The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dzialo-Hatton, R.
Right arrow Articles by Weaver, C. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dzialo-Hatton, R.
Right arrow Articles by Weaver, C. T.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CYCLOSPORIN A
*Genetics Home Reference
The Journal of Immunology, 2001, 166: 4534-4542.
Copyright © 2001 by The American Association of Immunologists

Differential Expression of Fas Ligand in Th1 and Th2 Cells Is Regulated by Early Growth Response Gene and NF-AT Family Members1

Robin Dzialo-Hatton*, Jeffrey Milbrandt{dagger}, Richard D. Hockett, Jr.2,3,* and Casey T. Weaver3,4,*

* Department of Pathology, University of Alabama, Birmingham, AL 35294; and {dagger} Department of Pathology and Internal Medicine, Washington University School of Medicine, St. Louis, MO 63110


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inducible expression of Fas ligand (CD95 ligand) by activated T cells and the resulting apoptosis of CD95-bearing cells is a critical component of peripheral T cell homeostasis and cytotoxic effector mechanisms. Transcriptional control of the expression of Fas ligand has been attributed to a number of factors, including early growth response gene 2 (Egr2), Egr3, Sp1, and NF-AT, although a direct contribution of NF-AT is controversial. The present study confirms a role for Egr factors and indicates that NF-AT is essential for optimal expression of murine Fas ligand through a direct interaction with an NF-AT consensus element. The role of these factors was further defined by studying the differential expression of Fas ligand in Th1 and Th2 lines derived from DO11.10 TCR transgenic mice. EMSA analyses of a composite Egr/NF-AT site showed recruitment of Sp1 to this site in Th2 cells, but not in Th1 cells. Furthermore, gel-shift analyses demonstrated the binding of Egr1, 2, and 3 in Th2 cells and Egr1 and 2, but not Egr3 in Th1 cells at a known Egr site. Northern analysis corroborated the lack of Egr3 in Th1 cells. Differential usage of these transcription factors by Th1 and Th2 cells suggests a potential mechanism underlying the differential expression of Fas ligand by distinct T cell lineages.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The activation of T lymphocytes through TCR ligation is critical for the generation of an immune response. Receptor stimulation results in the proliferation and differentiation of these cells, and at the conclusion of a response, activation-induced cell death can occur, serving as a means to preserve the homeostasis of the immune system (1, 2, 3). The interaction of Fas (CD95) with its partner, Fas ligand (FasL;5 CD95L), results in death of the Fas-bearing cell by apoptosis, thereby contributing to cytolytic effector functions and also to the termination of specific immune responses through activation-induced cell death (4, 5, 6, 7). CD95, a member of the TNFR superfamily, is inducibly expressed on a wide variety of cell types, whereas the expression of FasL is primarily limited to activated lymphocytes, macrophages, dendritic cells, neutrophils, and cells of the testis and eye (8, 9, 10, 11, 12). Within the T cell population, activated Th1 cells have been shown to express FasL, whereas Th2 cells lack its expression (13, 14, 15). The restricted expression of FasL and the inducibility of its mRNA following TCR stimulation have suggested that the regulation of CD95 ligand in T cells occurs primarily at the transcriptional level (4, 5, 8, 16).

Promoter studies aimed at understanding the transcriptional control of FasL have revealed a variety of transcription factors that can induce the expression of FasL depending on the type of stimulus and the cell population tested. The inhibition of FasL induction in T cells by cyclosporin A (CsA) has directed the search to factors that are sensitive to CsA (17, 18). CsA inhibits the calcineurin-dependent dephosphorylation of NF-AT, which is required for nuclear translocation and function of NF-AT in the expression of IL-2 and other cytokine genes (19). NF-AT consensus sequences have been identified in the human and mouse FasL promoters, and NF-AT has been shown to enhance the expression of FasL in several studies (20, 21, 22, 23). Accordingly, mice bearing mutations in NF-ATp (NF-ATc2) or in both NF-ATp and NF-AT4 (NF-ATc3) have impaired ability to express FasL (24, 25). Induction of the early growth response genes Egr2 and Egr3 following TCR engagement is also inhibited by CsA, and it has been argued that Egr factors are the dominant regulators of FasL expression in T cells (26, 27). It has also been proposed that Egr and NF-AT form composite sites within the FasL promoter and can cooperatively regulate transcription (28). Other recent evidence points to NF-AT as a regulator of the expression of Egr2 and Egr3, implying that the effect of NF-AT on the transcription of FasL is indirect (29, 30). Stress-inducing stimuli such as UV radiation, {gamma}-irradiation, and DNA-damaging agents can also increase the expression of FasL in T cells through the CsA-independent factors AP-1, NF-{kappa}B, and a MEK (mitogen-activated protein/extracellular signal-related kinase kinase) kinase-1-regulated response element (31, 32).

Conflicting data concerning the elements most responsible for the regulation of FasL may be attributable to the variety of cell lines and hybridomas that have been used for its study. To elucidate the elements that control FasL transcription in T cells, we have examined the promoter region using reporter constructs in a mouse T cell hybridoma and have extended these observations to analyses of more physiological Th1 and Th2 cells. By exploiting the differential expression of FasL in Th1 and Th2 cells, we find differences in transcriptional complexes between the two cell types that provide further insight into the regulation of the FasL gene.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice and cell lines

DO11.10 TCR transgenic mice on a BALB/c background (33, 34) were bred in a specific pathogen-free facility and were screened at age 3–4 wk for transgene expression by two-color flow cytometric analysis after staining of peripheral blood with anti-CD4 and the anti-clonotype mAb, KJ1-26 (35). BALB/c mice were purchased from The Jackson Laboratory (Bar Harbor, ME) or bred in our facility. The DO11.10 T cell hybridoma (35) was maintained in RPMI supplemented with 10% FCS, 20 mM glutamine, 10 mm HEPES, penicillin (1000 U/ml), and streptomycin (1000 U/ml). Cloned Th1 and Th2 lines were generated and maintained as described (36).

Generation of Th1 and Th2 cells

Naive CD4+ T cells were isolated from DO11.10 spleen and lymph nodes by positive sorting using anti-CD4 magnetic beads (Dynal AS, Oslo, Norway). Greater than 95% of the resulting cells were positive for CD4 and were plated at a ratio of 1:5 with irradiated BALB/c splenocytes and 5 µg/ml OVA peptide 323–339. The addition of 50 U/ml IL-12 (R&D Systems, Minneapolis, MN) and 10 µg/ml anti-IL-4 (11B11) (37) was used to generate cells with a Th1 phenotype, while 1000 U/ml IL-4 (R&D Systems) and 10 µg/ml anti-IL-12 (C17.8) (38) were used to generate cells with a Th2 phenotype (39).

Cloning the FasL promoter and determination of transcriptional start site

A mouse FasL cDNA was isolated by RT-PCR amplification of mRNA from PMA/ionomycin-activated Th1 cells using the following primers: 5' sense, ATGCAGCAGCCCATGAATTACCC and 3' antisense, TTAAAGCTTATACAAGCCGAAAAAGG. The full-length cDNA was used to screen a murine 129 liver genomic library (Stratagene, La Jolla, CA), and four phage clones were isolated. Using oligonucleotides specific for the 5' and 3' ends of the cDNA, one clone was identified that hybridized solely with the 5' probes. From this phage, a BamHI to BglII fragment was isolated that contained 2.2 kb of the murine FasL promoter, which was sequenced in its entirety by dideoxy chain termination sequencing (United States Biochemical, Cleveland, OH). To define the transcriptional start site, primer extension analysis was performed by hybridizing 10 µg Th1 total RNA to a 32P end-labeled primer corresponding to 5'-TTCTGTCCTTGACACCTGAG-3' and extending with reverse transcriptase (SuperScript II; Life Technologies, Gaithersburg, MD). The product was resolved on a denaturing 6% polyacrylamide gel alongside of a dideoxy chain termination sequencing reaction using the same primer and a fragment of the mouse FasL promoter.

Generation of promoter/reporter constructs

To generate the luciferase reporter constructs, PCR products were generated using Expand High Fidelity PCR System (Roche Molecular Biologicals, Indianapolis, IN) and oligonucleotides synthesized based on the sequence of the 2.2-kb BamHI/BglII fragment. The upstream primer of each pair incorporated a HindIII site, and the downstream oligomer incorporated a BglII site. After PCR, the products were digested with HindIII and BglII, purified, and subcloned into pGL3basic (Promega, Madison, WI). Clones for each construct were isolated and sequenced to prove authenticity. Internal mutational constructs were generated by oligonucleotide site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit; Stratagene). Mutations were confirmed by automated sequencing (Applied Biosystems, Foster City, CA; University of Alabama at Birmingham Department of Microbiology sequencing facility).

Transfection into the DO11.10 hybridoma and luciferase assay

A total of 2.5 x 106 DO11.10 cells was transfected with 2 µg murine FasL promoter/pGL3 (firefly luciferase) construct and 150 ng pRL-TK (Renilla luciferase, an internal control for transfection efficiency) using DEAE-dextran (Amersham Pharmacia, Uppsala, Sweden). Cells were rested overnight and stimulated the following day for 5 h with 750 ng/ml ionomycin and 50 ng/ml PMA (Sigma, St. Louis, MO). Following stimulation, the Dual Luciferase Assay (Promega) was performed by lysing the cells in Passive Lysis Buffer, and reading the relative light units of one-fifth the lysate with both the firefly substrate and the renilla substrate using a Turner Systems TD 20/20 luminometer (Promega). Each transfection was performed in triplicate and in a minimum of five independent experiments .

Nuclear extract preparation

Th1 and Th2 cells were either left unstimulated or treated for 5 h with 50 ng/ml PMA and 750 ng/ml ionomycin (Sigma). Extracts were prepared (adapted from Latinis 1997) by lysing 5 x 107 cells in 500 µl of a solution containing 3 mM MgCl2, 40 mM KCl, 10 mM HEPES, pH 7, 5% glycerol, 0.2% Nonidet P-40, 1 mM DTT, and Complete-EDTA Free protease inhibitor (Roche, Indianapolis, IN). Lysates were centrifuged at 14,000 rpm for 2 min at 4°C. Pellets were resuspended in 300 µl 1.5 mM MgCl2, 420 mM KCl, 20 mM HEPES, pH 7.9, 0.2 mM EDTA, 25% glycerol, 1 mM DTT, and Complete-EDTA Free, and incubated at 4°C for 1 h. Nuclear lysates were dialyzed overnight at 4°C vs 0.1 M KCl, 20 mM HEPES, pH 7.9, 0.2 mM EDTA, 20% glycerol, 1 mM DTT, and Complete-EDTA Free. Lysates were then concentrated using Microcon spin concentrators (Millipore, Bedford, MA), and the resulting protein concentration was determined (Bio-Rad Protein Assay; Bio-Rad, Hercules, CA).

EMSAs

EMSAs were performed by incubating 10 µg of protein from nuclear extracts with 0.02 pmol 32P end-labeled double-stranded oligonucleotide probes in binding buffer containing 10 mM Tris, pH 7.5, 75 mM KCl, 10% glycerol, 0.1 mM EDTA, 2.5 mM MgCl2, 0.25 mM DTT, and 1 µg poly(dI-dC)·poly(dI-dC) (Amersham Pharmacia Biotech, Piscataway, NJ) at room temperature for 20 min. Supershifts were performed by adding 2 µg Ab to the nuclear extract and binding buffer and incubating for 30 min at 4°C, followed by the addition of the labeled probe and incubating at room temperature for an additional 20 min. Protein/DNA complexes were resolved on 5.8% polyacrylamide gel run in 1x Tris-glycine-EDTA, pH 8.5, at 200 V at 4°C. Egr1, Egr3, Sp1, and Sp3 Abs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). NF-ATp (NF-ATc2), clone G1-D10, was obtained from PharMingen-BD (San Diego, CA), and NF-ATc (NF-ATc1), clone 7A6, from Affinity BioReagents (Golden, CO). An anti-Egr-2 Ab was purchased from BabCO (Richmond, CA). The sequence of the NF-AT distal gel-shift probe is 5'-AATTTCTGGGCGGAAACTTCC-3', and the Egr proximal probe is 5'-GCAAGTGAGTGGGTGTCTC-3'.

Northern blot and RNase protection assay

A total of 10 µg of total RNA (TRIzol; Life Technologies) per sample was electrophoresed on a 1% agarose/formaldehyde denaturing gel, subsequently transferred to a nitrocellulose membrane (Micron Separations, Westboro, MA), and immobilized by baking at 80°C under vacuum. Probes were hybridized to the membrane in a 50% formamide solution at 42°C overnight, and final washes were in 0.1x SSC, 0.1% SDS at 60°C. Egr1, Egr2, and Egr3 cDNA probes were generated as previously described (40, 41, 42), and the mouse {gamma}-actin probe was obtained from Ambion (Austin, TX). FasL mRNA was detected with the mAPO-3 multiprobe template set using the PharMingen-BD Riboquant RNase protection assay system.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Deletional analysis of the mouse FasL promoter identifies two major DNA elements that control expression

To identify regulatory regions that control inducible expression of the mouse FasL gene, study of a 2.2-kb fragment of its promoter was undertaken. Promoter/reporter constructs containing incrementally shorter promoter fragments relative to the 2.2-kb fragment were cloned into the luciferase vector pGL3basic, and were transiently transfected into the mouse T cell hybridoma, DO11.10. The DO11.10 T cell hybridoma was used in initial experiments to define promoter regulatory regions because it demonstrates activation-dependent expression of FasL and is readily transfectable (13 , and data not shown). A gross examination of the full-length 2.2-kb fragment indicated that maximal inducible promoter activity was contained in the 326 nucleotides upstream of the translational initiation site, and a detailed deletional analysis of this region was undertaken (Fig. 1Go and data not shown). All transfected constructs had negligible luciferase activity without prior activation of the DO11.10 cells (data not shown). Upon activation, all constructs tested yielded an increase in luciferase activity compared with a construct that contained fragment -127 to -51 bp relative to the translational start site. This construct, designated the minimal promoter, contained the principal transcriptional initiation site at nucleotide -127 that was identified by primer extension analysis (Fig. 1GoA).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1. Murine FasL promoter/reporter deletional analysis. A, Determination of transcriptional start site by primer extension. A 32P end-labeled primer corresponding to a sequence 53 nucleotides upstream of the translational start site of the mouse FasL promoter was hybridized to Th1 mRNA. The reverse-transcribed product was compared with a sequencing reaction of the promoter primed with the same oligomer. The bold arrow denotes the major transcriptional start site; the thin arrow denotes a minor transcriptional start site. B, Promoter/reporter constructs were made with progressively 5' truncated mouse FasL promoter fragments cloned into pGL3 basic luciferase vector (Promega). A total of 2.5 x 106 DO11.10 hybridoma cells was transfected with 2 µg of promoter construct along with pRL-TK to control for transfection efficiency. At 18 h after transfection, cells were stimulated with PMA + ionomycin for an additional 5 h. The hatched boxes in the schematic of the FasL promoter represent the putative Egr/Sp1/NF-AT site; black boxes represent the proximal Egr consensus sequence. Negative numbers denote bp distances from the first bp of the translational start codon. The arrow at -127 bp identifies the major transcriptional start site. Data are the means and SEM of at least five separate determinations and are normalized to an internal Renilla control. Activity is expressed as fold increase relative to the minimal promoter (bp -127 to +1).

 
From these analyses, three regions of the -326 promoter fragment were identified that contained apparent regulatory elements (Fig. 1GoB). A small, but reproducible, activation-dependent increase in luciferase activity was identified in construct -190 compared with the minimal promoter. Searches of transcription factor databases (TESS, URL: http//www.cbil.upenn.edu/tess/index.html) identified an Egr-like site in this region (-183GAGTGGGTG-175) (23, 26, 41). A 2.4-fold increase in activity of construct -200 over -190 identified a potential AP4 site in this region (43). However, deletion of this site (-200CAGCTT-195) in the context of the -326 promoter fragment resulted in no decrease in activation-dependent luciferase activity (13.6 ± 1.6-fold increase vs 13.8 ± 1.1-fold increase), and it was not studied further. The inclusion of DNA fragment -250 to -235 resulted in nearly maximal promoter activity. Transcription factor database searches indicated that this fragment contains a potential Egr/Sp1/NF-AT composite site at -250 to -236 (21, 22, 28, 44), although the Egr-like sequence within this site (-248TTCTGGGCG-240) diverges from the Egr consensus nonamer at its 5' end (GCGTGGGCG; Ref. 41). Comparison of the human and mouse FasL proximal promoter sequences identified high homology in these regions (Fig. 2Go), consistent with conserved function in both species (21, 28, 45).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. Comparison of proximal FasL promoter sequences of mouse and human. Numbering is from the translational start site of the mouse FasL gene. Nucleotides of the human FasL promoter that differ from corresponding nucleotides in the mouse are underlined; gaps inserted for optimal alignment are indicated. The boxed sites are putative regulatory sites. The arrow identifies the major transcriptional start site of the mouse FasL gene (see Fig. 1Go).

 
Analysis of CsA effects on FasL promoter function identifies nonredundant effects on Egr/Sp1 and Egr/Sp1/NF-AT sites

It has been shown that expression of FasL is inhibited by CsA (17, 18). To define the CsA sensitivity of individual regulatory sites in the -326 promoter fragment, the effect of CsA was examined in the context of different FasL promoter fragments. CsA completely abolished activation-induced luciferase expression of constructs -200 and -230, each of which contains the Egr/Sp1 consensus site and lacks the Egr/Sp1/NF-AT site (Fig. 3Go). This is consistent with the inhibitory effects of CsA on the NF-AT-dependent expression of Egr2 and Egr3 (27, 46). Likewise, CsA completely inhibited expression driven by the -240 construct that terminates immediately 5' of the NF-AT consensus site within the putative Egr/Sp1/NF-AT composite site, and therefore lacks the Egr/Sp1 component. An increase in luciferase activity of the CsA-treated -250 as compared with -240 could conceivably be due to the effects of the CsA-insensitive factor Egr1 or Sp1 at this site. Similarly, a contribution by additional CsA-insensitive factor(s) may account for the increased promoter activity found by inclusion of sequences 5' of the -250 construct. Collectively, these results confirm that CsA-sensitive factors are necessary for maximal induction of the FasL promoter, but do not distinguish CsA effects that directly affect the Egr/Sp1/NF-AT site, indirectly affect the Egr/Sp1 site, or both. CsA-insensitive factors that map 5' of the NF-AT core consensus site (-240GGAAA-234) contribute relatively modest promoter activity.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 3. CsA effects on the murine FasL proximal promoter. The indicated promoter constructs were transfected into DO11.10 hybridoma cells as in Fig. 1Go. At 18 h after transfection, cells were stimulated with PMA + ionomycin for an additional 5 h without ({blacksquare}) or with () the addition of 100 ng/ml CsA. The hatched boxes in the schematic of the FasL promoter represent the putative Egr/Sp1/NF-AT site; black boxes represent the proximal Egr consensus sequence. Data are the means and SEM of at least four separate determinations and are normalized to an internal Renilla control. Activity is expressed as fold increase relative to the minimal promoter.

 
To confirm the regulatory role of the DNA elements identified above and better define the effects of CsA on each regulatory site, a mutational analysis was performed in the context of the -326 construct. Fig. 4Go shows the effects of mutations made to both the putative proximal Egr/Sp1 site and to the more distal Egr/Sp1/NF-AT site. Mutation of the Egr-like sequence (-183GAGTGGGTG-175) of the proximal Egr/Sp1 site (mut1) reduced the maximal promoter activity by nearly half. Mutation of flanking nucleotides 5' of the putative Egr/Sp1 site (mut2) resulted in a more modest decrease in promoter activity, which paralleled that seen with deletion of these bases between constructs -190 and -181 (Fig. 1Go). In contrast, mutation of this region in the context of the mutated Egr/Sp1 site (mut3) did not further diminish the decreased luciferase expression, suggesting that function of this 5' flanking sequence was Egr/Sp1 site dependent.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 4. Mutational analysis of murine FasL proximal promoter. A promoter fragment consisting of nucleotides -51 to -326 relative to the translational start site cloned into pGL3 basic was used as the backbone for mutational analyses. The hatched and black boxes in the FasL promoter schematic represent the putative Egr/Sp1/NF-AT proximal Egr/Sp1 sites, respectively. Internal mutations or deletions are identified and align with * beneath the sequence. Transfections were performed as in Fig. 1Go. Black bars in the graph denote stimulation with 50 ng/ml PMA and 750 ng/ml ionomycin; gray bars denote stimulation with PMA, ionomycin, and CsA (100 ng/ml). Data are the means and SEM of at least three determinations.

 
A greater reduction in promoter activity was apparent when the consensus NF-AT site sequence (-240GGAAA-236) was mutated (mut4) or deleted (mut5), resulting in approximately 4- and 3-fold decreases in promoter activity, respectively. Mutation of the Egr/Sp1 consensus nucleotides at -244 to -241 of the Egr/Sp1/NF-AT composite site (mut6) resulted in a more modest reduction of luciferase activity, but confirmed the positive contribution of this flanking sequence indicated by deletional analysis above (construct -250 vs construct -240; Fig. 1Go). Mutations encompassing the entire Egr/Sp1/NF-AT composite site (mut7) had essentially the same effect as mutation of the NF-AT site alone, arguing that NF-AT is essential for the function of this site. Notably, in the absence of both the consensus NF-AT site and the proximal Egr/Sp1 site (mut8), FasL promoter activity was completely abolished, suggesting that no other promoter elements are functional in the absence of these sites. Also, the addition of CsA further diminished the activity of each construct except mut8, indicating that functional elimination of either the Egr/Sp1 site or the Egr/Sp1/NF-AT site resulted in residual promoter activity that was CsA sensitive. Thus, although the Egr/Sp1/NF-AT site appears to contribute the majority of the proximal promoter activity, intact Egr/Sp1 and Egr/Sp1/NF-AT sites are required for maximal activity. Furthermore, the inhibitory effects of CsA act upon the two sites independently.

Distinct complexes of Egr and NF-AT family members are present in nuclear extracts from activated Th1 and Th2 cells

Conflicting results concerning the contribution of NF-AT and Egr factors have been reported in previous studies of the human and mouse FasL promoters and may be due in some part to the different transformed cell lines that have been used as transfection hosts (21, 22, 23, 26). To obviate potential cell line-dependent effects, we chose to extend our analyses to nontransformed T cells of identical Ag specificity to the DO11.10 hybridoma used in the transfection studies above. Cloned Th1 and Th2 lines were derived from the DO11.10 transgenic mouse and tested for their expression of FasL (Fig. 5Go). Consistent with published data (13, 14, 15), DO11.10-derived activated Th1 cells expressed FasL, whereas Th2 cells did not. The basis for differential expression of FasL by these two T cell lineages was pursued to better define the critical transcriptional factors that control FasL expression. Although cloned Th1 and Th2 cells are resistant to DNA transfection and therefore a poor model for transfection-based promoter analyses, they do provide a more physiologic model for examination of the transcription factors that might or might not be available for interaction with regulatory sequences within the FasL promoter.



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 5. RNase protection assay analysis of FasL expression in Th1 and Th2 clones. Total RNA was prepared from Th1 and Th2 cells derived from the DO11.10 TCR transgenic mouse. Cells were activated for 5 h with 50 ng/ml PMA plus 750 ng/ml ionomycin, where indicated. Two micrograms of each sample were analyzed using the BD-PharMingen mAPO-3 probe template.

 
Nuclear extracts were prepared from stimulated and unstimulated Th1 and Th2 cells and were examined for the presence or absence of binding activity to DNA elements identified in transfection studies of the DO11.10 hybridoma above. EMSA analyses performed using a probe encompassing the proximal Egr/Sp1 site (-189 to -171) demonstrated that activation of both Th1 and Th2 cells induced the assembly of a DNA-binding complex specific for this site (Fig. 6Go). However, the DNA-binding complexes of activated Th1 and Th2 extracts were distinct.



View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 6. EMSA analysis of the proximal Egr site in the FasL proximal promoter. EMSAs were performed using the indicated FasL probes and extracts from cloned Th1 and Th2 cells derived from the DO11.10 TCR transgenic mouse. Cells were activated for 5 h with PMA/ionomycin, where indicated, and nuclear extracts were prepared. In supershift experiments, Abs specific for Egr1, Egr2, and Egr3 or Sp1 and Sp3 were used singly or in the indicated combinations. The arrow indicates a complex supershifted by anti-Egr3 in Th2 nuclear extracts. Anti-Pax1 was used as an isotype-matched negative control.

 
To define the composition of the complexes identified, Abs specific for distinct Egr and Sp1 family members were used (Th1, lanes 3–10, and Th2, lanes 14–21). Initial studies demonstrated that Egr1 and Egr2 were present in complexes that bound this site from both activated Th1 and Th2 nuclear extracts. In contrast, Egr3 was present only in Th2 cell extracts and appeared to shift the fastest migrating component of the complex (Th1, lanes 5, 7, and 8 vs Th2, lanes 16, 18, and 19). Therefore, activated Th2 extracts contain binding activity for each of the three Egr factors examined (Egr1, Egr2, and Egr3), whereas complexes formed with activated Th1 extracts were supershifted by Abs specific for Egr1 and Egr2, but not Egr3. In both activated Th1 and Th2 extracts, the dominant binding activity appeared to be contributed by Egr2 (Fig. 6Go and data not shown).

Combinations of different anti-Egr Ab pairs (lanes 6–8 and 17–19 in Fig. 6Go, and data not shown) suggested that Egr-containing complexes bound to the proximal Egr/Sp1 site were monomeric rather than heteromeric (47). Both Sp1 and Sp3 were detected in activated Th1 and Th2 extracts (Fig. 7GoB and data not shown), but neither factor bound the putative Sp1 site contained in the FasL probe (Fig. 6Go). A negative control Ab to Pax1 (lanes 11 and 22) was also negative. Mutations introduced into the Egr consensus sequence of EMSA probes encompassing nucleotides -189 to -171 (-180TGGGTG-175->-180CAAGCG-175) abrogated binding of the activation-induced complexes and all Egr family supershifts (data not shown). Collectively, these data suggest that the activation-dependent transcriptional complex targeting this sequence is specific in both Th1 and Th2 cells, yet differs in its composition .



View larger version (73K):
[in this window]
[in a new window]
 
FIGURE 7. EMSA analysis of the distal Egr/NF-AT composite site in the FasL proximal promoter. A, EMSAs were performed using the indicated FasL probes and extracts from Th1 and Th2 cells as in Fig. 4Go. Arrows and arrowheads indicated the mobilities of complexes supershifted by anti-Egr1 and anti-NF-ATp, respectively. Filled and open arrows/arrowheads identify distinct complex mobilities from Th1 (filled) and Th2 (open) extracts, respectively. B, A Sp1 family consensus sequence probe was used as a control to demonstrate the presence of Sp1 and Sp3 nuclear activities in supershift EMSAs using Th1 cells.

 
To further identify factors contributing to the inducible expression of FasL, we examined Th1 and Th2 nuclear extracts for binding to the distal Egr/Sp1/NF-AT composite site. A probe containing both the putative Egr/Sp1 and NF-AT sites was prepared (-252 to -232) and used in mobility shift assays. Specific DNA-binding complexes were apparent in nuclear extracts from activated Th1 and Th2 cells, although, again, mobilities of the complexes were distinct in the two cell types (Fig. 7GoA). All complexes shifted by Th1 extracts had slightly slower migration properties than those from Th2 extracts, suggesting the possibility of an additional factor in the Th1 complex. Anti-NF-ATp supershifted the majority of the activation-induced complex in both Th1 and Th2 extracts, confirming the contribution of NF-AT (21, 22, 23, 48, 49). However, only in Th2 extracts was a supershifted complex identifiable with anti-NF-ATc. Similarly, Sp1 was only detected in complexes formed with Th2 extracts (Fig. 7GoA). Sp3 was identified in activated Th1 and Th2 nuclear extracts and bound a control probe that contained the Sp3 consensus sequence (Fig. 7GoB), but did not bind the Egr/Sp1/NF-AT composite site of FasL.

Abs to Egr1 supershifted a complex in both Th1 and Th2 cells, but no binding to anti-Egr2 or anti-Egr3 was evident, suggesting that this Egr site had more restrictive binding characteristics than the proximal Egr site discussed above. The inability to bind multiple Egr family members may be due to a weaker consensus site, the close proximity of the NF-AT binding site, or both. The distal Egr/Sp1/NF-AT site is able to bind both Egr and NF-AT family members in extracts from both Th1 and Th2 cells, but the addition of Sp1 and NF-ATc to the Th2 complex or the possibility of an additional factor from the slower migrating Th1 complex may account for the differential expression of FasL in these two cell types.

Egr3 mRNA is preferentially expressed in activated Th2 cells

Because of the differences found in DNA-binding complexes formed with the proximal Egr/Sp1 site probe in Th1 and Th2 cells, further investigation into the expression of the Egr family members was undertaken. Northern analyses were performed with total RNA prepared from cloned Th1 and Th2 cells that were not activated, or were activated with PMA/ionomycin for 1, 2, and 4 h (Fig. 8Go). Resting Th1 and Th2 cells were negative for expression of each of the Egr family members. Following PMA/ionomycin stimulation, there was rapid expression of Egr1 and Egr2 by both populations, followed by rapid decay of expression (46). Both Th1 and Th2 cells expressed readily detectable Egr1 and Egr2 mRNA 1 h after activation, although Th2 cells appeared to express lower levels of Egr1 and Egr2 mRNA. Levels of Egr1 and Egr2 mRNA were markedly decreased or undetectable at 4 h. Consistent with the absence of detectable Egr3 protein in DNA-binding complexes from Th1 cells, no Egr3 mRNA was detected in Th1 cells, whereas Th2 cells expressed Egr3 with similar kinetics to Egr2. Thus, the lack of Egr3 binding to the proximal Egr/Sp1 EMSA probe in Th1 nuclear extracts (Fig. 6Go) was due to a global deficiency of Egr3 gene transcription by Th1 cells and was not specific to the proximal Egr/Sp1 site.



View larger version (78K):
[in this window]
[in a new window]
 
FIGURE 8. Northern blot analysis of Egr family member expression by Th1 and Th2 cells. Ten micrograms of total RNA were initially probed with a 508-bp cDNA fragment of Egr3. Blots were stripped after each hybridization and rehybidized with probes specific for Egr1, Egr2, and {beta}-actin. A, RNA prepared from DO11.10 TCR long-term cloned Th1 and Th2 lines. B, RNA prepared from primary CD4+ T cells isolated from DO11.10 TCR transgenic mice and cultured under Th1/Th2-polarizing conditions for 1 wk. Recovered Th1- and Th2-polarized cells were restimulated as indicated. The hybridizing bands had relative mobilities of 3.4 kb (Egr1), 3.2 kb (Egr2), and 4.8 kb (Egr3).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although NF-AT and Egr factors have been previously implicated in FasL gene regulation, the relative contributions of these groups of factors and their individual family members have been contentious. The approach of identifying critical regulatory sites in the FasL promoter by transfection-based deletional and mutational analyses in the DO11.10 hybridoma and translating these findings to DO11.10 Th1 and Th2 cell lines that differentially express FasL has permitted distinct insights into this issue. This study supports a role for both NF-AT and Egr family members in the transcriptional control of the FasL gene in murine T cells and identifies differences in the DNA-binding complexes that promote FasL transcription in Th1 cells, but not Th2 cells.

The transfection studies reported in this study are in agreement with those of other groups that have emphasized the importance of NF-AT sites in the human FasL promoter (21, 22, 23, 48, 49). In apparent conflict with these results, it has been reported that Egr2 or Egr3 acts at the proximal Egr site to confer most of the activation-induced expression of FasL (26, 27). Since NF-AT appears to be required for Egr2 and Egr3 expression in T cells, it was proposed that the effect of NF-AT on FasL transcription is largely indirect, acting through its induction of the Egr2 and Egr3 promoters (29, 30). Our own studies favor a direct role for NF-AT in FasL gene activation. Thus, mutations in the NF-AT consensus sequence of the Egr/Sp1/NF-AT composite site (-236 to -240) had a more profound effect on expression of FasL in the DO11.10 hybridoma than mutations in the Egr proximal site (-181 to -175), although both sites were critical for maximal promoter activity. Also, CsA significantly inhibited residual promoter activity in constructs with an ablated Egr/Sp1 proximal site, strongly supporting a direct effect of NF-AT at the Egr/Sp1/NF-AT site.

When both the NF-AT consensus sequence in the Egr/Sp1/NF-AT composite site and the Egr/Sp1 proximal sites were destroyed, promoter activity was completely abolished. These results argue that no other factors act independently of NF-AT and Egr factors in this region; to achieve maximal promoter activity, both the Egr/Sp1/NF-AT and the Egr1/Sp1 proximal sites must be occupied. There is clearly a modest effect of 5' flanking sequences on the optimal activation of both the Egr/Sp1/NF-AT and the Egr/Sp1 proximal sites, since mutation or deletion of these regions partially blocked their function. However, activity of these regions appears to be dependent on occupancy of the adjacent NF-AT or Egr sites, respectively. In contrast to some studies in the human (28), we found no evidence of additional NF-AT-responsive sites in the murine FasL promoter. In particular, an additional NF-AT-responsive site has been proposed in the human promoter juxtaposed 5' of the Egr/Sp1 proximal site (28). This consensus site does not exist in the mouse promoter, and we have been unable to demonstrate NF-AT binding to DNA in this region (data not shown). Collectively, these data support a model in which NF-AT and Egr factors act cooperatively through interactions at the Egr/Sp1/NF-AT and the Egr1/Sp1 proximal sites (28, 48).

EMSA analyses of activated Th1 and Th2 extracts demonstrated distinct patterns of transcription factor binding to both the Egr1/Sp1/NF-AT and the Egr/Sp1 proximal sites. NF-ATc binding was not detected in Th1 extracts using the Egr1/Sp1/NF-AT probe, but was detected in activated Th2 extracts. The preferential expression of NF-ATc in Th2 extracts is consistent with published results (24, 50), and could play a role in the suppression of FasL in Th2 cells. However, this is probably unlikely given the predominance of NF-ATp binding in both cell types. By similar reasoning, it is also unlikely that Sp1 binding to the Egr1/Sp1/NF-AT site in Th2 extracts accounts for their deficiency of FasL expression, although in some cases Sp1-mediated transcriptional activation can be repressed by an inhibitory member of the Sp family, Sp3 (51). It is clear from the EMSA studies, however, that the sizes of Th1 and Th2 complexes that bind the Egr1/Sp1/NF-AT site are distinct, and it is probable that additional, unidentified factors participate in the function of this site.

Interestingly, we and others have been unable to demonstrate the presence of AP-1 cofactors interacting at the Egr/Sp1/NF-AT site ((52) and data not shown). Thus, although there is precedent for NF-AT acting independently, it is intriguing that Egr1 binds in such close proximity to NF-AT at this site and could conceivably act as an NF-AT cofactor (21). In this vein, Egr1 has been shown to both functionally and physically interact with the RelA subunit of NF-{kappa}B, and this interaction modulates the transcriptional activity of NF-{kappa}B (53). Because the DNA-binding domain of NF-AT shares moderate sequence similarity to the DNA-binding domains of Rel family proteins (19), it is possible that Egr1 could interact directly with NF-AT to modulate its transcriptional capacity in a similar way. Also of interest is the absence of Egr2 or Egr3 binding to this site, despite the presence of both factors in the nucleus of activated Th2 cells, or in the case of Th1 cells, the presence of Egr2. The 5' sequence immediately flanking the NF-AT site is not a canonical Egr site (41), but does contain a stretch of seven contiguous nucleotides (-245TGGGCGG-239) that partially overlap the NF-AT consensus site at the 5' end and have sequence identity to the 3' end of a Egr consensus site. Preliminary EMSA experiments that have examined Egr/Sp1/NF-AT site probes with a mutation of the NF-AT consensus site that conserves the putative Egr site indicate that Egr1 does not bind without an intact NF-AT site (data not shown), suggesting that recruitment of Egr1 to this site may be NF-AT dependent.

Th1 and Th2 cells differed in the activation-dependent assembly of transcriptional complexes that bound the Egr proximal element of the FasL promoter. The nuclei of both Th1 and Th2 cells contained Egr1 and Egr2 that could bind the Egr proximal site, whereas Th2 cells uniquely expressed Egr3 nuclear activity. Sp1 family members were not important in the regulation of this site in either lineage. Although Egr1 was present and could bind this site, it is unlikely to function independently of Egr2 or Egr3, since CsA blocked activity of this site and Egr1 is not CsA sensitive (46). The absence of Egr3 binding to the Egr/Sp1 site in Th1 cells suggests either that Egr3 is not critically involved in FasL regulation, or that Egr2 can effectively replace this activity in the absence of Egr3. A recent report by Rengarajan et al. (30) proposed that the Th2 lineage is FasL negative due to deficient expression of Egr3. This is difficult to reconcile with our results, since Th1 cells in our study expressed FasL in the absence of Egr3, and since Egr3 was well expressed by Th2 cells. It would therefore appear that the lack of FasL expression by Th2 cells is not due to a deficiency of Egr3. It is possible that Rengarajan’s results differ from ours based on the time points of Egr expression studied and/or the activation protocols employed. However, our kinetic analyses of Egr mRNA expression (maximal expressed as early as 1 h after activation and down-regulation by 4 h) are consistent with published data concerning the kinetics of expression of early growth response genes (46). Finally, mice with a targeted disruption of Egr3 experience no lymphoproliferative disorders that are typical of FasL-deficient mice (54), and T cells from these mice can express FasL (unpublished data).

Since it appears that Th2 cells possess the major transcription factors necessary for the production of FasL (NF-ATp and Egr2/Egr3), what is responsible for the lack of FasL expression by these cells? While it is possible that Egr3 might repress FasL expression in the context of Th2 cells, this seems unlikely given other data that Egr3 is a positive regulator of FasL (26, 27). Indeed, in recent studies of short-term Th1 lines derived from DO11.10 TCR transgenic mice, there appears to be no negative correlation between Egr3 and FasL expression (unpublished observation). An alternative possibility is the presence of yet to be identified negative regulatory factors that are preferentially active in Th2 cells. The mobility of the DNA-binding complex interactive with the Egr1/Sp1/NF-AT distal site is decidedly different in nuclear extracts from activated Th1 and Th2 cells, and it is conceivable that negative factors are present in this complex. It has been demonstrated that transcriptional activation by Egr family members can be modulated by interactions with the NGF1-A-binding protein (NBA) family of corepressors, and NAB1 and NAB2 have been shown to down-regulate the activity of Egr1, Egr2, and Egr3 (55, 56, 57). Examination of the expression and function of NAB factors in Th1 and Th2 cells warrants investigation. Another plausible explanation is that although the appropriate transcription factors are expressed in the Th2 lineage, the FasL gene locus is inaccessible in this cell type, analogous to the regulation of cytokine genes by modulation of chromatin structure during Th1 and Th2 development (58). Experiments designed to examine the accessibility of the FasL promoter in Th2 cells are presently being undertaken.


    Acknowledgments
 
We thank Dr. Vincent Hurez for critical review of the manuscript, and Sharron Shehan for excellent secretarial support.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants AR43272 (to C.T.W.) and T32 AI07051 (to R.D.-H.), and a grant from Sankyo Company (to C.T.W.). Back

2 Current address: Eli Lilly and Company, Indianapolis, IN 46285. Back

3 R.D.H. and C.T.W. contributed equally to this work. Back

4 Address correspondence and reprint requests to Dr. Casey T. Weaver, Department of Pathology, University of Alabama, Birmingham, AL 35294. Back

5 Abbreviations used in this paper: FasL, Fas ligand; CsA, cyclosporin A; Egr, early growth response gene; NAB, NGF1-A-binding protein. Back

Received for publication September 22, 2000. Accepted for publication January 22, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nagata, S.. 1997. Apoptosis by death factor. Cell 88:355.[Medline]
  2. Green, D. R., D. W. Scott. 1994. Activation-induced apoptosis in lymphocytes. Curr. Opin. Immunol. 6:476.[Medline]
  3. Russell, J. H.. 1995. Activation-induced death of mature T cells in the regulation of immune responses. Curr. Opin. Immunol. 7:382.[Medline]
  4. Brunner, T., R. J. Mogil, D. LaFace, N. J. Yoo, A. Mahboubi, F. Echeverri, S. J. Martin, W. R. Force, D. H. Lynch, C. F. Ware, D. R. Green. 1995. Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature 373:441.[Medline]
  5. Alderson, M. R., T. W. Tough, T. Davis-Smith, S. Braddy, B. Falk, K. A. Schooley, R. G. Goodwin, C. A. Smith, F. Ramsdell, D. H. Lynch. 1995. Fas ligand mediates activation-induced cell death in human T lymphocytes. J. Exp. Med. 181:71.[Abstract/Free Full Text]
  6. Dhein, J., H. Walczak, C. Bäumler, K.-M. Debatin, P. H. Krammer. 1995. Autocrine T-cell suicide mediated by APO-1/(Fas/CD95). Nature 373:438.[Medline]
  7. Ju, S.-T., D. J. Panka, H. Cui, R. Ettinger, M. El-Khatib, D. H. Sherr, B. Z. Stanger, A. Marshak-Rothstein. 1995. Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature 373:444.[Medline]
  8. Suda, T., T. Takahashi, P. Golstein, S. Nagata. 1993. Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis family. Cell 75:1169.[Medline]
  9. Badley, A. D., D. Dockrell, M. Simpson, R. Schut, D. H. Lynch. 1997. Macrophage-dependent apoptosis of CD4+ T lymphocytes from HIV-infected. J. Exp. Med. 185:55.[Abstract/Free Full Text]
  10. Bellgrau, D., D. Gold, H. Selary, J. Moore, A. Franzusoff, R. C. Duke. 1995. A role for CD95 ligand in preventing graft rejection. Nature 377:630.[Medline]
  11. Griffith, T. S., T. Brunner, S. M. Fletcher, D. R. Green, T. A. Ferguson. 1995. Fas ligand-induced apoptosis as a mechanism of immune privilege. Science 270:1189.[Abstract/Free Full Text]
  12. Takahashi, T., M. Tanaka, C. I. Brannan, N. A. Jenkins, N. G. Copeland, T. Suda, S. Nagata. 1994. Generalized lymphoproliferative disease in mice, caused by a point mutation in the Fas ligand. Cell 76:969.[Medline]
  13. Suda, T., T. Okazaki, Y. Naito, T. Yokota, N. Arai, S. Ozaki. 1995. Expression of the Fas ligand in cells of T cell lineage. J. Immunol. 154:3806.[Abstract]
  14. Zhang, X., T. Brunner, L. Carter, R. W. Dutton, P. Rogers, L. Bradley, T. Sato, J. C. Reed, D. Green, S. L. Swain. 1997. Unequal death in T helper cell Th1 and Th2 effectors: Th1, but not Th2, effectors undergo rapid Fas/FasL-mediated apoptosis. J. Exp. Med. 185:1837.[Abstract/Free Full Text]
  15. Ramsdell, F., M. S. Seaman, R. E. Miller, K. S. Picha, M. K. Kennedy, D. H. Lynch. 1994. Differential ability of Th1 and Th2 cells to express Fas ligand and to undergo activation-induced cell death. Int. Immunol. 6:1545.[Abstract/Free Full Text]
  16. Yang, Y., M. Mercep, C. F. Ware, J. D. Ashwell. 1995. Fas and activation-induced Fas ligand mediate apoptosis of T cell hybridomas: inhibition of Fas ligand expression by retinoic acid and glucocorticoids. J. Exp. Med. 181:1673.[Abstract/Free Full Text]
  17. Anel, A., M. Buferne, C. Boyer, A. M. Schmitt-Verhulst, P. Golstein. 1994. T cell receptor-induced Fas ligand expression in cytotoxic T lymphocyte clones is blocked by protein tyrosine kinase inhibitors and cyclosporin A. Eur. J. Immunol. 24:2469.[Medline]
  18. Brunner, T., N. J. Yoo, D. LaFace, C. F. Ware, D. R. Green. 1996. Activation-induced cell death in murine T cell hybridomas: differential regulation of Fas (CD95) versus Fas ligand expression by cyclosporin A and FK506. Int. Immunol. 8:1017.[Abstract/Free Full Text]
  19. Rao, A., C. Luo, P. G. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 15:707.[Medline]
  20. Latinis, K. M., L. A. Norian, S. L. Eliason, G. A. Koretzky. 1997. Two NFAT transcription factor binding sites participate in the regulation of CD95 (Fas) ligand expression in activated human T cells. J. Biol. Chem. 272:31427.[Abstract/Free Full Text]
  21. Latinis, K. M., L. L. Carr, E. J. Peterson, L. A. Norian, S. L. Eliason, G. A. Koretzky. 1997. Regulation of CD95 (Fas) ligand expression by TCR-mediated signaling events. J. Immunol. 158:4602.[Abstract]
  22. Holtz-Heppelmann, C. J., A. Algeciras, A. D. Badley, C. V. Paya. 1998. Transcriptional regulation of the human FasL promoter-enhancer region. J. Biol. Chem. 273:4416.[Abstract/Free Full Text]
  23. Li-Weber, M., O. Laur, A. Hekele, J. Coy, H. Walczak, P. H. Krammer. 1998. A regulatory element in the CD95 (APO-1/Fas) ligand promoter is essential for responsiveness to TCR mediated activation. Eur. J. Immunol. 28:2373.[Medline]
  24. Ranger, A. M., M. Oukka, J. Rengarajan, L. H. Glimcher. 1998. Inhibitory function of two NFAT family members in lymphoid homeostasis and Th2 development. Immunity 9:627.[Medline]
  25. Hodge, M. R., A. M. Ranger, F. Charles de la Brousse, T. Hoey, M. J. Grusby, L. H. Glimcher. 1996. Hyperproliferation and dysregulation of IL-4 expression in NF-ATp-deficient mice. Immunity 4:397.[Medline]
  26. Mittelstadt, P. R., J. D. Ashwell. 1998. Cyclosporin A-sensitive transcription factor Egr-3 regulates Fas ligand expression. Mol. Cell. Biol. 18:3744.[Abstract/Free Full Text]
  27. Mittelstadt, P. R., J. D. Ashwell. 1999. Role of Egr-2 in up-regulation of Fas ligand in normal T cells and aberrant double-negative lpr and gld T cells. J. Biol. Chem. 274:3222.[Abstract/Free Full Text]
  28. Li-Weber, M., O. Laur, P. H. Krammer. 1999. Novel Egr/NFAT composite sites mediate activation of the CD95 (APO-1/Fas) ligand promoter in response to T cell stimulation. Eur. J. Immunol. 29:3017.[Medline]
  29. Mages, H. W., R. Baag, B. Steiner, R. A. Kroczek. 1998. Utilization of an NF-ATp binding promoter element for Egr-3 expression in T cells but not fibroblasts provides a molecular model for the lymphoid cell-specific effect of cyclosporin A. Mol. Cell. Biol. 18:7157.[Abstract/Free Full Text]
  30. Rengarajan, J., P. R. Mittelstadt, H. W. Mages, A. J. Gerth, R. A. Kroczek, J. D. Ashwell, L. H. Glimcher. 2000. Sequential involvement of NFAT and Egr transcription factors in FasL regulation. Immunity 12:293.[Medline]
  31. Faris, M., K. M. Latinis, S. J. Kempiak, G. A. Koretzky, A. Nel. 1998. Stress induced Fas ligand expression in T cells is mediated through a MEK kinase 1 regulated response element in the Fas ligand promoter. Mol. Cell. Biol. 18:5414.[Abstract/Free Full Text]
  32. Kasibhatla, S., T. Brunner, L. Genestier, F. Echeverri, A. Mahboubi, D. R. Green. 1998. DNA damaging agents induce expression of Fas ligand and subsequent apoptosis in T lymphocytes via the activation of NF-{kappa}B and AP-1. Mol. Cell 1:543.[Medline]
  33. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science 250:1720.[Abstract/Free Full Text]
  34. Kearney, E. R., K. A. Pape, D. Y. Loh, M. K. Jenkins. 1994. Visualization of peptide-specific T cell immunity and peripheral tolerance induction in vivo. Immunity 1:327.[Medline]
  35. Haskins, K., R. Kubo, J. White, M. Pigeon, J. Kappler, P. Marrack. 1983. The major histocompatibility complex-restricted antigen receptor on T cells. I. Isolation with a monoclonal antibody. J. Exp. Med. 157:1149.[Abstract/Free Full Text]
  36. Bucy, R. P., A. Panoskaltsis-Mortari, G.-Q. Huang, J. Li, L. Karr, M. Ross, J. H. Russell, K. M. Murphy, C. T. Weaver. 1994. Heterogeneity of single-cell cytokine gene expression in clonal T cell populations. J. Exp. Med. 180:1251.[Abstract/Free Full Text]
  37. Ohara, J., W. E. Paul. 1985. Production of a monoclonal antibody to and molecular characterization of B-cell stimulatory factor-1. Nature 315:333.[Medline]
  38. Wysocka, M., M. Kubin, L. Q. Vieira, L. Ozmen, G. Garotta, P. Scott, G. Trinchieri. 1995. Interleukin-12 is required for interferon-{gamma} production and lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672.[Medline]
  39. Szabo, S. J., N. G. Jacobson, A. S. Dighe, U. Gubler, K. M. Murphy. 1995. Developmental commitment to the Th2 lineage by extinction of IL-12 signaling. Immunity 2:665.[Medline]
  40. Milbrandt, J.. 1987. A nerve growth factor-induced gene encodes a possible transcriptional regulatory factor. Science 238:797.[Abstract/Free Full Text]
  41. Swirnoff, A. H., J. Milbrandt. 1995. DNA-binding specificity of NGFI-A and related zinc finger transcription factors. Mol. Cell. Biol. 15:2275.[Abstract]
  42. Chavrier, P., U. Janssen-Timmen, M.-G. Mattei, M. Zerial, R. Bravo, P. Charnay. 1989. Structure, chromosome location, and expression of the mouse zinc finger gen Krox-20: multiple gene products and coregulation with the proto-oncogene c-fos. Mol. Cell. Biol. 9:787.[Abstract/Free Full Text]
  43. Hu, Y., B. Luscher, A. Admon, N. Mermod, R. Tjian. 1990. Transcription factor AP-4 contains multiple dimerization domains that regulate dimer specificity. Genes Dev. 4:1741.[Abstract/Free Full Text]
  44. McClure, R. F., C. J. Heppelmann, C. V. Paya. 1999. Constitutive Fas ligand gene transcription in Sertoli cells is regulated by Sp1. J. Biol. Chem. 274:7756.[Abstract/Free Full Text]
  45. Takahashi, T., M. Tanaka, J. Inazawa, T. Abe, T. Suda, S. Nagata. 1995. Human Fas ligand: gene structure, chromosomal location, and species specificity. Int. Immunol. 6:1567.[Abstract/Free Full Text]
  46. Mages, H. W., T. Stamminger, O. Rilke, R. Bravo, R. A. Kroczek. 1993. Expression of PILOT, a putative transcription factor, requires two signals and is cyclosporin A sensitive in T cells. Int. Immunol. 5:63.[Abstract/Free Full Text]
  47. Yan, S. F., Y. S. Zou, Y. Gao, C. Zhai, N. Mackman, S. L. Lee, J. Milbrandt, D. Pinsky, W. Kisiel, D. Stern. 1998. Tissue factor transcription driven by Egr-1 is a critical mechanism of murine pulmonary fibrin deposition in hypoxia. Proc. Natl. Acad. Sci. USA 95:8298.[Abstract/Free Full Text]
  48. Norian, L. A., K. M. Latinis, G. A. Koretzky. 1998. A newly identified response element in the CD95 ligand promoter contributes to optimal inducibility in activated T lymphocytes. J. Immunol. 161:1078.[Abstract/Free Full Text]
  49. Norian, L. A., K. M. Latinis, S. L. Eliason, K. Lyson, C. Yang, T. Ratliff, G. A. Koretzky. 2000. The regulation of CD95 (Fas) ligand expression in primary T cells: induction of promoter activation in CD95LP-Luc transgenic mice. J. Immunol. 164:4471.[Abstract/Free Full Text]
  50. Ranger, A. M., M. R. Hodge, E. M. Gravallese, M. Oukka, L. Davidson, F. W. Alt, F. C. de la Brousse, T. Hoey, M. Grusby, L. H. Glimcher. 1998. Delayed lymphoid repopulation with defects in IL-4-driven responses produced by inactivation of NF-ATc. Immunity 8:125.[Medline]
  51. De Luca, P., B. Majello, L. Lania. 1996. Sp3 represses transcription when tethered to promoter DNA or targeted to promoter proximal RNA. J. Biol. Chem. 271:8533.[Abstract/Free Full Text]
  52. Latinis, K. M., L. A. Norian, S. L. Eliason, G. A. Koretzky. 1997. Two NFAT transcription factor binding sites participate in the regulation of CD95 (Fas) ligand expression in activated human T cells. J. Biol. Chem. 272:31427.
  53. Chapman, N. R., N. D. Perkins. 2000. Inhibition of the RelA(p65) NF-{kappa}B subunit by Egr-1. J. Biol. Chem. 275:4719.[Abstract/Free Full Text]
  54. Tourtellotte, W. G., J. Milbrandt. 1998. Sensory ataxia and muscle spindle agenesis in mice lacking the transcription factor Egr3. Nat. Genet. 20:87.[Medline]
  55. Russo, M. W., B. R. Sevetson, J. Milbrandt. 1995. Identification of NAB1, a repressor of NGFI-A and Krox20-mediated transcription. Proc. Natl. Acad. Sci. USA 92:6873.[Abstract/Free Full Text]
  56. Svaren, J., B. R. Sevetson, E. D. Apel, D. B. Zimonjic, N. C. Popescu, J. Milbrandt. 1996. NAB2, a corepressor of NGFI-A (Egr-1) and Krox20, is induced by proliferative and differentiative stimuli. Mol. Cell. Biol. 16:3545.[Abstract]
  57. Sevetson, B. R., J. Svaren, J. Milbrandt. 2000. A novel activation function for NAB proteins in EGR-dependent transcription of the luteinizing hormone {beta} gene. J. Biol. Chem. 275:9749.[Abstract/Free Full Text]
  58. Agarwal, S., A. Rao. 1998. Long-range transcriptional regulation of cytokine gene expression. Curr. Opin. Immunol. 10:345.[Medline]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
A. Chen, B. Gao, J. Zhang, T. McEwen, S. Q. Ye, D. Zhang, and D. Fang
The HECT-Type E3 Ubiquitin Ligase AIP2 Inhibits Activation-Induced T-Cell Death by Catalyzing EGR2 Ubiquitination
Mol. Cell. Biol., October 1, 2009; 29(19): 5348 - 5356.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. Mellstrom, M. Savignac, R. Gomez-Villafuertes, and J. R. Naranjo
Ca2+-Operated Transcriptional Networks: Molecular Mechanisms and In Vivo Models
Physiol Rev, April 1, 2008; 88(2): 421 - 449.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. K. Koltsova, M. Ciofani, R. Benezra, T. Miyazaki, N. Clipstone, J. C. Zuniga-Pflucker, and D. L. Wiest
Early Growth Response 1 and NF-ATc1 Act in Concert to Promote Thymocyte Development beyond the beta-Selection Checkpoint
J. Immunol., October 1, 2007; 179(7): 4694 - 4703.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P.-L. Yao, Y.-C. Lin, P. Sawhney, and J. H. Richburg
Transcriptional Regulation of FasL Expression and Participation of sTNF-{alpha} in Response to Sertoli Cell Injury
J. Biol. Chem., February 23, 2007; 282(8): 5420 - 5431.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. Tong, H. S. Bandulwala, B. S. Clay, R. A. Anders, R. A. Shilling, D. D. Balachandran, B. Chen, J. V. Weinstock, J. Solway, K. J. Hamann, et al.
Fas-positive T cells regulate the resolution of airway inflammation in a murine model of asthma
J. Exp. Med., May 15, 2006; 203(5): 1173 - 1184.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Q. Cron, R. Bandyopadhyay, A. Genin, M. Brunner, G. J. Kersh, J. Yin, T. H. Finkel, and M. K. Crow
Early Growth Response-1 Is Required for CD154 Transcription
J. Immunol., January 15, 2006; 176(2): 811 - 818.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. L. Fields, S. A. Nish, B. D. Hondowicz, M. H. Metzgar, G. N. Wharton, A. J. Caton, and J. Erikson
The Influence of Effector T Cells and Fas Ligand on Lupus-Associated B Cells
J. Immunol., July 1, 2005; 175(1): 104 - 111.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. P.-L. Lee, E. Mansfield, S.-C. Hsieh, T. Hernandez-Boussard, W. Chen, C. W. Thomson, M. S. Ford, S. E. Bosinger, S. Der, Z.-x. Zhang, et al.
Expression Profiling of Murine Double-Negative Regulatory T Cells Suggest Mechanisms for Prolonged Cardiac Allograft Survival
J. Immunol., April 15, 2005; 174(8): 4535 - 4544.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. de Mestre, L. M. Khachigian, F. S. Santiago, M. A. Staykova, and M. D. Hulett
Regulation of Inducible Heparanase Gene Transcription in Activated T Cells by Early Growth Response 1
J. Biol. Chem., December 12, 2003; 278(50): 50377 - 50385.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. B. Keeton, K. D. Bortoff, W. L. Bennett, J. L. Franklin, D. Y. Venable, and J. L. Messina
Insulin-Regulated Expression of Egr-1 and Krox20: Dependence on ERK1/2 and Interaction with p38 and PI3-Kinase Pathways
Endocrinology, December 1, 2003; 144(12): 5402 - 5410.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. M. Droin, M. J. Pinkoski, E. Dejardin, and D. R. Green
Egr Family Members Regulate Nonlymphoid Expression of Fas Ligand, TRAIL, and Tumor Necrosis Factor during Immune Responses
Mol. Cell. Biol., November 1, 2003; 23(21): 7638 - 7647.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Li, X. Qi, M. Williams, Y. Shi, and A. D. Keegan
Overexpression of Insulin Receptor Substrate-1, But Not Insulin Receptor Substrate-2, Protects a T Cell Hybridoma from Activation-Induced Cell Death
J. Immunol., June 15, 2002; 168(12): 6215 - 6223.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Zhou, R. Q. Cron, B. Wu, A. Genin, Z. Wang, S. Liu, P. Robson, and H. S. Baldwin
Regulation of the Murine Nfatc1 Gene by NFATc2
J. Biol. Chem., March 15, 2002; 277(12): 10704 - 10711.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. T. Miller and L. J. Berg
Defective Fas Ligand Expression and Activation-Induced Cell Death in the Absence of IL-2-Inducible T Cell Kinase
J. Immunol., March 1, 2002; 168(5): 2163 - 2172.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Devadas, L. Zaritskaya, S. G. Rhee, L. Oberley, and M. S. Williams
Discrete Generation of Superoxide and Hydrogen Peroxide by T Cell Receptor Stimulation: Selective Regulation of Mitogen-Activated Protein Kinase Activation and Fas Ligand Expression
J. Exp. Med., January 7, 2002; 195(1): 59 - 70.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dzialo-Hatton, R.
Right arrow Articles by Weaver, C. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dzialo-Hatton, R.
Right arrow Articles by Weaver, C. T.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CYCLOSPORIN A
*Genetics Home Reference


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS