|
|
||||||||

*
Department of Pathology, University of Alabama, Birmingham, AL 35294; and
Department of Pathology and Internal Medicine, Washington University School of Medicine, St. Louis, MO 63110
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Promoter studies aimed at understanding the transcriptional control of
FasL have revealed a variety of transcription factors that can induce
the expression of FasL depending on the type of stimulus and the cell
population tested. The inhibition of FasL induction in T cells by
cyclosporin A (CsA) has directed the search to factors that are
sensitive to CsA (17, 18). CsA inhibits the
calcineurin-dependent dephosphorylation of NF-AT, which is required for
nuclear translocation and function of NF-AT in the expression of IL-2
and other cytokine genes (19). NF-AT consensus sequences
have been identified in the human and mouse FasL promoters, and NF-AT
has been shown to enhance the expression of FasL in several
studies (20, 21, 22, 23). Accordingly, mice bearing
mutations in NF-ATp (NF-ATc2) or in both NF-ATp and NF-AT4
(NF-ATc3) have impaired ability to express FasL (24, 25).
Induction of the early growth response genes Egr2 and Egr3 following
TCR engagement is also inhibited by CsA, and it has been argued that
Egr factors are the dominant regulators of FasL expression in T cells
(26, 27). It has also been proposed that Egr and NF-AT
form composite sites within the FasL promoter and can cooperatively
regulate transcription (28). Other recent evidence points
to NF-AT as a regulator of the expression of Egr2 and Egr3, implying
that the effect of NF-AT on the transcription of FasL is indirect
(29, 30). Stress-inducing stimuli such as UV radiation,
-irradiation, and DNA-damaging agents can also increase the
expression of FasL in T cells through the CsA-independent factors AP-1,
NF-
B, and a MEK (mitogen-activated protein/extracellular
signal-related kinase kinase) kinase-1-regulated response element
(31, 32).
Conflicting data concerning the elements most responsible for the regulation of FasL may be attributable to the variety of cell lines and hybridomas that have been used for its study. To elucidate the elements that control FasL transcription in T cells, we have examined the promoter region using reporter constructs in a mouse T cell hybridoma and have extended these observations to analyses of more physiological Th1 and Th2 cells. By exploiting the differential expression of FasL in Th1 and Th2 cells, we find differences in transcriptional complexes between the two cell types that provide further insight into the regulation of the FasL gene.
| Materials and Methods |
|---|
|
|
|---|
DO11.10 TCR transgenic mice on a BALB/c background (33, 34) were bred in a specific pathogen-free facility and were screened at age 34 wk for transgene expression by two-color flow cytometric analysis after staining of peripheral blood with anti-CD4 and the anti-clonotype mAb, KJ1-26 (35). BALB/c mice were purchased from The Jackson Laboratory (Bar Harbor, ME) or bred in our facility. The DO11.10 T cell hybridoma (35) was maintained in RPMI supplemented with 10% FCS, 20 mM glutamine, 10 mm HEPES, penicillin (1000 U/ml), and streptomycin (1000 U/ml). Cloned Th1 and Th2 lines were generated and maintained as described (36).
Generation of Th1 and Th2 cells
Naive CD4+ T cells were isolated from DO11.10 spleen and lymph nodes by positive sorting using anti-CD4 magnetic beads (Dynal AS, Oslo, Norway). Greater than 95% of the resulting cells were positive for CD4 and were plated at a ratio of 1:5 with irradiated BALB/c splenocytes and 5 µg/ml OVA peptide 323339. The addition of 50 U/ml IL-12 (R&D Systems, Minneapolis, MN) and 10 µg/ml anti-IL-4 (11B11) (37) was used to generate cells with a Th1 phenotype, while 1000 U/ml IL-4 (R&D Systems) and 10 µg/ml anti-IL-12 (C17.8) (38) were used to generate cells with a Th2 phenotype (39).
Cloning the FasL promoter and determination of transcriptional start site
A mouse FasL cDNA was isolated by RT-PCR amplification of mRNA from PMA/ionomycin-activated Th1 cells using the following primers: 5' sense, ATGCAGCAGCCCATGAATTACCC and 3' antisense, TTAAAGCTTATACAAGCCGAAAAAGG. The full-length cDNA was used to screen a murine 129 liver genomic library (Stratagene, La Jolla, CA), and four phage clones were isolated. Using oligonucleotides specific for the 5' and 3' ends of the cDNA, one clone was identified that hybridized solely with the 5' probes. From this phage, a BamHI to BglII fragment was isolated that contained 2.2 kb of the murine FasL promoter, which was sequenced in its entirety by dideoxy chain termination sequencing (United States Biochemical, Cleveland, OH). To define the transcriptional start site, primer extension analysis was performed by hybridizing 10 µg Th1 total RNA to a 32P end-labeled primer corresponding to 5'-TTCTGTCCTTGACACCTGAG-3' and extending with reverse transcriptase (SuperScript II; Life Technologies, Gaithersburg, MD). The product was resolved on a denaturing 6% polyacrylamide gel alongside of a dideoxy chain termination sequencing reaction using the same primer and a fragment of the mouse FasL promoter.
Generation of promoter/reporter constructs
To generate the luciferase reporter constructs, PCR products were generated using Expand High Fidelity PCR System (Roche Molecular Biologicals, Indianapolis, IN) and oligonucleotides synthesized based on the sequence of the 2.2-kb BamHI/BglII fragment. The upstream primer of each pair incorporated a HindIII site, and the downstream oligomer incorporated a BglII site. After PCR, the products were digested with HindIII and BglII, purified, and subcloned into pGL3basic (Promega, Madison, WI). Clones for each construct were isolated and sequenced to prove authenticity. Internal mutational constructs were generated by oligonucleotide site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit; Stratagene). Mutations were confirmed by automated sequencing (Applied Biosystems, Foster City, CA; University of Alabama at Birmingham Department of Microbiology sequencing facility).
Transfection into the DO11.10 hybridoma and luciferase assay
A total of 2.5 x 106 DO11.10 cells was transfected with 2 µg murine FasL promoter/pGL3 (firefly luciferase) construct and 150 ng pRL-TK (Renilla luciferase, an internal control for transfection efficiency) using DEAE-dextran (Amersham Pharmacia, Uppsala, Sweden). Cells were rested overnight and stimulated the following day for 5 h with 750 ng/ml ionomycin and 50 ng/ml PMA (Sigma, St. Louis, MO). Following stimulation, the Dual Luciferase Assay (Promega) was performed by lysing the cells in Passive Lysis Buffer, and reading the relative light units of one-fifth the lysate with both the firefly substrate and the renilla substrate using a Turner Systems TD 20/20 luminometer (Promega). Each transfection was performed in triplicate and in a minimum of five independent experiments .
Nuclear extract preparation
Th1 and Th2 cells were either left unstimulated or treated for 5 h with 50 ng/ml PMA and 750 ng/ml ionomycin (Sigma). Extracts were prepared (adapted from Latinis 1997) by lysing 5 x 107 cells in 500 µl of a solution containing 3 mM MgCl2, 40 mM KCl, 10 mM HEPES, pH 7, 5% glycerol, 0.2% Nonidet P-40, 1 mM DTT, and Complete-EDTA Free protease inhibitor (Roche, Indianapolis, IN). Lysates were centrifuged at 14,000 rpm for 2 min at 4°C. Pellets were resuspended in 300 µl 1.5 mM MgCl2, 420 mM KCl, 20 mM HEPES, pH 7.9, 0.2 mM EDTA, 25% glycerol, 1 mM DTT, and Complete-EDTA Free, and incubated at 4°C for 1 h. Nuclear lysates were dialyzed overnight at 4°C vs 0.1 M KCl, 20 mM HEPES, pH 7.9, 0.2 mM EDTA, 20% glycerol, 1 mM DTT, and Complete-EDTA Free. Lysates were then concentrated using Microcon spin concentrators (Millipore, Bedford, MA), and the resulting protein concentration was determined (Bio-Rad Protein Assay; Bio-Rad, Hercules, CA).
EMSAs
EMSAs were performed by incubating 10 µg of protein from nuclear extracts with 0.02 pmol 32P end-labeled double-stranded oligonucleotide probes in binding buffer containing 10 mM Tris, pH 7.5, 75 mM KCl, 10% glycerol, 0.1 mM EDTA, 2.5 mM MgCl2, 0.25 mM DTT, and 1 µg poly(dI-dC)·poly(dI-dC) (Amersham Pharmacia Biotech, Piscataway, NJ) at room temperature for 20 min. Supershifts were performed by adding 2 µg Ab to the nuclear extract and binding buffer and incubating for 30 min at 4°C, followed by the addition of the labeled probe and incubating at room temperature for an additional 20 min. Protein/DNA complexes were resolved on 5.8% polyacrylamide gel run in 1x Tris-glycine-EDTA, pH 8.5, at 200 V at 4°C. Egr1, Egr3, Sp1, and Sp3 Abs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). NF-ATp (NF-ATc2), clone G1-D10, was obtained from PharMingen-BD (San Diego, CA), and NF-ATc (NF-ATc1), clone 7A6, from Affinity BioReagents (Golden, CO). An anti-Egr-2 Ab was purchased from BabCO (Richmond, CA). The sequence of the NF-AT distal gel-shift probe is 5'-AATTTCTGGGCGGAAACTTCC-3', and the Egr proximal probe is 5'-GCAAGTGAGTGGGTGTCTC-3'.
Northern blot and RNase protection assay
A total of 10 µg of total RNA (TRIzol; Life Technologies) per
sample was electrophoresed on a 1% agarose/formaldehyde denaturing
gel, subsequently transferred to a nitrocellulose membrane (Micron
Separations, Westboro, MA), and immobilized by baking at 80°C under
vacuum. Probes were hybridized to the membrane in a 50% formamide
solution at 42°C overnight, and final washes were in 0.1x SSC, 0.1%
SDS at 60°C. Egr1, Egr2, and Egr3 cDNA probes were generated as
previously described (40, 41, 42), and the mouse
-actin
probe was obtained from Ambion (Austin, TX). FasL mRNA was detected
with the mAPO-3 multiprobe template set using the PharMingen-BD
Riboquant RNase protection assay system.
| Results |
|---|
|
|
|---|
To identify regulatory regions that control inducible expression
of the mouse FasL gene, study of a 2.2-kb fragment of its promoter was
undertaken. Promoter/reporter constructs containing incrementally
shorter promoter fragments relative to the 2.2-kb fragment were cloned
into the luciferase vector pGL3basic, and were transiently transfected
into the mouse T cell hybridoma, DO11.10. The DO11.10 T cell hybridoma
was used in initial experiments to define promoter regulatory regions
because it demonstrates activation-dependent expression of FasL and is
readily transfectable (13 , and data not shown). A gross
examination of the full-length 2.2-kb fragment indicated that maximal
inducible promoter activity was contained in the 326 nucleotides
upstream of the translational initiation site, and a detailed
deletional analysis of this region was undertaken (Fig. 1
and data not shown). All transfected
constructs had negligible luciferase activity without prior activation
of the DO11.10 cells (data not shown). Upon activation, all constructs
tested yielded an increase in luciferase activity compared with a
construct that contained fragment -127 to -51 bp relative to the
translational start site. This construct, designated the minimal
promoter, contained the principal transcriptional initiation site at
nucleotide -127 that was identified by primer extension analysis (Fig. 1
A).
|
|
It has been shown that expression of FasL is inhibited by CsA
(17, 18). To define the CsA sensitivity of individual
regulatory sites in the -326 promoter fragment, the effect of CsA was
examined in the context of different FasL promoter fragments. CsA
completely abolished activation-induced luciferase expression of
constructs -200 and -230, each of which contains the Egr/Sp1
consensus site and lacks the Egr/Sp1/NF-AT site (Fig. 3
). This is consistent with the
inhibitory effects of CsA on the NF-AT-dependent expression of Egr2 and
Egr3 (27, 46). Likewise, CsA completely inhibited
expression driven by the -240 construct that terminates immediately 5'
of the NF-AT consensus site within the putative Egr/Sp1/NF-AT composite
site, and therefore lacks the Egr/Sp1 component. An increase in
luciferase activity of the CsA-treated -250 as compared with -240
could conceivably be due to the effects of the CsA-insensitive factor
Egr1 or Sp1 at this site. Similarly, a contribution by additional
CsA-insensitive factor(s) may account for the increased promoter
activity found by inclusion of sequences 5' of the -250 construct.
Collectively, these results confirm that CsA-sensitive factors are
necessary for maximal induction of the FasL promoter, but do not
distinguish CsA effects that directly affect the Egr/Sp1/NF-AT site,
indirectly affect the Egr/Sp1 site, or both. CsA-insensitive factors
that map 5' of the NF-AT core consensus site
(-240GGAAA-234)
contribute relatively modest promoter activity.
|
|
Distinct complexes of Egr and NF-AT family members are present in nuclear extracts from activated Th1 and Th2 cells
Conflicting results concerning the contribution of NF-AT and Egr
factors have been reported in previous studies of the human and mouse
FasL promoters and may be due in some part to the different transformed
cell lines that have been used as transfection hosts (21, 22, 23, 26). To obviate potential cell line-dependent effects, we chose
to extend our analyses to nontransformed T cells of identical Ag
specificity to the DO11.10 hybridoma used in the transfection studies
above. Cloned Th1 and Th2 lines were derived from the DO11.10
transgenic mouse and tested for their expression of FasL (Fig. 5
). Consistent with published data
(13, 14, 15), DO11.10-derived activated Th1 cells expressed
FasL, whereas Th2 cells did not. The basis for differential expression
of FasL by these two T cell lineages was pursued to better define the
critical transcriptional factors that control FasL expression. Although
cloned Th1 and Th2 cells are resistant to DNA transfection and
therefore a poor model for transfection-based promoter analyses, they
do provide a more physiologic model for examination of the
transcription factors that might or might not be available for
interaction with regulatory sequences within the FasL promoter.
|
|
Combinations of different anti-Egr Ab pairs (lanes
68 and 1719 in Fig. 6
, and data not shown)
suggested that Egr-containing complexes bound to the proximal Egr/Sp1
site were monomeric rather than heteromeric (47). Both Sp1
and Sp3 were detected in activated Th1 and Th2 extracts (Fig. 7
B and data not shown), but
neither factor bound the putative Sp1 site contained in the FasL probe
(Fig. 6
). A negative control Ab to Pax1 (lanes 11 and
22) was also negative. Mutations introduced into the Egr
consensus sequence of EMSA probes encompassing nucleotides -189 to
-171
(-180TGGGTG-175
-180CAAGCG-175)
abrogated binding of the activation-induced complexes and all Egr
family supershifts (data not shown). Collectively, these data suggest
that the activation-dependent transcriptional complex targeting this
sequence is specific in both Th1 and Th2 cells, yet differs in its
composition .
|
Abs to Egr1 supershifted a complex in both Th1 and Th2 cells, but no binding to anti-Egr2 or anti-Egr3 was evident, suggesting that this Egr site had more restrictive binding characteristics than the proximal Egr site discussed above. The inability to bind multiple Egr family members may be due to a weaker consensus site, the close proximity of the NF-AT binding site, or both. The distal Egr/Sp1/NF-AT site is able to bind both Egr and NF-AT family members in extracts from both Th1 and Th2 cells, but the addition of Sp1 and NF-ATc to the Th2 complex or the possibility of an additional factor from the slower migrating Th1 complex may account for the differential expression of FasL in these two cell types.
Egr3 mRNA is preferentially expressed in activated Th2 cells
Because of the differences found in DNA-binding complexes formed
with the proximal Egr/Sp1 site probe in Th1 and Th2 cells, further
investigation into the expression of the Egr family members was
undertaken. Northern analyses were performed with total RNA prepared
from cloned Th1 and Th2 cells that were not activated, or were
activated with PMA/ionomycin for 1, 2, and 4 h (Fig. 8
). Resting Th1 and Th2 cells were
negative for expression of each of the Egr family members. Following
PMA/ionomycin stimulation, there was rapid expression of Egr1 and Egr2
by both populations, followed by rapid decay of expression
(46). Both Th1 and Th2 cells expressed readily detectable
Egr1 and Egr2 mRNA 1 h after activation, although Th2 cells
appeared to express lower levels of Egr1 and Egr2 mRNA. Levels of Egr1
and Egr2 mRNA were markedly decreased or undetectable at 4 h.
Consistent with the absence of detectable Egr3 protein in DNA-binding
complexes from Th1 cells, no Egr3 mRNA was detected in Th1 cells,
whereas Th2 cells expressed Egr3 with similar kinetics to Egr2. Thus,
the lack of Egr3 binding to the proximal Egr/Sp1 EMSA probe in Th1
nuclear extracts (Fig. 6
) was due to a global deficiency of Egr3 gene
transcription by Th1 cells and was not specific to the proximal
Egr/Sp1 site.
|
| Discussion |
|---|
|
|
|---|
The transfection studies reported in this study are in agreement with those of other groups that have emphasized the importance of NF-AT sites in the human FasL promoter (21, 22, 23, 48, 49). In apparent conflict with these results, it has been reported that Egr2 or Egr3 acts at the proximal Egr site to confer most of the activation-induced expression of FasL (26, 27). Since NF-AT appears to be required for Egr2 and Egr3 expression in T cells, it was proposed that the effect of NF-AT on FasL transcription is largely indirect, acting through its induction of the Egr2 and Egr3 promoters (29, 30). Our own studies favor a direct role for NF-AT in FasL gene activation. Thus, mutations in the NF-AT consensus sequence of the Egr/Sp1/NF-AT composite site (-236 to -240) had a more profound effect on expression of FasL in the DO11.10 hybridoma than mutations in the Egr proximal site (-181 to -175), although both sites were critical for maximal promoter activity. Also, CsA significantly inhibited residual promoter activity in constructs with an ablated Egr/Sp1 proximal site, strongly supporting a direct effect of NF-AT at the Egr/Sp1/NF-AT site.
When both the NF-AT consensus sequence in the Egr/Sp1/NF-AT composite site and the Egr/Sp1 proximal sites were destroyed, promoter activity was completely abolished. These results argue that no other factors act independently of NF-AT and Egr factors in this region; to achieve maximal promoter activity, both the Egr/Sp1/NF-AT and the Egr1/Sp1 proximal sites must be occupied. There is clearly a modest effect of 5' flanking sequences on the optimal activation of both the Egr/Sp1/NF-AT and the Egr/Sp1 proximal sites, since mutation or deletion of these regions partially blocked their function. However, activity of these regions appears to be dependent on occupancy of the adjacent NF-AT or Egr sites, respectively. In contrast to some studies in the human (28), we found no evidence of additional NF-AT-responsive sites in the murine FasL promoter. In particular, an additional NF-AT-responsive site has been proposed in the human promoter juxtaposed 5' of the Egr/Sp1 proximal site (28). This consensus site does not exist in the mouse promoter, and we have been unable to demonstrate NF-AT binding to DNA in this region (data not shown). Collectively, these data support a model in which NF-AT and Egr factors act cooperatively through interactions at the Egr/Sp1/NF-AT and the Egr1/Sp1 proximal sites (28, 48).
EMSA analyses of activated Th1 and Th2 extracts demonstrated distinct patterns of transcription factor binding to both the Egr1/Sp1/NF-AT and the Egr/Sp1 proximal sites. NF-ATc binding was not detected in Th1 extracts using the Egr1/Sp1/NF-AT probe, but was detected in activated Th2 extracts. The preferential expression of NF-ATc in Th2 extracts is consistent with published results (24, 50), and could play a role in the suppression of FasL in Th2 cells. However, this is probably unlikely given the predominance of NF-ATp binding in both cell types. By similar reasoning, it is also unlikely that Sp1 binding to the Egr1/Sp1/NF-AT site in Th2 extracts accounts for their deficiency of FasL expression, although in some cases Sp1-mediated transcriptional activation can be repressed by an inhibitory member of the Sp family, Sp3 (51). It is clear from the EMSA studies, however, that the sizes of Th1 and Th2 complexes that bind the Egr1/Sp1/NF-AT site are distinct, and it is probable that additional, unidentified factors participate in the function of this site.
Interestingly, we and others have been unable to demonstrate the
presence of AP-1 cofactors interacting at the Egr/Sp1/NF-AT site
((52) and data not shown). Thus, although there is
precedent for NF-AT acting independently, it is intriguing that Egr1
binds in such close proximity to NF-AT at this site and could
conceivably act as an NF-AT cofactor (21). In this vein,
Egr1 has been shown to both functionally and physically interact with
the RelA subunit of NF-
B, and this interaction modulates the
transcriptional activity of NF-
B (53). Because the
DNA-binding domain of NF-AT shares moderate sequence similarity to the
DNA-binding domains of Rel family proteins (19), it is
possible that Egr1 could interact directly with NF-AT to modulate its
transcriptional capacity in a similar way. Also of interest is the
absence of Egr2 or Egr3 binding to this site, despite the presence of
both factors in the nucleus of activated Th2 cells, or in the case of
Th1 cells, the presence of Egr2. The 5' sequence immediately flanking
the NF-AT site is not a canonical Egr site (41), but does
contain a stretch of seven contiguous nucleotides
(-245TGGGCGG-239) that
partially overlap the NF-AT consensus site at the 5' end and have
sequence identity to the 3' end of a Egr consensus site. Preliminary
EMSA experiments that have examined Egr/Sp1/NF-AT site probes with a
mutation of the NF-AT consensus site that conserves the putative Egr
site indicate that Egr1 does not bind without an intact NF-AT site
(data not shown), suggesting that recruitment of Egr1 to this site may
be NF-AT dependent.
Th1 and Th2 cells differed in the activation-dependent assembly of transcriptional complexes that bound the Egr proximal element of the FasL promoter. The nuclei of both Th1 and Th2 cells contained Egr1 and Egr2 that could bind the Egr proximal site, whereas Th2 cells uniquely expressed Egr3 nuclear activity. Sp1 family members were not important in the regulation of this site in either lineage. Although Egr1 was present and could bind this site, it is unlikely to function independently of Egr2 or Egr3, since CsA blocked activity of this site and Egr1 is not CsA sensitive (46). The absence of Egr3 binding to the Egr/Sp1 site in Th1 cells suggests either that Egr3 is not critically involved in FasL regulation, or that Egr2 can effectively replace this activity in the absence of Egr3. A recent report by Rengarajan et al. (30) proposed that the Th2 lineage is FasL negative due to deficient expression of Egr3. This is difficult to reconcile with our results, since Th1 cells in our study expressed FasL in the absence of Egr3, and since Egr3 was well expressed by Th2 cells. It would therefore appear that the lack of FasL expression by Th2 cells is not due to a deficiency of Egr3. It is possible that Rengarajans results differ from ours based on the time points of Egr expression studied and/or the activation protocols employed. However, our kinetic analyses of Egr mRNA expression (maximal expressed as early as 1 h after activation and down-regulation by 4 h) are consistent with published data concerning the kinetics of expression of early growth response genes (46). Finally, mice with a targeted disruption of Egr3 experience no lymphoproliferative disorders that are typical of FasL-deficient mice (54), and T cells from these mice can express FasL (unpublished data).
Since it appears that Th2 cells possess the major transcription factors necessary for the production of FasL (NF-ATp and Egr2/Egr3), what is responsible for the lack of FasL expression by these cells? While it is possible that Egr3 might repress FasL expression in the context of Th2 cells, this seems unlikely given other data that Egr3 is a positive regulator of FasL (26, 27). Indeed, in recent studies of short-term Th1 lines derived from DO11.10 TCR transgenic mice, there appears to be no negative correlation between Egr3 and FasL expression (unpublished observation). An alternative possibility is the presence of yet to be identified negative regulatory factors that are preferentially active in Th2 cells. The mobility of the DNA-binding complex interactive with the Egr1/Sp1/NF-AT distal site is decidedly different in nuclear extracts from activated Th1 and Th2 cells, and it is conceivable that negative factors are present in this complex. It has been demonstrated that transcriptional activation by Egr family members can be modulated by interactions with the NGF1-A-binding protein (NBA) family of corepressors, and NAB1 and NAB2 have been shown to down-regulate the activity of Egr1, Egr2, and Egr3 (55, 56, 57). Examination of the expression and function of NAB factors in Th1 and Th2 cells warrants investigation. Another plausible explanation is that although the appropriate transcription factors are expressed in the Th2 lineage, the FasL gene locus is inaccessible in this cell type, analogous to the regulation of cytokine genes by modulation of chromatin structure during Th1 and Th2 development (58). Experiments designed to examine the accessibility of the FasL promoter in Th2 cells are presently being undertaken.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Eli Lilly and Company, Indianapolis, IN 46285. ![]()
3 R.D.H. and C.T.W. contributed equally to this work. ![]()
4 Address correspondence and reprint requests to Dr. Casey T. Weaver, Department of Pathology, University of Alabama, Birmingham, AL 35294. ![]()
5 Abbreviations used in this paper: FasL, Fas ligand; CsA, cyclosporin A; Egr, early growth response gene; NAB, NGF1-A-binding protein. ![]()
Received for publication September 22, 2000. Accepted for publication January 22, 2001.
| References |
|---|
|
|
|---|
B and AP-1. Mol. Cell 1:543.[Medline]
production and lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672.[Medline]
B subunit by Egr-1. J. Biol. Chem. 275:4719.
gene. J. Biol. Chem. 275:9749.This article has been cited by other articles:
![]() |
A. Chen, B. Gao, J. Zhang, T. McEwen, S. Q. Ye, D. Zhang, and D. Fang The HECT-Type E3 Ubiquitin Ligase AIP2 Inhibits Activation-Induced T-Cell Death by Catalyzing EGR2 Ubiquitination Mol. Cell. Biol., October 1, 2009; 29(19): 5348 - 5356. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Mellstrom, M. Savignac, R. Gomez-Villafuertes, and J. R. Naranjo Ca2+-Operated Transcriptional Networks: Molecular Mechanisms and In Vivo Models Physiol Rev, April 1, 2008; 88(2): 421 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Koltsova, M. Ciofani, R. Benezra, T. Miyazaki, N. Clipstone, J. C. Zuniga-Pflucker, and D. L. Wiest Early Growth Response 1 and NF-ATc1 Act in Concert to Promote Thymocyte Development beyond the beta-Selection Checkpoint J. Immunol., October 1, 2007; 179(7): 4694 - 4703. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-L. Yao, Y.-C. Lin, P. Sawhney, and J. H. Richburg Transcriptional Regulation of FasL Expression and Participation of sTNF-{alpha} in Response to Sertoli Cell Injury J. Biol. Chem., February 23, 2007; 282(8): 5420 - 5431. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tong, H. S. Bandulwala, B. S. Clay, R. A. Anders, R. A. Shilling, D. D. Balachandran, B. Chen, J. V. Weinstock, J. Solway, K. J. Hamann, et al. Fas-positive T cells regulate the resolution of airway inflammation in a murine model of asthma J. Exp. Med., May 15, 2006; 203(5): 1173 - 1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Q. Cron, R. Bandyopadhyay, A. Genin, M. Brunner, G. J. Kersh, J. Yin, T. H. Finkel, and M. K. Crow Early Growth Response-1 Is Required for CD154 Transcription J. Immunol., January 15, 2006; 176(2): 811 - 818. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Fields, S. A. Nish, B. D. Hondowicz, M. H. Metzgar, G. N. Wharton, A. J. Caton, and J. Erikson The Influence of Effector T Cells and Fas Ligand on Lupus-Associated B Cells J. Immunol., July 1, 2005; 175(1): 104 - 111. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P.-L. Lee, E. Mansfield, S.-C. Hsieh, T. Hernandez-Boussard, W. Chen, C. W. Thomson, M. S. Ford, S. E. Bosinger, S. Der, Z.-x. Zhang, et al. Expression Profiling of Murine Double-Negative Regulatory T Cells Suggest Mechanisms for Prolonged Cardiac Allograft Survival J. Immunol., April 15, 2005; 174(8): 4535 - 4544. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. de Mestre, L. M. Khachigian, F. S. Santiago, M. A. Staykova, and M. D. Hulett Regulation of Inducible Heparanase Gene Transcription in Activated T Cells by Early Growth Response 1 J. Biol. Chem., December 12, 2003; 278(50): 50377 - 50385. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Keeton, K. D. Bortoff, W. L. Bennett, J. L. Franklin, D. Y. Venable, and J. L. Messina Insulin-Regulated Expression of Egr-1 and Krox20: Dependence on ERK1/2 and Interaction with p38 and PI3-Kinase Pathways Endocrinology, December 1, 2003; 144(12): 5402 - 5410. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Droin, M. J. Pinkoski, E. Dejardin, and D. R. Green Egr Family Members Regulate Nonlymphoid Expression of Fas Ligand, TRAIL, and Tumor Necrosis Factor during Immune Responses Mol. Cell. Biol., November 1, 2003; 23(21): 7638 - 7647. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Li, X. Qi, M. Williams, Y. Shi, and A. D. Keegan Overexpression of Insulin Receptor Substrate-1, But Not Insulin Receptor Substrate-2, Protects a T Cell Hybridoma from Activation-Induced Cell Death J. Immunol., June 15, 2002; 168(12): 6215 - 6223. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zhou, R. Q. Cron, B. Wu, A. Genin, Z. Wang, S. Liu, P. Robson, and H. S. Baldwin Regulation of the Murine Nfatc1 Gene by NFATc2 J. Biol. Chem., March 15, 2002; 277(12): 10704 - 10711. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Miller and L. J. Berg Defective Fas Ligand Expression and Activation-Induced Cell Death in the Absence of IL-2-Inducible T Cell Kinase J. Immunol., March 1, 2002; 168(5): 2163 - 2172. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Devadas, L. Zaritskaya, S. G. Rhee, L. Oberley, and M. S. Williams Discrete Generation of Superoxide and Hydrogen Peroxide by T Cell Receptor Stimulation: Selective Regulation of Mitogen-Activated Protein Kinase Activation and Fas Ligand Expression J. Exp. Med., January 7, 2002; 195(1): 59 - 70. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |