| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Immunobiology Research Center, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215;
Department of Medicine, University Medical School of Debrcen, Hungary;
Yale University, School of Medicine, Department of Internal Medicine, Pulmonary and Critical Care Section, New Haven, CT 06520;
Department of Pathology, Massachusetts General Hospital, Boston, MA 02114; and
¶ Division of Hematology, University of Minnesota, Minneapolis, MN 55455
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Rejection of mouse-to-rat cardiac transplants is prevented when the recipient is treated at the time of transplantation with cobra venom factor (CVF)5 to block complement activation and daily thereafter with cyclosporin A (CsA) to block T cell activation (4). We refer to graft survival under this regimen as "accommodation" (5, 10). Naive grafts transplanted into the same recipient 10 days after transplantation of the first graft undergo hyperacute rejection in a few minutes, suggesting that accommodated grafts are actively protected against rejection (5, 11). We have argued that accommodation is dependent on the expression by the graft vasculature of a series of protective genes (3, 5) including the stress-responsive gene heme oxygenase-1 (HO-1; Refs. 1, 3, 4, 5, 6, 12). We have shown that this is the case, and in particular that the expression of the protective gene HO-1 contributes in a critical manner to establish accommodation. This is illustrated by the observation that hearts from HO-1-deficient (HO-1-/-) mice transplanted into rats treated with CVF plus CsA undergo acute vascular rejection, whereas hearts from wild-type HO-1+/+ mice transplanted under the same regimen accommodate and survive long term (1). The mechanism by which HO-1 promotes accommodation remains to be established.
HOs are the rate-limiting enzymes in the catabolism of heme into bilirubin, free iron, and carbon monoxide (CO; Refs. 13, 14). Expression of HO-1 is up-regulated in most cell types exposed to oxidative stress, whereas the constitutive expression of HO-2 is not up-regulated under these conditions (13, 14). Analyses of HO-1-/- mice suggest that HO-1 regulates iron homeostasis (15) while acting as a cytoprotective gene (16). In addition, HO-1 may have potent antiinflammatory (16, 17, 18, 19) and antiapoptotic effects (1, 20, 21). Findings consistent with such biological functions were confirmed in a case report of HO-1 deficiency in humans (22).
The molecular mechanism(s) responsible for the cytoprotective effects
of HO-1 remain largely unknown. The current view is that HO-1 has a
diverse spectrum of cytoprotective effects that are associated with the
different end products of heme catabolism (13, 14). One
these products, i.e., CO, has potent cytoprotective effects
(23). These include the induction of vasorelaxation and
suppression of platelet aggregation (24, 25, 26), both of
which are mediated through the activation of the enzyme guanylyl
cyclase and subsequent generation of cGMP. In addition, CO inhibits the
proinflammatory phenotype associated with the activation of
monocyte/macrophages (M
; Ref. 27). CO also protects
endothelial cells from undergoing apoptosis (1, 28). Both
these biological actions of CO act through the activation of the p38
mitogen-activated protein kinase pathway, independently of the
activation of guanylyl cyclase or cGMP generation (27, 28). Presumably, these biological properties of CO contribute in
a critical manner to the overall cytoprotective and antiinflammatory
actions of HO-1 and thus may be a central component on the mechanism by
which HO-1 suppresses the rejection of transplanted organs (1, 29, 30). In this study, we tested whether or not the ability of
HO-1 to suppress the rejection of mouse-to-rat cardiac grafts depends
on the generation of CO. Our results suggest that this is the
case.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c mouse hearts were used as donor organs for transplantation into inbred adult male Lewis rats (Harlan Sprague-Dawley, Indianapolis, IN). Animals were housed in accordance with guidelines from the American Association for Laboratory Animal Care, and research protocols were approved by the Institutional Animal Care and Use Committees of the Beth Israel Deaconess Medical Center.
Surgical model
Animals were anesthetized by a combination of methoxyflurane (Pitman-Moore, Mundelain, IL) inhalation and pentobarbital (Abbott, North Chicago, IL) at a dose of 30–50 mg/kg i.p. during all procedures. Heterotopic cardiac transplants were performed as described before (1, 4). Graft survival was assessed daily by palpation, and rejection was diagnosed by cessation of ventricular contractions and confirmed by histologic examination.
Experimental reagents
CVF (Quidel, San Diego, CA) was administered i.p. on day -1 (60 U/kg) and on day 0 (20 U/kg) with respect to the day of transplantation (day 0). CsA (Novartis Pharma, Basel, Switzerland) was administered daily i.m. (15 mg/kg) starting at day 0 and daily thereafter until the end of each experiment. Tin protoporphyrin (SnPPIX), cobalt protoporphyrin (CoPPIX), and iron protoporphyrin (FePPIX; Porphyrin Products, Logan, UT) were diluted in 100 mM NaOH to a stock solution of 50 mM and kept at -70°C until used. Light exposure was limited has much as possible. Both SnPPIX and FePPIX were administered i.p. (30 µM/kg) in PBS. FePPIX and SnPPIX were administered to the donor at days -2 and -1 (30 µM/kg) and to the recipient at the time of transplantation (day 0) and daily thereafter (30 µM/kg).
CO exposure
Briefly, CO at a concentration of 1% (10,000 parts per million; ppm) in compressed air was mixed with balanced air (21% oxygen) in a stainless steel mixing cylinder before entering the exposure chamber. CO concentrations were controlled by varying the flow rates of CO in a mixing cylinder before delivery to the chamber. Because the flow rate is primarily determined by the O2 flow, only the CO flow was changed to deliver the final concentration to the exposure chamber. A CO analyzer (Interscan Corporation, Chatsworth, CA) was used to measure CO levels continuously in the chamber. Graft donors were placed in the CO exposure chamber 2 days before transplantation. Graft recipients were placed in the exposure chamber immediately following transplantation and were kept in the exposure chamber during 14 (n = 3) or 16 (n = 3) days. CO concentration was maintained between 250 and 400 ppm at all times. Animals were removed daily from the chamber to assess for graft survival and to administer CsA, SnPPIX, or FePPIX, as described above.
HO enzymatic activity
HO enzymatic activity was measured by bilirubin generation in
heart and liver microsomes. Animals were sacrificed, and the liver and
hearts were flushed with ice-cold PBS and frozen at -70°C until
used. Organs were homogenized in four volumes of sucrose (250 mM)
Tris-HCl (10 mM/L) buffer (pH 7.4) on ice and centrifuged (28,000
x g, 20 min, 4°C). The supernatant was centrifuged
(105,000 x g, 60 min, 4°C), and the microsomal
pellet was resuspended in MgCl2 (2
mM/L)-potassium phosphate (100 mM) buffer (pH 7.4) and sonicated on
ice. The samples (1 mg of protein) were added to the reaction mixture
(400 µl) containing rat liver cytosol (2 mg of protein), hemin (50
µM), glucose-6-phosphate (2 mM), glucose-6-phosphate dehydrogenase
(0.25 U), and NADPH (0.8 mM) for 60 min at 37°C in the dark. The
formed bilirubin was extracted with chloroform and 
OD was measured
at 464–530 nm (extinction coefficient, 40 mM/L/cm for bilirubin).
Enzyme activity is expressed as picomoles of bilirubin formed per
milligram of protein per 60 min (pmol/mg/h). The protein concentration
was determined by the bicinchoninic acid protein assay (Pierce,
Georgetown). The background of the technique was 
5 pmol/mg/h. All
reagents used in this assay were purchased from Sigma (St. Louis, MO),
unless otherwise indicated.
Carboxyhemoglobin was measured 2 days after transplantation by using a Corning 865 blood gas analyzer (Clinical Chemistry, Massachusetts General Hospital, Boston, MA).
Histomorphometric analysis
Grafts were harvested 3 days after transplantation, embedded in
paraffin, fixed in formalin, and serially sectioned (5 µm) in toto
from the apex to the base. Ten sections were placed per slide in a
total of about 20–25 slides. Every fifth slide was stained with
hematoxylin and eosin (H&E) for histomorphometric analysis. Two images
per slide were captured by using a Nikon Eclipse E600 microscope
(Nikon, Melville, NY) connected to a Hitachi 3-CCD Color Camera (model
HV-C20; Hitachi, Tokyo, Japan) and to a Power Macintosh 7300/200
computer (Apple Computer, Cupertino, CA) equipped with IPLab Spectrum
digital imaging software (Signal Analytics Corporation, Vienna, VA).
About 50 images were captured from each transplanted heart from two to
three animals per group. Images were analyzed by manual segmentation,
tracing the infarcted and noninfarcted areas from the right and left
ventricles in each section. Areas corresponding to infarcted and
noninfarcted tissue were calculated by digital imaging software as
number of pixels corresponding to those areas. Infarcted and
noninfarcted areas were then calculated as percentage of total area.
Pooled data for each group, expressed as area in pixels or as
percentage of infarction, was analyzed by using ANOVA. Results obtained
in this manner were similar whether using either pixels or percentage
of infarction and only the results obtained using percentage of
infarction are shown (see Table II
). Results are expressed as mean
± SD.
|
Grafts were harvested 3 days after transplantation, snap-frozen
in liquid nitrogen, and stored at -80°C. Cryostat sections were
fixed and stained as described previously (1). Rat
leukocyte populations were analyzed by using anti-rat leukocyte
common Ag (LCA, CD45; OX-1), 
TCR (TCR-chains; R73), B cell
(CD45RB; OX-33), NK cell (NKR-P1; 3.2.3), M (CD68; ED-1), and mAbs
(Serotec, Harlan Bioproducts for Science, Indianapolis, IN). Detection
of fibrin/fibrinogen was conducted by using a rabbit anti-human
fibrin/fibrinogen polyclonal Ab (Dako, Carpinteria, CA). Intragraft
complement activation was detected by using an anti-rat C1q (The
Binding Site, Birmigham, U.K.), C3 (ED11; Serotec), or C5b-9 mAbs
(Dako). Rat IgM was detected by using the mouse anti-rat IgM mAb
MARM-4 (a kind gift of Dr. H. Bazin, University of Louvain, Brussels,
Belgium). Isotype-matched mAbs or purified Ig, as well as a control for
residual endogenous peroxidase activity, were included in each
experiment. Detection of apoptosis was conducted by using ApopTag in
situ apoptosis detection kit (Oncor, Gaithersburg, MD) according to the
manufacturer’s instructions.
Complement hemolytic assay (CH50)
CH50 units were defined as the dilution of rat serum required to
produce 50% maximal lysis of Ab-sensitized sheep erythrocytes.
Briefly, Ab-sensitized sheep erythrocytes (1 x
108 cells/ml; Sigma) were incubated (30 min,
37°C) with rat serum in gelatin Veronal buffer
(GVB++; Sigma). Cells were centrifuged and
hemoglobin release was measured (
= 550 nm). Background was
measured in the absence of sheep erythrocytes or in the absence of
serum and subtracted from all samples.
Cellular ELISA
Serum levels of rat anti-mouse Abs were measured by
cellular-based indirect ELISA. The mouse 2F-2B endothelial cell line
(CRL-2168; American Type Culture Collection (ATCC), Manassas, VA) was
used as an antigenic target. Briefly, 2F-2B cells were cultured in DMEM
(Life Technologies, Rockville, MD), 10% FCS, 100 U/ml penicillin, and
100 µg/ml streptomycin (Life Technologies). Glutharaldehyde-fixed
2F-2B cells were incubated (1 h, 37oC) in the
presence of rat serum serially diluted in PBS 0.05% Tween 20 (Sigma)
and rat anti-mouse Abs were detected by using mouse anti-rat
IgM (MARM-4), IgG1 (MARG1-2), IgG2a (Marg2a-1), IgG2b (MARGb-8), or
IgG2c (MARG2c-5) (kind gifts from Prof. H. Bazin, University of
Louvain, Brussels, Belgium). Mouse anti-rat Abs were detected by
using HRP-labeled goat anti-mouse Fab' depleted from anti-rat
Ig cross reactivity (0.1 µg/ml, 1 h, room temperature; Pierce,
Rockford, IL). HRP was revealed by using ortho-phenyldiamine
(Sigma) and H2O2 (0.03%)
in citrate buffer (pH 4.9). Absorbance was measured at = 490
nm. The relative amount of circulating anti-graft Abs in the serum was
expressed as OD ( = 490) taken from one serial dilution in the
linear range of the assay (1:32–1:1024).
Binding of rat C3 to mouse endothelial cells was measured by a modified cellular ELISA with mouse 2F-2B endothelial cells as antigenic targets (8). Briefly, nonfixed 2F-2B endothelial cells were incubated in the presence of rat serum serially diluted in GVB++ buffer (1 h, 37°C). Cells were fixed in PBS, 0.05% glutharaldehyde, and rat C3 deposition was detected by using a mouse anti-rat C3 mAb (Serotec).
Platelet aggregation assay
Mouse 2F-2B endothelial cells were cultured on 0.2% gelatin (Sigma)-coated six-well plates in 88% DMEM (Life Technologies), 10% FCS (FCS), 100 U/ml penicillin, and 100 µg/ml streptomycin (Life Technologies). Confluent endothelial cells either were left untreated or were treated with the HO-inducing agent CoPPIX (50 µM; 18 h), the HO inhibitor SnPPIX (50 µM, 18 h), or both CoPPIX (50 µM, 15 h) and SnPPIX (50 µM, 3 h). Platelet-rich plasma was obtained by centrifugation (290 x g, 12 min, 19°C) of normal rat plasma in 3.8% sodium citrate. Rat platelets (3 x 108 cells/ml) were resuspended in HT buffer (8.9 mM NaHCO3, 0.8 mM KH2PO, 5.6 mM dextrose, 2.8 mM KCl solution, 0.8 mM MgCl2, 129 mM NaCl, 10 mM HEPES). Platelets were overlaid (5 min; 37°C) on mouse endothelial cells, and platelet aggregation assay were conducted as described before (31) by using an aggregometer (Chrono-Log, Harestown, PA) and ADP (0.5–4 µM) as an agonist.
Cell extracts and Western blot analysis
Endothelial cells were washed in PBS (pH 7.2), harvested by
scraping, and lysed in Laemmli buffer. Electrophoresis was conducted
under denaturing conditions with 10% polyacrylamide gels. Proteins
were transferred onto a polyvinyldifluoridine membrane (Immobilon P;
Millipore, Bedford, MA) by electroblotting and detected with rabbit
polyclonal Abs directed against human HO-1 or HO-2 (StressGen,
Victoria, Canada) or -tubulin (Boehringer Mannheim, Mannheim,
Germany). Proteins were visualized by using HRP-conjugated donkey
anti-rabbit IgG or goat anti-mouse IgG (Pierce) and the ECL
assay (Amersham Life Science, Arlington Heights, IL) according to
manufacturer’s instructions.
Transient transfections and apoptosis assay
The murine 2F-2B endothelial cell line (ATCC) was transiently
transfected as described elsewhere (1, 28). All
experiments were conducted 24–48 h after transfection.
-galactosidase-transfected cells were detected as described
elsewhere (1, 28). Percentage of viable cells was assessed
by evaluating the number of -galactosidase-expressing cells that
retained normal morphology as described elsewhere (1, 28).
The number of random fields counted was determined to have a minimal of
200 viable transfected cells per control well. The percentage of viable
cells was normalized for each DNA preparation to the number of
transfected cells counted in the absence of the apoptosis-inducing
agent (100% viability). All experiments were performed at least three
times in duplicate. Actinomycin D (Act.D; Sigma) was dissolved in PBS
and added to the culture medium (10 µg/ml) 24 h after
transfection. SnPPIX (Porphyrin Products) was dissolved (10 mM) in 100
mM NaOH and conserved at -20°C until used. SnPPIX was added to the
culture medium (50 µM) 6 h after transfection. Human recombinant
TNF- (R&D Systems, Minneapolis, MN) was dissolved in PBS, 1% BSA
and added to the culture medium (10–100 ng/ml) 24 h after
transfection.
Exposure of cultured endothelial cells to CO
Cells were exposed to compressed air or varying concentration of CO (250 and 10,000 ppm), as described elsewhere (27, 28).
RT-PCR was conducted after RNA isolation from the transplanted hearts
by using an RNA extracting kit, according with the manufacturer’s
instructions (Qiagen, Chatsworth, CA). Primers used for mouse -actin
were: sense, CCTGACCGAGCGTGGCTACAGC; antisense,
AGCCTCCAGGGCATCGGAC; and for mouse HO-1: sense,
TCCCAGACACCGCTCCTCCAG; antisense, GGATTTGGGGCTGCTGGTTTC.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mouse hearts transplanted into untreated rats underwent acute
vascular rejection 2–3 days after transplantation, an observation
consistent with our previous reports (1, 4). Under CVF
plus CsA treatment, mouse cardiac grafts survived long term (Table I), a finding also consistent with
previous reports (1, 4). Under CVF plus CsA treatment,
graft survival was associated with up-regulation of HO-1 expression by
graft endothelial and smooth muscle cells as well as by cardiac
myocytes (Fig. 1). Expression
of HO-1 mRNA was detected 12–24 h after transplantation
and HO-1 protein 24–72 h after transplantation (Fig. 1). Long-term
graft survival did not occur when the HO inhibitor SnPPIX was
administered to the donor and then to the recipient, despite treatment
with CVF plus CsA. Under these conditions, all grafts were rejected in
3–7 days (Table I). Control treatment with FePPIX, a protoporphyrin
that does not inhibit HO activity, did not lead to graft rejection
(Table I).
|
|
). Naive mouse hearts produced 35.5
± 4 picomols of bilirubin per milligram of total protein per hour
(pmol/mg/h; Fig. 2). HO activity was significantly increased in mouse
hearts transplanted into untreated (98 ± 7.21 pmol/mg/h;
p = 0.001), CVF plus CsA (98.3 ± 7.23
pmol/mg/h)-treated, or CVF plus CsA plus FePPIX (77.3 ± 5.51
pmol/mg/h; p = 0.0009)-treated rats, as compared with
naive hearts (Fig. 2). HO activity was inhibited to basal levels, as
present in naive hearts, in mouse hearts transplanted into rats treated
with CVF plus CsA plus SnPPIX (32.37 ± 7.23 pmol/mg/h). This
represented a highly significant inhibition as compared with mouse
hearts transplanted into untreated (p =
0.0009), CVF plus CsA (p = 0.0009)-treated, or
CVF plus CsA plus FePPIX-treated rats (p =
0.0018; Fig. 2). HO activity in the recipient’s livers was also
up-regulated after transplantation in a manner that mimicked that of
the transplanted hearts (data not shown). However, this was not the
case for the recipient’s heart, in which HO activity was not
up-regulated following transplantation (Fig. 2).
|
). This was not
observed in grafts transplanted into control rats treated with FePPIX
(Fig. 3).
|
). Generation of antigraft Abs was
correlated by complement activation, as demonstrated by C3 deposition
on mouse endothelial cells (Fig. 4). Neither SnPPIX or FePPIX treatment
influenced C3 deposition on mouse endothelial cells (Fig. 4).
|
All mouse hearts transplanted into rats treated with SnPPIX and
exposed to CO (400 ppm; 0.04%) survived long term (Table II
). The dose of CO used (400–500 ppm)
corresponds to approximately one-twentieth of the lethal dose (data not
shown). Rats and mice exposed to CO did not exhibit untoward reactions.
CO exposure was discontinued 14 (n = 3) or 16
(n = 3) days after transplantation without influencing
graft survival, i.e., grafts continued to function for >50 days
(Table II).
To determine whether exogenous CO interfered with inhibition of HO-1
enzymatic activity by SnPPIX, which could account for the ability of CO
to suppress graft rejection, we tested whether or not CO
affected HO enzymatic activity in hearts transplanted into
SnPPIX-treated rats. As shown in Fig. 5, this was not the case. Total HO enzymatic activity in hearts
transplanted under SnPPIX treatment (32.37 ± 7.23 pmol/mg/h) was
not significantly different from that of hearts transplanted into
rats treated with SnPPIX and exposed to CO (43.6 ± 7.57
pmol/mg/h; p = 0.1095; Fig. 5). Similar results were
obtained in the recipient’s livers and hearts (Fig. 5).
|
). The fact that the transplanted hearts survived when exposed
to CO, even under these suppressive effects of SnPPIX, shows that this
level of CO was sufficient to adequately "charge" RBC, deliver CO
into the graft, and suppress graft rejection (Fig. 5).
We then asked whether exogenous CO suppressed the development of
myocardial infarction that characterizes graft rejection in
SnPPIX-treated rats (Fig. 3). To test this hypothesis, grafts were
harvested 3 days after transplantation and quantified for the
percentage of infarcted area. Hearts transplanted into untreated rats
showed nearly complete transmural infarction of the right ventricle
(87.1 ± 4.9% of the right ventricle area) with extensive
endomyocardial and transmural infarction of the left ventricle
(32.0 ± 6.7% of the left ventricle area; data not shown).
Infarctions showed nonviable eosinophic myocardium lacking nuclei with
interstitial hemorrhage, edema, and neutrophils. Left ventricle
infarctions were always endomyocardial with transmural extension
depending on the degree of infarction, and those in the right ventricle
were more diffuse in origin. The percentage of infarcted area in both
ventricles generally increased from the apex to the base of the heart.
Hearts transplanted into CVF plus CsA-treated rats showed only small,
diffuse, nontransmural areas of infarction in the right (4.5 ±
4.9%) but not in the left (0.7 ± 2.1%) ventricle (Table III). Hearts transplanted into CVF plus
CsA plus FePPIX-treated rats showed small diffuse areas of infarction
in the right (12.2 ± 9.5%) but not in the left (0.7 ±
1.3%) ventricle (Table III). These hearts were indistinguishable from
those transplanted into CVF plus CsA-treated rats without FePPIX
treatment (Fig. 6). Hearts transplanted
into CVF plus CsA plus SnPPIX-treated rats showed significant
transmural right ventricular infarctions (26.1 ± 12.7%) with
extensive endomyocardial and transmural left ventricular infarctions
(37.6 ± 15.5%) (Table III) in a pattern that was
indistinguishable from that of hearts transplanted into untreated rats
(Fig. 6). These lesions were specific to the transplanted heart. The
recipients’ native hearts did not develop any infarction. The
percentage of infarcted area in hearts transplanted into SnPPIX-treated
rats was significantly higher (p < 0.001) as
compared with that of hearts transplanted into rats treated with CVF
plus CsA with or without FePPIX treatment (Table III). Hearts
transplanted into SnPPIX-treated rats that received exogenous CO showed
very little infarction of the right (8.4 ± 5.3%) and left
(1.8 ± 3.4%) ventricles (Table III), with patterns that were
similar to those of hearts transplanted into CVF plus CsA-treated rats
with or without FePPIX treatment (Fig. 6). The percentage of infarcted
area in hearts transplanted into SnPPIX-treated rats that received
exogenous CO was not significantly different from that of hearts
transplanted into CVF plus CsA-treated rats with or without FePPIX
treatment. However, the percentage of infarcted area in these hearts
was significantly different (p < 0.001) from
that of hearts transplanted under the same treatment but that did not
receive exogenous CO.
|
|
infiltration that characterize acute vascular rejection
Mouse hearts transplanted into CVF plus CsA-treated rats with or
without FePPIX treatment showed extensive intravascular deposition of
rat IgM and C1q (Fig. 7) but no
detectable IgG, C3, or C5b-9 (data not shown). HO-2, HO-1, and ferritin
were detected in graft endothelial and smooth muscle cells as well as
in cardiac myocytes (data not shown). There was only minimal vascular
thrombosis or infiltration by host leukocytes usually associated with
focal areas of infarction (Fig. 7). There was low but detectable
P-selectin expression on the vascular endothelium (Fig. 7).
|
) and no detectable IgG, C3, or C5b-9 (data not shown). There
was widespread vascular thrombosis of large coronary vessels associated
with P-selectin-expressing platelet aggregates (Fig. 7) and
intravascular fibrin (Fig. 7). Thrombi were consistently observed in
large coronary vessels at the base of the heart. There were no
detectable P-selectin-expressing platelet aggregates in the
microvasculature (data not shown). There was extensive graft
infiltration by host neutrophils as well as by
CD45+ leukocytes (Fig. 7) expressing the
monocyte/M marker CD68/ED-1 and MHC class II Ags (data not shown).
Infiltrating monocyte/M were found near arterioles and scattered
throughout the myocardium, associated with areas of infarction
(Fig. 7).
Hearts transplanted into SnPPIX-treated rats that were exposed to CO
were essentially indistinguishable from those transplanted into rats
treated with CVF plus CsA with or without FePPIX (Fig. 7). These hearts
showed similar level of IgM and C1q vascular deposition as compared
with hearts transplanted into recipients treated with SnPPIX but not
exposed to CO (Fig. 7). Under CO exposure, there were no signs of
vascular thrombosis as revealed by the lack of detectable
P-selectin-expressing platelet aggregates or intravascular fibrin (Fig. 7). P-selectin was detected on the graft vascular endothelium (Fig. 7).
There was some level of monocyte/M infiltration associated with
small focal areas of infarction (Fig. 7).
Up-regulation of HO-1 in endothelial cells inhibits platelet aggregation
Given the absence of platelet aggregation in grafts transplanted
into rats exposed to CO (Fig. 7), we questioned whether expression of
HO-1 in endothelial cells would inhibit platelet aggregation in vitro.
The hypothesis was that CO generated by endothelial cells expressing
HO-1 might be sufficient to suppress platelet aggregation. To test this
hypothesis, mouse endothelial cells were exposed to CoPPIX or SnPPIX to
induce or suppress HO activity in these cells, respectively. Platelets
were overlaid on the endothelial cells and tested for their ability to
aggregate on stimulation by ADP (2 µM). Platelets overlaid on
untreated endothelial cells aggregated normally when stimulated with
ADP (Fig. 8). When platelets were exposed
to endothelial cells pretreated with SnPPIX, platelet aggregation was
enhanced as compared with platelets exposed to untreated endothelial
cells (Fig. 8). This observation indicates that untreated endothelial
cells have a basal level of HO activity presumably attributable to
constitutive expression of HO-2 in these cells (Fig. 8). When platelets
were exposed to endothelial cells pretreated with CoPPIX, platelet
aggregation was significantly inhibited as compared with platelets
exposed to untreated or SnPPIX-treated endothelial cells (Fig. 8). This
inhibitory effect was suppressed when platelets were exposed to
endothelial cells treated with both CoPPIX and SnPPIX (Fig. 8). Both
CoPPIX and SnPPIX up-regulated the expression of HO-1 in cultured
endothelial cells (Fig. 8). The differential effects of these
protoporphyrins should be attributed to the ability of SnPPIX to act as
a potent inhibitor of HO-1 enzymatic activity.
|
One of the main features that characterizes the rejection of mouse
hearts transplanted into rats treated with SnPPIX is the widespread
apoptosis of endothelial cells and cardiac myocytes (Fig. 9). Apoptosis did not occur in mouse
hearts transplanted into rats treated with FePPIX (Fig. 9). Given the
ability of HO-1 to suppress endothelial cell apoptosis in vitro
(1, 28), we asked whether this cytoprotective effect was
mediated via the generation of CO. Apoptosis did not occur in mouse
hearts transplanted into rats treated with SnPPIX and exposed to CO,
suggesting that this was the case (Fig. 9). To further test this
hypothesis, we analyzed in vitro whether under inhibition of HO-1
activity by SnPPIX exogenous CO would suppress endothelial cells from
undergoing TNF--mediated apoptosis. The data illustrated in Fig. 9
suggests that this is the case. Overexpression of HO-1 suppressed
TNF--mediated endothelial cell apoptosis, such as it occurs in the
presence of Act.D (Fig. 9; 1, 28). The antiapoptotic
effect of HO-1 is mediated through its enzymatic activity because
exposure of endothelial cells to SnPPIX blocked the antiapoptotic
effect of HO-1 (Fig. 9). Under inhibition of HO-1 activity by SnPPIX,
exogenous CO (10,000 ppm) suppressed TNF--mediated apoptosis,
suggesting that HO-1 suppresses endothelial cell apoptosis via the
generation of CO (Fig. 9).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and Fig. 3). Inhibiting HO-1 activity by SnPPIX led to graft rejection
in a manner that was indistinguishable from that observed when
HO-1-deficient (HO-1-/-) mouse hearts are
transplanted under the same immunosuppressive regimen, both with regard
to the time of rejection (Table I and Fig. 3; Ref. 1) and
to the pathogenesis of rejection (Figs. 3 and 7; Ref. 1).
In the absence of HO-1 or under inhibition of HO activity by SnPPIX,
graft rejection was characterized by widespread hemorrhagic infarction
associated with vascular thrombosis and leukocyte infiltration (Figs. 3 and 7). These lesions did not occur in control recipients treated with
FePPIX under the same immunosuppressive regimen (Figs. 3 and 7). This
data suggests that HO-1 suppresses graft rejection by preventing
thrombosis and infarction that lead to this type of rejection, a
finding consistent with those of others (32).
One possible explanation for the requirement of HO-1 to suppress graft
rejection is that HO-1 enzymatic function is necessary to eliminate
proinflammatory free heme as it accumulates through release of oxidized
hemoglobin and myoglobin after transplantation. When HO-1 activity is
suppressed, proinflammatory heme would accumulate and trigger
endothelial cell activation and the expression of proinflammatory genes
presumably involved in the pathogenesis of graft rejection
(33). An alternative but not mutually exclusive
explanation would be that HO enzymatic activity is needed to generate
one or more of the end-products of heme catabolism, e.g. bilirubin,
free iron that leads to ferritin expression, and/or CO. These
antiinflammatory molecules would then abrogate the proinflammatory
responses that lead to graft rejection. We favored the second
hypothesis and tested directly whether the generation of CO would
account for the protective effect of HO-1 in preventing graft
rejection. To do so, mouse hearts were transplanted under inhibition of
HO-1 activity by SnPPIX and exposed to exogenous CO. Exposure to CO
fully suppressed graft rejection, allowing grafts to survive long term,
despite the suppression of HO-1 activity by SnPPIX (Tables II and III).
This data suggests that CO can fully substitute for the protective
effect of HO-1 in this model. This data also suggests that the major
mechanism by which HO-1 prevents graft rejection does not involve
elimination of free heme but rather the generation of one of the end
products of heme catabolism by HO-1, e.g., CO. We do not exclude that
other end products of HO-1 activity, e.g., iron/ferritin and bilirubin,
may contribute to prevent graft rejection as well. However, our present
data shows that CO alone can fully substitute for HO-1.
It could be argued that the use of SnPPIX in these experiments is a
rather nonspecific approach to demonstrate that HO-1 enzymatic activity
is involved in preventing graft rejection. However, there are at least
three observations that argue against this. First, under SnPPIX
treatment, the pathogenesis of graft rejection (Table I and Fig. 3) is
indistinguishable from that of hearts from
HO-1-/- mice, transplanted under the same
immunosuppressive regimen (1). Second, control treatment
with FePPIX, a protoporphyrin that does not suppress HO-1 activity
(Fig. 1) but that is otherwise very similar to SnPPIX, does not
precipitate graft rejection (Table I). Third, one of the end products
of HO-1 enzymatic activity, i.e., CO, can revert the ability of SnPPIX
to precipitate graft rejection (Tables II and III). Taken together,
these observations strongly support the notion that 1) SnPPIX
precipitates graft rejection by suppressing HO-1 enzymatic activity and
that 2) CO can revert the effect of SnPPIX by reconstituting the
cytoprotective effect of endogenous CO that is generated when the
action of HO-1 is not impaired.
The exact mechanism by which CO suppresses graft rejection remains to
be elucidated. However, our present study provides some clues regarding
these mechanism. One of the most significant effects of exogenous CO in
our study was its ability to suppress platelet aggregation in the
arterioles of the transplanted hearts (Fig. 7), a prominent feature
observed during acute vascular rejection (9, 34). It is
well established that CO has similar effects in vitro
(35). Such effects of CO are also in keeping with our
present data showing that expression of HO-1 in mouse endothelial cells
suppressed platelet aggregation in vitro (Fig. 8), a finding similar to
those reported by others using smooth muscle cells
(24).
Although apoptosis of endothelial cells and cardiac myocytes is not a
prominent feature associated with the rejection of mouse-to-rat cardiac
transplants (1), widespread apoptosis occurs when these
grafts cannot express HO-1 (e.g., grafts from
HO-1-/- mice; Ref. 1) or when HO-1
enzymatic activity is inhibited by SnPPIX (Fig. 9). These data suggests
that expression of HO-1 in vivo suppresses apoptosis. This notion is
further supported by the fact that HO-1 can suppress endothelial cell
apoptosis in vitro (1, 28). Given the proinflammatory
effects associated with endothelial cell apoptosis, the antiapoptotic
effect of HO-1 is likely to contribute to suppress graft rejection.
Under inhibition of HO-1 activity, exogenous CO can suppress
endothelial cell apoptosis in vivo (Fig. 9), suggesting that the
antiapoptotic effect of HO-1 is mediated through the generation of CO
(Fig. 7). This is further supported by the finding that in the absence
of HO-1 activity, exogenous CO suppresses endothelial cell apoptosis in
vitro (Fig. 9). Given the above, we suggest that the antiapoptotic
effect of CO is likely to contribute to the overall protective effect
of HO-1 in preventing graft rejection.
CO may have additional effects that could contribute to prevent graft
rejection. This include the ability of CO to promote vasodilatation
(36) by the induction of smooth muscle cell relaxation
(26, 37). Vasodilatation may contribute to prevent
vascular thrombosis, which would be important in suppressing graft
rejection. An additional antiinflammatory property of CO is its ability
to suppress the expression of proinflammatory genes associated with the
activation of monocyte/M (27). This is illustrated by
the observation that CO suppresses TNF- production while inducing
the production of the anti-inflammatory cytokine IL-10 in activated
M (27). In light of this observation, it is tempting to
speculate that endothelial cells that express high levels of HO-1 and
generate CO may modulate the activation of graft-infiltrating M in a
manner that may contribute to suppress graft rejection.
In conclusion, our data suggests that the generation of CO by the graft
vasculature, through the expression of the protective gene HO-1, plays
a critical role in promoting the survival of cardiac transplants. We
suggest that CO acts as an anti-inflammatory molecule that induces
vasodilatation while suppressing platelet aggregation and
proinflammatory monocyte/M activation. In addition, CO has
antiapoptotic effects over the graft endothelium that may contribute to
suppress graft rejection as well. Potential therapeutic applications of
these findings include the possibility to overexpress HO-1 in
endothelial cells of a graft to generate CO at the time of
transplantation. Although our studies have used a xenotransplantation
as a model of vascular inflammatory injury, it seems likely that these
effects of CO might be used therapeutically in other inflammatory
processes.
|
Footnotes |
|---|
2 Current address: Second Department of Surgery, Tohoku University Hospital, Sendai, Japan.
3 F.H.B. is the Lewis Thomas Professor at the Harvard Medical School and is a paid consultant for Novartis Pharma.
4 Address correspondence and reprint requests to Dr. Miguel P. Soares, Immunobiology Research Center, Beth Israel Deaconess Medical Center, Harvard Medical School, 99 Brookline Avenue, Boston, MA 02215.
5 Abbreviations used in this paper: CVF, cobra venom factor; CsA, cyclosporin A; HO, heme oxygenase; CO, carbon monoxide; M, macrophages; CoPPIX, cobalt protoporphyrin; FePPIX, iron protoporphyrin; SnPPIX, tin protoporphyrin; Act.D, actinomycin D; ppm, parts per million; H&E, hematoxylin and eosin; CH50, complement hemolytic assay.
Received for publication October 16, 2000. Accepted for publication January 4, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-induced apoptosis in cultured fibroblast. Am. J. Physiol. Lung Cell. Mol. Physiol 278:312.
This article has been cited by other articles:
|
|
 |
|
  S. W. Ryter and A. M. K. Choi Heme Oxygenase-1/Carbon Monoxide: From Metabolism to Molecular Therapy Am. J. Respir. Cell Mol. Biol., September 1, 2009; 41(3): 251 - 260. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. C. Ganta and J. S. Alexander Focus on carbon monoxide: a modulator of neutrophil oxidants and elastase spatial localization? Am J Physiol Heart Circ Physiol, September 1, 2009; 297(3): H902 - H904. [Full Text] [PDF]
|
|
|
|
 |
|
 B. Chen, L. Guo, C. Fan, S. Bolisetty, R. Joseph, M. M. Wright, A. Agarwal, and J. F. George Carbon Monoxide Rescues Heme Oxygenase-1-Deficient Mice from Arterial Thrombosis in Allogeneic Aortic Transplantation Am. J. Pathol., July 1, 2009; 175(1): 422 - 429. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Morales, D. Gutman, P. J. Cejas, K. P. Lee, and L. H. Boise Reactive Oxygen Species Are Not Required for an Arsenic Trioxide-induced Antioxidant Response or Apoptosis J. Biol. Chem., May 8, 2009; 284(19): 12886 - 12895. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. R. Scott, M. A. Cukiernik, M. C. Ott, A. Bihari, A. Badhwar, D. K. Gray, K. A. Harris, N. G. Parry, and R. F. Potter Low-dose inhaled carbon monoxide attenuates the remote intestinal inflammatory response elicited by hindlimb ischemia-reperfusion Am J Physiol Gastrointest Liver Physiol, January 1, 2009; 296(1): G9 - G14. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. S. Kim, P. A. Loughran, J. Rao, T. R. Billiar, and B. S. Zuckerbraun Carbon monoxide activates NF-{kappa}B via ROS generation and Akt pathways to protect against cell death of hepatocytes Am J Physiol Gastrointest Liver Physiol, July 1, 2008; 295(1): G146 - G152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Wang, J.-Y. S. Lee, J. H. Kwak, Y. He, S. I. Kim, and M. E. Choi Protective effects of low-dose carbon monoxide against renal fibrosis induced by unilateral ureteral obstruction Am J Physiol Renal Physiol, March 1, 2008; 294(3): F508 - F517. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Bathoorn, D-J. Slebos, D. S. Postma, G. H. Koeter, A. J. M. van Oosterhout, M. van der Toorn, H. M. Boezen, and H. A. M. Kerstjens Anti-inflammatory effects of inhaled carbon monoxide in patients with COPD: a pilot study Eur. Respir. J., December 1, 2007; 30(6): 1131 - 1137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. True, M. Olive, M. Boehm, H. San, R. J. Westrick, N. Raghavachari, X. Xu, E. G. Lynn, M. N. Sack, P. J. Munson, et al. Heme Oxygenase-1 Deficiency Accelerates Formation of Arterial Thrombosis Through Oxidative Damage to the Endothelium, Which Is Rescued by Inhaled Carbon Monoxide Circ. Res., October 26, 2007; 101(9): 893 - 901. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Sheftel, S. F. Kim, and P. Ponka Non-heme Induction of Heme Oxygenase-1 Does Not Alter Cellular Iron Metabolism J. Biol. Chem., April 6, 2007; 282(14): 10480 - 10486. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. S. Zuckerbraun, B. Y. Chin, M. Bilban, J. de Costa d'Avila, J. Rao, T. R. Billiar, and L. E. Otterbein Carbon monoxide signals via inhibition of cytochrome c oxidase and generation of mitochondrial reactive oxygen species FASEB J, April 1, 2007; 21(4): 1099 - 1106. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Gueler, J.-K. Park, S. Rong, T. Kirsch, C. Lindschau, W. Zheng, M. Elger, A. Fiebeler, D. Fliser, F. C. Luft, et al. Statins Attenuate Ischemia-Reperfusion Injury by Inducing Heme Oxygenase-1 in Infiltrating Macrophages Am. J. Pathol., April 1, 2007; 170(4): 1192 - 1199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Ryter, D. Morse, and A. M. K. Choi Carbon Monoxide and Bilirubin: Potential Therapies for Pulmonary/Vascular Injury and Disease Am. J. Respir. Cell Mol. Biol., February 1, 2007; 36(2): 175 - 182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. B. Suliman, M. S. Carraway, L. G. Tatro, and C. A. Piantadosi A new activating role for CO in cardiac mitochondrial biogenesis J. Cell Sci., January 15, 2007; 120(2): 299 - 308. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Bainbridge, L. Belkacemi, M. Dickinson, C. H. Graham, and G. N. Smith Carbon Monoxide Inhibits Hypoxia/Reoxygenation-Induced Apoptosis and Secondary Necrosis in Syncytiotrophoblast Am. J. Pathol., September 1, 2006; 169(3): 774 - 783. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Juncos, J. P. Grande, N. Murali, A. J. Croatt, L. A. Juncos, R. P. Hebbel, Z. S. Katusic, and K. A. Nath Anomalous Renal Effects of Tin Protoporphyrin in a Murine Model of Sickle Cell Disease Am. J. Pathol., July 1, 2006; 169(1): 21 - 31. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. W. Ryter, J. Alam, and A. M. K. Choi Heme Oxygenase-1/Carbon Monoxide: From Basic Science to Therapeutic Applications Physiol Rev, April 1, 2006; 86(2): 583 - 650. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Wang, S. S. Lee, C. Dell'Agnello, V. Tchipashvili, J. D'Avilla, E. Czismadia, B. Y. Chin, and F. H. Bach Bilirubin Can Induce Tolerance to Islet Allografts Endocrinology, February 1, 2006; 147(2): 762 - 768. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Neto, A. Nakao, H. Toyokawa, M. A. Nalesnik, A. J. Romanosky, K. Kimizuka, T. Kaizu, N. Hashimoto, O. Azhipa, D. B. Stolz, et al. Low-dose carbon monoxide inhalation prevents development of chronic allograft nephropathy Am J Physiol Renal Physiol, February 1, 2006; 290(2): F324 - F334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Wu and R. Wang Carbon Monoxide: Endogenous Production, Physiological Functions, and Pharmacological Applications Pharmacol. Rev., December 1, 2005; 57(4): 585 - 630. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. K. Sarady-Andrews, F. Liu, D. Gallo, A. Nakao, M. Overhaus, R. Ollinger, A. M. Choi, and L. E. Otterbein Biliverdin administration protects against endotoxin-induced acute lung injury in rats Am J Physiol Lung Cell Mol Physiol, December 1, 2005; 289(6): L1131 - L1137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Morse and A. M. K. Choi Heme Oxygenase-1: From Bench to Bedside Am. J. Respir. Crit. Care Med., September 15, 2005; 172(6): 660 - 670. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Minamoto, H. Harada, V. N. Lama, M. A. Fedarau, and D. J. Pinsky Reciprocal regulation of airway rejection by the inducible gas-forming enzymes heme oxygenase and nitric oxide synthase J. Exp. Med., July 18, 2005; 202(2): 283 - 294. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Mendicino, M. Liu, A. Ghanekar, W. He, C. Koscik, I. Shalev, M. Javadi, J. Turnbull, W. Chen, L. Fung, et al. Targeted Deletion of Fgl-2/Fibroleukin in the Donor Modulates Immunologic Response and Acute Vascular Rejection in Cardiac Xenografts Circulation, July 12, 2005; 112(2): 248 - 256. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Wang, S. S. Lee, W. Gao, E. Czismadia, J. McDaid, R. Ollinger, M. P. Soares, K. Yamashita, and F. H. Bach Donor Treatment With Carbon Monoxide Can Yield Islet Allograft Survival and Tolerance Diabetes, May 1, 2005; 54(5): 1400 - 1406. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Brusko, C. H. Wasserfall, A. Agarwal, M. H. Kapturczak, and M. A. Atkinson An Integral Role for Heme Oxygenase-1 and Carbon Monoxide in Maintaining Peripheral Tolerance by CD4+CD25+ Regulatory T Cells J. Immunol., May 1, 2005; 174(9): 5181 - 5186. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhang, P. Shan, J. Alam, X.-Y. Fu, and P. J. Lee Carbon Monoxide Differentially Modulates STAT1 and STAT3 and Inhibits Apoptosis via a Phosphatidylinositol 3-Kinase/Akt and p38 Kinase-dependent STAT3 Pathway during Anoxia-Reoxygenation Injury J. Biol. Chem., March 11, 2005; 280(10): 8714 - 8721. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Liu, J. Wei, D. H. Peng, M. D. Layne, and S.-F. Yet Absence of Heme Oxygenase-1 Exacerbates Myocardial Ischemia/Reperfusion Injury in Diabetic Mice Diabetes, March 1, 2005; 54(3): 778 - 784. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. B. Mayr, A. Spiel, J. Leitner, C. Marsik, P. Germann, R. Ullrich, O. Wagner, and B. Jilma Effects of Carbon Monoxide Inhalation during Experimental Endotoxemia in Humans Am. J. Respir. Crit. Care Med., February 15, 2005; 171(4): 354 - 360. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Song, Z. Zhou, P. K. M. Kim, R. A. Shapiro, F. Liu, C. Ferran, A. M. K. Choi, and L. E. Otterbein Carbon Monoxide Promotes Fas/CD95-induced Apoptosis in Jurkat Cells J. Biol. Chem., October 22, 2004; 279(43): 44327 - 44334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Szabo, E. Gallyas, I. Bak, A. Rakotovao, F. Boucher, J. de Leiris, N. Nagy, E. Varga, and A. Tosaki Heme Oxygenase-1-Related Carbon Monoxide and Flavonoids in Ischemic/Reperfused Rat Retina Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3727 - 3732. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-M. Hu, Y.-H. Chen, M.-T. Chiang, and L.-Y. Chau Heme Oxygenase-1 Inhibits Angiotensin II-Induced Cardiac Hypertrophy In Vitro and In Vivo Circulation, July 20, 2004; 110(3): 309 - 316. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Cascalho, B. M. Ogle, and J. L. Platt Xenotransplantation and the Future of Renal Replacement J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1106 - 1112. [Full Text] [PDF]
|
|
|
|
|
|
C. A. Koch, Z. I. Khalpey, and J. L. Platt Accommodation: Preventing Injury in Transplantation and Disease J. Immunol., May 1, 2004; 172(9): 5143 - 5148. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. W. Ryter, D. Morse, and A. M. K. Choi Carbon Monoxide: To Boldly Go Where NO Has Gone Before Sci. Signal., April 27, 2004; 2004(230): re6 - re6. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-O. Pae, G.-S. Oh, B.-M. Choi, S.-C. Chae, Y.-M. Kim, K.-R. Chung, and H.-T. Chung Carbon Monoxide Produced by Heme Oxygenase-1 Suppresses T Cell Proliferation via Inhibition of IL-2 Production J. Immunol., April 15, 2004; 172(8): 4744 - 4751. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Sikorski, T. Hock, N. Hill-Kapturczak, and A. Agarwal The story so far: molecular regulation of the heme oxygenase-1 gene in renal injury Am J Physiol Renal Physiol, March 1, 2004; 286(3): F425 - F441. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Kronke, V. N. Bochkov, J. Huber, F. Gruber, S. Bluml, A. Furnkranz, A. Kadl, B. R. Binder, and N. Leitinger Oxidized Phospholipids Induce Expression of Human Heme Oxygenase-1 Involving Activation of cAMP-responsive Element-binding Protein J. Biol. Chem., December 19, 2003; 278(51): 51006 - 51014. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A Nakao, B A Moore, N Murase, F Liu, B S Zuckerbraun, F H Bach, A M K Choi, M A Nalesnik, L E Otterbein, and A J Bauer Immunomodulatory effects of inhaled carbon monoxide on rat syngeneic small bowel graft motility Gut, September 1, 2003; 52(9): 1278 - 1285. [Abstract] [Full Text]
|
|
|
|
|
|
F. A. D. T. G. Wagener, H.-D. Volk, D. Willis, N. G. Abraham, M. P. Soares, G. J. Adema, and C. G. Figdor Different Faces of the Heme-Heme Oxygenase System in Inflammation Pharmacol. Rev., September 1, 2003; 55(3): 551 - 571. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Hirai, H. Kubo, M. Yamaya, K. Nakayama, M. Numasaki, S. Kobayashi, S. Suzuki, S. Shibahara, and H. Sasaki Microsatellite polymorphism in heme oxygenase-1 gene promoter is associated with susceptibility to oxidant-induced apoptosis in lymphoblastoid cell lines Blood, September 1, 2003; 102(5): 1619 - 1621. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Araujo, L. Meng, A. D. Tward, W. W. Hancock, Y. Zhai, A. Lee, K. Ishikawa, S. Iyer, R. Buelow, R. W. Busuttil, et al. Systemic Rather Than Local Heme Oxygenase-1 Overexpression Improves Cardiac Allograft Outcomes in a New Transgenic Mouse J. Immunol., August 1, 2003; 171(3): 1572 - 1580. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Clark, P. Naughton, S. Shurey, C. J. Green, T. R. Johnson, B. E. Mann, R. Foresti, and R. Motterlini Cardioprotective Actions by a Water-Soluble Carbon Monoxide-Releasing Molecule Circ. Res., July 25, 2003; 93 (2): e2 - e8. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. D. Mayer, X. Wang, and M. D. Maines Nitric Oxide Inhibitor N{omega}-Nitro-L-arginine Methyl Ester Potentiates Induction of Heme Oxygenase-1 in Kidney Ischemia/Reperfusion Model: A Novel Mechanism for Regulation of the Oxygenase J. Pharmacol. Exp. Ther., July 1, 2003; 306(1): 43 - 50. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Song, M. Kubo, D. Morse, Z. Zhou, X. Zhang, J. H. Dauber, J. Fabisiak, S. M. Alber, S. C. Watkins, B. S. Zuckerbraun, et al. Carbon Monoxide Induces Cytoprotection in Rat Orthotopic Lung Transplantation via Anti-Inflammatory and Anti-Apoptotic Effects Am. J. Pathol., July 1, 2003; 163(1): 231 - 242. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhang, P. Shan, J. Alam, R. J. Davis, R. A. Flavell, and P. J. Lee Carbon Monoxide Modulates Fas/Fas Ligand, Caspases, and Bcl-2 Family Proteins via the p38{alpha} Mitogen-activated Protein Kinase Pathway during Ischemia-Reperfusion Lung Injury J. Biol. Chem., June 6, 2003; 278(24): 22061 - 22070. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-H. Chen, S.-F. Yet, and M. A. Perrella Role of Heme Oxygenase-1 in the Regulation of Blood Pressure and Cardiac Function Experimental Biology and Medicine, May 1, 2003; 228(5): 447 - 453. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. D. Blydt-Hansen, M. Katori, C. Lassman, B. Ke, A. J. Coito, S. Iyer, R. Buelow, R. Ettenger, R. W. Busuttil, and J. W. Kupiec-Weglinski Gene Transfer-Induced Local Heme Oxygenase-1 Overexpression Protects Rat Kidney Transplants From Ischemia/Reperfusion Injury J. Am. Soc. Nephrol., March 1, 2003; 14(3): 745 - 754. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhang, P. Shan, L. E. Otterbein, J. Alam, R. A. Flavell, R. J. Davis, A. M. K. Choi, and P. J. Lee Carbon Monoxide Inhibition of Apoptosis during Ischemia-Reperfusion Lung Injury Is Dependent on the p38 Mitogen-activated Protein Kinase Pathway and Involves Caspase 3 J. Biol. Chem., January 3, 2003; 278(2): 1248 - 1258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Sarady, S. L. Otterbein, F. Liu, L. E. Otterbein, and A. M. K. Choi Carbon Monoxide Modulates Endotoxin-Induced Production of Granulocyte Macrophage Colony-Stimulating Factor in Macrophages Am. J. Respir. Cell Mol. Biol., December 1, 2002; 27(6): 739 - 745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Song, R. S. Mahidhara, F. Liu, W. Ning, L. E. Otterbein, and A. M. K. Choi Carbon Monoxide Inhibits Human Airway Smooth Muscle Cell Proliferation via Mitogen-Activated Protein Kinase Pathway Am. J. Respir. Cell Mol. Biol., November 1, 2002; 27(5): 603 - 610. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Ning, R. Song, C. Li, E. Park, A. Mohsenin, A. M. K. Choi, and M. E. Choi TGF-beta 1 stimulates HO-1 via the p38 mitogen-activated protein kinase in A549 pulmonary epithelial cells Am J Physiol Lung Cell Mol Physiol, November 1, 2002; 283(5): L1094 - L1102. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Vulapalli, Z. Chen, B. H. L. Chua, T. Wang, and C.-S. Liang Cardioselective overexpression of HO-1 prevents I/R-induced cardiac dysfunction and apoptosis Am J Physiol Heart Circ Physiol, August 1, 2002; 283(2): H688 - H694. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Morse and A. M. K. Choi Heme Oxygenase-1 . The "Emerging Molecule" Has Arrived Am. J. Respir. Cell Mol. Biol., July 1, 2002; 27(1): 8 - 16. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Brouard, P. O. Berberat, E. Tobiasch, M. P. Seldon, F. H. Bach, and M. P. Soares Heme Oxygenase-1-derived Carbon Monoxide Requires the Activation of Transcription Factor NF-kappa B to Protect Endothelial Cells from Tumor Necrosis Factor-alpha -mediated Apoptosis J. Biol. Chem., May 10, 2002; 277(20): 17950 - 17961. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Gunther, P. O. Berberat, M. Haga, S. Brouard, R. N. Smith, M. P. Soares, F. H. Bach, and E. Tobiasch Carbon Monoxide Protects Pancreatic {beta}-Cells From Apoptosis and Improves Islet Function/Survival After Transplantation Diabetes, April 1, 2002; 51(4): 994 - 999. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Motterlini, J. E. Clark, R. Foresti, P. Sarathchandra, B. E. Mann, and C. J. Green Carbon Monoxide-Releasing Molecules: Characterization of Biochemical and Vascular Activities Circ. Res., February 8, 2002; 90 (2): e17 - e24. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M.K. Choi Heme Oxygenase-1 Protects the Heart Circ. Res., July 20, 2001; 89(2): 105 - 107. [Full Text] [PDF]
|
|
|
|
|
|
R. Motterlini, J. E. Clark, R. Foresti, P. Sarathchandra, B. E. Mann, and C. J. Green Carbon Monoxide-Releasing Molecules: Characterization of Biochemical and Vascular Activities Circ. Res., February 8, 2002; 90 (2): e17 - e24. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
