|
|
||||||||

*
Neuromuscular Research Laboratory, Department of Neurology, and
Department of Oncology, Johns Hopkins School of Medicine, Baltimore, MD 21287
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In the present study, we have explored the ability of APCs with VVV-transferred genes to target and eliminate Ag-specific T cells, using a murine transgenic T cell model specific for influenza HA (17) in vitro. Our findings indicate that the APCs express all three gene products and effectively and specifically induce apoptosis of HA-specific T cells, while sparing T cells of other specificities.
| Materials and Methods |
|---|
|
|
|---|
BALB/c transgenic mice expressing an 
TCR specific for the
HA epitope (18) 110120 were bred and maintained in the
animal care facilities at the Johns Hopkins University. BALB/c
transgenic mice expressing an 
T cell receptor specific for OVA
(DO11.10 strain (19)) were a gift of Dr. K. Murphy
(Washington University, St. Louis, MO). Wild-type (wt) BALB/c mice
(812 wk old) were purchased from The Jackson Laboratory (Bar Harbor,
ME) or the National Cancer Institute (Frederick, MD). All animal
experiments were performed in accordance with protocols approved by the
Animal Care and Use Committee of the Johns Hopkins University School of
Medicine.
Cell lines
A20, human TK-, and CV-1 cell lines were purchased from American Type Culture Collection (Manassas, VA). The MC57G mouse fibroblast cell line was provided by Dr. D. Pardoll (Johns Hopkins University).
Insertion of genes into VVV
The genes of interest were first ligated into appropriate
transfer plasmids and then transfected into the vaccinia virus (VV) by
homologous recombination in predetermined loci within the viral genome
(14). To insert more than one gene, different transfer
plasmids are used sequentially, inserted into different loci, and using
different methods of selection at each successive step of recombination
(13, 15). In these studies, we have inserted up to three
genes in a single VV (Fig. 1
) and have
demonstrated that all of the genes are efficiently expressed by
infection of APCs. The first gene (HA-LAMP), which induces processing
and presentation of HA, was inserted in a transfer plasmid that
recombines in the J2R region of the virus and disrupts the vaccinia
thymidine kinase (TK) gene. Recombined VVV was selected with medium
containing bromodeoxyuridine (BrdU), which is lethal to cells that
express TK. VV with a cDNA construct for HA fused to LAMP-1 was a
generous gift of D. Pardoll. The second gene (FasL) was inserted in a
transfer plasmid that reinduces expression of TK (pTK7.5b), and
recombines in the HindIII-F region of vaccinia. Selection of
the recombined virus, which now expresses TK, was conducted using
medium containing methotrexate, which is lethal to cells that do not
express TK. The third gene (TrFADD), which protects Fas-expressing APCs
from Fas-L-mediated death, was inserted in a plasmid that recombines in
the I4L region of vaccinia and induces expression of
-glucuronidase
(15).
-Glucuronidase converts the chromogenic substrate
5-bromo-4-chloro-3-indolyl-
-glucuronide to a blue color that is used
for selection of plaques.
|
We designed primers for FasL (based on published sequences
(20)), amplified FasL cDNA from a human lymphocyte cDNA
library by PCR, and verified it by sequencing. The FasL cDNA was cloned
into the pZeoSV2(+) plasmid (Invitrogen, San Diego, CA), amplified in
Escherichia coli, selected in Zeocin-containing
medium. The FasL fragment was released from the plasmid by the
restriction enzymes BamHI and EcoRV and recloned
into the transfer plasmids pSC11mcs2 and pTK7.5b for homologous
recombination in vaccinia virus (Fig. 1
). TrFADD fragment was a gift
from Dr. V. Dixit, Genentech, South San Francisco, CA in a pcDNA3.1
vector. The TrFADD fragment was amplified by PCR using a pair of
primers that were designed to anchor on the pcDNA3.1 plasmid and to
have ApaI restriction sites at both ends. The primer
sequences were as follows: sense primer,
AATACGACTGGGCCCAGGGAGACCCAAGCTTGG; antisense primer,
TATAGAATAGGGCCCTCTAG. The PCR product was digested with
ApaI restriction enzyme and ligated into the pIV113 transfer
plasmid (Fig. 1
).
Insertion of genes into VV and selection
For insertion of genes into VV, CV-1 cells were seeded at
25 x 105/well in six-well plates in MEM with 10%
FBS (13, 15, 21). One day later, the cells were infected
with the WR strain of VV at 0.11 PFU/cell in 1 ml MEM with 2.5% FBS
at 37°C with gentle shaking every 2030 min for 12 h. Transfection
of the CV-1 cells with the pSCmcs2 plasmid was carried out using the
Mammalian Transfection Kit (Stratagene, La Jolla, CA) according to the
manufacturers recommendation. The transfected cells were harvested,
frozen, and thawed three times, and sonicated to release the VVV, and
four 10-fold dilutions were made in MEM-2.5. Selection of recombinant
VVV was conducted as follows. Confluent TK- cells in
six-well plates were infected with 1 ml of each dilution of the
transfectant by incubation at 37°C for 2 h with gentle rocking.
After the medium was discarded, the cells were gently overlaid with 3
ml warmed (45°C) 1% LMP agarose in 1x plaque medium (Life
Technologies, Gaithersburg, MD) with 5% FBS (HyClone, Logan, UT), 25
µg/ml BrdU (Sigma, St. Louis, MO). The agarose layer was allowed to
solidify at room temperature, and the cultures were incubated at 37°C
for 2 days. For blue color selection, the cultures were overlaid with 2
ml low melting point (LMP) agarose in 1x plaque medium with 10
mg/ml neutral red and 1/150 volume of 5%
5-bromo-4-chloro-3-indolyl-
-D-galactoside (X-Gal) and
incubated at 37°C for an additional 12 days. Discrete blue plaques
were picked, freeze-thawed three times, and used for reselection as
above. Three to five rounds of selection were conducted until pure,
single plaques were obtained. Individual plaques were checked by PCR
and RT-PCR for each recombinant gene before being amplified. Viral
stocks were produced in TK- cells in T-175 flasks,
titered, aliquoted, and stored at -70°C.
For production of recombinant VVV containing a second gene, we used the
TK+ transfer plasmid, pTK7.5b (Fig. 1
). The procedures for
transfection of the CV-1 cells, and TK+ selection were
similar to those described above, with the one critical exception that
the selection medium contained MTAGG (methotrexate (3 µM),
thymidine (15 µM), adenosine (50 µM), guanosine (50 µM), and
glycine (10 µM); the methotrexate component selects for
TK+ cells), instead of BrdU. As above, three to five rounds
of selection were conducted to obtain pure two-gene VVV.
For production of recombinant VVV containing the third gene, we used
the a
-glucuronidase-expressing "GUS" transfer plasmid (pIV113)
construct containing the TrFADD gene, and a selection method that
depends on development of color by the expressed marker
-glucuronidase. The procedures for transfection of the CV-1 cells
were as described above. The first agarose overlay did not contain any
selection reagent. In the second layer,
5-bromo-4-chloro-3-indolyl-
-glucuronide (200 µg/ml; Clontech, Palo
Alto, CA) was used for the development of blue color. Because this
selection method does not involve negative selection of nonrecombined
VVV, five to six rounds of selection were carried out until pure single
plaques were obtained.
In vitro T cell proliferative responses
Different numbers of lymph node cells or splenocytes were seeded
in 96-well plates in complete medium (RPMI with 10% FBS, 5.5 x
10-5 M 2-ME, 1 mM HEPES buffer, 100 U/ml penicillin, 100
µg/ml streptomycin, and 0.25 µg/ml Fungizone) and incubated at
37°C with 5% CO2 for 25 days. Ag, or APCs transduced
with various VVV, were added to the wells. Cultures were pulsed with 1
µCi/well [3H]TdR for 816 h and harvested onto glass
fiber filters. Dried glass fiber filters were counted, and the results
were expressed as
cpm ± SEM.
Flow cytometry
Ab to human FasL and clonotypic Ab to the DO11.10 OVA-specific T cells (KJ1-26) were purchased from Caltag (Burlingame, CA). All other Abs used for flow cytometry were purchased from Pharmingen (San Diego, CA). Cells (210 x 105) were dispensed in 96-well plates in 1x HBSS supplemented with 1% FBS and 0.5% sodium azide. To each well were added 1020 µl of appropriately diluted Ab solutions, and the mixture was incubated on ice for 30 min. After three washes, 1020 µl of properly diluted secondary Ab were added and incubated for 30 min. After fixing with Cytofix (Pharmingen), cells were analyzed immediately or within 1 wk using a FACScan/FACSorter (BD Biosciences, San Jose, CA).
DNA fragmentation induced by FasL expressed by recombinant VV
To express FasL, MC57G mouse fibroblast cells were infected with
recombinant VVV containing the gene for FasL, or control VV, at 20
multiples of infection for 5 h in six-well plates. A20 mouse B
lymphoma cells, which express Fas abundantly, were used as target cells
after labeling overnight with [3H]TdR (5
µCi/106 cells/ml in 100-mm petri dishes at 37°C).
Labeled A20 cells (104 per 1.5-ml tube) were cocultured
with different numbers of transduced MC57G cells, as indicated in Fig. 3
at 37°C. Negative controls contained labeled A20 cells alone;
positive controls contained labeled A20 cells with added anti-Fas
Ab. After 24 h coculture, all tubes were centrifuged at 2500 rpm
for 5 min. The supernatants (
200 µl) were collected in
scintillation vials with 2.5 ml scintillation fluid. The pellets were
further extracted by mixing vigorously with 200 µl 1x TE
buffer with 1% Triton and centrifuging at 14,000 rpm. Radioactivity in
each supernatant (S), Triton-extracted supernatant (T), both containing
fragmented DNA, and pellet (P), containing unfragmented DNA, was
counted. The result is expressed as the percentage of total DNA that
was fragmented: % of DNA fragmented = [(fragmented DNA (S +
T)/(total DNA (S + T + P))] x 100%.
|
The following procedure was used to determine the appropriate parameters of PUVA treatment to attenuate each batch of VVV. Viral suspensions were freshly made in the range of 108109 PFU/ml in 1x HBSS with 0.1% BSA, and 1 ml was transferred to each 35-mm tissue culture dish. Psoralen (Trioxsalen; Calbiochem, La Jolla, CA) was added to a final concentration of 110 µg/ml and incubated at 20°C for 10 min. UV irradiation was conducted in a Stratalinker 1800 UV irradiation unit (Stratagene) for 110 min. PUVA-treated virus suspensions were used immediately, stored at 4°C for days, or stored in aliquots at -80°C for months. Confluent monolayers of CV-1 cells were infected with 103106 PFU virus/well in MEM-2.5 and incubated overnight at 37°C with 5% CO2. Plaques were counted after staining with 0.5% crystal violet. CV-1 cells infected with PUVA-treated VVV in another six-well plate were used for RT-PCR. The appropriate PUVA attenuation parameter is defined as the minimal dose of psoralen and shortest UV irradiation time required to eliminate plaque formation (replication), but with preserved production of mRNA as shown by positive RT-PCR results.
| Results |
|---|
|
|
|---|
As described above, we prepared, selected, and amplified recombinant VVV containing the three gene constructs, in five single or multiple combinations, as follows: HA-LAMP-1; FasL; HA-LAMP-1 + FasL; FasL + TrFADD; HA-LAMP-1 + FasL + TrFADD ("three-gene VVV").
Each transfer plasmid was tested by PCR and sequencing for the accuracy of the construct. Each recombinant VVV was tested by PCR for the presence of the appropriate gene construct(s) and by RT-PCR for transcription of mRNA for the recombined genes. In all cases, the selected VVV contained and expressed the gene constructs of interest (data not shown).
APCs expressing VVV-transferred HA-LAMP stimulate HA-specific T cells
Lymph node cells from HA-specific TCR transgenic mice were
cocultured with congenic BALB/c mouse splenocytes that had been
infected overnight with the HA-LAMP VVV. Cultures were harvested at
different time points with the addition of [3H]TdR for
the last 1618 h (Fig. 2
). The results
showed pronounced stimulation of the HA-specific T cells. This
experiment demonstrated that the product of the VVV-transferred HA-LAMP
gene was processed and presented by APCs and stimulated HA-specific T
cells to proliferate.
|
Expression of FasL was tested by infection of the MC57G cell line
with each FasL-containing VVV overnight at a multiple of infection of
20:1, and staining with PE-labeled specific Ab to FasL. Flow cytometry
demonstrated that up to 83% of the MC57G cells expressed FasL (Fig. 3
a). To test the function of
the FasL gene product expressed by the recombinant viruses, we used
Fas-positive A20 B lymphoma cells as targets. A20 cells pulsed with
[3H]TdR were incubated with different numbers of
VVV-transduced MC57G cells overnight (see details in Materials
and Methods). As shown in Fig. 3
b, the FasL gene
products expressed by the VVV-infected cells induced apoptosis of the
A20 cells. The percentage of DNA that was fragmented varied from 40 to
80%, with different recombinant viruses, contrasted with only 1525%
in A20 cells incubated with control uninfected MC57G cells or MC57G
cells infected with wt VV. The results indicate that these different
recombinant viruses express strongly functional FasL gene products.
APCs expressing VVV-transferred "three-gene" products kill HA-specific T cells
Lymph node cells from HA-specific TCR-transgenic mice and from
OVA-specific TCR transgenic mice were collected and cultured for
48 h in RPMI 10 with the corresponding Ag, either HA peptide 10
µg/ml or OVA 40 µg/ml. In 96-well plates, 2 x 104
stimulated HA or OVA LNCs were then cocultured at a ratio of 1:10 with
BALB/c splenocytes that had been infected overnight with the three-gene
VVV, or with wt VV. Cells were cocultured for 5 days and pulsed for the
last 18 h with [3H]TdR. [3H]TdR
incorporated by HA cells cultured with the three-gene transduced APCs
was reduced by >40%, as compared with control HA cells that had been
cultured with wild-type VV-infected APCs (Fig. 4
). OVA-specific T cells showed only
minimal inhibition after coculture with the three-gene-transduced APCs.
This experiment suggests that APCs with the three-gene VVV kill only
the HA-specific T cells.
|
We compared the ability of APCs transduced with either the
three-gene VVV or the VVV expressing FasL and TrFADD (but without the
targeting construct HA-LAMP) to kill HA-specific T cells (Fig. 5
). Target T cells from
HA-transgenic mice were spleen cells that were first stimulated for
48 h with HA. APCs from BALB/c mice that had been infected
overnight with either the three-gene VVV or the FasL + TrFADD VVV
or control APCs infected with wt VV were added to the cultures and
coincubated overnight. The cultures were harvested, and apoptosis was
measured by standard ELISA (Boehringer Mannheim Cell Death Detection
ELISA; Boehringer Mannheim, Indianapolis, IN). The background ODs were
measured in supernatants from separately cultured APCs transduced with
each of the VVVs. The background OD for APCs transduced with each
specific VVV was subtracted from the results of the cocultures with the
corresponding APCs, to give the
OD. The enrichment factor was
calculated by dividing the
OD by the OD of HA-transgenic T cells
that had been cultured alone (i.e., without APCs or Ag). The enrichment
factor therefore represents apoptosis of T cells due to coculture with
the particular VVV-transduced APCs. The results showed that
HA-transgenic T cell cultures that were coincubated with three-gene
VVV-transduced APCs exhibited marked apoptosis (enrichment factor
= 2.43). By contrast, coincubation of HA-specific T cells with APCs
that expressed FasL and TrFADD, but did not present HA, did not induce
apoptosis (enrichment factor <1, which is not significant).
|
In preliminary experiments, we found that naive transgenic
HA-specific T cells had to be stimulated for
2 days to render them
vulnerable to killing either by APCs transduced with the three-gene VVV
or by Ab to Fas. This is consistent with the requirement for activation
of T cells to induce up-regulation of Fas and vulnerability to FasL
(9, 10, 22). To determine whether our transduced APCs
could first stimulate, and then kill, these naive HA-specific T cells,
we coincubated the T cells from transgenic HA mice with APCs that had
been transduced with the three-gene VVV. Control APCs were infected
with HA-LAMP VVV or wt VV. The cocultures with wt VV-infected APCs were
either stimulated with 5 µg HA (as shown) or unstimulated and used
for determination of backgrounds. Cocultures were grown for 8 days, and
duplicate sets of cultures were pulsed with [3H]TdR for
18 h on each day from day 2 through day 8. The results indicated
that all three groups were initially stimulated, reaching a peak on day
4 (Fig. 6
). However, the T cells
cocultured with three-gene APCs showed a rapid reduction of
[3H]TdR incorporation after the peak and zero
incorporation after day 5, suggestive of death of the cells.
[3H]TdR incorporation declined slowly in the
HA-stimulated T cells but remained active through the remainder of the
8-day experiment.
|
| Discussion |
|---|
|
|
|---|
Our results clearly demonstrate that APCs expressing all 3 gene constructs induce apoptosis and death of HA-specific T cells, while sparing T cells with other specificities. Moreover, we have tested each component of this strategy and have shown that it works independently.
Ag presentation
"Professional" APCs normally process and present exogenously derived Ag (25, 26). However, endogenously synthesized proteins can also be processed and presented by APCs, provided that they are efficiently directed to the class II processing pathway. Recent studies have identified the protein signal LAMP-1, which can direct a variety of endogenously synthesized Ags to the class II pathways efficiently, resulting in greatly enhanced Ag presentation and T cell immune responses (6, 7, 27, 28, 29). This requires the LAMP-1 signal sequence at the 5'-terminus of the Ag to ensure translocation into the endoplasmic reticulum, as well as the transmembrane/cytoplasmic domain of LAMP-1 at its 3'-terminus (8, 30, 31, 32). Our results show that APCs transduced with recombinant VVV expressing the HA-LAMP-1 gene construct, alone or in combination with other genes, produced vigorous stimulation (and therefore targeting) of HA-specific T cells in vitro.
Fas-mediated cell death
The Fas-FasL system is of fundamental importance in the regulation of T lymphocytes. Fas (CD95) is present at the surface membranes of T cells, and is upregulated when they are activated (9, 10, 22). When FasL molecules interact with Fas, they cross-link Fas, initiating a series of steps that activate caspases and result in apoptosis of the Fas-bearing cells (33, 34, 35). In the present studies, we transferred the gene for FasL by means of recombinant VVV. Our results show that the FasL gene product is highly expressed by transduced cells, as demonstrated both by flow cytometry and functionally by killing stimulated HA-specific T cells as well as Fas-bearing A20 cells. Because of its lethal effect on activated T cells, FasL can therefore be used as a potent agent to eliminate Fas-expressing lymphocytes. Consistent with our findings, a previous study has shown that infection of APCs with adenovirus engineered to carry the gene for FasL induced T cell tolerance to the adenovirus, by producing apoptosis of T cells specific for the adenovirus, and infection of macrophages with FasL-expressing adenovirus induced tolerance to cell surface Ags of the macrophage (36, 37).
Truncated FADD
Studies of the role of FADD have led to a robust strategy for preventing Fas-mediated cell death. FADD is associated with the cytoplasmic portion of Fas and normally participates as an intermediary in the Fas-mediated cell death pathway. However, a FADD deletion mutant lacking aa 179 acts as a dominant negative, which inhibits Fas-mediated cell death (11, 12). We have obtained cDNA for this TrFADD mutant. Expression of the gene for TrFADD in the highly vulnerable A20 cells confers protection against cell death mediated by the Fas pathway (J.-M. Wu unpublished results). In the present study, we used VVV with the TrFADD gene in association with the gene for FasL, to avoid the risk of self-destruction of the APCs.
VV as a vector for gene transfer
VV has been used for >15 years as a vector for expression of genes in mammalian cells (14) including APCs (29). For our purposes, vaccinia has several important characteristics, including: 1) the ability to transfer multiple genes simultaneously; 2) high level production of the proteins encoded by the transferred genes; 3) the ability to be attenuated (by treatment with psoralen and UV light (16, 38)), so that it does not replicate (and therefore does not escape to infect other cells) but does direct expression of the gene products by the infected cells.
Our results clearly demonstrate the validity of the principles embodied in the "guided missile" strategy. We have shown that APCs genetically engineered to process and present epitopes of a model Ag and to express FasL can target and induce apoptosis of Ag-specific T cells. Our results demonstrated the specificity of the lethal effect of Ag-directed APCs. Thus, OVA-specific T cells were not affected significantly by three-gene APCs that presented HA-specific epitopes, even though the T cells were appropriately stimulated and in close physical contact with the APCs. Intimacy of contact between T cells expressing Fas and APCs expressing FasL appears to be necessary for induction of apoptosis. APCs expressing the two gene products, FasL and TrFADD, but not presenting HA did not induce apoptosis of HA-specific T cells. This is consistent with reports that FasL-expressing cells must bind their Fas-expressing victims to induce apoptosis (39, 40). Furthermore, for T cells to undergo Fas-mediated apoptosis, they must be activated and must express Fas strongly. Our findings showed that naive HA-transgenic T cells required Ag stimulation in order to be susceptible to apoptosis induced by the FasL-expressing APCs. The time course experiment showed that the three-gene APCs were able to kill naive HA-specific T cells in culture but that they first stimulated the T cells before inducing apoptosis.
The lethal (or inhibitory) effect of the three-gene-transduced APCs could not be attributed to Ag-induced cell death, but rather to the effect of the FasL expressed by transduction of the APCs. Parallel experiments in which the HA-specific cells were confronted with APCs that were transduced with the stimulatory HA-LAMP-1 VVV and the three-gene VVV showed that stimulation per se did not induce apoptosis of the targeted cells, whereas Ag targeting and expression of FasL effectively induced apoptosis.
Certain features of these studies require comment. First, as a
convenient source of abundant and highly reproducible Ag-specific T
cells, we used a well-defined model murine system, with transgenic T
cells that express the 
TCR for HA. Although the Ag-specific T
cells used here were actually monoclonal, we have also had equally
striking success with a heterogeneous Ag-specific T cell population
(41). Second, for the purposes of the present experiments,
we have used the VV for gene transfer. The advantages of vaccinia for
this purpose have been stated, but other methods of gene transfer may
prove useful in the future. The use of retroviral vectors that can
express multiple gene products is under investigation in our
laboratories. Third, as a convenient source of APCs, we have used a
mixed population of spleen cells, including macrophages, dendritic
cells, and B cells. Now that new methods of obtaining relatively large
populations of dendritic cells are becoming available, we are
evaluating the feasibility of using dendritic cells as APCs in these
experiments. Ultimately, it should be possible to develop the guided
missile strategy described here for the treatment of autoimmune
diseases.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Daniel B. Drachman, Department of Neurology, Johns Hopkins School of Medicine, Meyer 5-119, 600 N. Wolfe Street, Baltimore, MD 21287-7519. ![]()
3 Abbreviations used in this paper: HA, hemagglutinin (influenza); BrdU, bromodeoxyuridine; FADD, Fas-associated death domain; FasL, Fas ligand; LAMP-1, lysosome-associated membrane protein-1; PUVA, psoralen plus UV light A; TK, thymidine kinase; TrFADD, truncated FADD; VV, vaccinia virus; VVV, vaccinia virus vector; wt, wild type. ![]()
Received for publication November 8, 2000. Accepted for publication January 26, 2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Schutz, M. Fleck, A. Mackensen, A. Zoso, D. Halbritter, J. P. Schneck, and M. Oelke Killer artificial antigen-presenting cells: a novel strategy to delete specific T cells Blood, April 1, 2008; 111(7): 3546 - 3552. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Bohana-Kashtan and C. I. Civin Fas Ligand as a Tool for Immunosuppression and Generation of Immune Tolerance Stem Cells, November 1, 2004; 22(6): 908 - 924. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Kosiewicz, P. Alard, S. Liang, and S. L Clark Mechanisms of tolerance induced by transforming growth factor-{beta}-treated antigen-presenting cells: CD8 regulatory T cells inhibit the effector phase of the immune response in primed mice through a mechanism involving Fas ligand Int. Immunol., May 1, 2004; 16(5): 697 - 706. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hoves, S. W. Krause, D. Halbritter, H.-G. Zhang, J. D. Mountz, J. Scholmerich, and M. Fleck Mature But Not Immature Fas Ligand (CD95L)-Transduced Human Monocyte-Derived Dendritic Cells Are Protected from Fas-Mediated Apoptosis and Can Be Used as Killer APC J. Immunol., June 1, 2003; 170(11): 5406 - 5413. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Rich and W. R. Green Characterization of the Fas Ligand/Fas-Dependent Apoptosis of Antiretroviral, Class I MHC Tetramer-Defined, CD8+ CTL by In Vivo Retrovirus-Infected Cells J. Immunol., March 15, 2002; 168(6): 2751 - 2758. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |