The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Montalto, M. C.
Right arrow Articles by Stahl, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Montalto, M. C.
Right arrow Articles by Stahl, G. L.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
The Journal of Immunology, 2001, 166: 4148-4153.
Copyright © 2001 by The American Association of Immunologists

A Keratin Peptide Inhibits Mannose-Binding Lectin1

Michael C. Montalto2,*, Charles D. Collard2,*, Jon A. Buras{dagger}, Wende R. Reenstra{dagger}, Rebecca McClaine*, David R. Gies{ddagger}, Russell P. Rother{ddagger} and Gregory L. Stahl3,*

* Department of Anesthesiology, Perioperative and Pain Medicine, Center for Experimental Therapeutics and Reperfusion Injury, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; {dagger} Department of Emergency Medicine, Beth Israel-Deaconess Hospital, Boston, MA 02115; and {ddagger} Alexion Pharmaceuticals, Inc., New Haven, CT 06511


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Complement plays a significant role in mediating endothelial injury following oxidative stress. We have previously demonstrated that the lectin complement pathway (LCP), which is initiated by deposition of the mannose-binding lectin (MBL), is largely responsible for activating complement on endothelial cells following periods of oxidative stress. Identifying functional inhibitors that block MBL binding will be useful in characterizing the role of the LCP in disease models. The human cytokeratin peptide SFGSGFGGGY has been identified as a molecular mimic of N-acetyl-D-glucosamine (GlcNAc), a known ligand of MBL. Thus, we hypothesized that this peptide would specifically bind to MBL and functionally inhibit the LCP on endothelial cells following oxidative stress. Using a BIAcore 3000 optical biosensor, competition experiments were performed to demonstrate that the peptide SFGSGFGGGY inhibits binding of purified recombinant human MBL to GlcNAc in a concentration-dependent manner. Solution affinity data generated by BIAcore indicate this peptide binds to MBL with an affinity (KD) of 5 x 10-5 mol/L. Pretreatment of human serum (30%) with the GlcNAc-mimicking peptide (10–50 µg/ml) significantly attenuated MBL and C3 deposition on human endothelial cells subjected to oxidative stress in a dose-dependent manner, as demonstrated by cell surface ELISA and confocal microscopy. Additionally, this decapeptide sequence attenuated complement-dependent VCAM-1 expression following oxidative stress. These data indicate that a short peptide sequence that mimics GlcNAc can specifically bind to MBL and functionally inhibit the proinflammatory action of the LCP on oxidatively stressed endothelial cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The lectin complement pathway (LCP)4 is an important mediator of the innate immune response, especially during early childhood (1, 2). The LCP is typically initiated by the binding of mannose-binding lectin (MBL) to carbohydrate moieties present on the surface of various bacteria, yeast, and other pathogens (2). Bound MBL associates with the C1r2C1s2-like MBL-associated serine proteases (MASP-1 and MASP-2) which then cleave C2 and C4 to form the classical C3 convertase (3, 4). The LCP converges with the Ab-dependent classical pathway and Ab-independent alternative pathway at the level of C3 cleavage (5).

We have previously shown that the LCP is activated on human endothelial cells that have been subjected to oxidative stress (6). Furthermore, we observed MBL deposition on rat myocardium following ischemia-reperfusion, suggesting that MBL may be proinflammatory during periods of oxidative stress in vivo (6). Additionally, MBL has been implicated in the development of other proinflammatory conditions such as IgA nephropathy and Henoch-Schönlein purpura nephritis (7, 8, 9). Therefore, the development and characterization of potential inhibitors of MBL may be beneficial to understanding the role of MBL as an inflammatory mediator.

MBL is a C-type lectin (collectin) that has a binding affinity for N-acetyl-D-glucosamine (GlcNAc) and mannan (10, 11, 12, 13). In humans, MBL forms an oligomeric structure composed of subunit monomers (32 kDa) arranged in a hexamer of trimers (13, 14). Association of the N-terminal collagen region of multiple monomers creates a clustering of the C-terminal carbohydrate recognition domains (CRD) (12, 14). This bouquet-like conformation allows for the binding of multiple sugar carbohydrate residues and likely contributes to the high binding affinity of MBL for oligosaccharides and bacteria cell walls (5, 12). Although the LCP can be inhibited by natural ligands such as GlcNAc or mannose, carbohydrates serve as poor potential therapeutics due to their limited bioavailability (15). For this reason, our laboratory has focused on identifying alternative inhibitors of MBL and the LCP.

Shikham et al. (16) have demonstrated that mouse and human Abs specific for GlcNAc cross-react with the cytokeratin 14 decapeptide SFGSGFGGGY. Additionally, it was shown that several GlcNAc-specific lectins, including Datura stramonium lectin, Lycopericon esculentum lectin, Solanum tuberosum lectin, wheat germ agglutinin, and Ulex europaeus lectin II, were capable of binding this peptide sequence (16). More recently, another group demonstrated that the enamel matrix protein amelogenin, which is capable of binding GlcNAc, could also bind the peptide SFGSGFGGGY, confirming that this sequence is a molecular mimic of GlcNAc (17). Since MBL has a natural binding affinity for GlcNAc, we hypothesized that the GlcNAc-mimicking peptide SFGSGFGGGY would specifically bind MBL and inhibit the LCP on oxidatively stressed endothelial cells. Thus, this is the first report of a noncarbohydrate ligand interacting with the CRD of MBL.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HUVECs

HUVECs were isolated and cultured as previously described (18). Briefly, HUVECs were harvested with 0.1% collagenase (Worthington Biochemical, Lakewood, NJ) and suspended in medium 199 containing 20% heat-inactivated bovine calf serum (Life Technologies, Rockville, MD). The cells were grown in a 95% air/5% CO2 incubator at 37°C. Endothelial cell purity was assessed as previously described (18). HUVECs were used at passages 1–3.

Production of mAbs

Production and characterization of the anti-human MBL mAb 3F8 has been previously described (6). An anti-porcine C5a mAb was used as an isotype control (19).

Cloning and expression of recombinant human MBL

Human recombinant MBL (rMBL) was cloned by PCR amplification of human liver cDNA. PCR primers were synthesized by Life Technologies. The 5' primer (GCGCGGATCCACCATGGCCCTGTTTCCATCACTCCC) was generated from the 5 ' end of the human MBL (hMBL) coding sequence and contains an upstream BamHI site followed by a Kozak consensus sequence (20). Base 4 of the coding region was changed from a thymine to a guanine, resulting in a serine to alanine change to optimize ribosome binding. The 3' primer (CCTACCTGCAGGTCAGATAGGGAACTCACAGACG) was generated from the 3 ' end of the hMBL coding sequence and contains an Sse8337 cloning site. PCR was performed using the Advantage PCR kit with human liver QUICK-Clone cDNA as the template using the manufacturer’s protocol (Clontech, Palo Alto, CA). The resulting 771-bp band was cloned into the TA cloning vector pCR2.1-TOPO (Invitrogen, Carlsbad, CA) and the sequence was verified. The fragment was directionally subcloned into the mammalian expression vector APEX-3P that was digested with BamHI/Sse8337, resulting in the plasmid pAPEX-3P hMBL (21).

pAPEX-3P hMBL was transfected into 293 EBNA human embryonic kidney cells (Invitrogen) using the transfectam lipid transfection reagent (Promega, Madison, WI) as previously described (21). Cells were selected in growth medium (DMEM with 10% FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mmol/L glutamine, and 250 U/ml G418) containing puromycin at 1 µg/ml for 7–10 days. A pooled cell population was tested by ELISA for the presence of recombinant hMBL and expanded for production. Confluent T-175 flasks of selected cells were washed with PBS before the addition of 30 ml of HB Pro serum-free medium (Irvine Scientific, Santa Ana, CA) containing 250 U/ml G418 and 1 µg/ml puromycin. Supernatants were harvested on two consecutive 4-day intervals, at which time cell debris was removed by centrifugation. Cleared supernatants were stored at 4°C before purification.

hMBL was purified from cell supernatants as previously described with some modifications (22). Briefly, hMBL-containing supernatants (1 liter) were adjusted to 10 mmol/L CaCl2 and rocked overnight at 4°C with 30 ml of mannan-agarose (Sigma, St. Louis, MO) previously washed with TBS (150 mmol/L NaCl, 20 mmol/L Tris, pH 7.4). Following batch binding, the resin was allowed to settle and supernatant was removed. The mannan-agarose resin was transferred to a 100-ml chromatography column (Bio-Rad, Hercules, CA) and washed with 5 volumes of TBS supplemented with 10 mmol/L CaCl2. The hMBL was then eluted with TBS containing 10 mmol/L EDTA. One-milliliter fractions were collected and samples with significant absorbances at A280 were pooled and dialyzed against PBS/0.5 mol/L NaCl (pH 7.4). Protein was concentrated in a Centriprep 30 concentrator (Amicon, Beverly, MA) and sterile filtered using a 0.22-µm Millipore syringe filter (Millipore, Bedford, MA). PAGE analysis of hMBL was performed under reducing and nonreducing conditions. Five micrograms of purified hMBL was separated on a 4–20% Novex gradient gel (Invitrogen) and proteins were stained with Coomassie blue. High order oligomers of MBL were observed under nonreducing conditions and a single monomer (~30 kDa) was observed under reducing conditions (data not shown). For control experiments, native hMBL was purified from human serum as previously described (6).

Conjugation of GlcNAc to BSA

GlcNAc-phenylisothiocyanate (5 mg; Sigma) was dissolved in 5 ml of DMSO and mixed with 3 ml of BSA (5 mg/ml in 0.1 mol/L Na2CO3 buffer, pH 9.0) and rotated overnight at 4°C. The resulting BSA-GlcNAc conjugate was dialyzed against 100 volumes of 0.1 mol/L Tris-HCl (pH 7.0) for 4 h and further dialyzed against PBS for 48 h. A mock control reaction was performed in parallel using DMSO containing no GlcNAc-phenylisothiocyanate. BSA-GlcNAc conjugation was confirmed by ELISA using an anti-O-linked GlcNAc mAb (Affinity Bioreagents, Golden, CO) (data not shown).

Surface plasmon resonance and solution affinity kinetics

The peptide SFGSGFGGGY (referred to here as Glupep4 for N-acetyl-D-glucosamine peptide) was synthesized by the Dana-Farber Molecular Biology core facility (Boston, MA). Binding analysis was performed using a BIAcore 3000 and BIAevaluation 3.0.2 software (BIAcore, Uppsala, Sweden). A biosensor C1 chip (containing no dextran) was washed with 0.1 mol/L glycine-NaOH/0.3% Triton X-100 and activated with N-hydroxysuccinimide and N-ethyl-N'-(dimethyl-aminopropyl)-carbodiimide according to the manufacturer’s instructions. GlcNAc-BSA was diluted to 100 µg/ml in acetate buffer (pH 4.0) and injected manually over a single flow cell until a resonance unit value of ~1000 was obtained. BSA from the mock conjugation reaction was immobilized on a control flow cell and used to subtract nonspecific binding and bulk changes in the refractive index.

To generate a calibration curve for solution affinity analysis, rMBL was diluted in running buffer (143 mmol/L NaCl, 10 mmol/L HEPES, 40 mmol/L CaCl2, 40 mmol/L MgCl2, pH 7.4) and injected at 20 µl/min for 3 min. Each concentration was separated with 2.5 min of disassociation time and a 30-s regeneration with 100 mmol/L glycine (pH 3.0). Each sensogram represents the relative response after subtraction of the reference (control) flow cell. The initial slope of the association phase is directly proportional to concentration under mass transport limited conditions only (23). Therefore, we confirmed rMBL binding to be mass transport limited by varying the flow rate on separate injections (data not shown). A calibration curve was generated by plotting the concentration of rMBL against the initial slope of each response at 20 s after injection. For inhibition analysis and KD calculations, varying concentrations of Glupep (100–0 µg/ml; 1 µg/ml of Glupep = 1.069 µmol/L), an inhibitory mAb specific for human MBL (3F8, 5 or 50 µg/ml) or an isotype control Ab (50 µg/ml) were incubated with a constant concentration of rMBL (6.9 nmol/L in running buffer) for 15–30 min at 23°C. Flow rate, contact time, and regeneration conditions for Glupep inhibition experiments were identical to conditions used for standard curve generation. For control experiments, a 90-s contact time was used. BIAevaluation software 3.0.2 was used to calculate the KD (BIAcore). Briefly, the slope at 20-s after injection was recorded and the concentration of free MBL in each sample was extrapolated from the calibration curve. The KD was calculated using the solution affinity model with general fit parameters according to the equation:

where Bfree = concentration of free MBL in solution, B = the total concentration of MBL, and A = the total concentration of Glupep (23).

Cell surface ELISA

C3 deposition was measured on hypoxic/reoxygenated HUVECs as previously described (6, 18). Briefly, confluent monolayers of HUVECs were subjected to either 0, 12, or 24 h of <1% O2 (hypoxia) in a humidified chamber (Coy Laboratory Products, Ann Arbor, MI) at 37°C. Medium was removed and cells were reoxygenated for 3 h in a 95% air/5% CO2 incubator in the presence of 30% human serum diluted in gelatin/Veronal-buffered saline supplemented with 5 mmol/L Ca2+/Mg2+ (GVB2+). Glupep or GlcNAc (Sigma) was diluted to various concentrations in 30% human serum/GVB2+. Cells were fixed in 1% paraformaldehyde (Sigma) for 30 min and then washed. C3 was detected using a peroxidase-conjugated polyclonal goat anti-human C3 Ab (Cappel, West Chester, PA) and developed with ABTS. VCAM-1 expression was measured using a mAb to human VCAM-1 (mAb 6G10) (24) as previously described (25). All ELISA data represent the mean ± SE. All data were analyzed by a two-way ANOVA with pairwise multiple comparisons using the Tukey test. Sigma Stat (Jandel Scientific, San Rafael, CA) was used for statistical analysis.

Confocal microscopy

Confocal microscopy for MBL deposition was performed as previously described (6, 25). Briefly, HUVECs were grown on LabTek tissue culture slides (Nunc, Naperville, IL) and exposed to either 0 or 24 h of hypoxia. The hypoxic medium was removed and GVB2+ containing 30% human serum treated with either PBS (vehicle), an inhibitory mAb specific for human MBL (3F8, 5 µg/ml), or Glupep (30, 10, or 3 µg/ml) was added at initiation of the 3-h reoxygenation period. Cells were washed and fixed in 4% paraformaldehyde for 15 min and blocked with 10% normal goat serum. Human MBL was identified using a biotinylated 1C10 mAb and streptavidin-conjugated Cy5 (blue; Jackson ImmunoResearch, West Grove, PA). The cells were washed, counterstained with propidium iodide (20 µg/ml), mounted, and analyzed as previously described (6, 25).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To determine whether the peptide SFGSGFGGGY (Glupep) is capable of inhibiting the binding of MBL to a natural ligand, GlcNAc, we performed competition experiments using a BIAcore 3000. As expected, purified recombinant human MBL bound to immobilized BSA-GlcNAc conjugate (Fig. 1Go, sensogram A). A functional inhibitory mAb to MBL (3F8, 5 and 50 µg/ml) inhibited this interaction (sensograms C and D, respectively), indicating that the binding of MBL to BSA-GlcNAc was specific. Preincubation of MBL with Glupep inhibited rMBL binding to BSA-GlcNAc in a concentration-dependent manner (Fig. 2Go). Glupep also inhibited native human MBL (purified from human serum) in a comparable manner (data not shown). Thus, our data suggest that a short amino acid sequence from cytokeratin 14 is capable of binding MBL and attenuating its interactions with a natural ligand.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 1. Surface plasmon resonance of rMBL binding to BSA-GlcNAc. rMBL (6.9 nmol/L) was incubated with vehicle (A), 50 µg/ml of an IgG isotype control (B), 5 or 50 µg/ml mAb 3F8 (C and D, respectively). Samples were injected for 90 s and allowed to dissociate for at least 4 min. Each sensogram was overlaid and zeroed on the y-axis to the average baseline before injection. The start injection time for each sample was set to zero on the x-axis.

 


View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. Inhibition of rMBL binding to GlcNAc by Glupep. Decreasing concentrations (100–0 µg/ml) of Glupep were incubated with rMBL (6.9 nmol/L) before injection over immobilized BSA-GlcNAc. Flow parameters and binding conditions are outlined in Materials and Methods. Each sensogram was overlaid as described in the legend to Fig. 1Go.

 
Small molecular mass analytes (<1 kDa) do not give sizable relative responses under direct binding conditions by BIAcore (23). Therefore, it would be difficult to calculate the kinetics of the interaction between rMBL and Glupep from direct binding analysis (see Discussion). Furthermore, it has been suggested that solid surface binding does not necessarily reflect the kinetic interactions that occur in solution (26). Therefore, we chose to use solution competition experiments to determine the affinity between rMBL and Glupep. Decreasing concentrations of rMBL were injected over BSA-GlcNAc and the initial slope of each response was used to generate a standard calibration curve (Fig. 3GoA). Glupep was incubated with a constant concentration of rMBL (6.9 nmol/L) and allowed to reach equilibrium. Glupep/rMBL samples were injected over BSA-GlcNAc (Fig. 2Go) and the amount of rMBL in solution that was not bound to Glupep (free MBL) was determined from the calibration curve. The amount of rMBL available to bind BSA-GlcNAc was plotted against Glupep concentrations (Fig. 3GoB) using BIAevaluation software and the KD for the rMBL-Glupep interaction was determined to be 5 x 10-5 mol/L as calculated from the equation presented earlier.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 3. Solution affinity analysis of Glupep. A, Decreasing concentrations of rMBL were injected over immobilized BSA-GlcNAc and the slope 20 s after injection was recorded. To generate a calibration curve, a nonlinear regression plot of the initial binding rate was plotted using a four-parameter fit. B, rMBL (6.9 nmol/L) was incubated with varying concentrations of Glupep and allowed to reach equilibrium (see Fig. 2Go). The amount of free rMBL in solution was determined from the calibration curve and plotted against Glupep concentrations. The KD was determined using the equation in the text (see Materials and Methods).

 
We have previously shown that the LCP is activated on hypoxic/reoxygenated endothelial cells (6). We tested the ability of Glupep to inhibit complement deposition on endothelial cells subjected to hypoxic stress. HUVECs were subjected to either 0 or 24 h of hypoxia (<1% O2), followed by 3 h of reoxygenation with 30% human serum. As expected, there was a significant increase in C3 deposition on cells subjected to hypoxia compared with the normoxic controls (Fig. 4Go). C3 deposition was significantly attenuated on hypoxic/reoxygenated cells by Glupep treatment in a concentration-dependent manner (Fig. 4Go).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 4. Inhibition of complement on oxidatively stressed endothelial cells. HUVECs were subjected to either 0 h (normoxia) or 24 h of <1% O2 (hypoxia) followed by 3 h of reoxygenation in 30% human serum with or without inhibitors. C3 deposition was evaluated by ELISA using an HRP-coupled anti-human C3 Ab. *, p < 0.01 vs vehicle (n = 3).

 
To determined whether the decrease in C3 deposition coincided with a decrease in MBL deposition, we performed confocal microscopy. As expected, hypoxia/reoxygenation (Fig. 5GoB) increased MBL deposition compared with normoxic controls (Fig. 5GoA). Treatment of human serum with Glupep (3, 10, and 30 µg/ml) significantly attenuated MBL deposition on endothelial following hypoxia/reoxygenation in a concentration-dependent manner (Fig. 5Go, D–F, respectively). These data suggest that Glupep binds MBL and is capable of inhibiting complement deposition on endothelial cells following oxidative stress.



View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 5. Confocal microscopy of MBL deposition on endothelial cells subjected to oxidative stress. HUVECs were exposed to normoxia (A) or hypoxia (B–F) for 24 h and reoxygenated in the presence of 30% human serum that was preincubated with vehicle (A and B), 3F8 at 5 µg/ml (C), Glupep at 3, 10, or 30 µg/ml (D–F, respectively).

 
VCAM-1 mediates leukocyte endothelial interactions and likely contributes to the overall inflammatory process following ischemia/reperfusion (27, 28, 29). It is known that C5b-9 results in the transcriptional activation and protein expression of VCAM-1 on endothelial cells (25, 30). To determine whether Glupep could functionally inhibit complement and the resulting endothelial cell activation, we tested its ability to attenuate VCAM-1 expression following reoxygenation of hypoxic endothelial cells. As we have previously observed (25), hypoxia followed by reoxygenation in the presence of human serum significantly increased VCAM-1 expression (Fig. 6Go). Pretreatment of human serum with inhibitors of MBL, 3F8 or Glupep, attenuated VCAM-1 expression. These data suggest that activation of the LCP on endothelial cells exposed to oxidative stress results in endothelial cell activation and, furthermore, that MBL-mediated cell activation can be inhibited by Glupep.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. VCAM-1 expression following hypoxia-reoxygenation of endothelial cells. HUVECs were subjected to either 0 h (normoxia) or 12 h of <1% O2 (hypoxia) followed by 3 h of reoxygenation in 30% human serum preincubated with Glupep or 3F8. *, p < 0.01 compared with normoxia (n = 3).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we have characterized a previously identified peptide mimic of GlcNAc, SFGSGFGGGY (Glupep), as a functional inhibitor of the LCP on oxidatively stressed endothelial cells. Competition experiments indicate that this peptide sequence can attenuate the binding of MBL to GlcNAc, a natural ligand of MBL. It is unclear whether this peptide binds directly to the CRD of MBL or, alternatively, changes the conformation of the molecule such that the CRD is nonfunctional. In light of previous data that demonstrated binding of this peptide to GlcNAc-specific Abs and GlcNAc-specific lectins, combine with data presented in this study, it seems unlikely that Glupep coincidentally binds to a region outside of the CRD. Thus, our data support the hypothesis that the peptide SFGSGFGGGY can mimic a carbohydrate ligand by binding to the CRD region of MBL. To our knowledge, this is the first report that demonstrates that a peptide is capable of specifically binding to MBL and, more importantly, that this peptide functionally inhibits the lectin complement pathway.

To measure the affinity of the Glupep-MBL interaction, we chose to use surface plasmon resonance (SPR) using a BIAcore 3000 optical biosensor. SPR provides an advantage over traditional methods by generating "real-time" kinetic data without the requirement for radiolabeling experiments (31). In principle, plasmon resonance measures the change in refractive index that occurs as a molecule (analyte) is associating (Ka) with and/or dissociating (Kd) from its partner (ligand) at the sensor surface. Since the change in refractive index is dependent on mass, compounds <1 kDa do not give measurable responses when analyzed directly by SPR (23). Therefore, we used a solution affinity technique to measure the affinity of the Glupep-MBL interaction. Solution affinity kinetics provide data that are comparable to and/or more accurate than other SPR techniques (23, 26). Using this method, we determined the KD of the Glupep-MBL interaction to be 5 x 10-5 mol/L. Our data indicate that MBL has a greater affinity for Glupep compared with monosaccharides (0.1–1 x 10-3 mol/L), but does not approach the affinity of MBL for multivalent ligands present on bacterial cell walls or polysaccharides (~10-9 mol/L) (10, 12). These data are consistent with the hypothesis that Glupep is recognized by MBL as a singe residue in the CRD.

The peptide SFGSGFGGGY is located in the head domain of cytokeratin 14 and was originally identified as an epitope that cross-reacted with anti-carbohydrate Abs (16, 32). The observation that GlcNAc mimics specific epitopes of cytoskeletal and extracellular matrix proteins and vice versa is physiologically relevant. For example, Cunningham and colleagues (33) observed that patients with rheumatic heart disease harbor streptococcal Abs that cross-react with cardiac valvular myosin and laminin. Furthermore, these cross-reactive anti-GlcNAc Abs are cytotoxic to human endothelial cells in the presence of complement (34). These data support the hypothesis that proinflammatory disease states may be mediated by cross-reactive Abs and/or complement activation. In this context the finding that MBL binds to a small peptide region of cytokeratin 14 has important implications. Since MBL possesses carbohydrate specificity, similar to anti-carbohydrate Abs, it is logical to speculate that MBL can cross-react with various proteins that mimic GlcNAc. Reports exist of complement activation on intermediate filaments, including a report that describes the activation of the "classical" pathway in the absence of Ab (35, 36). In view of data presented in this study, it is possible that MBL binds to intermediate filaments and/or extracellular matrix proteins and activates the LCP. Studies are ongoing in our laboratory to address this hypothesis.

The terminal complement complex C5b-9 is known to increase the expression of VCAM-1 on endothelial cells (30). We have shown that hypoxia/reoxygenation induces endothelial VCAM-1 expression in a C5-dependent manner (25). In that study, complement-mediated VCAM-1 up-regulation was dependent on a decrease of cellular cGMP (4) and/or NO levels. Furthermore, translocation of the transcription factor NF-{kappa}B, which has been implicated as a regulator of VCAM-1 mRNA expression, was attenuated by anti-C5 treatment or cGMP analogs (25, 37). Together, these data suggest that complement activation on endothelial cells initiates a series of intracellular mechanisms resulting in adhesion molecule transcription and expression. In this report, we confirm our previous observation that VCAM-1 expression is increased on oxidatively stressed endothelial cells. Interestingly, inhibition of the LCP with MBL inhibitors, including an MBL-specific mAb or Glupep, attenuates the increase in VCAM-1 expression. These data support the novel hypothesis that the LCP may potentiate a proinflammatory response during conditions of oxidative stress by up-regulation of endothelial adhesion molecules that are involved in the adhesion of leukocytes. Furthermore, these data suggest that the decapeptide SFGSGFGGGY may be capable of functionally inhibiting the intracellular mechanisms that lead to endothelial cell activation.

In summary, our data are consistent with reports demonstrating that the decapeptide SFGSGFGGGY is a mimic of GlcNAc (16). Furthermore, we extend this finding to show that this peptide can specifically bind to MBL with a physiologically relevant affinity. The finding that a peptide can functionally block MBL-ligand interactions creates the possibility of identifying additional inhibitory peptide mimics or small molecular mass inhibitors of the LCP. Furthermore, these data support the hypothesis that initiation of the LCP via MBL may be proinflammatory under conditions that do not necessarily involve binding of MBL to the surface of foreign pathogens.


    Acknowledgments
 
We thank Margaret M. Morrissey for assistance with HUVEC cultures.


    Footnotes
 
1 This work was supported in part by National Institutes of Health Grants HL-03854 (to C.D.C.) and HL-56086 (to G.L.S.), by the Foundation for Anesthesia Education and Research (to C.D.C.), and by an American Heart Association Established Investigator Award (to G.L.S.). M.C.M. is a recipient of a National Institutes of Health Individual National Service Research Award (F32 HL-103870). Back

2 M.C.M. and C.D.C contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Gregory L. Stahl, Department of Anesthesiology, Perioperative and Pain Medicine, Center for Experimental Therapeutics and Reperfusion Injury, Brigham and Women’s Hospital, Harvard Medical School, 75 Francis Street, Boston, MA 02115. Back

4 Abbreviations used in this paper: LCP, lectin complement pathway; MBL, mannose-binding lectin; CRD, carbohydrate recognition domain; GlcNAc, N-acetyl-D-glucosamine; Glupep, GlcNAc peptide; GVB, gelatin-Veronal buffer; hMBL, human MBL; rMBL, recombinant MBL; SPR, surface plasmon resonance. Back

Received for publication November 8, 2000. Accepted for publication January 5, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Soothill, J. F., B. A. Harvey. 1976. Defective opsonization: a common immunity deficiency. Arch. Dis. Child 51:91.[Abstract/Free Full Text]
  2. Turner, M. W.. 1998. Mannose-binding lectin (MBL) in health and disease. Immunobiology 199:327.[Medline]
  3. Matsushita, M., T. Fujita. 1992. Activation of the classical complement pathway by mannose-binding protein in association with a novel C1s-like serine protease. J. Exp. Med. 176:1497.[Abstract/Free Full Text]
  4. Thiel, S., T. Vorup-Jensen, C. M. Stover, W. Schwaeble, S. B. Laursen, K. Poulsen, A. C. Willis, P. Eggleton, S. Hansen, et al 1997. A second serine protease associated with mannan-binding lectin that activates complement. Nature 386:506.[Medline]
  5. Turner, M. W.. 1997. The lectin pathway of complement activation. Res. Immunol. 147:110.
  6. Collard, C. D., A. Vakeva, M. A. Morrissey, A. Agah, S. A. Rollins, W. R. Reenstra, J. A. Buras, S. Meri, G. L. Stahl. 2000. Complement activation after oxidative stress: role of the lectin complement pathway. Am. J. Pathol. 156:1549.[Abstract/Free Full Text]
  7. Endo, M., H. Ohi, I. Ohsawa, T. Fujita, M. Matsushita. 2000. Complement activation through the lectin pathway in patients with Henoch-Schonlein purpura nephritis. Am. J. Kidney Dis. 35:401.[Medline]
  8. Lhotta, K., R. Wurzner, P. Konig. 1999. Glomerular deposition of mannose-binding lectin in human glomerulonephritis. Nephrol. Dial. Transplant. 14:881.[Abstract/Free Full Text]
  9. Endo, M., H. Ohi, I. Ohsawa, T. Fujita, M. Matsushita. 1998. Glomerular deposition of mannose-binding lectin (MBL) indicates a novel mechanism of complement activation in IgA nephropathy. Nephrol. Dial. Transplant. 13:1984.[Abstract/Free Full Text]
  10. Kawasaki, N., T. Kawasaki, I. Yamashina. 1989. A serum lectin (mannan-binding protein) has complement-dependent bactericidal activity. J. Biochem. 106:483.[Abstract/Free Full Text]
  11. Kozutsumi, Y., T. Kawasaki, I. Yamashina. 1981. Kinetical properties of the serum mannan-binding protein from rabbit: a comparison with those of the liver mannan-binding protein. J. Biochem. 90:1799.[Abstract/Free Full Text]
  12. Lee, R. T., Y. Ichikawa, T. Kawasaki, K. Drickamer, Y. C. Lee. 1992. Multivalent ligand binding by serum mannose-binding protein. Arch. Biochem. Biophys. 299:129.[Medline]
  13. Kawasaki, N., T. Kawasaki, I. Yamashina. 1983. Isolation and characterization of a mannan-binding protein from human serum. J. Biochem. 94:937.[Abstract/Free Full Text]
  14. Lu, J. H., S. Thiel, H. Wiedemann, R. Timpl, K. B. Reid. 1990. Binding of the pentamer/hexamer forms of mannan-binding protein to zymosan activates the proenzyme C1r2C1s2 complex, of the classical pathway of complement, without involvement of C1q. J. Immunol. 144:2287.[Abstract]
  15. Setnikar, I., R. Palumbo, S. Canali, G. Zanolo. 1993. Pharmacokinetics of glucosamine in man. Arzneim.-Forsch. 43:1109.[Medline]
  16. Shikhman, A. R., N. S. Greenspan, M. W. Cunningham. 1994. Cytokeratin peptide SFGSGFGGGY mimics N-acetyl-{beta}-D- glucosamine in reaction with antibodies and lectins, and induces in vivo anti-carbohydrate antibody response. J. Immunol. 153:5593.[Abstract]
  17. Ravindranath, R. M., W. Y. Tam, P. Nguyen, A. G. Fincham. 2000. The enamel protein amelogenin binds to N-acetyl-D-glucosamine-mimicking peptide motif of cytokeratins. J. Biol. Chem. 275:39654.[Abstract/Free Full Text]
  18. Collard, C. D., A. Vakeva, C. Bukusoglu, G. Zund, C. J. Sperati, S. P. Colgan, G. L. Stahl. 1997. Reoxygenation of hypoxic human umbilical vein endothelial cells (HUVECs) activates the classic complement pathway. Circulation 96:326.[Abstract/Free Full Text]
  19. Tofukuji, M., G. L. Stahl, A. Agah, C. Metais, M. Simons, F. W. Sellke. 1998. Anti-C5a monoclonal antibody reduces cardioplegia-induced coronary endothelia dysfunction. J. Thorac. Cardiovasc. Surg. 116:1060.[Abstract/Free Full Text]
  20. Garred, P., S. Thiel, H. O. Madsen, L. P. Ryder, J. C. Jensenius, A. Svejgaard. 1992. Gene frequency and partial protein characterization of an allelic variant of mannan binding protein associated with low serum concentrations. Clin. Exp. Immunol. 90:517.[Medline]
  21. Evans, M. J., S. L. Hartman, D. W. Wolff, S. A. Rollins, S. P. Squinto. 1995. Rapid expression of an anti-human C5 chimeric Fab utilizing a vector that replicates in COS and 293 cells. J. Immunol. Methods 184:123.[Medline]
  22. Ohtani, K., Y. Suzuki, S. Eda, T. Kawai, T. Kase, H. Keshi, Y. Sakai, S. Yamamoto, T. Sakamoto, N. Wakamiya. 1999. High-level and effective production of human mannan-binding lectin (MBL) in Chinese hamster ovary (CHO) cells. J. Immunol. Methods 222:135.[Medline]
  23. Adamczyk, M., J. A. Moore, Z. Yu. 2000. Application of surface plasmon resonance toward studies of low-molecular-weight antigen-antibody binding interactions. Methods 20:319.[Medline]
  24. Masinovsky, B., D. Urdal, W. M. Gallatin. 1990. IL-4 acts synergistically with IL-1B to promote lymphocyte adhesion to microvascular endothelium by induction of vascular cell adhesion molecule-1. J. Immunol. 145:2886.[Abstract]
  25. Collard, C. D., A. Agah, W. R. Reenstra, J. Buras, G. L. Stahl. 1999. Endothelial nuclear factor-{kappa}B translocation and vascular cell adhesion molecule-1 induction by complement: inhibition with anti-human C5 therapy or cGMP analogues. Arterioscler. Thromb. Vasc. Biol. 19:2623.[Abstract/Free Full Text]
  26. Nieba, L., A. Krebber, A. Pluckthun. 1996. Competition BIAcore for measuring true affinities: large differences from values determined from binding kinetics. Anal. Biochem. 234:155.[Medline]
  27. Dragun, D., U. Hoff, J. K. Park, Y. Qun, W. Schneider, F. C. Luft, H. Haller. 2000. Ischemia-reperfusion injury in renal transplantation is independent of the immunologic background. Kidney Int. 58:2166.[Medline]
  28. Kokura, S., R. E. Wolf, T. Yoshikawa, H. Ichikawa, D. N. Granger, T. Y. Aw. 2000. Endothelial cells exposed to anoxia/reoxygenation are hyperadhesive to T-lymphocytes: kinetics and molecular mechanisms. Microcirculation. 7:13.[Medline]
  29. Ley, K.. 1996. Molecular mechanisms of leukocyte recruitment in the inflammatory process. Cardiovasc. Res. 32:733.[Medline]
  30. Tedesco, F., M. Pausa, E. Nardon, M. Introna, A. Mantovani, A. Dobrina. 1997. The cytolytically inactive terminal complement complex activates endothelial cells to express adhesion molecules and tissue factor procoagulant activity. J. Exp. Med. 185:1619.[Abstract/Free Full Text]
  31. Myszka, D. G.. 1997. Kinetic analysis of macromolecular interactions using surface plasmon resonance biosensors. Curr. Opin. Biotechnol. 8:50.[Medline]
  32. Shikhman, A. R., M. W. Cunningham. 1994. Immunological mimicry between N-acetyl-{beta}-D-glucosamine and cytokeratin peptides. Evidence for a microbially driven anti-keratin antibody response. J. Immunol. 152:4375.[Abstract]
  33. Adderson, E. E., A. R. Shikhman, K. E. Ward, M. W. Cunningham. 1998. Molecular analysis of polyreactive monoclonal antibodies from rheumatic carditis: human anti-N-acetylglucosamine/anti-myosin antibody V region genes. J. Immunol. 161:2020.[Abstract/Free Full Text]
  34. Galvin, J. E., M. E. Hemric, K. Ward, M. W. Cunningham. 2000. Cytotoxic mAb from rheumatic carditis recognizes heart valves and laminin. J. Clin. Invest. 106:217.[Medline]
  35. Linder, E., H. Helin, I. Rantala. 1986. Activation of complement by intermediate filaments of glomerular epithelial cells. Clin. Immunol. Immunopathol. 40:265.[Medline]
  36. Linder, E., V. P. Lehto, S. Stenman. 1979. Activation of complement by cytoskeletal intermediate filaments. Nature 278:176.[Medline]
  37. Marui, N., M. K. Offermann, R. Swerlick, C. Kunsch, C. A. Rosen, M. Ahmad, R. W. Alexander, R. M. Medford. 1993. Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant-sensitive mechanism in human vascular endothelial cells. J. Clin. Invest. 92:1866.



This article has been cited by other articles:


Home page
CirculationHome page
C. D. Collard, S. K. Shernan, A. A. Fox, T. Bernig, S. J. Chanock, W. K. Vaughn, K. Takahashi, A. B. Ezekowitz, P. Jarolim, and S. C. Body
The MBL2 'LYQA Secretor' Haplotype Is an Independent Predictor of Postoperative Myocardial Infarction in Whites Undergoing Coronary Artery Bypass Graft Surgery
Circulation, September 11, 2007; 116(11_suppl): I-106 - I-112.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
A. Barenholz, A.-H. Hovav, Y. Fishman, G. Rahav, J. M. Gershoni, and H. Bercovier
A peptide mimetic of the mycobacterial mannosylated lipoarabinomannan: characterization and potential applications
J. Med. Microbiol., May 1, 2007; 56(5): 579 - 586.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Roos, A. J. Nauta, D. Broers, M. C. Faber-Krol, L. A. Trouw, J. W. Drijfhout, and M. R. Daha
Specific Inhibition of the Classical Complement Pathway by C1q-Binding Peptides
J. Immunol., December 15, 2001; 167(12): 7052 - 7059.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. E. Jordan, M. C. Montalto, and G. L. Stahl
Inhibition of Mannose-Binding Lectin Reduces Postischemic Myocardial Reperfusion Injury
Circulation, September 18, 2001; 104(12): 1413 - 1418.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
C. D. Collard, M. C. Montalto, W. R. Reenstra, J. A. Buras, and G. L. Stahl
Endothelial Oxidative Stress Activates the Lectin Complement Pathway : Role of Cytokeratin 1
Am. J. Pathol., September 1, 2001; 159(3): 1045 - 1054.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Montalto, M. C.
Right arrow Articles by Stahl, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Montalto, M. C.
Right arrow Articles by Stahl, G. L.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS