb 4H6-treated mice, whereas
tumors from mice treated with mAb 4G7 or control mAb showed very little
necrosis (Fig. 5). These findings suggest
that mAb 4H6 exerts its anti-tumor activity through direct
induction of apoptosis in tumor cells, rather than indirectly through
recruiting immune effector functions. However, this requires further
investigation.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
An important question is how mAb 4H6, administered without exogenous
cross-linking agents, induces potent anti-tumor activity in vivo,
considering that trimerization of death receptors is required for
signaling. It is possible that oligomerization of mAb 4H6 in vivo may
occur through some endogenous mechanisms. Possible mechanisms include
interaction of the Fc portions of mAbs with FcR on effector cells or
with complement, or interaction through spontaneous Fc-Fc self
aggregation. However, we have ruled out these mechanisms as potential
major mechanisms for the reasons discussed below. It has been well
documented that mIgG2a isotype is much more effective than mIgG1 in
mediating Fc-mediated functions, such as Ab-dependent cell-mediated
cytotoxicity (36, 37, 38) and complement-dependent
cytotoxicity (33, 34). In fact, most IgG1 Abs do not
activate complement, as shown with mAb 4H6 of mIgG1 isotype (Fig. 1).
If the interaction of the Fc region of Ab molecules with FcR on
effector cells or with complement plays a major role in the
anti-tumor activity of anti-DR4 mAbs, mIgG2a anti-DR4 mAbs
should induce stronger anti-tumor activity than mIgG1 anti-DR4
mAbs. However, our in vivo studies (Figs. 3 and 4) show that the mIgG1
mAb 4H6 has much more potent anti-tumor activity in vivo than the
mIgG2a isotype variant of 4H6 and IgG2a mAb 4G7, which have similar
agonistic activities in vitro. A similar IgG1 isotype preference was
observed when we compared several IgG1 and IgG2 anti-DR4 mAbs in
vivo (Table II). Thus, we conclude that neither Ab-dependent
cell-mediated cytotoxicity nor complement-dependent cytotoxicity may
play a major role in inducing the potent anti-tumor activity of mAb
4H6. In addition, mAb 4H6 molecules are unlikely to be self aggregated
in vivo, because mIgG1 is known to be relatively rigid in structure
(40). We postulate that, in vivo, mAb 4H6 may induce the
death signal by oligomerizing DR4 receptors, which might be
overexpressed and therefore preassociated, as shown with TNF receptors
(41) and Apo-1 (Fas) molecules (42). This
hypothesis needs to be further investigated.
The comparison of several anti-DR4 mAbs that do or do not block ligand binding to DR4 suggested that binding to a unique epitope is not a prerequisite for the in vivo anti-tumor activity. Nonetheless, recognition of an epitope that coincides with the ligand binding site on DR4 appeared to enhance anti-tumor activity. The mAb 4H6 is a blocking mAb as determined by the ligand receptor binding ELISA. Thus, the potent anti-tumor activity of mAb 4H6 may be a combination of the mIgG1 isotypic structure of this mAb and its ability to bind the same or an overlapping epitope recognized by Apo2L/TRAIL, mimicking the ligand’s agonistic activity.
From a therapeutic point of view, the main potential advantage of anti-DR4 mAbs over Apo2L/TRAIL is the relatively long pharmacologic half-lives of these Abs, which may enable less frequent administration to achieve similar efficacy. We have found that normal human umbilical cord vascular endothelial cells and microvascular endothelial cells, which express DR4, do not undergo significant apoptosis when exposed to cross-linked anti-DR4 mAbs in vitro (data not shown). This is consistent with the finding that soluble recombinant Apo2L/TRAIL did not show any significant side effects in rodents or nonhuman primates (9, 10). Recently, Jo et al. (43) reported that the His-TRAIL/Apo2L molecule induced a significant level of apoptosis in normal human hepatocytes in vitro, raising the possibility of hepatocyte toxicity in vivo. Thus, the potential side effects of these mAbs as anti-cancer therapeutic agents need to be further investigated.
In conclusion, we have demonstrated that anti-DR4 mAbs have potent activity in a colon tumor xenograft model. We also have shown that at least for the in vivo anti-tumor efficacy of anti-DR4 mAbs, mIgG1 is superior to mIgG2 even when they have similar binding affinities. Although cross-linking of mAbs is required for in vitro apoptosis, it is not clear from our study whether cross-linking is also required for in vivo activity. The main mechanism of action of anti-DR4 mAbs appeared to be direct induction of tumor cell apoptosis rather than immune-mediated effector cell recruitment.
In summary, our findings should help to guide the choice of individual mAbs to DR5 and other death receptors for further in vivo efficacy and safety studies in cancer.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Abbreviations used in this paper: TRAIL, TNF-related apoptosis-inducing ligand; DR4, death receptor 4; PARP, poly(ADP-ribose) polymerase; RC, rabbit complement; mIg, murine Ig; HIC, heat-inactivated RC.
Received for publication September 5, 2000. Accepted for publication February 14, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, on a syngeneic murine melanoma. Int. J. Cancer 38:763.[Medline]
receptor (hIFNAR1) using blocking monoclonal antibodies: the role of domains 1 and 2. J. Immunol. 160:1782. receptor 2. J. Immunol. 163:766. complex: implications for TNF receptor activation. Cell 73:431.[Medline]
This article has been cited by other articles:
|
|
 |
|
  E. Contassot, K. Kerl, S. Roques, R. Shane, O. Gaide, M. Dupuis, A. H. Rook, and L. E. French Resistance to FasL and tumor necrosis factor-related apoptosis-inducing ligand-mediated apoptosis in Sezary syndrome T-cells associated with impaired death receptor and FLICE-inhibitory protein expression Blood, May 1, 2008; 111(9): 4780 - 4787. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. G. Oliver, A. F. LoBuglio, K. R. Zinn, H. Kim, L. Nan, T. Zhou, W. Wang, and D. J. Buchsbaum Treatment of Human Colon Cancer Xenografts with TRA-8 Anti-death Receptor 5 Antibody Alone or in Combination with CPT-11 Clin. Cancer Res., April 1, 2008; 14(7): 2180 - 2189. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Bin, J. Thorburn, L. R. Thomas, P. E. Clark, R. Humphreys, and A. Thorburn Tumor-derived Mutations in the TRAIL Receptor DR5 Inhibit TRAIL Signaling through the DR4 Receptor by Competing for Ligand Binding J. Biol. Chem., September 21, 2007; 282(38): 28189 - 28194. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. C. DeRosier, D. J. Buchsbaum, P. G. Oliver, Z.-Q. Huang, J. C. Sellers, W. E. Grizzle, W. Wang, T. Zhou, K. R. Zinn, J. W. Long, et al. Combination Treatment with TRA-8 Anti Death Receptor 5 Antibody and CPT-11 Induces Tumor Regression in an Orthotopic Model of Pancreatic Cancer Clin. Cancer Res., September 15, 2007; 13(18): 5535s - 5543s. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lukashev, D. LePage, C. Wilson, V. Bailly, E. Garber, A. Lukashin, A. Ngam-ek, W. Zeng, N. Allaire, S. Perrin, et al. Targeting the Lymphotoxin-{beta} Receptor with Agonist Antibodies as a Potential Cancer Therapy Cancer Res., October 1, 2006; 66(19): 9617 - 9624. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Cheng, B. L. Hylander, M. R. Baer, X. Chen, and E. A. Repasky Multiple mechanisms underlie resistance of leukemia cells to Apo2 Ligand/TRAIL. Mol. Cancer Ther., July 1, 2006; 5(7): 1844 - 1853. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. McCarthy, K. A. DiVito, M. Sznol, D. Kovacs, R. Halaban, A. J. Berger, K. T. Flaherty, R. L. Camp, R. Lazova, D. L. Rimm, et al. Expression of tumor necrosis factor-related apoptosis-inducing ligand receptors 1 and 2 in melanoma. Clin. Cancer Res., June 15, 2006; 12(12): 3856 - 3863. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. van der Sloot, V. Tur, E. Szegezdi, M. M. Mullally, R. H. Cool, A. Samali, L. Serrano, and W. J. Quax Designed tumor necrosis factor-related apoptosis-inducing ligand variants initiating apoptosis exclusively via the DR5 receptor PNAS, June 6, 2006; 103(23): 8634 - 8639. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Smyth, Y. Hayakawa, E. Cretney, N. Zerafa, P. Sivakumar, H. Yagita, and K. Takeda IL-21 Enhances Tumor-Specific CTL Induction by Anti-DR5 Antibody Therapy J. Immunol., May 15, 2006; 176(10): 6347 - 6355. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Ricci and W.-X. Zong Chemotherapeutic approaches for targeting cell death pathways. Oncologist, April 1, 2006; 11(4): 342 - 357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Guo, C. Chen, Y. Zheng, J. Zhang, X. Tao, S. Liu, D. Zheng, and Y. Liu A Novel Anti-human DR5 Monoclonal Antibody with Tumoricidal Activity Induces Caspase-dependent and Caspase-independent Cell Death J. Biol. Chem., December 23, 2005; 280(51): 41940 - 41952. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Horak, D. Pils, A. Kaider, A. Pinter, K. Elandt, C. Sax, C. C. Zielinski, R. Horvat, R. Zeillinger, A. Reinthaller, et al. Perturbation of the Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Cascade in Ovarian Cancer: Overexpression of FLIPL and Deregulation of the Functional Receptors DR4 and DR5 Clin. Cancer Res., December 15, 2005; 11(24): 8585 - 8591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Clancy, K. Mruk, K. Archer, M. Woelfel, J. Mongkolsapaya, G. Screaton, M. J. Lenardo, and F. K.-M. Chan Preligand assembly domain-mediated ligand-independent association between TRAIL receptor 4 (TR4) and TR2 regulates TRAIL-induced apoptosis PNAS, December 13, 2005; 102(50): 18099 - 18104. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. McCarthy, M. Sznol, K. A. DiVito, R. L. Camp, D. L. Rimm, and H. M. Kluger Evaluating the Expression and Prognostic Value of TRAIL-R1 and TRAIL-R2 in Breast Cancer Clin. Cancer Res., July 15, 2005; 11(14): 5188 - 5194. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. M. Ghobrial, T. E. Witzig, and A. A. Adjei Targeting Apoptosis Pathways in Cancer Therapy CA Cancer J Clin, May 1, 2005; 55(3): 178 - 194. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Motoki, E. Mori, A. Matsumoto, M. Thomas, T. Tomura, R. Humphreys, V. Albert, M. Muto, H. Yoshida, M. Aoki, et al. Enhanced Apoptosis and Tumor Regression Induced by a Direct Agonist Antibody to Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Receptor 2 Clin. Cancer Res., April 15, 2005; 11(8): 3126 - 3135. [Abstract] |
, The starting date of the first mAb
treatment. Tumor sizes were measured until mice had to be sacrificed
due to tumor necrosis in the control group. Each group comprised seven
or eight mice. Data points represent the mean ± SEM.
A, Dose effect of mAb 4G7 (IgG2a) treatment on the
growth of Colo 205 tumors. Various concentrations of mAbs were given
three times per week. The mAb 4G7 at 2.5 mg/kg was the most effective
(p = 0.028 compared with the control group).
B, Dose effect of mAb 4H6 (IgG1) treatment on the growth
of Colo 205 xenografts. Various concentrations of mAbs were given three
times per week. There were significant tumor growth inhibitions by all
doses of mAb 4H6 treatment (p < 0.001 compared
with the control group). C, Effect of mAb 4H6 treatment
frequency on the growth of Colo 205 xenografts. Mice were treated with
5 mg/kg of mAb one, two, and three times per week. There were
significant tumor growth inhibitions at all frequencies of mAb 4H6
treatment (p < 0.001 compared with the control
group).
