| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
B and STAT5 Play Important Roles in the Regulation of Mouse Toll-Like Receptor 2 Gene Expression1
*
Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Nagoya, Japan; and
Department of Periodontology, School of Dentistry, Aichi-Gakuin University, Nagoya, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B, two CCAAT/enhancer binding
protein, one cAMP response element-binding protein, and one STAT
consensus sequences. In mouse macrophage cell lines, deletion of both
NF-B sites caused the complete loss of mTLR2 promoter responsiveness
to TNF-
. NF-B sites were also important but not absolutely
necessary for LPS-mediated mTLR2 promoter activation. In T cell lines,
mTLR2 responsiveness to IL-15 was abrogated by the 3' NF-B mutation,
whereas 5' NF-B showed no functional significance. The STAT binding
site also seemed to contribute, as the deletion of this sequence
significantly reduced the IL-15-mediated mTLR2 promoter activation.
EMSAs confirmed nuclear protein binding to both NF-B sites in
macrophages following LPS and TNF- stimulation and to the 3' NF-B
site in T cells after IL-15 treatment. Thus, NF-B activation is
important but differently involved in the regulation of
mTLR2 gene expression in macrophages and T cells following
LPS or cytokine stimulation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B homologue known as dorsal and
the subsequent production of antimicrobial peptides (1).
Recently, a series of mammalian Toll homologues have been identified
and termed Toll-like receptors
(TLRs)3
(3). In the past few years, various members of the TLR family have been discovered (3, 4, 5). Recent studies have shown that a member of this family, TLR2, mediates signals from bacterial LPS (6, 7, 8) or other bacterial components such as lipoteichoic acid, peptidoglycan, and lipoproteins (9, 10, 11, 12). Although TLR2 can mediate LPS signals in vitro, its role as the LPS receptor in vivo is ambiguous since the gene-disrupted mouse of TLR2 shows almost normal responses to LPS (13).
We have previously cloned the mouse TLR2 cDNA, analyzed its gene
expression in immunocompetent cells, and reported that LPS and various
cytokines including TNF-, IFN-
, IL-1
, IL-2, and IL-15 rapidly
induce TLR2 gene expression in macrophages, whereas the gene
expression of TLR4, another member of TLR, remains constant
(14). We have also demonstrated that TCR engagement and
the stimulation with IL-2 and IL-15 increase TLR2 mRNA in T cells.
Although these results have indicated that the induced TLR2 plays
important roles in mediating immune responses in the later phases of
infections, the transcriptional machinery controlling TLR2
gene expression remains largely unknown. In the present study, we have
analyzed the 5' upstream region of the mouse TLR2 gene and investigated
the mechanisms of its expression in mouse macrophage and T cell lines.
The 5' flanking region of the mTLR2 gene contains a number
of cis-acting elements that LPS or inflammatory cytokines
might modulate, including two NF-B binding sites. We constructed a
series of the 5' deletion constructs along with NF-B deletion
mutants to analyze the functional importance of these elements. We also
analyzed protein binding to some of these sites after LPS or cytokine
stimulation. Our results indicated the critical but different
requirements for NF-B in the activation-driven mouse TLR2 (mTLR2)
promoter in macrophages and T cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recombinant mouse TNF- and human IL-15 were purchased from
PeproTech (Seattle, WA). LPS from Escherichia coli serotype
B6:026 was obtained from Sigma (St. Louis, MO). Synthetic E.
coli-type lipid A, ONO4007, was kindly provided by Ono
Pharmaceutical (Tokyo, Japan). RPMI 1640 and DMEM were purchased from
Sigma. Anti-p50, p65 were obtained from Santa Cruz Biotechnology (Santa
Cruz, CA) and anti-STAT5 Ab was obtained from
PharMingen/Transduction Laboratories (San Diego, CA).
Isolation and characterization of mTLR2 genomic clones
The mTLR2 cDNA containing the whole coding region was labeled with 32P by random priming and used for screening the mouse genomic phage library, Lambda Fix II (Stratagene, La Jolla, CA). Phages were plated with E coli strain XL1-Blue MRA and transferred to nitrocellulose membranes. The membranes were prehybridized in 500 mM NaCl, 1% SDS, and 10% dextran sulfate for 3 h at 65°C, followed by hybridization with 32P-labeled probe for 14 h at 65°C. Membranes were washed twice with 2x SSC and 0.1% SDS for 5 min at 50°C, twice with 0.1x SSC and 0.1% SDS for 15 min at 50°C, and exposed to x-ray films. Positive clones were plated and screened until successive pure clones were obtained. Phage DNAs were isolated from positive clones and characterized by enzyme restriction mapping. Subfragments were cloned into pBlueScript II KS+ (Stratagene) and were enzymatically nucleotide sequenced by the DNA sequencer (model 373A sequencer) using DYEnamic ET terminator cycle sequencing kit (Amersham Pharmacia Biotech, Piscataway, NJ). The nucleotide sequences upstream to the transcriptional initiation site were searched for the potential binding sites for transcription factors by TRANSFAC (http://www.dna.affrc.go.jp and http://www.motif.genome.ad.jp).
Cell culture and transient transfection assays
A mouse macrophage cell line, RAW264.7 was obtained from The
Institute of Physical and Chemical Research (Japan) Cell Bank
(Tsukuba, Japan) and maintained in DMEM with 10% newborn calf serum. A
mouse T cell line, CTLL-2, was obtained from The Institute of Physical
and Chemical Research (Japan) Cell Bank and maintained in RPMI 1640
with 10% FCS and 10 ng/ml mouse IL-2. For the transient transfection,
2 µg of the mTLR2 luciferase construct, in combination with 0.2 µg
of pRL-SV40 as an internal control, was transfected into RAW264.7 by
LipofectAMINE (Life Technologies, Rockville, MD) or CTLL-2 by DMRIE-C
(Life Technologies) according to the manufacturer’s instructions.
Forty-eight hours after transfection, cells were stimulated with 1
µg/ml LPS, 10 µg/ml synthetic lipid A, 10 ng/ml TNF-, or 10
ng/ml IL-15 for 8 h. Then cells were lysed and the lysates were
used for luciferase activity measurements using the dual luciferase
reporter assay system (Toyo Ink, Tokyo, Japan) according to the
manufacturer’s instructions. All of the luciferase assays shown in the
current study were repeated at least three times, and a typical result
was shown for each experiment.
Mapping the transcriptional start site of mTLR2
Primer extension analysis was applied to map the initiation start site of the mTLR2 gene. Total RNAs were prepared from RAW264.7 cells stimulated with 1 µg/ml LPS. An oligonucleotide, AGGAGTCCTCCAGCCGCCGC, complementary to the 5' untranslated region of the mTLR2 cDNA (8) was end labeled with 32P and hybridized with 10 µg of RNA at 55°C for 8 h. The reverse transcription was performed in 20 µl of first-strand buffer and 100 U of Superscript II (Life Technologies) at 42°C for 1 h. The same primer was used in DNA sequencing on a plasmid containing the 5' flanking region of the mTLR2 gene with fmol DNA sequencing systems (Promega, Madison, WI). The extended primer was run along with the sequencing product on an 8% denaturing polyacrylamide urea gel.
Plasmid constructs, deletion mutagenesis, and DNA purification
A series of synthesis oligonucleotide senses (CCGCTCGAGCCCAATCGTGGGATTCCATG (pGL3–2332), CCGCTCGAGGTTGACCCCATGGTGGTT (pGL3–1486), CCGCTCGAGGCAGGGGGACAAAGTGTTGA (pGL3–789), CCGCTCGAGTGGGCCTCGATAGGGTATTT (pGL3–598), CCGCTCGAGCATTCAGCCATCATTGTCCA (PGL3–384), CCGCTCGAGAACGTTTCCTAGCTGGAGCA (pGL3–297), CCGCTCGAGAGGCGAGCTGGGAGGCAGCT (pGL3–201), CCGCTCGAGACGGAGCCTCTGGACTTTCA (pGL3–144), CCGCTCGAGGCCTGCCCTGTGGCTCCTGC (pGL3–117)) and an antisense (GGAAGATCTCTGGGCACCAGCCTAGGAAG, derived from the respective part of the 5' upstream region of the mTLR2 gene) were used to generate a series of 5' deletion DNA fragments. All PCR fragments were digested with XhoI and BglII and subcloned into pGL3-basic vector (Promega).
To construct a NF-B deletion mutant, 3' NF-B-mut, two PCR
products from two pairs of primers (CCGCTCGAGGTTGACCCCATGGTGGTT and
CGGATATCGGTGTCCTAAAGAGAAGCT; GCGATATCACGGAGCCTCTGGACTTTCA and
GGAAGATCTCTGGGCACCAGCCTAGGAAG) were amplified, digested with
EcoRV, ligated, and cloned into the pGL3-basic vector. To
construct 5' NF-B-mut, PCR products from two pairs of primers
(CCGCTCGAGGTTGACCCCATGGTGGTT and CGGATATCTACTTTAAAACAAGTTAATC;
GCGATTATCCTTACAACTGGAATATGGAG and GGAAGATCTCTGGGCACCAGCCTAGGAAG)
were amplified, digested with EcoRV, ligated, and cloned
into pGL3-basic vector. To construct 3/5' NF-B-mut, PCR products
from three pairs of primers (CCGCTCGAGGTTGACCCCATGGTGGTT and
CGGATATCTACTTTAAAACAAGTTAATC; GCGATTATCCTTACAACTGGAATATGGAG and
CGGATATCGGTGTCCTAAAGAGAAG CT; GCGATATCACGGAGCCTCTGGACTTTCA and
GGAAGATCTCTGGGCACCAGCCTAGGAAG) were amplified, digested with
EcoRV, and cloned into pGL3-basic vector. To prepare
pGL3–384-mut, oligonucleotides used for pGL3–384 were used with the
3' NF-B-mut as the template. The amplified product was cloned into
pGL3-basic vector. Plasmid DNAs were purified from bacterial cultures
using an Endofree Plasmid Maxi kit (Qiagen, Chatsworth, CA). Finally,
restriction enzyme mapping and sequencing confirmed all constructs.
PcDNA3-STAT5a, a dominant negative STAT5a expression plasmid, was a generous gift from Alan D. Andrea (Dana-Farber Cancer Institute, Boston, MA).
Immunoprecipitation and Western blot analysis
Cellular extracts were prepared from untreated or IL-15-treated CTLL-2 cells using PLC lysis buffer (50 mM HEPES (pH 7.0), 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF, 10 mM NaPPi, 1 mM Na3VO4, 1 mM PMSF, 10 mg/ml aprotinin, and 10 mg/ml leupeptin). The lysates from 107 cells were incubated with the STAT5 Ab for 2 h at 4°C, followed by protein G-Sepharose beads (Amersham Pharmacia Biotech) for an additional 1 h. The beads were washed three times with lysis buffer, suspended in SDS sample buffer, and heated at 95°C for 5 min. The eluted proteins were applied to SDS-polyacrylamide gel and electrotransferred to a nitrocellulose membrane. The membrane was blocked for 2 h in 2% BSA-TBST (20 mM Tris-HCl (pH 7.6), 0.15 M sodium chloride, and 0.1% Tween 20), incubated with primary Abs in TBST for 1 h, washed three times with TBST, and incubated for 1 h with HRP-conjugated antimouse Ig (Amersham, Arlington Heights, IL) diluted 1:10,000 in TBST. After three washes in TBST, the blot was developed with the ECL system (Amersham Pharmacia Biotech) according to the manufacturer’s instructions.
EMSA
Nuclear extracts were prepared from RAW264.7 stimulated with 1
µg/ml LPS or 10 ng/ml TNF- and from CTLL-2 stimulated with 10
ng/ml IL-15 as previously described (15). The binding
sequences used for the EMSAs comprise 5'-TTTAAAGTAGGGGGTTTCCCCTTACAACTG
for 5' NF-B, 5'-ACCTGGGGAATTCCCACACG for 3' NF-B, and
5'-GAGCATTCCAATAACCAAAG for STAT. Approximately 1 x
105 cpm of an oligonucleotide, labeled with
32P using T4 polynucleotide kinase, 10 µg of
nuclear extract, and 1 µg of poly(dI · dC) were added to the
binding buffer (10 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 4% glycerol)
and incubated for 30 min at 4°C. For competition assays, nuclear
extracts were incubated with a 50- or 100-fold excess of unlabeled over
labeled oligonucleotide in before the 32P-labeled
probe. For supershift assays, anti-p50, anti-p65 NF-B, or
anti-STAT5 Abs were incubated with nuclear extracts for 2 h
before the binding reactions. The reaction mixtures were run through a
6% nondenaturing polyacrylamide gel at 4°C in TBE buffer (90
mM Tris-borate, 2 mM EDTA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have previously demonstrated that TLR2 mRNA is up-regulated in
mouse macrophages in response to LPS and various cytokines including
IL-1, IL-2, IL-15, TNF-, and IFN- (14).
TLR2 gene expression is also induced by TCR engagement,
IL-2, or IL-15 stimulation in T cells (8). To study the
transcriptional regulation of mTLR2, a mouse genomic library was
screened with a mTLR2 cDNA probe. After screening 
2 x
106 clones, we isolated two positive clones and
characterized them by enzyme mapping and nucleotide sequencing. The two
overlapping clones contained inserts of 14.6 and 15 kb, respectively
(Fig. 1
). The exon/intron junctions of
the mTLR2 gene were partially decided. The published 5'
untranslated region of mTLR2 cDNA (8) was encoded by three
exons. The first ATG that corresponded to the translational start codon
was located at 15 bases downstream of the 5' end of the third
exon.
|
The transcriptional initiation site of the mouse TLR2 gene was
determined by primer extension analysis. A synthetic oligonucleotide
complementary to nucleotide positions 37–57 of the reported mTLR2 cDNA
sequence (8) was hybridized to total RNA from
LPS-stimulated RAW264.7 cells and extended by reverse transcription. As
shown in Fig. 2A, the length
of the extended product was 102 nt, as determined by comparison with
the sequence ladders from the same primer. This transcriptional
initiation site was located 55 bp upstream of the 5' end of the
previously described cDNA (8). Several probes prepared
from the genomic DNA 5' upstream of this site did not generate any
signals in Northern blotting analyses using RNA from LPS-treated
RAW264.7 cells (data not shown). The mRNA transcription initiation site
is designated as +1 in the numbering of the nucleotide sequence
throughout this paper (Fig. 2B).
|
B (positions -1115
to -1106 and -160 to -150), two CCAAT/enhancer binding protein
(C/EBP; positions -1591 to -1578 and -777 to 765), a cAMP response
element-binding protein (CREB; positions -1267 to -1260), and a STAT
(positions -279 to -271) binding sites (Fig. 2
B). Functional analysis of the TLR2 promoter in mouse macrophage cell lines
A series of 5' deletion constructs of the mTLR2 promoter region
was initially generated to analyze mTLR2 promoter activity and to
identify functional cis-acting elements required for
mTLR2 gene expression (Fig. 3A). These 5'-deleted DNAs
were cloned into the promoter-less luciferase vector pGL3-basic
(Promega). The generated plasmids were transfected into a mouse
macrophage cell line, RAW264.7, whose mTLR2 mRNA was responsive to
various stimulants (14). Forty-eight hours after the
transfection, the cells were stimulated with LPS or TNF- for 8
h, and the luciferase activity was measured. The results standardized
by the internal control are shown in Fig. 3B.
|
treatments. The longer construct, pGL3–2332, showed less
induction for each treatment, suggesting that the 1486-bp 5' upstream
region of the mTLR2 gene is sufficient for the maximal
induction by LPS and TNF-. It may also indicate the region between
-2332 and -1486 is inhibitory for the mTLR2 induction. The five
shorter constructs (789, 598, 384, 297, and 201) showed slightly less
induction for both LPS and TNF-. However, the responsiveness for
these treatments was abrogated when the construct was downed to -144
(pGL3–144). We also transfected these constructs into another mouse
macrophage cell line, J774.1 and obtained very similar results to those
from RAW264.7 cells (data not shown).
Roles of NF-B consensus sequences in mTLR2 gene expression in
mouse macrophages
In our previous report, we demonstrated that specific inhibitors
for extracellular signal-regulated kinase (ERK) did not inhibit
LPS-mediated mTLR2 mRNA induction in RAW264.7 cells, suggesting that
the activation of ERK is not essential for the induction
(14). In contrast, curcumin, the NF-B inhibitor,
effectively inhibited the mTLR2 up-regulation by LPS (14).
This result, however, was not conclusive since the inhibitory effect of
curcumin is not specific to NF-B.
Our luciferase assay data with 5' deletion constructs (Fig. 3A) are consistent with the essential roles of the two
NF-B sites (positions -1115 to -1106 and -160 to -150) in mTLR2
mRNA induction by LPS and TNF-. To further confirm the roles of
NF-B binding sites, we separately mutated two NF-B binding sites
of pGL3–1486 (termed 5' NF-B-mut and 3' NF-B-mut, respectively)
and compared their activity with pGL3–1486 (Fig. 4, A and B). Each
NF-B mutant showed a lower response to LPS or TNF- treatment than
the wild-type construct, suggesting that both NF-B sites contributed
to the full mTLR2 mRNA induction by LPS and TNF-. Deletion of both
NF-B sites (5'/3' NF-B-mut) abrogated the response to TNF-.
This construct, however, still retained a significant response to LPS
stimulation.
|
B binding sites,
we next mutated the 3' NF-B site of a shorter construct, pGL3–384.
The new construct termed pGL3–384-mut did not show any induction in
response to either LPS or TNF- (Fig. 4C). Altogether,
these results have demonstrated that in mouse macrophages, two NF-B
binding sites of mTLR2 promoter are essential in the transcriptional
response to TNF-. They are also important for the LPS response, but
transcriptional factors other than NF-B are also activated by LPS
and contribute by affecting the TLR2 5' flanking region between -384
and -1486. Sythetic lipid A-mediated mTLR2 promoter activation in mouse macrophages
To rule out the possibility that LPS-mediated mTLR2 promoter
activation was due to a small amount of contaminating substances other
than LPS, additional experiments were done with synthetic lipid A, the
biological center of LPS. A series of 5' deletion constructs and
NF-B-mutated constructs were transfected into RAW264.7 cells and
transfected cells were stimulated with 10 µg/ml synthetic lipid A.
The luciferase assay results with lipid A (Fig. 5, A and B) showed
very similar patterns to those with LPS (Figs. 3 and 4). These results
indicated that the LPS-mediated mTLR2 promoter activation was not due
to the contaminating substances such as lipoproteins.
|
A significant fraction of T cells express TLR2 and TLR4 genes, and gene expression of TLR2, unlike that of TLR4, is rapidly induced by TCR engagement, IL-2, or IL-15 stimulation (8). Although we have revealed that ERK and p38 kinase activation are essential for the mTLR2 mRNA up-regulation by TCR engagement (14), molecular mechanisms mediating IL-2/IL-15 responsiveness have not been explored.
To analyze the mechanisms of IL-15-mediated mTLR2 gene
expression in T cells, CTLL-2, a mouse T cell line, was transiently
transfected with a series of 5'-deleted mTLR2 promoter constructs (Fig. 3A). Forty-eight hours after transfection, cells were
starved and stimulated with IL-15 for 8 h. The results of
luciferase assays are shown in Fig. 6A. They were similar to those
with LPS- or TNF--stimulated RAW264.7 cells, except for pGL3–201.
Although this construct was slightly responsive to IL-15, the induction
ratio was significantly less than the four longer constructs (789, 598,
384, and 297). We also performed the assay with IL-2 stimulation and
obtained very similar results (data not shown), which seemed reasonable
since IL-2 and IL-15 share the same signaling receptors (IL-2R and
common chain) in T cells (16).
|
B (17, 18), we also used
NF-B binding site-disrupted constructs to analyze the role of
NF-B in mTLR2 gene expression mediated by IL-15 in CTLL-2
cells (Fig. 6, B and C). Surprisingly, 5' NF-B
deletion had no effect on mTLR2 gene induction by IL-15. In
contrast, the 3' NF-B mutation caused the complete loss of the
responsiveness in CTLL-2 cells. These results indicated that the two
NF-B binding sites of the mTLR2 gene promoter play
different roles in IL-15-mediated mTLR2 gene transcription
in T cells. We also transfected these constructs into another mouse T
cell line, S49.1, for IL-15 stimulation and obtained basically the same
results as those from CTLL-2 cells (data not shown).
The different roles of the two NF-B sites are not specific to IL-15
but due to the cell type difference, since IL-15-mediated mTLR2
promoter activation was mediated by each NF-B site in RAW264.7 cells
(Fig. 6B).
DNA protein binding of mTLR2 promoter in RAW264.7 cells
To examine the NF-B binding to the mTLR2 promoter, EMSAs were
performed (Fig. 7). The double-strand
oligonucleotides corresponding to the 5' and 3' NF-B sequences of
mTLR2 promoter were labeled and incubated with nuclear extracts from
RAW264.7 cells stimulated with LPS or TNF-. We observed constitutive
protein binding to the 3' NF-B probe, but not to the 5' NF-B
probe in this cell line (Fig. 7, A and B).
Stimulation with LPS or TNF- significantly induced protein binding
to both 5' and 3' NF-B probes. The protein binding was abrogated by
the addition of a 50-fold molar excess of unlabeled oligonucleotides,
suggesting the binding was specific.
|
B probes
could be modified by Abs against NF-B/Rel family members p50 and
p65. As shown in the Fig. 7C, the inducible 3' NF-B
complexes were supershifted with Abs against p50 and p65, indicating
the contributions of both p65 and p50 in the shift complexes. In
contrast, inducible 5' NF-B complexes were shifted with Ab against
p65 but not affected by that of p50 (Fig. 7D). Thus, the 5'
NF-B site binds the p65 homodimer.
EMSAs using two NF-B probes were also performed for IL-15-treated
CTLL-2 cells (Fig. 8, A and
C). Unlike LPS or TNF- in macrophages, IL-15 induced
nuclear protein binding only to the 3' NF-B site in T cells (Fig. 8, A and C). The protein-DNA complex of the 3'
NF-B site was supershifted by both anti-p65 and p50 Abs (Fig. 8B).
|
Since IL-15 induced the activation of STAT5 in T cells
(19), we investigated the possibility that STAT-binding
element might also be required in IL-15-mediated mTLR2 gene
expression in T cells. Western blot analyses revealed that IL-15
induced tyrosine phosphorylation of STAT5 in CTLL-2 cells (Fig. 9A). Shortened luciferase
reporter constructs that have 3' NF-B and STAT binding sites,
pGL3–384, were cotransfected with a STAT5a dominant negative
expression plasmid. The cotransfection of this dominant negative
construct abrogated the response to IL-15 (Fig. 9B). We then
performed electrophoretic gel shift assay using an oligonucleotide
corresponding to the STAT consensus sequence found in the mTLR2
promoter region and STAT5 Ab. As shown in Fig. 8C, IL-15
induced the specific protein binding to this STAT consensus sequence,
which was supershifted by STAT5 Ab. These results have indicated that
STAT5 activation contributes to the mTLR2 gene transcription
in IL-15-stimulated T cells.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-2, IL-15, IFN-, or TNF-
(14), whereas in T cells it was responsive to TCR
engagement, IL-2, or IL-15 (8). In our current study, we
focused on the molecular mechanism of how mTLR2 transcription is
regulated by LPS, TNF-, and IL-15. Our results of promoter
functional analyses showed that the upstream region reaching up to
-1486 is sufficient for the fully inducible expression of the
mTLR2 gene in both macrophages and T cells. Nucleotide
sequencing analysis of this region identified consensus sequences for
binding of various transcription factors that may be involve in the
induction of mTLR2 gene expression. They included two
NF-B, two C/EBP, one CREB, and one STAT consensus sequences, all of
which are responsive to LPS or cytokine stimulation in some gene
promoters. This is in contrast to mouse and human TLR4 promoters, in
which neither NF-B nor CREB consensus sequences were found in the 5'
proximal regions of the transcriptional initiation sites. Both human
and mouse TLR4 genes, however, contains two C/EBP sites in
their promoter regions (20). The difference of the
promoter sequences between these two TLRs probably explains their
different mRNA induction patterns in macrophages and T cells as we have
previously reported (8, 14).
In our previous report, we demonstrated that curcumin, an NF-B
inhibitor, effectively inhibited the LPS-mediated mTLR2 gene
expression in macrophages (14). This result, however, was
not conclusive since the inhibitory effect of curcumin is not specific.
The luciferase assay results in our current report are consistent with
the important roles of the two NF-B sites (positions -1115 to
-1106 and -160 to -150) in mTLR2 mRNA induction by both LPS and
TNF-. The deletion analysis of each NF-B site clearly showed that
NF-B has indeed integrating function for full stimulation of the
mTLR2 promoter in macrophages. Thus, like several other receptors, TLR2
not only activates NF-B, but it itself is induced by NF-B.
NF-B encompasses an important family of
transcriptional activators. It is critical for the inducible expression
of multiple genes, including those playing essential roles in immune
responses. The members of the NF-B family include p50 (NF-B1),
p52 (NF-B2), p65 (RelA), RelB, v-Rel, and c-Rel
(21, 22, 23, 24, 25). In cells, NF-B exists as homo- or
heterodimers with distinct DNA-binding specificity. A heterodimer
composed of p50 and p65 subunits is the most common dimer (21, 22). In unstimulated cells, the NF-B proteins exist in
cytoplasm and form an inactive complex with the inhibitory protein
inhibitor B (26, 27). Cellular stimulation with LPS,
inflammatory cytokines, or phorbol ester results in phosphorylation,
ubiquitination, and subsequent degradation of inhibitor B. This
allows the translocation of NF-B to the nucleus where it
up-regulates the transcription of the target genes (1, 23).
In contrast to the essential role of NF-B activation in
TNF--mediated mTLR2 mRNA induction, LPS and lipid A could activate
mTLR2 promoter, albeit to a lesser degree, in the absence of both
NF-B binding sites (Fig. 4B). The additional regulatory
site(s) should exist between -1486 and -384 because pGL3–384-mut, in
which the 3' NF-B site was mutated, failed to respond to LPS and
lipid A (Figs. 4C and 5B). Although NF-B is
the most typical transcription factor activated by LPS, LPS signals
also involve several other transcription factors in various cell types,
namely, ATF-2, AP-1, Sp-1, CREB, and C/EBP (28, 29, 30). It is
of note that the 1486 bp upstream region of the mTLR2 gene
contains CREB and C/EBP binding sites. It is thus conceivable that some
of these sites contribute to the LPS-mediated mTLR2 transcription. Our
experiments using 5' deletion constructs revealed that the difference
between pGL3–1486 and pGL3–789 was more marked with LPS than with
TNF- treatment. In contrast, pGL3–598 showed almost the same
induction as pGL-789 with LPS treatment. These results are consistent
with the idea that the CREB binding site (-1267 to -1260) plays a
role in the LPS-mediated mTLR2 induction. It has recently been reported
that CREB plays a role in the TNF- mRNA induction by LPS in
macrophages (28). In another report, it has been revealed
that CREB is activated by LPS through p38 stress-activated
protein kinase and is involved in the up-regulation of CD80,
CD83, and CD86 (31). It is noteworthy that LPS-mediated
mTLR2 gene expression was slightly inhibited by a specific
inhibitor of p38 stress-activated protein kinase
(14).
The results of the supershift assay suggested the difference between
the two NF-B sites. The 3' NF-B was supershifted by Abs against
p50 and p65, whereas 5' NF-B was supershifted only by an Ab against
p65. Thus, 3' NF-B is preferably bound by the p50/p65 heterodimer
and 5' NF-B is more prone to bind the p65 homodimer.
p65 homodimers have different binding specificities from p50/p65
heterodimers (32). p65 homodimers preferentially bind
GGGRNTTTCC, as evidenced by screening with a pool of random
oligonucleotides (33). This motif is somewhat different
from the p50 homodimer consensus sequence (GGGGATYCCC), and the DNA
motifs that bind p65 homodimers but not p50 homodimers do not bind
p50/p65 heterodimers well. The sequence of the 5' NF-B binding site
of the mTLR2 promoter (GGGGGTTTCC) exactly matches the motif for the
p65 homodimer and thus may preferentially bind p65 homodimers.
In a recent paper, it has been suggested that some kinds of the commercially available LPS contain small amounts of contaminants that can be recognized by TLR2 (34). In our study, however, mTLR2 promoter was activated by synthetic lipid A treatment, clearly indicating that LPS could activate mTLR2 promoter with its lipid A portion.
In contrast to macrophages, only the 3' NF-B sequence seemed
functional in IL-15-treated CTLL-2 cells. It is consistent with the
EMSA data in which the 5' NF-B probe was not shifted with nuclear
extracts prepared from the IL-15-treated T cell line (Fig. 8B). The different roles of these NF-B sites seemed
cell-type specific, since both 5' and 3' NF-B sites were functional
in IL-15-treated RAW264.7 cells (Fig. 6B). Considering the
differences of the binding specificity of the two NF-B sites, it is
reasonable to presume that IL-15-treated CTLL-2 cells did not contain
sufficient amounts of p65 homodimers. The molar ratio of the three
NF-B complexes (p50 homodimer, p50/p65 heterodimer, and p65
homodimer) varies among different cell types (21).
Although the expression of p65 is essentially constitutive, some
increases have been reported in some T cell lines (21) and
TNF--treated astrocytes (35). Unfortunately, the
effects of LPS, TNF-, or IL-15 on the ratio of NF-B dimers in
macrophages or T cells has not been elucidated.
In contrast to LPS or TNF-, the region between -297and -201 plays
a role in the IL-15-mediated mTLR2 transcription. It is likely that a
STAT binding site in this region is responsible for this, since STAT5
was tyrosine phosphorylated and bound the STAT consensus sequence in
IL-15-treated CTLL-2 cells (Fig. 9, A and C).
Interestingly, the expression of the dominant negative form of STAT5a
abrogated the mTLR2 promoter activation by IL-15 (Fig. 9B).
Although STAT3 is also activated by IL-15 in T cells (19),
this result indicates that STAT5 is not only involved but is required
for the IL-15-mediated mTLR2 gene expression in T cells. It
was of note, however, that pGL3–384-mut, which contains the STAT
binding site, but no NF-B site, was not responsive to IL-15
treatment. It suggests that the cooperation of the active STAT and 3'
NF-B sites is necessary to mediate the IL-15 effect in T cells.
Synergy between different signal pathways has recently been
demonstrated for many cytokines and growth factors. The collaboration
between the NF-B motif and a STAT-binding element has recently been
reported for IFN regulatory factor-1 gene promoter
(36). It has been reported that artificial constructs
containing a single copy of both a STAT-binding element and a NF-B
motif were able to mediate a synergistic response to IFN- and
TNF-, and this response varied with both the relative spacing and
the specific sequence of the regions between these two sites
(36).
In conclusion, the present study has explored how mTLR2 promoter is
activated in immunocompetent cells by LPS, TNF-, or IL-15. We have
found that NF-B, probably the most important transcriptional factor
in immune responses of the host, plays important but different roles in
response to these three stimulants. Although NF-B is sufficient for
the full response to TNF-, other factors contribute to the maximum
mTLR2 induction by LPS or IL-15. Both TNF- and IL-15 are rapidly
induced in the early phase of bacterial infections. Since
TLR2 can induce signals by recognizing a wide variety of
bacterial components, the rapid induction of TLR2 will enhance the
prompt responses of the host to bacteria. There are at least 11 members
of TLRs in the mouse, and our preliminary data suggested that the gene
expression of at least 2 other members of TLRs, TLR3 and
TLR5, were induced by LPS treatment (T. Matsuguchi,
unpublished results). It remains an open question whether the
expression of these TLRs are under the similar control mechanisms
to TLR2.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Tetsuya Matsuguchi, Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550, Japan.
3 Abbreviations used in this paper: TLR, Toll-like receptor; C/EBP, CCAAT/enhancer inducing protein; CREB, cAMP response element-binding protein; mTLR, mouse TLR; ERK, extracellular signal-regulated kinase.
Received for publication October 20, 2000. Accepted for publication January 17, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and c-Jun N-terminal kinase. J. Biol. Chem. 274:19368./IL-7R doubly deficient mice recapitulate the thymic and intraepithelial lymphocyte (IEL) developmental defects of c-/- mice: roles for both IL-2 and IL-15 in CD8 IEL development. J. Immunol. 163:5906.B activation and IL-8 production in human neutrophils. Blood 92:4828.B transcription factors. Oncogene 18:6853.[Medline]
B. Annu. Rev. Cell. Biol. 10:405.
B: a lesson in family values. Cell 80:529.[Medline]
B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]
B: ten years after. Cell 87:13.[Medline]
B and IB proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
B: a specific inhibitor of the NF-B transcription factor. Science 242:540.B can rapidly dissociate the complex of the NF-B transcription factor with its cognate DNA. Cell 61:255.[Medline]
- or lipopolysaccharide-induced expression of the murine P-selectin gene in endothelial cells involves novel B sites and a variant activating transcription factor/cAMP response element. J. Biol. Chem. 273:10068.B signal transduction pathways are involved in the survival and maturation of lipopolysaccharide-stimulated human monocyte-derived dendritic cells. Blood 96:1039.B. EMBO J. 10:3805.[Medline]
B/Rel DNA-binding motifs: interaction of both subunits of NF-B with DNA is required for transcriptional activation. Mol. Cell. Biol. 12:4412.B and C/EBP isoforms. J. Neuroimmunol. 92:196.[Medline]
and tumor necrosis factor- in transcriptional activation is mediated by cooperation between signal transducer and activator of transcription 1 and nuclear factor B. J. Biol. Chem. 272:14899.This article has been cited by other articles:
|
|
 |
|
  M. Lalancette-Hebert, D. Phaneuf, G. Soucy, Y. C. Weng, and J. Kriz Live imaging of Toll-like receptor 2 response in cerebral ischaemia reveals a role of olfactory bulb microglia as modulators of inflammation Brain, April 1, 2009; 132(4): 940 - 954. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. K. Phulwani, N. Esen, M. Md. Syed, and T. Kielian TLR2 Expression in Astrocytes Is Induced by TNF-{alpha}- and NF-{kappa}B-Dependent Pathways J. Immunol., September 15, 2008; 181(6): 3841 - 3849. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Wu, R. J. Martin, S. LaFasto, B. J. Efaw, J. G. Rino, R. J. Harbeck, and H. W. Chu Toll-like Receptor 2 Down-regulation in Established Mouse Allergic Lungs Contributes to Decreased Mycoplasma Clearance Am. J. Respir. Crit. Care Med., April 1, 2008; 177(7): 720 - 729. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Uno, K. Kato, T. Atsumi, T. Suzuki, J. Yoshitake, H. Morita, S. Ohara, Y. Kotake, T. Shimosegawa, and T. Yoshimura Toll-like receptor (TLR) 2 induced through TLR4 signaling initiated by Helicobacter pylori cooperatively amplifies iNOS induction in gastric epithelial cells Am J Physiol Gastrointest Liver Physiol, November 1, 2007; 293(5): G1004 - G1012. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Johnson and R. I. Tapping Microbial Products Stimulate Human Toll-like Receptor 2 Expression through Histone Modification Surrounding a Proximal NF-{kappa}B-binding Site J. Biol. Chem., October 26, 2007; 282(43): 31197 - 31205. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Izadi, A. T. Motameni, T. C. Bates, E. R. Olivera, V. Villar-Suarez, I. Joshi, R. Garg, B. A. Osborne, R. J. Davis, M. Rincon, et al. c-Jun N-Terminal Kinase 1 Is Required for Toll-Like Receptor 1 Gene Expression in Macrophages Infect. Immun., October 1, 2007; 75(10): 5027 - 5034. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Rogers, A. Hakki, I. Perkins, C. Newton, R. Widen, N. Burdash, T. Klein, and H. Friedman Legionella pneumophila Infection Up-Regulates Dendritic Cell Toll-Like Receptor 2 (TLR2)/TLR4 Expression and Key Maturation Markers Infect. Immun., June 1, 2007; 75(6): 3205 - 3208. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Foster, S. R. Lea, P. M. Preshaw, and J. J. Taylor Pivotal Advance: Vasoactive intestinal peptide inhibits up-regulation of human monocyte TLR2 and TLR4 by LPS and differentiation of monocytes to macrophages J. Leukoc. Biol., April 1, 2007; 81(4): 893 - 903. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Graveline, M. Segura, D. Radzioch, and M. Gottschalk TLR2-dependent recognition of Streptococcus suis is modulated by the presence of capsular polysaccharide which modifies macrophage responsiveness Int. Immunol., April 1, 2007; 19(4): 375 - 389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. M. Nhu, N. Cuesta, and S. N. Vogel Transcriptional regulation of lipopolysaccharide (LPS)-induced Toll-like receptor (TLR) expression in murine macrophages: role of interferon regulatory factors 1 (IRF-1) and 2 (IRF-2) Innate Immunity, October 1, 2006; 12(5): 285 - 295. [Abstract] [PDF]
|
|
|
|
 |
|
 J. Fan, Y. Li, Y. Vodovotz, T. R. Billiar, and M. A. Wilson Hemorrhagic shock-activated neutrophils augment TLR4 signaling-induced TLR2 upregulation in alveolar macrophages: role in hemorrhage-primed lung inflammation Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L738 - L746. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. P. Gomariz, A. Arranz, C. Abad, M. Torroba, C. Martinez, F. Rosignoli, M. Garcia-Gomez, J. Leceta, and Y. Juarranz Time-course expression of Toll-like receptors 2 and 4 in inflammatory bowel disease and homeostatic effect of VIP J. Leukoc. Biol., August 1, 2005; 78(2): 491 - 502. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Musikacharoen, A. Oguma, Y. Yoshikai, N. Chiba, A. Masuda, and T. Matsuguchi Interleukin-15 induces IL-12 receptor {beta}1 gene expression through PU.1 and IRF 3 by targeting chromatin remodeling Blood, January 15, 2005; 105(2): 711 - 720. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Dunzendorfer, H.-K. Lee, and P. S. Tobias Flow-Dependent Regulation of Endothelial Toll-Like Receptor 2 Expression Through Inhibition of SP1 Activity Circ. Res., October 1, 2004; 95(7): 684 - 691. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Nilsen, U. Nonstad, N. Khan, C. F. Knetter, S. Akira, A. Sundan, T. Espevik, and E. Lien Lipopolysaccharide and Double-stranded RNA Up-regulate Toll-like Receptor 2 Independently of Myeloid Differentiation Factor 88 J. Biol. Chem., September 17, 2004; 279(38): 39727 - 39735. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Hermoso, T. Matsuguchi, K. Smoak, and J. A. Cidlowski Glucocorticoids and Tumor Necrosis Factor Alpha Cooperatively Regulate Toll-Like Receptor 2 Gene Expression Mol. Cell. Biol., June 1, 2004; 24(11): 4743 - 4756. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Hongkuan Fan and J. A. Cook Review: Molecular mechanisms of endotoxin tolerance Innate Immunity, April 1, 2004; 10(2): 71 - 84. [Abstract] [PDF]
|
|
|
|
 |
|
 S. M. McWhirter, K. A. Fitzgerald, J. Rosains, D. C. Rowe, D. T. Golenbock, and T. Maniatis From The Cover: IFN-regulatory factor 3-dependent gene expression is defective in Tbk1-deficient mouse embryonic fibroblasts PNAS, January 6, 2004; 101(1): 233 - 238. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Haase, C. J. Kirschning, A. Sing, P. Schrottner, K. Fukase, S. Kusumoto, H. Wagner, J. Heesemann, and K. Ruckdeschel A Dominant Role of Toll-Like Receptor 4 in the Signaling of Apoptosis in Bacteria-Faced Macrophages J. Immunol., October 15, 2003; 171(8): 4294 - 4303. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Musikacharoen, Y. Yoshikai, and T. Matsuguchi Histone Acetylation and Activation of cAMP-response Element-binding Protein Regulate Transcriptional Activation of MKP-M in Lipopolysaccharide-stimulated Macrophages J. Biol. Chem., March 7, 2003; 278(11): 9167 - 9175. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Hajishengallis, M. Martin, R. E. Schifferle, and R. J. Genco Counteracting Interactions between Lipopolysaccharide Molecules with Differential Activation of Toll-Like Receptors Infect. Immun., December 1, 2002; 70(12): 6658 - 6664. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Faraldo, M.-A. Deugnier, S. Tlouzeau, J. P. Thiery, and M. A. Glukhova Perturbation of beta 1-Integrin Function in Involuting Mammary Gland Results in Premature Dedifferentiation of Secretory Epithelial Cells Mol. Biol. Cell, October 1, 2002; 13(10): 3521 - 3531. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Tsuboi, Y. Yoshikai, S. Matsuo, T. Kikuchi, K.-I. Iwami, Y. Nagai, O. Takeuchi, S. Akira, and T. Matsuguchi Roles of Toll-Like Receptors in C-C Chemokine Production by Renal Tubular Epithelial Cells J. Immunol., August 15, 2002; 169(4): 2026 - 2033. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Wang, W. P. Lafuse, K. Takeda, S. Akira, and B. S. Zwilling Rapid Chromatin Remodeling of Toll-Like Receptor 2 Promoter During Infection of Macrophages with Mycobacterium avium J. Immunol., July 15, 2002; 169(2): 795 - 801. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Haehnel, L. Schwarzfischer, M. J. Fenton, and M. Rehli Transcriptional Regulation of the Human Toll-Like Receptor 2 Gene in Monocytes and Macrophages J. Immunol., June 1, 2002; 168(11): 5629 - 5637. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wei, M. W.-H. Wang, S. L. Teitelbaum, and F. P. Ross Interleukin-4 Reversibly Inhibits Osteoclastogenesis via Inhibition of NF-kappa B and Mitogen-activated Protein Kinase Signaling J. Biol. Chem., February 15, 2002; 277(8): 6622 - 6630. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Li, Y. Wang, L. Gao, J. Zhang, J. Shao, S. Wang, W. Feng, X. Wang, M. Li, and Z. Chang Expression of Toll-like Receptors 2 and 4 and CD14 during Differentiation of HL-60 Cells Induced by Phorbol 12-Myristate 13-Acetate and 1{alpha}, 25-Dihydroxy-Vitamin D3 Cell Growth Differ., January 1, 2002; 13(1): 27 - 38. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Wang, W. P. Lafuse, and B. S. Zwilling NF{kappa}B and Sp1 Elements Are Necessary for Maximal Transcription of Toll-like Receptor 2 Induced by Mycobacterium avium J. Immunol., December 15, 2001; 167(12): 6924 - 6932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Martin, J. Katz, S. N. Vogel, and S. M. Michalek Differential Induction of Endotoxin Tolerance by Lipopolysaccharides Derived from Porphyromonas gingivalis and Escherichia coli J. Immunol., November 1, 2001; 167(9): 5278 - 5285. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
