|
|
||||||||
Centro de Biología Molecular "Severo Ochoa" Consejo Superior de Investigaciones Cientificas-Universidad Autónoma de Madrid, Cantoblanco, Madrid, Spain
| Abstract |
|---|
|
|
|---|
B- nor AP1-independent binding sites. Endogenous expression of
Tat induced a decrease in the amount of the specific protein complex
bound to the CD28RE/AP1 probe after PMA plus calcium ionophore
stimulation. This effect was accompanied by qualitative alterations of
the AP1 complex. Thus, in wild-type Jurkat cells, c-jun was absent from
the complex, whereas in Tat-expressing cells, c-jun was increasingly
recruited overtime. By contrast, similar amounts of
c-rel and a small amount of NFAT1 were detected
both in wild type and in Jurkat Tat+ cells. Furthermore,
Tat not only induced the participation of c-jun in the cooperative
complex but also a decrease in its transactivation activity alone or in
combination with c-rel. Thus, the interaction of Tat
with the components of this rel/AP1 cooperative complex seems to induce
quantitative and qualitative alterations of this complex as activation
progresses, resulting in a decrease of IL-2 gene transcription.
Altogether our results suggest the existence of tuned mechanisms that
allow the viral protein to specifically affect cooperative interactions
between transcription factors. | Introduction |
|---|
|
|
|---|
Furthermore, the presence of Tat does not only affect viral
transactivation but also mediates alterations in multiple cellular
processes. Thus, Tat has been involved in both apoptotic
(4, 5, 6) and survival (7, 8) mechanisms in the
alteration of T cell proliferation (9) and in the aberrant
expression of several cytokine genes: TNF-
(10),
TGF-
(11), IL-6 (12), IL-2
(13, 14, 15, 16), IFN-
(17), and IL-8
(18). Many of these effects are thought to be mediated by
alterations of cellular gene expression by Tat. In this regard, it has
been demonstrated a direct interaction of the viral protein with
several transcription factors including Oct, Sp1, and NFAT (19, 20). Besides, indirect mechanisms have been proposed to explain
alterations of the transcriptional activity of NF-
B (5, 21) and AP1 (22) transcription factors.
In the immune response, IL-2 is considered to play a pivotal role. This
cytokine is strongly regulated at the level of transcription, and the
regulatory sequences conferring its inducible expression in T cells are
localized in a region of
300 bp 5'of the transcription start site
(23). Within this region, the existence of binding sites
for different ubiquitous and cell-specific transcription factors
(NF-
B, AP1, NFAT, and Oct1, among others) has been
reported (reviewed in Ref. 24). Many of these sites are
noncanonical, differing in one or several base pairs from the
corresponding consensus sequences and, consequently, the existence of
cooperative interactions between transcription factors binding to
adjacent sites becomes necessary to obtain an efficient transactivation
(25). In this regard, the CD28RE/AP1 (-164/-145) and
NFAT/AP1 distal (-286/-268) sites of the human IL-2 promoter are very
representative examples of these cooperative interactions between the
rel and AP1 families in the former case (26) and NFAT and
AP1 families in the latter (27). The contribution of the
different regulatory elements to IL-2 gene expression is controversial
(28, 29), and it seems to be different in normal
and Jurkat T cells (30).
Transcriptional transactivation regulated through composite elements is
further complicated by the interplay between these families of
transcription factors. Thus, binding of NFAT proteins to
B-like
sites takes place on several promoters (20, 31, 32, 33).
Moreover, NF-
B and AP1 transcription factors are regulated not only
by transcriptional and posttransductional mechanisms, but also by the
qualitative composition of the dimers. This determines the
transcriptional activity, the DNA sequence specificity, and the
interactions with transcriptional coactivators
(34, 35, 36).
As the Tat viral protein has been shown to affect cytokine expression and interact with different transcription factors, we consider of interest the study of how this viral protein can alter the cooperative interactions determining the transactivation of these composite elements. Here, we demonstrate that Jurkat cells stably expressing Tat have a drastic inhibition in CD28RE/AP1-mediated transactivation, concomitantly with a severe impairment of IL-2-induced transcription. Furthermore, we show that this viral protein acts on this composite element inducing quantitative and qualitative changes in the transactivating complex as activation progresses, possibly explaining the inhibition of IL-2 gene transcription observed in Jurkat Tat+ cells.
| Materials and Methods |
|---|
|
|
|---|
Jurkat Jhan cells (both wild type and stably expressing the full-length HIV-1 Tat of 86 aa) were a gift from J. Alcamí and were grown in complete RPMI 1640 medium supplemented with 10% FCS. Tat-expressing cells were obtained by transfection of pLTat SN plasmid (a gift from O. Schwartz, Institute Pasteur, Paris, France). This plasmid contains Tat under long terminal repeat (LTR) of Moloney virus control. The stable expressing cells were selected by resistance to geneticin. COS cells were obtained from the American Type Culture Collection (Manassas, VA) and were maintained in complete DMEM supplemented with 10% FCS. Cells were stimulated with anti-CD3 (1 µg/ml) plus anti-CD28 (1 µg/ml) Abs, or with PMA (25 ng/ml; Sigma, St. Louis, MO) and ionophore A23187 (1 µM; Sigma) as indicated. Anti-Tat polyclonal Ab was obtained from B. Cullen (Duke University, Durham, NC) through AIDS Research and Reference Program (37). None of the agents affect the viability of the cells at the concentrations used, as confirmed by the trypan blue dye exclusion test.
Cytokine measurement
The concentration of IL-2 was quantified in supernatants of Jurkat Tat- or Jurkat Tat+ cell cultures (7 x 105 cells/ml) harvested after 24 or 48 h of cultivation in the absence or presence of PMA+calcium ionophore A23187 (PMA+Io). Commercially available ELISA kits were used according to manufacturers instructions (IL-2; R&D Systems, Minneapolis, MN). Cytokine concentration was assayed in duplicate.
Plasmid constructs
The reporter plasmid pIL2luc containing the sequences from -326
to +46 of the human IL-2 gene directing transcription of the firefly
luciferase gene has already been described (23). The
plasmid TK-luc contains the herpes simplex I thymidine kinase promoter
(38). The pCD28RE/AP1luc plasmid contains four copies of
the oligonucleotide corresponding to the CD28RE/NF-IL-2B of the
human IL-2 gene promoter and was a gift from A. Weiss (University of
California, San Francisco, CA) (26). The plasmid
p
B-conalbumin (CONA)-luc containing three tandem copies of the
B
site of the Ig
-chain promoter cloned upstream of the CONA
transcription start site was provided by J. Alcamí
(Hospital 12 de Octubre, Madrid, Spain) (39). The reporter
plasmid pLTRxluc was a gift from J. L. Virelizier (Institute
Pasteur). (40). It carries the U3'UTR of the LTR of the
LAI strain of HIV-1 from nucleotide -644 to +78. The pNFATluc plasmid
was a gift from G. Crabtree (Stanford University Medical
School, Stanford, CA). It contains three tandem copies of the NFAT
distal site of the human IL-2 promoter fused to the minimal human IL-2
promoter (23). The pTNF-luc plasmid contains a region 1311
bp upstream from the transcriptional initiation site of the human
TNF-
promoter (41). The p-73col-luc plasmid including
the AP1-responsive (-73/+63 bp) regions of the human collagenase
promoter fused to the luciferase gene has been previously described
(42). The pGAL4-luc reporter plasmid includes five GAL4
DNA binding sites fused to the luciferase gene (43). The
pRSV-GAL4-c-Jun (wild type) and pRSV-GAL4-c-Jun
S1+S2 constructs encode the
wild-type transactivation domain of c-jun, and this domain mutated in
its phosphorylation sites (Ser 63 and Ser 73), respectively, in frame
with the GAL4 DNA binding domain (44). The
pGAL4-c-rel (309588) and pGAL4-c-rel (309318)
express a chimera containing the GAL4 DNA binding domain together with
the transactivation domain of c-rel or 10 aa without
transactivating capacity, respectively, and were cloned by A.
García in our laboratory (45). The
pRSV-cJ-expressing c-jun was a gift from A. Muñoz (Instituto de
Investigaciones Biomedicas, Madrid, Spain) and was previously
described (44) and the pRc-hc-rel expression
plasmid resulting from the cloning of the cDNA of c-rel in
the HindIII-XbaI restriction sites of pRcCMV
(Invitrogen, San Diego, CA) was provided by N. Rice (National Cancer
Institute, Frederick, MD) (45). The plasmid pEF-BOS-NFAT1
bears the gene encoding the influenza virus hemagglutinin-tagged NFAT1
and was a gift from J. M. Redondo (Centro de Biología
Molecular, Madrid, Spain). The CMVTat was a gift from J.
Alcamí and contains full-length HIV Tat (86 aa) under control
of CMV-immediate early promoter (40). The pcDNA3 plasmid
(Invitrogen) is a cloning vector containing the CMV promoter. It was
used in our experiments as a control in the transfection of expression
plasmids or to adjust the quantities of DNA transfected. To evaluate
transfection efficiency, pRL-tk-luc plasmid (Promega, Madison, WI) was
used. It contains the herpes simplex virus thymidine kinase (HSV-TK)
promoter to provide low to moderate levels of Renilla luciferase
expression in cotransfected mammalian cells.
EMSAs
Nuclear extracts were obtained from Jurkat cells essentially by the previously described method (46). Gel retardation assays were performed as described (47) with the only modification that in the competition experiments, the unlabeled homologous oligonucleotides were used at 80-fold molar. The sequences of the oligonucleotides (5' to 3') used in EMSAs were tcgaGTTTAAAGAAATTCCAAAGAGTCATCAG (CD28RE/AP1 of human IL-2 promoter), gatcGGAGGAAAAACTGTTTCATACAGAAGGCGT (distal NFAT site of human IL-2 promoter), gatcATAAAATTTTCCAATGTAAA (mouse P sequence of the IL-4 promoter), and CGCTTGATGAGTCAGCCGGAA (AP1 consensus oligonucleotide).
The pairs of complementary synthetic oligonucleotides were annealed and
labeled with the Klenow fragment of the DNA polymerase I using
[
-32P]dCTP and
[
-32P]dGTP with the exception of the AP1
oligonucleotide (Promega) that was labeled with the T4-PNK using
[
-32P]dATP. To purify the labeled
oligonucleotides, Quick Spin Columns Sephadex G25 (Boehringer Mannheim,
Heidelberg, Germany) equilibrated with Tris-EDTA were used.
When using serum to supershift or to inhibit the induced binding, the Abs were added to the binding reactions before the addition of the radiolabeled probe. The serum used in EMSAs were 672 anti-NFAT1 (gift from J. M. Redondo), anti-junB, and anti-fos family (provided by A. Corbí, Centro de Investigaciones Biológicas, Madrid, Spain), anti c-jun (sc-45-G; Santa Cruz Biotechnology, Santa Cruz, CA), and the anti-c-rel (1136) (48) and anti-p65 (1226) (49) sera were gifts from N. Rice.
RT-PCR analysis
Total RNA was prepared from Jurkat cells by the TRIzol reagent RNA protocol (Life Technologies, Paisley, U.K.). Total RNA (1 µg) was reverse transcribed into cDNA and used for PCR amplification with either human IL-2 or HIV-1-Tat or GAPDH-specific primers by the RNA PCR Core Kit (Perkin-Elmer, Norwalk CT) as previously described (50). Briefly, the PCR was amplified by 2035 repeat denaturation cycles at 94°C for 1 min, annealing at 60°C for 1 min, and extension at 72°C for 1 min. Amplified cDNAs were separated by agarose gel electrophoresis, and bands were visualized by ethidium bromide staining.
Transient transfections
Transcriptional activity in Jurkat and COS cells was measured in reporter gene assays after transient transfection of cells with the corresponding plasmid using Lipofectamine as recommended by the manufacturer (Life Technologies). Briefly, exponential growing Jurkat cells (2 x 106) were transfected with 4 µl of Lipofectamine, 6 µl of Plus Reagent (Life Technologies) and 0.5 µg of the firefly luciferase reporter plasmid (containing the regulatory region under test) together with 10 ng of the pRL-tk-luc in a final volume of 1 ml of OptiMem (Life Technologies). Following 4 h of incubation, 3 ml of complete medium was added to cells, and they were incubated overnight to complete transfection. Cells were then counted by trypan blue exclusion and treated (7 x 105 cells/ml) with different stimuli for 6 h. In the case of COS cells, exponential growing cells were transfected in suspension. For 5 x 105 cells, 2 µl of Lipofectamine, 3 µl of Plus Reagent, and 1 µg of the firefly luciferase reporter plasmid plus 20 ng of the pRL-tk-luc and 0.25 µg of the corresponding expression plasmid were incubated for 3 h in a final volume of 1 ml of OptiMem. COS cells were then pelleted and resuspended in 4 ml of complete medium. Cells were plated on multidish 24-well plates and, after 24 h, stimuli were added for an additional 6-h period.
Luciferase assays
After the stimulation period, cells were harvested, lysed, and measured for 10 s in a luminometer following the instructions in the Dual-Luciferase Assay System Kit (Promega). Data are represented in relative firefly luciferase units normalized by the relative renilla luciferase units obtained in the control samples of every transfection (RLUff/ren). Every experiment was conducted in duplicate. All of the experiments shown are representative of at least three performed to guarantee the reproducibility of the results.
| Results |
|---|
|
|
|---|
To study the effect of Tat on IL-2 synthesis, we compared the
activation response of Jurkat wild-type (Tat-)
cells to those stably expressing the viral protein (Jurkat
Tat+). Cells were stimulated with phorbol esters
in combination with calcium ionophore, and IL-2 secretion into the
supernatant was evaluated by bioassays (data not shown) or by specific
ELISA (Fig. 1
A). Normal Jurkat
Tat- cells secreted IL-2 upon stimulation by
PMA+Io. By contrast, Jurkat Tat+ cells had a
drastic if not complete blockade in their ability to produce IL-2.
Furthermore, no IL-2 mRNA could be detected by RT-PCR techniques in
Jurkat Tat+ cells at any time after activation
although it was already observed at 2 h of stimulation in
wild-type Jurkat cells (Fig. 1
B). These data suggested an
inhibitory effect of Tat at the level of IL-2 gene transcription.
|
To further confirm that Tat was affecting IL-2 gene expression, we analyzed the expression of a reporter gene under the control of the -326/+45 region of the human IL-2 gene promoter. Transactivation of the IL-2 promoter was increased in Jurkat cells upon PMA+Io stimulation, but this induced transcription was strongly inhibited in Jurkat Tat+ cells. By contrast, the transactivation of the TNF promoter was up-regulated in Jurkat Tat+ cells.
It is well known that IL-2 gene expression is dependent on the
coordinated activity of several transcription factors activated after T
cell stimulation (24). Among the DNA sequences present in
the IL-2 promoter, the most relevant in transcriptional regulation are
those recognized by AP1, NF-
B, and the composite elements NFAT/AP1
(NFAT distal site) and CD28RE/AP1, where Rel and AP1 proteins
transactivate in a cooperative way (26). Therefore, we
decided to analyze which of those factors was altered in Jurkat
Tat+ cells by transiently transfecting plasmids
that express the luciferase reporter gene under the control of the
corresponding response elements. As shown in Fig. 2
B, PMA+Io-induced
transcription controlled by CD28RE/AP1 was severely abolished in Jurkat
Tat+ cells. By contrast, transcription dependent
on pure
B or AP1 sites was not significantly altered,
whereas NFAT/AP1-dependent transcription was enhanced 2-fold in Jurkat
Tat+ cells. Thus, the global effect of Tat on
IL-2 promoter regulation seemed to correlate with the effect on the
CD28RE/AP1 element, indicating its prominent role in
controlling IL-2 transcription.
|
To further corroborate that this effect was exclusively to Tat and not
to some artifact produced during the generation of stable transfected
cells, Jurkat wild-type cells were transfected with different doses of
a pCMVTat-expressing plasmid together with CD28RE/AP-1 reporter. As
shown in Fig. 3
, the transfection of low
amounts of the Tat-expressing plasmid significantly decreased the
transactivation of the CD28RE/AP-1 reporter induced by anti-CD3
plus CD28 PMA+Io induced a stronger up-regulation of this reporter than
anti-CD23 plus anti-CD28, but this induction was also inhibited
by Tat, although it required higher amounts. As a control, TK-luc was
unaffected by Tat expression (Fig. 3
). Similar results were found in
another human T cell line, MOLT-4 (data not shown).
|
|
To study the underlying mechanism of Tat-mediated inhibition on
CD28RE/AP1 transactivation, we analyzed the effects of the viral
protein on the binding of activated transcription factors to this
composite element. For that purpose, we performed EMSAs with nuclear
extracts of Jurkat Tat- and Jurkat
Tat+ cells using the corresponding
oligonucleotide-labeled probe. As shown in Fig. 5
, activation of Jurkat cells led to the
appearance of a specific complex bound to the CD28RE/AP1
oligonucleotide that increased with time after stimulation. In Jurkat
Tat+ cells, the amount of this complex was about
the same as that in Jurkat Tat- up to 90 min and
only at longer times after activation it was significantly
decreased.
|
B composition at the CD28RE/AP1 element
Both the apparent discrepancies between the strong inhibition
observed in Jurkat Tat+ cells in CD28RE/AP1
transactivation and the partial effect observed in EMSAs were
suggestive of the existence of additional inhibitory mechanisms. As the
transactivating function of both NF-
B and AP1 transcription factors
is regulated by the composition of the dimers (34, 35, 36), a
possible Tat-induced qualitative alteration in the transactivating
complex could not be excluded.
To test this hypothesis, we investigated which one of the components in
the binding complex could be altered, because the CD28RE/AP1 site of
the IL-2 promoter is known to bind transcription factors from the
NF-
B and AP1 families (26). Within this composite
element, the CD28RE has been described as a nonconsensus
B site
(51) recognized by diverse members of the NF-
B
transcription factor family (49). Therefore, we evaluated
whether the
B composition was being altered by Tat using Abs against
the p65 and c-rel proteins of the
B family in the EMSAs.
Both in nuclear extracts of PMA+Io-stimulated Jurkat
Tat- and Jurkat Tat+
cells, the presence of c-rel was predominant when compared
with p65, but no significant differences were detected in the
composition of the complex either at 90 (Fig. 6
) or 270 min of stimulation (data not
shown).
|
It has already been shown that Tat interacts with NFAT altering
its transactivating capacity (20) and at present there is
a controversy about the implication of NFAT in the regulation of the
CD28RE/AP1 response element (28, 31). Therefore, it could
be possible that the effects of Tat on this responsive element were
caused by Tat-NFAT interaction, somehow altering the transactivating
B-AP1 complex. To test this hypothesis, first we analyzed whether
NFAT was present in the complex bound to the CD8RE/AP1 probe by using
specific Abs against NFAT1 in the EMSAs. As shown in Fig. 7
A, a small amount of NFAT was
able to bind to this probe. However, almost identical supershifting
results were observed in Jurkat Tat- and Jurkat
Tat+, indicating a similar participation of NFAT1
in the complex in both types of cells. The participation of NFAT was
also confirmed by competition of the binding using unlabeled probes
containing NFAT binding sites. The result of this competition evidenced
the presence of AP1 in the complex and, to a minor extent, the
participation of NFAT (competition with the NFAT binding site of the
mouse IL-4 promoter) both in Jurkat Tat-
and Jurkat Tat+ cells. However, we could not
exclude the possibility that the presence of Tat in the complex could
be inducing a competition between the NFAT and the c-rel
proteins bound to the
B-like site, altering their cooperation with
AP1 and, therefore, the transactivating activity. To evaluate this
possibility, we transfected COS cells, which do not endogenously
express NFAT but express high basal levels of AP1 (52)
with the pCD28RE/AP1luc plasmid together with different combinations of
the expression plasmids of c-rel, Tat and/or NFAT1. NFAT1
did not inhibit the transactivation of the CD28RE/AP1 element
induced by c-rel either in the presence or in the absence of
Tat. Actually, even an additive effect in transactivation was detected
when NFAT and c-rel proteins were cotransfected (Fig. 7
B). These results excluded the interaction between NFAT and
Tat as the main cause of the inhibition on the CD28RE/AP1 element by
the viral protein.
|
It is well known that AP1-dependent transcriptional regulation is
determined by the composition of the AP1 dimers (36). To
test whether this component of the complex was qualitatively affected
in Jurkat Tat+ cells, the participation of some
of the AP1 factors was evaluated by analyzing the inhibition of the
specific binding after incubation with Abs in the EMSAs. As shown in
Fig. 8
A, the presence of
c-jun, junB, and fos proteins in the complex bound to the CD28RE/AP1
element was very similar when comparing nuclear extracts from 90-min
stimulated wild type and Tat-expressing Jurkat cells. However,
when we evaluated nuclear extracts from cells stimulated for 270 min,
qualitative differences, in addition to the previously shown reduction
in the amount of the complex bound, could be observed (Fig. 8
B). Thus, although in both Jurkat
Tat- and Jurkat Tat+ the
AP1 dimers contained a similar proportion of fos proteins both at 90
and 270 min, the participation of c-jun at different times of
stimulation was different in Jurkat Tat- and
Jurkat Tat+. c-jun was very poorly represented in
both types of cells at 90 min of stimulation, but at 270 min its
participation in the complexes bound to the CD28RE/AP1 site
significantly increased in Jurkat Tat+ cells.
This effect of Tat was selective on c-jun, as the participation of junB
in the complex was very similar in Jurkat Tat-
and Jurkat Tat+ at both 90 and 270 min of
stimulation.
|
Altogether, the above mentioned results indicated that Tat
expression in Jurkat cells was increasing the participation of c-jun in
the CD28RE/AP1 binding complex as activation progresses. This effect
was associated with a quantitative decrease in protein binding and an
inhibition of the transactivating function of the complex. To test the
existence of a direct effect of Tat on the transactivating activity of
c-rel and c-jun, Jurkat Tat- cells
were cotransfected with plasmids expressing GAL4 chimeric proteins
(containing the transactivation domain under test and the DNA binding
domain of GAL4) together with pGAL4luc and different doses of a Tat
expression plasmid (Fig. 9
).
c-rel transactivation activity was not decreased by
coexpression of Tat. In fact, we could observe some increase when very
low doses of pCMVTat were used (Fig. 9
A). In
contrast, the activity of c-jun was inhibited in a dose-dependent
manner by pCMVTat transfection (Fig. 9
B). These data were
suggestive of an inhibitory effect of Tat on the transactivation of the
CD28RE/AP1 element mediated through a direct inhibition of the c-jun
component.
|
B and AP1 at the CD28RE/AP1 element and, thus, the
inhibition of transcription was only abolished when the presence of Tat
in the Jurkat Tat+ cell was insignificant
compared with the functional overexpressed NF-
B/AP1 complexes. To
corroborate this hypothesis, Jurkat Tat- or COS
cells were cotransfected with c-jun + c-rel and pCMVTat. As
shown in Fig. 10
1000-fold in Jurkat
Tat- cells. However, the cotransfection of low
amounts of pCMVTat (50 ng) significantly down-regulated both the basal
and the PMA+Io-induced transactivation of the CD28RE/AP1
reporter. Similar results were found in COS cells. Inhibition of
CD28RE/AP1-dependent transactivation was dependent of the amount of
pCMVTat cotransfected, being c-rel + c-jun-mediated
transactivation completely abrogated by high doses of pCMVTat (Fig. 10
|
| Discussion |
|---|
|
|
|---|
Our results suggest that HIV1-Tat affects IL-2 transcription mainly by inhibiting the transactivation of the CD28RE/AP1 site. The preponderant role proposed for the CD28RE/AP1 complex in the regulation of IL-2 transcription would be in consonance with the data described in normal T cells about IL-2 promoter activity (30) and with the impaired IL-2 expression observed in c-rel knockout mice (54). However, we cannot exclude that within the entire promoter the inhibition of this composite element could induce alterations on other transactivating complexes bound at different sites of the promoter.
The drastic inhibition observed on the transactivation of the
CD28RE/AP1 element in Jurkat Tat+ cells is likely
the result of a combination of a quantitative reduction of the binding
of transcription factors to this site and also of subtle
qualitative changes that may alter the transcriptional activity of the
factors bound. Because Tat decreases in a dose-response manner c-jun +
c-rel-induced CD28RE/AP1 transactivation, it is also
plausible that Tat also down-regulates the transcriptional activity of
the NF-
B/AP-1 complexes bound to the CD28RE/AP-1 site of the IL-2
promoter without affecting the individual activity of NF-
B and AP-1.
Interestingly, our results indicate that c-jun minimally participates
in AP1 dimers bound to the CD28RE/AP1 site in activated T cells. As
activation progresses, an alteration of the relative participation of
c-jun and junB in the binding complex is observed when comparing Jurkat
Tat+ cells to Jurkat Tat-.
In this regard, it has been demonstrated that heterodimerization of AP1
proteins not only determines their ability to bind specific DNA
sequences and to interact with the basal transcriptional machinery but
also influences their recognition by protein kinases and
transcriptional coactivators (reviewed in Ref. 36). Thus,
phosphorylation of jun proteins by c-Jun N-terminal kinase (JNK) is
dependent on the presence of a JNK-docking site in the jun proteins,
but efficient phosphorylation also requires certain
specificity-conferring residues, such as a proline at the P + 1
position flanking the phosphate acceptor site (55). c-jun
fulfils both requirements but junB, although having an efficient
JNK-docking site is not phosphorylated by JNK as it lacks the necessary
proline. An additional difference between c-jun and junB is that only
the former interacts with the transcriptional coactivator JAB1 (jun
activation domain binding protein 1), which enhances the ability of
c-jun to activate transcription through stabilization of the AP1-DNA
complex (56). Bearing in mind all these data, the
existence of subtle alterations of the AP1 composition in the
transactivating complex may lead to have amplified functional
consequences. Furthermore, we show Tat does not only favor the
participation of c-jun in the binding complex but besides, and,
probably more importantly, it interacts with c-jun inhibiting its
transcriptional activity. This is, to our knowledge, the first
description of a Tat-mediated inhibition of c-jun transactivating
activity and may have important consequences due the importance of this
transcription factor in T cell activation.
The importance of the AP1 component on the complete function of the
NF-
B/AP1 complex has already been demonstrated (57).
Significantly, the CD28-induced costimulation is based not only on the
activation of the NF-
B component bound to the CD28RE but also on the
complete activation of AP1, both at the level of the composition of the
dimer (58) and at the posttransductional modifications
that alter the transactivating function of c-jun (59).
Therefore, it is possible that the recruitment of c-jun to the
CD28RE/AP1 element by Tat may be the main cause of the alteration
observed on the binding characteristics of the NF-
B/AP1 complex and
subsequently in its decreased transactivating activity in Jurkat
Tat+ cells.
The existence of a direct interaction between a transactivator viral
protein and AP1 has already been proposed for the Tat protein of the
Visna virus (60) and for the human T cell leukemia virus
transactivator tax (61, 62). Our results show that the
effects of HIV-Tat on AP1 seem specific of composite elements as
transactivation controlled by consensus AP1 sites was not affected by
endogenous expression of Tat in the cell. Although not addressed in
this study, this lack of effect could be due to the lack of alteration
of the AP1 dimers bound to pure AP1 sites. Besides, this could indicate
the existence of a direct contact of Tat with other components of the
complex, somehow allowing a more efficient Tat/c-jun interaction. In
this regard, cotransfection experiments of pGal4-c-rel and
low doses of pCMVTat in Jurkat Tat- cells
evidence an alteration of the transactivating function of
c-rel by Tat and suggest the existence of an interaction
between these two proteins. The dependence of this effect on the
presence of a restricted Tat concentration (low levels) is intriguing.
A possible explanation could result from the fact that from certain
levels of Tat expression, dimerization of the viral protein could be
taking place, thus avoiding its interaction with c-rel. The
idea of an alteration on the dimer composition of AP1 in a manner
dependent on Tat-rel contacts is reinforced by reports that demonstrate
that c-rel may alter AP1-mediated transactivation
(63). Altogether, the effect of Tat on the transactivating
complex may be more complex than the sum of the effects of the viral
protein on the individual components. Besides, taking into account that
cooperative interactions are required on the CD28RE/AP1 element, it is
possible that both the interactions of Tat with both c-rel
and with c-jun are the cause of the selective recruitment of c-jun to
this composite element. This idea is further supported by the fact that
the effect of Tat on CD28RE/AP-1 transcription depends on the relative
amounts of the three components as demonstrated by the transient
transfection experiments in Jurkat Tat-
or COS cells. In this regard, Lim et al. have recently found
that Tat interaction with SP1 at the human monocyte chemoattractant
protein 1 (hMCP-1) gene promoter may serve as a platform to
recruit and stabilize the interaction of AP1 and NF-
B proteins to
this promoter (64). Thus, studying the effects of Tat on
synergistic interactions among transcription factors is becoming
increasingly relevant to fully understand its physiological
role.
Although our results point toward a NF-
B/Tat/AP1 tripartite
interaction, the indirect disruption of interactions between these
transcription factors and coactivators as a consequence of the presence
of Tat in the cell cannot be excluded. Thus, the interaction of c-jun
with the transcriptional coactivator CBP has been involved in the
regulation of the transactivating function of c-jun (65),
and Tat interacts in vivo and in vitro with CBP/p300 (2, 66). The possibility that c-jun-CBP interaction could be altered
by the one maintained between Tat and CBP would also contribute to
explain the inhibition of c-jun-transactivating activity by the viral
protein.
In contrast, despite the highly controversial implication of NFAT in
the regulation of the CD28RE/AP1 element (28, 31), our
results demonstrate that NFAT is present in the induced binding
complex, but in a similar amount both in Jurkat
Tat- and Jurkat Tat+
cells. Moreover, reporter gene experiments in COS-transfected cells
evidence a cooperation between NFAT1 and c-rel in the
transactivation of the CD28RE/AP1 element both in the absence or
presence of Tat. These data are consistent with those suggesting that
activation of the IL-2 gene expression through the CD28 costimulatory
signal involves both NF-
B/rel and NFAT functionally interacting with
CD28RE (67) but exclude that the effects of HIV-Tat on the
CD28RE/AP1 response element are mediated through the NFAT component of
the complex, as it has been proposed for the HTLV-I-tax protein
(32).
We have not detected a significant effect of constitutive Tat
expression on the activity of
B-dependent reporter genes. This is in
contrast with several reports that have described effects of Tat on
NF-
B (5, 21) but in agreement with those by Ott et al.
They suggest that Tat is able to alter the binding of NF-
B to
sequences recognized by this transcription factor with low affinity and
with a strong participation of c-rel, not detecting any
effect on "classical"
B sites recognized mainly by
p50-p65 dimers (18). The existing controversy
about the enhancing or inhibiting effects of Tat on IL-2 regulation
(13, 14, 15, 16) is also remarkable. All of these
discrepancies are probably due to the use of different experimental
conditions, as in many of those studies enforced expression of Tat (by
transfecting large amounts of Tat expression plasmids) or extracellular
recombinant Tat were used, whereas very low Tat intracellular
concentrations (closer to physiological levels) exist in our Jurkat Tat
cells. Despite the fact that Tat could be secreted and affects
neighboring cells, extracellular Tat is not involved in the inhibition
of the CD28RE/AP1-dependent transcription. Altogether, these results
indicate that the effects of Tat may vary depending on its cellular
location, a point not always taken into account in the literature.
In summary, we have shown that intracellular expression of HIV-Tat may affect transcription from the CD28RE/AP1 composite element of the IL-2 human promoter at various levels: reducing the binding of the transcription factors to the complex, altering their composition, and decreasing c-jun transcriptional activity. This causes a drastic inhibition of transcriptional activation of IL-2 gene. These data underline the importance of studying the multiple interactions maintained at composite response elements, as subtle distortions of one component of the complex may affect the binding and transactivating functions of complete transactivation complex.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Manuel Fresno, Centro de Biología Molecular "Severo Ochoa" (Consejo Superior de Investigaciones Cientificas-Universidad Autónoma), Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain. ![]()
3 Abbreviations used in this paper: CBP, cAMP response element binding protein binding protein; Io, calcium ionophore A23187; LTR, long terminal repeat; CONA, conalbumin; JNK, c-Jun N-terminal kinase. ![]()
Received for publication March 27, 2000. Accepted for publication January 26, 2001.
| References |
|---|
|
|
|---|
B activation and cytotoxicity by altering the cellular redox state. EMBO J. 14:546.[Medline]
1 by marrow macrophages: a potential mechanism for human immunodeficiency virus-1-induced hematopoietic suppression. Blood 80:3036.
(NF-IL6) transcription factors. J. Biol. Chem. 272:14883.
and Tat involvement in the immunosuppression of uninfected T cells and C-C chemokine decline in AIDS. Proc. Natl. Acad. Sci. USA 95:3851.
B factors. J. Immunol. 160:2872.
B through the cellular interferon-inducible, double-stranded RNA-dependent protein kinase, PKR. J. Virol. 73:7080.
B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]
B: structure-function relationship of its protein subunits. Biochem. J. 290:297.
B and increases human immunodeficiency virus replication in human monocytes and T lymphocytes. J. Virol. 67:6596.
promoter region in macrophage, T cell, and B cell lines. J. Biol. Chem. 267:22102.
activation of NF-
B requires the phosphorylation of Ser-471 in the transactivation domain of c-Rel. J. Biol. Chem. 275:24383.
B site-dependent activation of the interleukin-2 receptor
-chain gene promoter by human c-Rel. Mol. Cell. Biol. 12:4067.
B family: c-Rel, p50, and p65. Proc. Natl. Acad. Sci. USA 90:1696.
B-like response element. J. Biol. Chem. 266:14179.
-chemokine monocyte chemoattractant protein 1 in the human astrocytoma cell line U-87 MG: role of SP-1, AP- 1, and NF-
B consensus sites. J. Virol. 74:1632.
B/Rel transcription factors. Mol. Cell. Biol. 17:2605.[Abstract]This article has been cited by other articles:
![]() |
K. Gee, J. B. Angel, W. Ma, S. Mishra, N. Gajanayaka, K. Parato, and A. Kumar Intracellular HIV-Tat Expression Induces IL-10 Synthesis by the CREB-1 Transcription Factor through Ser133 Phosphorylation and Its Regulation by the ERK1/2 MAPK in Human Monocytic Cells J. Biol. Chem., October 20, 2006; 281(42): 31647 - 31658. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Hidalgo-Estevez, E. Gonzalez, C. Punzon, and M. Fresno Human immunodeficiency virus type 1 Tat increases cooperation between AP-1 and NFAT transcription factors in T cells J. Gen. Virol., June 1, 2006; 87(6): 1603 - 1612. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rizzi, M. P. Crippa, R. E. Jeeninga, B. Berkhout, F. Blasi, G. Poli, and M. Alfano Pertussis Toxin B-Oligomer Suppresses IL-6 Induced HIV-1 and Chemokine Expression in Chronically Infected U1 Cells via Inhibition of Activator Protein 1 J. Immunol., January 15, 2006; 176(2): 999 - 1006. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Fortin, C. Barat, Y. Beausejour, B. Barbeau, and M. J. Tremblay Hyper-responsiveness to Stimulation of Human Immunodeficiency Virus-infected CD4+ T Cells Requires Nef and Tat Virus Gene Products and Results from Higher NFAT, NF-{kappa}B, and AP-1 Induction J. Biol. Chem., September 17, 2004; 279(38): 39520 - 39531. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Calzado, R. Sancho, and E. Munoz Human Immunodeficiency Virus Type 1 Tat Increases the Expression of Cleavage and Polyadenylation Specificity Factor 73-Kilodalton Subunit Modulating Cellular and Viral Expression J. Virol., July 1, 2004; 78(13): 6846 - 6854. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Chung, B. Y. Kang, and T. S. Kim Inhibition of Interleukin-4 Production in CD4+ T Cells by Peroxisome Proliferator-Activated Receptor-{gamma} (PPAR-{gamma}) Ligands: Involvement of Physical Association between PPAR-{gamma} and the Nuclear Factor of Activated T Cells Transcription Factor Mol. Pharmacol., November 1, 2003; 64(5): 1169 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Kohm, A. Mozaffarian, and V. M. Sanders B Cell Receptor- and {beta}2-Adrenergic Receptor-Induced Regulation of B7-2 (CD86) Expression in B Cells J. Immunol., June 15, 2002; 168(12): 6314 - 6322. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |