The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koelle, D. M.
Right arrow Articles by Corey, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koelle, D. M.
Right arrow Articles by Corey, L.
The Journal of Immunology, 2001, 166: 4049-4058.
Copyright © 2001 by The American Association of Immunologists

CD8 CTL from Genital Herpes Simplex Lesions: Recognition of Viral Tegument and Immediate Early Proteins and Lysis of Infected Cutaneous Cells1

David M. Koelle2,*,{dagger},||, Hongbo B. Chen{dagger}, Marc A. Gavin{ddagger}, Anna Wald*,§, William W. Kwok|| and Lawrence Corey*,{dagger}

Departments of * Medicine, {dagger} Laboratory Medicine, {ddagger} Immunology, and § Epidemiology, University of Washington, Seattle, WA 98195; Fred Hutchinson Cancer Research Center, Clinical Division, Seattle, WA 98109; and || Virginia Mason Research Center, Seattle, WA 98101


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HSV-2 causes chronic infections. CD8 CTL may play several protective roles, and stimulation of a CD8 response is a rational element of vaccine design for this pathogen. The viral Ags recognized by CD8 T cells are largely unknown. It has been hypothesized that HSV inhibition of TAP may favor recognition of virion input proteins or viral immediate early proteins. We tested this prediction using HSV-specific CD8 CTL clones obtained from genital HSV-2 lesions. Drug and replication block experiments were consistent with specificity for the above-named classes of viral proteins. Fine specificity was determined by expression cloning using molecular libraries of viral DNA, and peptide epitopes recognized at nanomolar concentrations were identified. Three of four clones recognized the viral tegument proteins encoded by genes UL47 and UL49. These proteins are transferred into the cytoplasm on virus entry. Processing of the tegument Ag-derived epitopes was TAP dependent. The tegument-specific CTL were able to lyse HLA class I-appropriate fibroblasts after short times of infection. Lysis of keratinocytes required longer infection and pretreatment with IFN-{gamma}. Another clone recognized an immediate early protein, ICP0. Lymphocytes specific for these lesion-defined epitopes could be reactivated from the PBMC of additional subjects. These data are consistent with an influence of HSV immune evasion genes upon the selection of proteins recognized by CD8 CTL in lesions. Tegument proteins, identified for the first time as Ags recognized by HSV-specific CD8 CTL, are rational candidate vaccine compounds.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
As with other chronic viral infections, HSV coexists with a vigorous cellular and humoral immune response. HSV latency in sensory ganglion neurons, a cell type with very low HLA expression, is characterized by absent or extremely limited viral protein synthesis (1). T cell detection of infected neurons therefore faces considerable challenges, although some murine data are consistent with this possibility (2, 3, 4, 5). HSV reactivates from latency and travels down axons to mucocutaneous sites, where it replicates, and may be transmitted with or without causing lesions (6). HSV has several immune evasion mechanisms that are thought to assist with primary or recurrent infection (7, 8, 9), including genes that interfere with CD8 CTL responses. In turn, the immunocompetent host has counterevasive mechanisms that promote the temporal and spatial containment of lytic viral replication.

Clinical and experimental data indicate that HSV-2-specific CD8 CTL responses are a functionally important component of the acquired immune response to this prevalent infection. CD8 CTL localize to the site of recurrent HSV-2 genital lesions (10, 11), and the clearance of infectious virus from lesions correlates temporally with the infiltration of CD8 T cells and HSV-specific CTL (12). In HIV-HSV-2-coinfected subjects, the frequency of HSV-specific CD8 CTL in the PBMC correlated inversely with the severity of recurrent anogenital HSV-2 infection in a cross-sectional study (13). In mice, CD8 CTL are involved in clearance of infectious virus from the infected ganglia and prevention of reactivation from latency (5).

Two HSV-2 proteins interfere with CD8 T cell recognition. The infected cell protein No. 47 (ICP47),3 encoded by gene US12, is one of the five viral "immediate early" proteins that are synthesized within 1–2 h of infection. ICP47 of HSV-1 and HSV-2 directly inhibit human TAP; their relative inactivity against murine TAP (14) somewhat complicates the interpretation of murine pathogenesis studies. The virion host shutoff (vhs) protein, encoded by gene UL41, rapidly degrades host cell mRNA, contributing to decreased synthesis of new HLA class I. As a functional consequence of these activities, HSV-2-infected human fibroblasts and keratinocytes are poorly recognized by HSV- or allospecific CD8 CTL clones (10). Using knockout viruses, contributions of both genes can be discerned. They can be overcome, and CTL lysis restored, if fibroblasts are pretreated with IFN-{gamma} (15). IFN-{gamma} up-regulates proteasome, TAP, and HLA genes involved in class I Ag processing and presentation. In vivo, IFN-{gamma} levels are very high in recurrent HSV-2 lesions (16).

HSV encodes ~85 proteins (1). Little is known concerning the targets of HSV-specific CD8 CTL or how the CD8 repertoire is shaped by immune evasion genes. Clones recognizing type-common epitopes in HSV envelope glycoproteins B and D (15, 17) have been derived from PBMC using secondary in vitro restimulation. Other clones were active against targets infected in the presence of transcriptional inhibitors (17), consistent with recognition of viral protein(s) loaded into APC upon virion binding and entry. The molecular identity of these targets was not determined. Recently, Mikloska et al. (18) found a high prevalence of bulk CD8 CTL responses specific for immediate early proteins ICP27 and ICP4, using IFN-{gamma}-treated keratinocytes as stimulator and readout cells. The kinetics of HSV-induced down-regulation of HLA class I may predict that either viral proteins injected directly into the cytoplasm, as is the case for CMV protein pp65, or viral immediate early proteins, might "outpace" immune evasion. Alternatively, it is possible that TAP-independent Ag processing might sidestep TAP inhibition.

We used genetic approaches to test these predictions. T cell clones were recovered from recurrent genital HSV-2 lesions, without secondary in vitro restimulation with Ag. We have tried to minimize bias that might be introduced by such restimulation, as recently reported for CMV pp65 (19), and to study cells that have physiologically localized to the site of infection. Expression cloning was used to assign antigenic specificity. This paper describes the first identification of three HSV-2 proteins as targets of the local HSV-2-specific CD8 T cell response. We further investigate the ability of these CTL to recognize skin-derived cells, their TAP dependence, and their reactivation from the PBMC of HLA-appropriate persons.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines and viruses

EBV-transformed lymphocyte cell lines (EBV-LCL) were derived from PBMC and maintained in LCL medium (RPMI 1640, 25 mM HEPES, 2 mM L-glutamine, 1% penicillin-streptomycin, 2 x 10-5 M 2-ME, 1 mM pyruvate) as described (10). Autologous EBV-LCL 1874, 5101, and 5491 and EBV-LCL 5085 were initiated in house, and HLA B*45-bearing EBV-LCL HM0983-022A-3216 was provided by Dr. L. Musey. TAP-deficient cell lines 721.174 (20), T2 (21), and T2/B7.63 (T2 transfected with HLA B*0702) were maintained in LCL medium. Cell line T2/B7.63, made by Dr. Peter Cresswell and provided by Dr. Charles Lutz, was maintained in 600 µg/ml G418. Primate kidney epithelial COS-7 cells (22) were grown in MEM with 10% FCS, 2 mM L-glutamine, and 1% penicillin-streptomycin. Fibroblasts were grown from skin biopsies as described (10). Single donor neonatal foreskin keratinocytes (Cascade Biologics, Portland, OR) were HLA typed, and HLA A*0201 cells were expanded per the manufacturer’s recommendations with Epilife medium containing growth supplement (HKGS), penicillin-streptomycin-amphotericin, trypsin, and trypsin inhibitor supplied by the Cascade Biologics.

Donors for lesion and PBMC studies had their HSV-1 and HSV-2 serostatus determined by type-specific serology (23). All subjects gave informed consent. Lesion HSV-specific T cells were obtained from three subjects from HSV-2 culture-positive recurrent lesions as previously described (11, 12). Lesions were 4 to 5 days old at the time of specimen collection. For subjects 1874 and 5491, lesion lymphocytes were expanded in bulk with PHA and IL-2 in the presence of acyclovir (11, 12) and CD8+ cells were positively selected with CD8 immunomagnetic beads (Minimacs; Miltenyi Biotec, Auburn, CA) and cloned (11). Two input numbers (3 and 1 cell/well) were used, and clones selected for workup were from plates with <37% of wells positive for growth. For subject 5101, tissue was digested with collagenase IV-S (C1889; Sigma, St. Louis, MO) in PBS, and the resultant cell suspension was immediately cloned (24) in serial 10-fold dilutions. Clones selected for study were from plates with <37% of wells positive for growth. To expand clones after positive screening assays, 5 x 104 cells were mixed in 25 ml T cell medium (TCM) (11) with 2.5 x 107 irradiated (3300 rad) allogeneic PBMC, 5 x 106 irradiated allogeneic (8000 rad) EBV-LCL, and 30 ng/ml anti-CD3 mAb OKT3 (Ortho, Raritan, NJ) (25). At 24 h and approximately every 3 days, human recombinant IL-2 (50 U/ml; Chiron, Emeryville, CA) was added with fresh medium, and cells were split as needed. The nomenclature for clones lists subject number, year of specimen, and clone number.

CTL were restimulated from PBMC by incubating 4 x 106 PBMC (Ficoll-Hypaque density gradient centrifugation) with 100 µM peptide (synthesized by F-moc chemistry) in ~100 µl TCM for 1 h (1% DMSO was present). Cells were diluted to 106/ml and cultured in 1.88-cm2 wells in the presence of 20 ng/ml recombinant human (rh) IL-7 (R&D systems). rhIL-2 (Chiron) was included at 20 U/ml starting on day 3. Cultures were fed with 0.5 volume medium containing the same cytokines every 2–3 days without further addition of peptide and assayed on days 12–14. For ICP0 responses, a modified protocol was used. PBMC (4 x 106) were stimulated with 1 µM peptide in 1.88-cm2 wells with rhIL-2 (10 U/ml) added on day 3. Cells were restimulated on day 7 with 2 x 106 autologous PBMC, 1 µM peptide, and IL-2 and fed with 0.5 volume medium containing IL-2 every 2–3 days until assay on days 14–16. For some bulk PBMC-derived cultures, CD8 cells were positively selected, cloned at 1 cell/well, and expanded as described above.

HSV-1 strain E115 (26) and HSV-2 strains 333 (27) and HG52 (28) were raised and titered in Vero cells (29). The ICP4 deletion mutant of HSV-2, hr259, was grown on complementing E4 cells (30). Recombinant vaccinia expressing ICP0 of HSV-2 (31) (kindly provided by Dr. B. Rouse) and wild-type vaccinia NY were raised and titered in BSC-40 cells.

Expression cloning

The strategy of Boon et al. (32) was adapted to genomic HSV-2 DNA. Cytoplasmic and supernatant virus purified from HSV-2 strain HG52-infected Vero cells (33) were combined. DNA was digested with Sau3AI, reextracted, and partially filled in with DNA polymerase Klenow fragment (3'-5-exo-) (New England Biolabs, Beverly, MA), dTTP, and dCTP. Plasmids pcDNA3.1(+)/His A, B, and C (Invitrogen, Carlsbad, CA) were digested with XhoI and partially filled with Klenow fragment, dATP, and dGTP. After ligation of repurified (organic extraction, ethanol precipitation) insert mixture (~100 ng) and individual vectors (~1 µg), DNA was precipitated, washed, and electroporated into Escherichia coli strain DH10B (Life Technologies, Gaithersburg, MD). Each library contained several thousand primary transformants. The majority of each library was immediately amplified in bulk. Among 20 random clones, all contained single HSV-2 Sau3AI fragments. Sequencing (Taq Dye-Deoxy FS; Perkin-Elmer ABI, Foster City, CA) was performed per the manufacturer’s instructions.

To make library DNA for transfection, 96-well plates (140504; Beckman, Fullerton, CA) were inoculated either with libraries at ~15 colonies/well or with selected individual clones. After overnight incubation at 37°C at 300 rpm agitation, DNA was prepared with 96-well filters (Millipore, Bedford, MA) per the manufacturer. Some bacteria in each well were saved. Average yield was 10 µg of DNA per well. IFN-{gamma} secretion as the primary readout of T cell activation.

COS-7 cells seeded at 9000 cells/well in 96-well flat-bottom plates were transfected the next day (day 2) with 50 ng HLA heavy chain cDNA and Fugene-6 (Boerhinger Mannheim-Roche, Indianapolis, IN), using the manufacturer’s protocol. On day 3, cells were infected with HSV-2 strain 333 at an estimated MOI of 10. On day 4, 0.7–1.0 x 105 cloned CD8 T cells in 150 µl FCS-based medium were added. Supernatants were saved on day five for IFN-{gamma} ELISA (below).

To screen libraries, COS-7 were cotransfected with 50 ng HLA cDNA and 100 ng library DNA (pool or single colony). Two days later, 1 x 105 cloned T cells/well (with rhIL-2 at 5 U/ml for some assays) were added, and supernatants were saved as above. DNA was prepared as above from 96 individual colonies derived from positive pools, and the process was repeated to identify individual active plasmids which were then sequenced to identify antigenic regions of HSV-2.

To make HLA B*4501 cDNA, total RNA (5 µg) from subject 1 (HLA A1, A*0201, B7, B*4501) EBV-LCL, purified using guanidinium-acid phenol (34), was incubated in 15 µl water with 0.5 µg oligo(dT)12–18 (Pharmacia, Piscataway, NJ) at 70°C for 10 min and chilled. The reaction mixture (25 µl) containing 1 µl Moloney murine leukemia virus reverse transcriptase, 2.5 mM MgCl2, 5 mM DTT, 2.5 µl 10x PCR buffer II (500 mM KCl, 100 mM Tris, pH 9.0), and 500 µM each dNTP was incubated at 42°C for 1 h and boiled for 5 min. For PCR, a 50-µl reaction containing 1x pfu buffer and 1 U pfu DNA polymerase (Invitrogen), 5 µl 2.5 mM each dNTP, 1 µl cDNA, and 50 pmol each primer (AAGGTACCATGCGGGTCACGGCACCCCGAA and GGTCTAGAAGTTCGACACTCTCTGTGTAGT; KpnI and XbaI sites underlined) was heated to 94°C for 2 min; cycled four times at 96°C for 30 s, 50°C for 30 s, and 72°C for 3 min; cycled 30x with 60°C annealing; and extended for 10 min at 72°C. Amplimer purified by organic extraction/alcohol precipitation was digested with appropriate enzymes and ligated into pcDNA3.0 (Invitrogen). The sequence was identical with GenBank 61710. HLA A*0201 and B*0702 cDNAs previously similarly cloned by RT-PCR, and shown by sequencing to be identical with wild-type sequences, were obtained from Dr. Stanley Riddell.

To study the cDNA species derived from the positive genomic clone containing portions of ICP0 (Results), COS-7 cells (100 mm2) were transfected with the ICP0 genomic clone, and total RNA was prepared after 48 h. The primer used for cDNA synthesis (TGCTCTAGAGACTCGATCCCTGCGCGTCGG; XbaI site underlined) was from the 3'-end of the HSV-2 DNA in the ICP0 genomic clone. Moloney murine leukemia virus reverse transcriptase (Life Technologies) was used per the manufacturer. To examine splicing, PCR used pfu cDNA polymerase, the above 3'-primer, and 5'-primer TAAGGTACCTGAACCCCGGCCCGGCACGAGC (KpnI site). To isolate exon 1 (28) of ICP0, PCR used the same 5'-primer and 3'-primer TGCTCTAGACCAGGCGTGCGGGGCGGCGGG (XbaI site). Reaction conditions were individually optimized. Product was digested with Acc65I and XbaI, gel purified, and ligated into similarly treated pCDNA 3.1-His-B, and in-frame insertion was confirmed by sequencing.

Full-length UL47 of HSV-2 was cloned by PCR into pCDNA3.1/His-C using 5'-primer CTAGGATCCCCTCCGGCCACCATGTCC and 3'-primer CGATCTAGACCTATGGGCGTGGCGGGC (BamHI and XbaI sites underlined). Full-length UL46 of HSV-2 was cloned by PCR into pcDNA3.1/His-C with 5'-primer CGAGGATCCGTCTCCGCCATGCAACGCCG and 3'-primer CGCTCTAGATTTTAATGGCTCTGGTGTCG (BamHI and XbaI sites underlined). Similarly, a construct expressing aa 1–590 of UL47 was made by PCR, using the above 5'-primer, an appropriate 3'-primer, and pCDNA3.1/His-C. Expression of aa 1–535 and 536–696 of UL47 was driven by constructs derived from full-length UL47 using a naturally occurring NotI site at aa 535. In-frame vector-HSV-2 fusion at the 5'-end of the HSV-2 DNA was confirmed by sequencing in each case.

We investigated some CD8 CTL clones in the COS-7 system using a panel of cloned HSV-2 genes. Cells were cotransfected with HLA class I heavy chain cDNA (50 ng/well) and HSV-2 constructs (25 ng/well) and assayed for stimulation of IFN-{gamma}. Our gene panel included UL46 and UL47 (above) and full-length HSV-2 UL19, UL21, UL50, and US8, each cloned into the pcDNA3.1/His series, and UL49 cloned into pEGFP-C1 (Clontech, Palo Alto, CA) as described and validated (35, 36).

Cytotoxicity assays

Cytotoxicity assays were performed as previously described (10) using 4-h 51Cr release. Target EBV-LCL were typically infected for 18 h with HSV or vaccinia strains at multiplicity of infection (MOI) 10, and the usual E:T was 20:1, or loaded with peptide for 90 min at 37°C in 200-µl volumes. In some assays, purified mAb W6/32 (37) was included at 10 µg/ml. To inhibit viral RNA expression, EBV-LCL were preincubated with actinomycin D (Sigma) at 5 µg/ml for 30 min before infection. Actinomycin D was maintained throughout the 90-min infection, wash, and assay periods. For fibroblast targets, cells were plated in 9.6-cm2 plates and infected at 70–90% confluence, usually the next day, with the exception of IFN-{gamma} experiments, in which some wells were treated with 500 U/ml IFN-{gamma} (Endogen, Woburn, MA) and all wells were held for 72 h until infection. The IFN-{gamma} wells were maintained with IFN-{gamma} throughout the infection. For keratinocyte targets, cells were plated in 9.6-cm2 plates at 2.5 x 103 cells/cm2, and IFN-{gamma} treatment was begun 4 days later when cells reached 60% confluence. Adherent cells were chromated overnight, and were peptide loaded (1 µM) for 90 min, before trypsinization and washing. All targets were used in CTL assays at 2 x 103/well, and 2.5% Ipegal (Sigma, St. Louis, MO) was used to measure total release. Assays were performed in triplicate and spontaneous release was usually <25%.

HLA-peptide tetramers

A tetrameric reagent containing HLA A*0201 heavy chains, {beta}2-microglobulin, and peptide UL47 551–559 was synthesized by the Tetramer Facility of the National Institutes of Allergy and Infectious Diseases (Bethesda, MD). Tetramers were biotinylated and labeled with streptavidin-PE.

Flow cytometry

Lymphocytes were washed and incubated with anti-CD4-FITC/anti-CD8-PE (Sigma), anti-CD3-FITC/anti-CD16PE and CD56-PE, or anti-TCR {alpha}{beta}-FITC or anti-TCR {gamma}{delta}-PE (Becton Dickinson, San Jose, CA), or a mixture of control FITC- and PE-labeled mAb (Sigma) on ice for 30 min. For tetramer staining, cells were centrifuged, resuspended in 100 µl TCM, and incubated with 1 µl tetramer for 1 h at room temperature. After this, 1 µg CD8-FITC (Caltag) was added, and cells were incubated for 30 min on ice. To measure HLA transfection, trypsinized COS-7 cells were stained with 1 µg FITC-labeled mAb B12 reactive with HLA B*4501 (One Lambda, Canoga Park, CA) or PE-labeled mAb 1288 reactive with HLA B*0702 (Chemicon, Temecula, CA), or supernatant of MA2.1 cells (38) reactive with HLA A*0201, followed by FITC-labeled goat anti-mouse IgG (Sigma). Washed cells fixed with 1% paraformaldehyde in PBS were analyzed with a FACScan cytometer (Becton Dickinson) and WinMDI version 2.8 shareware (http://facs.scripps.edu). Cells in the appropriate gates on forward vs side scatter were analyzed. To measure the infection of wild-type and mutant LCL with HSV-2, uninfected or infected (18 h, MOI 10) cells were stained with mAb 18{beta}B3 specific for envelope glycoprotein D or control mouse IgG1, followed by FITC-conjugated goat anti-mouse IgG (Sigma) as previously described (10).

HLA typing

Subjects were typed serologically and by DNA methods at the Puget Sound Blood Center (Seattle, WA).

ELISA

IFN-{gamma} was measured with reagents from Endogen. Costar No. 3369 plates (Corning, NY) were coated with 100 µl 0.25 µg/ml capture mAb (M700A-E) diluted in 0.1 M sodium carbonate (pH 9.4) overnight at 4°C, and blocked with 1% BSA in 0.2 M NaCl, 3 mM KCl, 0.05 M Tris, pH 9 (TBS) for 1 h. Subsequent incubations were each 100 µl, preceded by three to five washes with PBS/0.2% Tween 20, and performed with rotation at room temperature. Samples and standards diluted in TBS with 0.1% BSA, 0.05% Tween 20, and 4 µg/ml Ig-Inhibiting Reagent No. 6LD1068 (Bioreclamation, East Meadow, NY; sample buffer) were added for 2 h. Biotinylated detection mAb (M701B) diluted to 100 ng/ml in sample buffer was added for 1 h. Avidin D:HRP (A-2004) diluted to 100 ng/ml in TBS with 1% BSA, 0.05% Tween 20 was added for 1 h. TMB substrate was added for 10 min, reactions were stopped with 1 M phosphoric acid, and results were read on a plate reader at 450 and 650 nm. The lower limit of detection was 10 pg/ml.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of HSV-2 type-specific CD8 CTL from genital HSV-2 lesions and assignment of HLA-restricting alleles

CD8 CTL clones specific for HSV-2 were obtained from herpetic lesions, without secondary in vitro restimulation with Ag, as previously described (12). Clones with HSV-specific cytotoxic activity in screening assays, and CD8 but not CD4 expression, were expanded for further study. For subjects 1874 and 5491, multiple T cell clones with the same apparent pattern of HSV-2 type specificity and HLA restriction were derived. Representative clones, based on HLA restriction analysis and HSV-2 type specificity (39), were chosen for detailed study (Table IGo). Clone 5101.1999.23 was obtained by collagenase digestion of a lesion biopsy and was the single CD8 CTL clone obtained in screening 60 clones. Each clone was CD3+, CD8+, TCR {alpha}{beta}+, CD4-, and CD16/56- and recognized an HSV-2 type-specific epitope. For each clone, most HLA-A- and B-mismatched target cells were not lysed, regardless of viral infection. HLA-restricting alleles were preliminarily assigned as HLA A*0201, B*0702, or B*4501 by HLA typing the source subjects and using partially matched EBV-LCL as APC (Table IGo). A transfection/infection assay (Fig. 1Go) confirmed the CTL results (Table IGo) and also established the suitability of HLA-transfected COS-7 for expression cloning.


View this table:
[in this window]
[in a new window]
 
Table I. CTL activity and HLA restriction of CD8 clones, and initial results of expression cloning1

 


View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 1. Secretion of IFN-{gamma} by lesion-derived CD8+ T cell clones in response to COS-7 cells transfected with HLA class I heavy chain cDNA and infection with HSV-2 strain 333. Values are mean of duplicate IFN-{gamma} secretion into the medium as measured by ELISA.

 
Requirement for viral protein expression for lysis of HSV-2-infected target cells

To evaluate whether the T cell clones recognized virion input proteins, we checked their cytolytic activity against EBV-LCL infected in the presence of actinomycin D. Clones 1874.1991.22, 5101.1999.23, and 5491.2000.48 lysed these target cells (Table IGo). Lysis by clone 1874.1997.51 was significantly inhibited by blockade of transcription. Each of the clones was able to lyse target cells infected with the mutant virus hr259, which lacks the ICP4 trans activator protein, and is only able to newly express the other immediate early proteins, ICP0, ICP27, ICP22, ICP47, and the small unit of ribonucleotide reductase (30).

Recognition of tegument HSV-2 Ags by CD8 T cells

For expression cloning, HSV-2 genomic DNA fragments were cotransfected together with HLA class I cDNA into COS-7 cells, and IFN-{gamma} secretion again used as the readout for T cell activation. The genomic HSV-2 Sau3aI libraries, in each reading frame, were screened to oversample the HSV-2 genome ~6-fold. Each of the first three CD8 T cell clones studied responded to cells transfected with plasmid DNA prepared from individual bacterial colonies, which were sequenced to preliminarily identify T cell Ags (Table IGo).

CD8 clone 5101.1999.23 recognized COS-7 cells cotransfected with HLA A*0201 and a HSV-2 Sau3aI fragment from bp 102,943–102,876 (28) (Table IGo). The predicted fusion protein contains HSV-2 UL47 aa 278–298. Reactivity with UL47 was confirmed by cotransfection of A*0201 and full-length HSV-2 UL47 (Table IIGo).


View this table:
[in this window]
[in a new window]
 
Table II. Confirmation and localization of epitopes recognized by CD8+ clones1

 
The CD8 T cell clone 1874.1991.22 recognized COS-7 cells cotransfected with HLA A*0201 and a HSV-2 Sau3aI fragment from bp 102,875–101,383 (Table IGo). This fragment was predicted to contain the DNA encoding UL47 aa 300–696, intervening DNA, and then aa 1–71 of UL46. Analysis of the 5'-vector-insert junction in C:2:C10:B9 revealed out-of-frame translation of the initial UL47 DNA. The insert is expected to contain the UL46 promoter (40). The epitope, therefore, could be encoded by UL46. C:2:C10:B9 also contains potential sites of internal initiation of translation within UL47. We assayed UL46 and UL47 separately in the COS-7 cotransfection assay (Table IIGo). UL47 was active, whereas UL46 was not. Truncation analysis localized the epitope to aa 535–590 (Table IIGo).

The specificity of CD8 clone 5491.2000.48 was determined with a panel of partial- and full-length HSV-2 genes. The HSV-2 genes studied were previously shown to be recognized by CD4 T cell clones (35, 36, 41). Only HSV-2 UL49, when cotransfected with HLA B*0702, stimulated IFN-{gamma} release by clone 5491.2000.48 (Fig. 2Go).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 2. Secretion of IFN-{gamma} by lesion-derived CD8+ T cell clone 5491.2000.48 in response to COS-7 cells cotransfected with HLA B*0702 cDNA and the indicated HSV-2 DNA fragments. All HSV-2 genes are full length except for UL47, which is was tested in two segments encoding the indicated amino acids. Values are mean of duplicate IFN-{gamma} secretion into the medium as measured by ELISA.

 
HSV-2 gene UL47 encodes protein VP13/14, whereas UL49 encodes VP22 (1); both tegument proteins are loaded into the cytoplasm on virion binding and entry (42). The small genomic HSV-2 fragment of UL47 recognized by clone 5101.1999.23 was scanned for peptides fitting the A*0201 binding motif (http://134.2.96.221/ and http://bimas.dcrt.nih.gov/molbio/hla_bind/). Peptide UL47 (HSV-2) 289–298 had a 50% effective concentration (EC50) in the 1–10 nM range in cytolysis assays (Fig. 3Go). UL47 535–590 (Table IIGo) was similarly analyzed. Peptide 551–559 was active at 1 nM (Fig. 3Go). Potential HLA B*0702-binding peptides in UL49 of HSV-2 were synthesized, and two (aa 47–55 and 14–22) were active at 1 µM (data not shown). Titration (Fig. 3Go) showed that UL49 49–55 was highly active, with an EC50 of <10 nM, whereas UL49 14–22 had activity only at 1 µM (not shown). The antigenic peptides in UL47 and UL49 contain significant amino acid sequence differences from the corresponding predicted HSV-1 peptides (28, 43), explaining type-specific recognition of HSV-2 (Table IGo).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 3. Lysis by lesion-derived CD8 clones of autologous LCL loaded with HSV-2 peptides at the indicated concentrations. Data are percent specific 51Cr release at E:T 20:1. •, Lysis by clone 5101.1999.23 of targets loaded with UL47 551–559; {circ}, clone 1874.1991.22 and UL47 289–298; {blacktriangledown}, clone 1874.1997.51 and ICP0 92–101; {triangledown}, clone 5491.2000.48 and UL49 49–57. Lysis of mock-loaded targets was <5% specific release for each clone.

 
Recognition of immediate early HSV-2 protein ICP0 by CD8 T cells

For clone 1874.1997.51, positive reactions to plasmid pools were present in each library. The active plasmids in each library contained a genomic Sau3AI fragment from nucleotides 1858–3022 (28). Nucleotide 2007 listed as T in the published sequence was read as C. In addition to 445 bp of 5'-untranslated sequence, all of predicted exon 1, intron 1, and the first 234 bp of predicted exon 2 of ICP0 were present, preliminarily identifying the Ag as ICP0. Because alternative splicing of HSV-1 ICP0 has been documented at both the RNA and protein levels (44, 45), we first identified the Ag-encoding mRNA species in COS-7 cells to determine how the ICP0 genomic clone was spliced in our system. COS-7 cells were transfected with genomic clone C:1:H3:B8 (Table IGo), and cDNA was synthesized from total cellular RNA followed by PCR designed to amplify the spliced transcript. The size of the PCR product (~300 bp) was consistent with the splicing out of intron 1. Sequencing showed a slight difference from the reported (28) splice point for mature HSV-2 ICP0 mRNA. Three base pairs encoding aa Q26 (28) were missing. We have retained Q26 for peptide numbering (below). To determine whether the antigenic peptide lay within exon 1 or exon 2, PCR was repeated with specific primers. The exon 1-partial exon 2 cDNA, but not exon 1 cDNA, was stimulatory for T cell clone 1874.1997.51 (Table IIGo), localizing the epitope to aa 26–105 in exon 2. Reactivity was confirmed in CTL assays using a recombinant vaccinia virus expressing ICP0. At E:T 20:1, lysis of vaccinia ICP0 (31)-infected target cells was 52.1% compared with 2.3% for vaccinia wild type. Having determined the RNA splicing pattern, we proceeded to find the peptide epitope.

Two reported HLA B45-restricted epitopes (46, 47, 48), AEEAAGIGIL and GAETFYVDGA, share with the B44 supertype (49) a preference for negatively charged and hydrophobic amino acid side chains at the P2 and P9 anchor positions. ICP0 (HSV-2) 92–105, containing this motif, was active at 1 µM (not shown). Truncation yielded ICP0 (HSV-2) 92–101, with an EC50 in the 1 nM range (Fig. 3Go).

Recognition of skin-derived fibroblasts and keratinocytes by CD8 CTL clones

Within lesions, HSV-2 is mainly present in keratinocytes (16). We investigated how MOI (amount of virus), time of infection, and pretreatment with IFN-{gamma} influenced lysis of dermal fibroblasts and keratinocytes. For fibroblasts (Fig. 4Go), in the absence of IFN-{gamma} pretreatment, infection for 2 h led to detectable lysis, which increased with increasing MOI. Lysis was undetectable (<5% specific release at E:T of 20:1) after overnight infection with MOI 1, 5, or 25. With IFN-{gamma} pretreatment, lysis was generally increased, but 2-h infection was still superior. HLA-mismatched target cells were not lysed, even after peptide loading (data not shown).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 4. Cytolytic activity of CD8 CTL clones against cutaneous cells. Top, UL49-specific clone 5491.2000.48, HLA B*0702-expressing fibroblasts from subject SJ, and peptide UL49 aa 49–47. Middle, UL47-specific clone 1874.1991.22, HLA A*0201-bearing fibroblasts from subject 1874, and peptide UL47 aa 551–559. Left, Lysis of non-IFN-{gamma}-treated fibroblasts infected at the indicated MOI for 2 h before assay; right, fibroblasts pretreated for 3 days with 500 U/ml IFN-{gamma} and then infected or treated with peptide. In each case, HLA-mismatched target fibroblasts had <5% specific release at E:T 2:1, 6:1, and 20:1. Bottom, HLA A*0201-bearing keratinocytes are used as target cells. Left, UL47-specific clone 5101.1999.23 and peptide UL47 aa 289–298; right. UL47-specific clone 1874.1991.22 and peptide UL47 aa 551–559. HLA A*0201-bearing keratinocytes were mock treated or treated with 500 U/ml IFN-{gamma} and then infected for 2 or 18 h with HSV-2 at MOI 25 or loaded with peptide for 90 min.

 
Keratinocytes showed some similarities and differences from fibroblast as target cells (Fig. 4Go). IFN-{gamma} pretreatment generally increased recognition, without leading to lysis of control cells. In contrast to fibroblasts, 18-h infection was generally required. Weak cytolysis of cells infected for 2 h was noted only for IFN-{gamma}-pretreated targets. Chromium release again correlated directly with the amount of infectious virus added, because no specific lysis was noted at MOI 1 or 5 (data not shown).

PBMC responses to HSV-2 T cell epitopes

The A*0201-restricted responses to UL47 were studied in six HLA A*0201-bearing, HSV-2 infected persons (Fig. 5Go). No response was seen in a HSV-uninfected control subject. One HSV-2-infected subject, 9383, who has infrequently recurring genital HSV-2, had strong cytolytic responses, with effector populations killing both HSV-2-infected A*0201-bearing EBV-LCL and peptide-loaded targets. Subject 1874, from whom the 551–559-specific clone was derived, also had low but detectable PBMC CTL responses to peptide 551–559. In contrast, subject 5101, from whom the 289–298-specific clone was derived, did not have a detectable PBMC CTL response after peptide restimulation. Confirmation of CTL activity was obtained by deriving CD8 clones from peptide-stimulated PBMC from donor 9383. For both UL47 289–298 and 551–559, clones were obtained which lysed HLA A*0201-bearing EBV-LCL loaded with the stimulating peptide or infected with HSV-2 (data not shown).



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 5. CTL activity and tetramer binding by cultured PBMC of A*0201-bearing persons restimulated for 12–14 days with UL47 peptides. Top, Data are percent specific 51Cr release at E: T 20:1. Donor 1659 is HSV-1 and HSV-2 seronegative; the other donors are HSV-2 seropositive. Cells were stimulated with the indicated peptide as discussed in Materials and Methods. Target cells were EBV-LCL either with or without HLA A*0201 and were incubated with 1 µM peptide for 90 min or infected for 18 h with HSV-2 at MOI 10. Bottom, Detection of tetramer-binding cells among PBMC restimulated with HSV-2 UL47 peptide 551–559. The percentages listed are the proportion of CD8-staining cells that also stain with tetramer, using the thresholds shown. A, CD8 clone 1874.1991.22, specific for UL47 551–559, stained with anti-CD8-FITC only. All other panels are double stained with anti-CD8-FITC and a PE-labeled tetrameric complex of HLA A*0201 and peptide 551–559 (tetramer A2/551); B, clone 1874.1999.22 which is specific for peptide UL47 551–559 in the context of A*0201 (see text); C, negative control clone 5491.2000.48; D–J, bulk PBMC cultures restimulated with peptide UL47 551–559 as discussed in Materials and Methods. D, Subject 1659, HSV-uninfected; E–J, the six HSV-2-infected A*0201 subjects in the same order as in the top: 7282, 1874, 9107, 10081, 9383, and 5101, respectively. FL, Fluorescence.

 
A tetrameric form of HLA A*0201, loaded with UL47 peptide 551–559 and labeled with PE, was used to study these effector populations (Fig. 5Go). The tetramer bound specifically to the index T cell clone 1874.1991.22. Flow cytometric assays showed the highest level of CD8+ and tetramer+ cells for subject 9383. The index subject, 1874, also had tetramer+ CD8 cells detected. However, other subjects who did not have detectable CTL, such as 7282 and 5101, appeared to have enriched numbers of tetramer-binding cells compared with the HSV-seronegative control subject.

Three HSV-2-infected, HLA-compatible (B*4501) persons were available for study of the epitope in ICP0. Two subjects had strong CTL responses (Table IIIGo). Lysis of infected targets was inhibited by anti-class I mAb, and not observed if the target cells did not express B*4501.


View this table:
[in this window]
[in a new window]
 
Table III. Recognition of HSV-2 ICP0 by peptide-stimulated PBMC from HSV-2-infected, HLA-appropriate persons1

 
TAP dependence of Ag processing for recognition by HSV-2 tegument protein epitopes by CD8 CTL

For each of the three CD8 clones studied, lysis of TAP-deficient cells after HSV-2 infection was greatly reduced in comparison to wild-type EBV-LCL (Table IVGo). Greater than 90% of each of the TAP-deficient cell lines, as well as control wild-type LCL, were permissive for viral infection and protein synthesis as evaluated by flow cytometry using mAb specific for envelope glycoprotein gD. Peptide loading was able to sensitize the TAP-deficient cells, confirming HLA class I expression.


View this table:
[in this window]
[in a new window]
 
Table IV. TAP dependence of processing of HSV-2 tegument for presentation to CD8 T cells1

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HSV-2 causes considerable morbidity and mortality, especially in neonates (50). Because of the chronic nature of the infection, the limitations of antiviral therapy, and the frequency with which transmission is caused by asymptomatic shedding of the virus, vaccination is likely to be required to reduce new HSV-2 infections (51). To date, most vaccines have been ineffective in phase III clinical trials (52). The recent report that vaccination with a specific adjuvant and an envelope glycoprotein induced partial protection in HSV-1/HSV-2-seronegative women (53) highlights both the potential efficacy of vaccination and the need for improved formulations and markers of effective immunity.

The possible functional importance of HSV-specific CD8 CTL in humans has been addressed in several recent studies (4, 12, 13, 16, 54). Murine studies also illustrate protective roles for CD8 CTL (55, 56, 57). Because the HSV-2-encoded protein ICP47 is a relatively inefficient inhibitor of murine TAP (14), we chose the human system for our Ag discovery work.

Earlier work has shown that the majority of human PBMC- and lesion-derived HSV-2-reactive CD8 CTL clones are type specific for HSV-2 (12, 15, 17, 58). This is also consistent with a possible functional role for CD8 responses in host defense, because prior HSV-1 infection provides poor protection against subsequent HSV-2 infection (59), whereas both neutralizing Ab and CD4 responses have a strong type-common component (60, 61). We emphasized study of HSV-2 type-specific clones. Clones recovered directly from the site of infection, derived without secondary in vitro restimulation with Ag (62), were used to study physiological responses at the site of disease.

Little is known about the specificity of human HSV-2-specific CD8 CTL. The two published epitopes are type-common peptides within glycoproteins B and D (10, 15). At the nonclonal level, experiments using restimulation of PBMC, drug blocks, and vaccinia recombinants show that HSV-1 ICP4, ICP27, ICP0, all immediate early proteins, HSV-1 early protein ICP6, and possibly other true early proteins may be targets of human CTL (18, 63, 64). HSV-1 early protein thymidine kinase (tk) is recognized by CD8 clones from PBMC of subjects treated with tk-transfected autologous cells, but this is likely a primary immune response (65). A PBMC-derived CD8 T cell clone specific for a melanoma-associated protein (Melan A/MART-1) also reacted with a peptide from HSV-1 glycoprotein C (66).

It has been hypothesized that the selection of Ags recognized by HSV-specific CD8 CTL is influenced by immune evasion genes within HSV (7, 9). ICP47 blocks assembly of mature HLA-{beta}2-microglobulin-peptide complexes by inhibition of TAP. This effect occurs quickly during viral infection (67). In addition, vhs destabilizes host mRNA and reduces synthesis of new HLA class I. It is rational to predict that processing of both virion input proteins and immediate early proteins might outpace the down-regulation of HLA class I. A similar model has been proposed for human CMV, which also potently down-regulates HLA class I (9, 68, 69, 70).

In general, our results support an effect of immune evasion genes on the selection of CD8 Ags, given that we uncovered reactivity with two virion tegument proteins and one immediate early protein. The HSV open reading frame UL47 was detected twice. UL47 encodes tegument protein VP13/14, which is present in large amounts in virions (71). The physiological function(s) of UL47 are incompletely studied. The protein enhances trans activation by VP16 (72) but is dispensable for replication in culture (72, 73). Direct trafficking of input UL47 into the cytoplasm has been detected shortly after virion binding (42). UL49 encodes VP22, a tegument protein required for viral replication (1). UL49 protein is also abundant in virions and delivered into the cytoplasm by virus entry (42). Lysis of EBV-LCL by tegument-specific CD8 CTL was not inhibited by blockade of gene transcription or infection with a replication-incompetent virus, consistent with the processing and presentation of preformed virion input protein.

CD8 T cell specificity for the immediate early protein ICP0 (74) was also detected. ICP0 may be present in small amounts in HSV-1 virions (75). However, we found that lysis by the ICP0-specific CD8 clone 1874.1997.51 was substantially inhibited by infection in the presence of actinomycin D. Infection with the replication-incompetent virus hr259, which is able to direct the synthesis of ICP0, was able to sensitize target cells to lysis. These data are consistent with recognition of endogenously synthesized viral protein. As manipulation of virus or host is not possible with the natural host species for HSV-2, formal proof of an effect of immune evasion genes on the CD8 CTL repertoire will be difficult to obtain. If additional epitopes can be accrued with this or other approaches, they can be examined to determine whether a pattern consistent with antigenicity of virion input and immediate early proteins is present.

TAP-independent processing has been reported in other viral systems (76, 77, 78). Thus far, in our examination of three discrete epitopes in tegument proteins, we did not find evidence for TAP-independent Ag processing of HSV epitopes. The CD8 response seems to "evade the evasion," at least in the cases examined to date, while continuing to rely on TAP for Ag processing. The TAP dependence of responses to immunodominant Ags, if these can be identified as such, will also be of interest.

Most studies of clonal CD8 responses have used EBV-LCL as target cells. These cells are relatively resistant to HSV-mediated class I down-regulation (10). For dermal fibroblasts, we found that a short time of infection (2 h) was adequate for target cell sensitization for lysis by tegument protein-specific CTL. Because the UL47 and UL49 tegument proteins are synthesized with "late" kinetics (1), typically starting after 6 h or more of viral infection, these data are also consistent with recognition of preformed Ag in fibroblasts. Lysis was MOI dependent. Because HSV preparations typically contain a large number of defective particles (1), it is likely that tegument proteins were also being delivered into fibroblasts by noninfectious particles. After 18 h of infection, the fibroblasts were not lysed, regardless of MOI, similar to previous results with CD8 CTL clones of unknown fine specificity (10). IFN-{gamma} pretreatment was able to partially restore lysis of 18-h-infected cells. In contrast to fibroblasts, recognition of keratinocytes after 18 h of infection was superior to recognition after 2 h of infection. The reason for the difference between fibroblasts and keratinocytes is unknown. IFN-{gamma} pretreatment was able to restore some lysis of 2-h-infected cells, and further improved recognition of 18-h-infected cells. In future studies, we hope to compare the recognition of IFN-{gamma}-treated keratinocytes by both CD4 and CD8 CTL (79, 80, 81), given that both are present in lesions.

Tegument proteins have not previously been described as targets of the HSV-specific CD8 T cell response. CD4 responses to HSV-1 UL47 have been detected in HSV-mediated acute retinal necrosis (82). CD4 responses to UL49 are commonly detected among lesion-infiltrating HSV-2-specific clones (41). Because responses to UL49 are also present in the cornea in herpes stromal keratitis in humans (35), a disease that may be driven by pathogenic Th1-like T cells (82), caution is clearly warranted in using this protein as a vaccine. Overall, UL49 is the only known HSV-2 protein recognized by both CD4 and CD8 T cell clones recovered from herpetic lesions. A unique intercellular transport pathway allows highly efficient uptake of soluble UL49 protein into a variety of epithelial cell types (83, 84, 85) which could also intersect Ag processing pathways.

A few technical aspects of the methods warrant brief comment. Our library approach worked each of the first three consecutive times it was applied to CD8 CTL clones, so we do not think that technical factors greatly biased the viral kinetic or structural classes of the CTL epitopes detected. A library created, as was ours, with a single restriction endonuclease will contain "holes." The initial positive ICP0 genomic clone started well upstream of the ATG start, extending to bp -445. As noted above, the ATG start of ICP0 was out of frame with the vector-derived peptide expressed by the positive genomic clone. The ICP0 promoter appears to be functioning without additional viral factors such as the major trans activator VP16 as previously reported for HSV-1 (86). Not all viral promoters will necessarily be active outside of the context of natural viral infection. This problem can be overcome by fragmenting the HSV-2 DNA with alternative methods before library creation.

We chose the sequenced strain (28) of HSV-2, HG52, for library creation. HSV-2 strains are relatively invariant due to the high fidelity of the HSV DNA polymerase (1). Possibly, our approaches may fail if strain-specific epitopes are recognized in vivo. The library is a relatively efficient method for epitope/Ag discovery once conditions are optimized. Neither "holes" in the library nor strain-specific epitopes have interfered as of yet.

In summary, reactivity of lesion-infiltrating, HSV-2 type-specific CD8 T cell clones with the tegument proteins encoded by genes UL47 and UL49 (VP13/14 and VP22, respectively), and ICP0, are described for the first time. The data are consistent with a modulatory effect of ICP47 and/or vhs on the CD8 response to HSV. TAP function, but not viral gene transcription, is required for recognition by UL47- and UL49-specific clones, consistent with processing of preformed virion input protein. Tegument-specific CD8 clones were able to recognize skin-derived fibroblasts and keratinocytes. Responses were also detectable in the PBMC of additional subjects. Further studies are required to define the prevalence and dominance of these virus-specific responses and the potential role of these Ags in immunologic approaches to reduce HSV-2 infection and disease.


    Acknowledgments
 
We thank Al Farrand for essential advice concerning ELISA. Specimens were collected by the staff of the Virology Research Clinic. Sigrid N. Reymond, Christopher McClurkan, Matthew Wavra, Randal Cevallos, and Lonnie Yeung provided valuable technical assistance. HLA-typed EBV-LCL and T2 cells were kindly provided by Drs. J. Hansen, G. Nepom, and L. Musey. Dr. T. Spies provided cell line 721.174. Dr. C. Lutz provided cell line T2/B7.63, originally made by Dr. P. Cresswell. Dr. S. Riddell provided cloned HLA A*0201 and B*0702 cDNA. Dr. B. Rouse provided vaccinia expressing ICP0 of HSV-2. Dr. A. Davison provided cloned HSV-2 DNA. Dr. S. Barcy provided valuable molecular biology advice.


    Footnotes
 
1 Presented in abstract form at Immunology 2000, Seattle, WA, May 2000, and the 25th International Herpesvirus Workshop, Portland, OR, August 2000. This work was supported by National Institutes of Health Grants CA70017 (D.M.K.), AI30731 (L.C., A.W., and D.M.K..), AI42528 (L.C.), AI44443 (W.W.K.), and DK53345 (W.W.K.). Back

2 Address correspondence and reprint requests to Dr. David M. Koelle, Virology Division, Harborview Medical Center, University of Washington, Mail Stop 359690, 325 9th Avenue, Seattle, WA 98104-2499. Back

3 Abbreviations used in this paper: ICP47, infected cell protein number 47 (other protein numbers are similar); US12, unique short region of the HSV genome, gene 12 (other gene numbers are similar); vhs, virion host shutoff; UL47, unique long region of the HSV genome, gene 47 (other gene numbers are similar); EBV-LCL, EBV-transformed lymphocyte cell line; MOI, multiplicity of infection, the number of PFUs of virus added per cell; TCM, T cell medium; rh, recombinant human; EC50, 50% effective concentration. Back

Received for publication November 3, 2000. Accepted for publication January 9, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Roizman, B., A. E. Sears. 1996. Herpes simplex viruses and their replication. B. N. Fields, and D. M. Knipe, and P. M. Howley, eds. 3rd Ed.In Fields Virology Vol. 2:2231. Lippincott-Raven, Philadelphia.
  2. Simmons, A., D. C. Tscharke. 1992. Anti-CD8 impairs clearance of herpes simplex virus from the nervous system: implications for the fate of virally infected neurons. J. Exp. Med. 175:1337.[Abstract/Free Full Text]
  3. Pereira, R. A., A. Simmons. 1999. Cell surface expression of H2 antigens on primary sensory neurons in response to acute but not latent herpes simplex virus infection in vivo. J. Virol. 73:6484.[Abstract/Free Full Text]
  4. Pereira, R. A., M. M. Simon, A. Simmons. 2000. Granzyme A, a noncytolytic component of CD8+ cell granules, restricts the spread of herpes simplex virus in the peripheral nervous systems of experimentally infected mice. J. Virol. 74:1029.[Abstract/Free Full Text]
  5. Liu, T., K. M. Khanna, X. Chen, D. J. Fink, R. L. Hendricks. 2000. CD8+ T cells can block herpes simplex virus type 1 (HSV-1) reactivation from latency in sensory neurons. J. Exp. Med. 191:1459.[Abstract/Free Full Text]
  6. Wald, A., J. Zeh, S. Selke, T. Warren, A. Ryncarz, R. Ashley, J. N. Krieger, L. Corey. 2000. Reactivation of genital herpes type 2 infection in asymptomatic seropositive persons. N. Engl. J. Med. 342:844.[Abstract/Free Full Text]
  7. Ward, P. L., B. Roizman. 1998. Evasion and obstruction: the central strategy of the interaction between human herpesviruses with host defense. P. L. Medvezcky, ed. Herpesviruses and Immunity 1. Plenum, New York.
  8. Ploegh, H. L.. 1998. Viral strategies of immune evasion. Science 280:248.[Abstract/Free Full Text]
  9. Johnson, D. C., A. B. Hill. 1998. Herpesvirus evasion of the immune system. Curr. Top. Microbiol. Immunol. 232:1.[Medline]
  10. Koelle, D. M., M. A. Tigges, R. L. Burke, F. W. Symington, S. R. Riddell, H. Abbo, L. Corey. 1993. Herpes simplex virus infection of human fibroblasts and keratinocytes inhibits recognition by cloned CD8+ cytotoxic T lymphocytes. J. Clin. Invest. 91:961.
  11. Koelle, D. M., H. Abbo, A. Peck, K. Ziegweid, L. Corey. 1994. Direct recovery of HSV-specific T lymphocyte clones from human recurrent HSV-2 lesions. J. Infect. Dis. 169:956.[Medline]
  12. Koelle, D. M., C. M. Posavad, G. R. Barnum, M. L. Johnson, J. M. Frank, L. Corey. 1998. Clearance of HSV-2 from recurrent genital lesions correlates with infiltration of HSV-specific cytotoxic T lymphocytes. J. Clin. Invest. 101:1500.[Medline]
  13. Posavad, C. M., D. M. Koelle, M. F. Shaughnessy, L. Corey. 1997. Severe genital herpes infections in HIV-infected individuals with impaired HSV-specific CD8+ cytotoxic T lymphocyte responses. Proc. Natl. Acad. Sci. USA 94:10289.[Abstract/Free Full Text]
  14. Tomazin, R., N. E. van Schoot, K. Goldsmith, P. Jugovic, P. Sempe, K. Fruh, D. C. Johnson. 1998. Herpes simplex virus type 2 ICP47 inhibits human TAP but not mouse TAP. J. Virol. 72:2560.[Abstract/Free Full Text]
  15. Tigges, M. A., S. Leng, D. C. Johnson, R. L. Burke. 1996. Human herpes simplex (HSV)-specific CD8+ CTL clones recognize HSV-2-infected fibroblasts after treatment with IFN-{gamma} or when virion host shutoff functions are disabled. J. Immunol. 156:3901.[Abstract]
  16. Cunningham, A. L., R. R. Turner, A. C. Miller, M. F. Para, T. C. Merigan. 1985. Evolution of recurrent herpes simplex lesions: an immunohistologic study. J. Clin. Invest. 75:226.
  17. Tigges, M. A., D. M. Koelle, K. Hartog, R. E. Sekulovich, L. Corey, R. L. Burke. 1992. Human CD8+ herpes simplex virus-specific cytotoxic T lymphocyte clones recognize diverse virion protein antigens. J. Virol. 66:1622.[Abstract/Free Full Text]
  18. Mikloska, Z., M. Ruckholdt, I. Ghadiminejad, H. Dunckley, M. Denis, A. L. Cunningham. 2000. Monophosphoryl lipid A and QS21 increase CD8 T lymphocyte cytotoxicity to herpes simplex virus-2 infected cell proteins 4 and 27 through IFN-{gamma} and IL-12 production. J. Immunol. 164:5167.[Abstract/Free Full Text]
  19. Pepperl, S., J. Munster, M. Mach, J. R. Harris, B. Plachter. 2000. Dense bodies of human cytomegalovirus induce both humoral and cellular immune responses in the absence of viral gene expression. J. Virol. 74:6132.[Abstract/Free Full Text]
  20. DeMars, R., C. C. Chang, S. Shaw, P. J. Reitnauer, P. M. Sondel. 1984. Homozygous deletions that simultaneously eliminate expressions of class I and class II antigens of EBV-transformed B-lymphoblastoid cells. I. Reduced proliferative responses of autologous and allogeneic T cells to mutant cells that have decreased expression of class II antigens. Hum. Immunol. 11:77.[Medline]
  21. Salter, R. D., P. Cresswell. 1986. Impaired assembly and transport of HLA-A and -B antigens in a TxB hybrid. EMBO J. 5:943.[Medline]
  22. Gluzman, Y.. 1981. SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23:175.[Medline]
  23. Ashley, R. A., J. Militoni, F. Lee, A. Nahmias, L. Corey. 1988. Comparison of Western blot (immunoblot) and glycoprotein G-specific immunoblot for detecting antibodies to herpes simplex types 1 and 2 in human sera. J. Clin. Microbiol. 26:662.[Abstract/Free Full Text]
  24. Moretta, A., G. Pantaleo, L. Moretta, J.-C. Cerottini, M. C. Mingari. 1983. Direct demonstration of the clonogenic potential of every human peripheral blood T cell. J. Exp. Med. 157:743.[Abstract/Free Full Text]
  25. Brodie, S. J., D. A. Lewinsohn, B. K. Patterson, D. Jiyamapa, J. Krieger, L. Corey, P. D. Greenberg, S. R. Riddell. 1999. In vivo migration and function of transferred HIV-1-specific cytotoxic T cells. Nat. Med. 5:34.[Medline]
  26. Spruance, S. L., F. S. Chow. 1980. Pathogenesis of herpes simplex virus in cultures of epidermal cells from subjects with frequent recurrences. J. Infect. Dis. 142:671.[Medline]
  27. Kit, S., M. Kit, H. Qavi, D. Trkula, H. Otsuka. 1983. Nucleotide sequence of the herpes simplex virus type 2 (HSV-2) thymidine kinase gene and predicted amino acid sequence of thymidine kinase polypeptide and its comparison with the HSV-1 thymidine kinase gene. Biochim. Biophys. Acta 741:158.[Medline]
  28. Dolan, A., F. E. Jamieson, C. Cunningham, B. C. Barnett, D. J. McGeoch. 1998. The genome sequence of herpes simplex virus type 2. J. Virol. 72:2010.[Abstract/Free Full Text]
  29. Schmidt, N. J.. 1989. Cell culture procedures for diagnostic virology. N. J. Schmidt, and R. W. Emmons, eds. Diagnostic Procedures for Viral, Rickettsial and Chlamydial Infections 6th Ed.51. American Public Health Association, Inc, Washington, DC.
  30. Smith, C. A., P. A. Schaffer. 1987. Mutants defective in herpes simplex virus type 2 ICP4: isolation and preliminary characterization. J. Virol. 61:1092.[Abstract/Free Full Text]
  31. Manickan, E., M. Francotte, N. Kuklin, M. Dewerchin, C. Molitor, D. Gheysen, M. Slaoui, B. T. Rouse. 1995. Vaccination with recombinant vaccinia viruses expressing ICP27 induces protecting immunity against herpes simplex virus through CD4+ Th1+ T cells. J. Virol. 69:4711.[Abstract]
  32. De Plaen, E., C. Lurquin, V. Brichard, P. van der Bruggen, J.-C. Renauld, P. Coulie, J.-P. Szikora, T. Wolfel, A. Van Pel, T. Boon. 1997. Cloning of genes coding for antigens recognized by cytolytic T lymphocytes. I. Lefkowits, ed. In Immunology Methods Manual Vol. 2:691. Academic Press, New York.
  33. MacLean, A. R.. 1998. Preparation of HSV-DNA and production of infectious virus. S. M. Brown, and A. R. MacLean, eds. In Methods in Molecular Medicine: Herpes Simplex Virus Protocols Vol. 10:19. Humana Press, Totowa, NJ.
  34. Chomczynski, P., and N. Sacchi. 1992. Single step RNA isolation from cultured cells or tissues. In Current Protocols in Immunology. J. E. Coligan, A. M. Kruisbeek, D. H. Marguilies, E. M. Shevach, and W. Strober, eds. John Wiley and Sons, New York, p. 10.11.7.
  35. Koelle, D. M., S. N. Reymond, H. Chen, W. W. Kwok, C. McClurkan, T. Gyaltsong, E. W. Petersdorf, W. Rotkis, A. R. Talley, D. A. Harrison. 2000. Tegument-specific, virus-reactive CD4 T-cells localize to the cornea in herpes simplex virus interstitial keratitis in humans. J. Virol. 74:10930.[Abstract/Free Full Text]
  36. Koelle, D. M., M. Schomogyi, C. McClurkan, S. N. Reymond, H. B. Chen. 2000. CD4 T-cell responses to herpes simplex virus type 2 major capsid protein VP5: comparison with responses to tegument and envelope glycoproteins. J. Virol. 74:11422.[Abstract/Free Full Text]
  37. Barnstable, C. J., W. F. Bodmer, G. Brown, G. Galfre, C. Milstein, A. F. Williams, A. Ziegler. 1978. Production of monoclonal antibodies to group A erythrocytes, HLA and other human cell surface antigens-new tools for genetic analysis. Cell 14:9.[Medline]
  38. McMichael, A. J., P. Parham, N. Rust, F. Brodsky. 1980. A monoclonal antibody that recognizes an antigenic determinant shared by HLA A2 and B17. Hum. Immunol. 1:121.[Medline]
  39. Posavad, C. M., S. Barcy, M. L. Huang, D. M. Koelle, S. J. Polyak, L. Corey. 2000. Long-term persistence of herpes simplex virus-specific CD8+ CTL clones derived from genital lesions. J. Immunol. 165:1146.[Abstract/Free Full Text]
  40. Ohler, U., S. Harbeck, H. Niemann, E. Noth, M. G. Reese. 1999. Interpolated Markov chains for eukaryotic promoter recognition. Bioinformatics 15:362.[Abstract/Free Full Text]
  41. Koelle, D. M., J. M. Frank, M. L. Johnson, W. W. Kwok. 1998. Recognition of herpes simplex virus type 2 tegument proteins by CD4 T cells infiltrating human genital herpes lesions. J. Virol. 72:7476.[Abstract/Free Full Text]
  42. Morrison, E. E., A. J. Stevenson, Y. F. Wang, D. M. Meredith. 1998. Differences in the intracellular localization and fate of herpes simplex virus tegument proteins early in the infection of vero cells. J. Gen. Virol. 79:2517.[Abstract]
  43. McGeoch, D. J., M. A. Dalrymple, A. J. Davison, A. Dolan, M. C. Frame, D. McNab, L. J. Perry, J. E. Scott, P. Taylor. 1988. The complete DNA sequence of the long unique region of herpes simplex virus type 1. J. Gen. Virol. 69:1531.[Abstract/Free Full Text]
  44. Weber, P. C., S. J. Spatz, E. C. Nordby. 1999. Stable ubiquination of the ICP0R protein of herpes simplex virus type 1 during productive infection. Virology 253:288.[Medline]
  45. Carter, K. L., B. Roizman. 1996. Alternatively spliced mRNAs predicted to yield frame-shift proteins and stable intron mRNAs of the herpes simplex virus 1 regulatory gene {alpha}0 accumulate in the cytoplasm of infected cells. Proc. Natl. Acad. Sci. USA 93:12535.[Abstract/Free Full Text]
  46. Brander, C., and B. D. Walker. 1996. The HLA Class I Restricted CTL Response in HIV Infection: Systemic Identification of Optimal Epitopes. HIV molecular immunology database. C. B. B. Korber, B. Walker, R. Koup, J. Moore, B. Haynes, and G. Meyers, eds. Los Alamos National Laboratory: Theoretical Biology and Biophysics, Los Alamos, NM.
  47. Schneider, J., V. Brichard, T. Boon, K.-H. Meyer zum Buschenfelde, T. Wolfel. 1998. Overlapping peptides of melanocyte differentiation antigen melan-A/mart01 recognized by autologous cytolytic T lymphocytes in association with HLA-B45.1 and HLA A-A2.1. Int. J. Cancer 75:451.[Medline]
  48. Menendez-Arias, L., A. Mas, E. Domingo. 1998. Cytotoxic T-lymphocyte responses to HIV-1 reverse transcriptase. Viral Immunol. 11:167.[Medline]
  49. Sette, A., J. Sidney. 1998. HLA supertypes and supermotifs: a functional perspective on HLA polymorphism. Curr. Opin. Immunol. 10:478.[Medline]
  50. Corey, L., A. Wald. 1999. Genital Herpes. K. K. Holmes, and P. F. Sparling, and P. A. Mardh, and S. M. Lemon, and W. E. Stamm, and P. Piot, and J. M. Wasserheit, eds. Sexually Transmitted Diseases 3rd Ed.285. McGraw-Hill, New York.
  51. Stanberry, L. R., A. L. Cunningham, A. Mindel, L. L. Scott, S. L. Spruance, F. Y. Aoki, C. J. Lacey. 2000. Prospects for control of herpes simplex virus disease through immunization. Clin. Infect. Dis. 30:549.[Medline]
  52. Corey, L., A. G. M. Langenberg, R. Ashley, R. E. Sekulovich, A. E. Izu, J. M. Douglas, H. Handsfield, T. Warren, L. Marr, S. Tyring, et al 1999. Two double-blind, placebo-controlled trials of a vaccine containing recombinant gD2 and gB2 antigens in MF59 adjuvant for the prevention of genital HSV-2 acquisition. J. Am. Med. Assoc. 282:331.[Abstract/Free Full Text]
  53. Spruance, S. L., and Smithkline Beecham (SB) Herpes Vaccine Efficacy Study Group. 2000. Gender-specific efficacy of a prophylactic SBAS4-adjuvanted gD2 subunit vaccine against genital herpes disease (GHD): results of two clinical efficacy trials. In 40th Interscience Conference on Antimicrobial Agents and Chemotherapy, September 17, 2000. American Society for Microbiology, Washington, DC (Late-breaker Abstract L-6).
  54. Koelle, D. M., M. Schomogyi, L. Corey. 2000. Recovery of antigen-specific T-cells from the uterine cervix of women with genital herpes simplex virus type 2 virus infection. J. Infect. Dis. 182:662.[Medline]
  55. Blaney, J. E., E. Nobusawa, M. A. Brehm, R. H. Bonneau, L. M. Mylin, T. M. Fu, Y. Kawoaka, S. S. Tevethia. 1998. Immunization with a single major histocompatibility class I-restricted cytotoxic T-lymphocyte recognition epitope of herpes simplex virus type 2 confers protective immunity. J. Virol. 72:9567.[Abstract/Free Full Text]
  56. Cose, S. C., J. M. Kelly, F. R. Carbone. 1995. Characterization of a diverse primary herpes simplex virus type 1 gB-specific cytotoxic T-cell response showing a preferential V{beta} bias. J. Virol. 69:5849.[Abstract]
  57. Cose, S. C., C. M. Jones, M. E. Wallace, W. R. Heath, F. R. Carbone. 1997. Antigen-specific CD8+ T cell subset distribution in lymph nodes draining the site of herpes simplex virus infection. Eur. J. Immunol. 27:2310.[Medline]
  58. Posavad, C. M., D. M. Koelle, L. C. Corey. 1996. High frequency of CD8+ cytotoxic T-lymphocyte precursors specific for herpes simplex viruses in persons with genital herpes. J. Virol. 70:8165.[Abstract]
  59. Langenberg, A. G. M., R. L. Corey, R. L. Ashley, W. P. Leong, S. E. Straus. 1999. Acquisition of symptomatic and asymptomatic HSV-1 and HSV-2 infections: a prospective study of their incidence and clinical spectrum. N. Engl. J. Med. 341:1432.[Abstract/Free Full Text]
  60. Muggeridge, M. I., V. J. Isola, R. A. Byrn, T. J. Tucker, A. C. Minson, J. C. Glorioso, G. H. Cohen, R. J. Eisenberg. 1988. Antigenic analysis of a major neutralization site of herpes simplex virus glyoprotein D, using deletion mutants and monoclonal antibody-resistant mutants. J. Virol. 62:3274.[Abstract/Free Full Text]
  61. Koelle, D. M., L. Corey, R. L. Burke, R. J. Eisenberg, G. H. Cohen, R. Pichyangkura, S. J. Triezenberg. 1994. Antigenic specificity of human CD4+ T cell clones recovered from recurrent genital HSV-2 lesions. J. Virol. 68:2803.[Abstract/Free Full Text]
  62. Arrode, G., C. Boccaccio, J. Lule, S. Allart, N. Moinard, J. P. Abastado, A. Alam, C. Davrinche. 2000. Incoming human cytomegalovirus pp65 (UL83) contained in apoptotic infected fibroblasts is cross-presented to CD8+ T cells by dendritic cells. J. Virol. 74:10018.[Abstract/Free Full Text]
  63. Garland, R. J., K. J. Roberts-Lewis, N. G. Goulden, C. G. Steward, and A. W. Rowbottom. 1999. Peptide binding affinity and the generation of HSV-1 specific cytotoxic CD8 lymphocytes. In 24th International Herpesvirus Workshop, p. 9.012.
  64. Mikloska, A., A. M. Kesson, M. E. T. Penfold, A. L. Cunningham. 1996. Herpes simplex virus protein targets for CD4 and CD8 lymphocyte cytotoxicity in cultured epidermal keratinocytes treated with interferon-{gamma}. J. Infect. Dis. 173:7.[Medline]
  65. Riddell, S. R., M. Elliott, D. A. Lewinsohn, M. J. Gilbert, L. Wilson, S. A. Manley, S. D. Lupton, R. W. Overell, T. C. Reynolds, L. Corey, P. D. Greenberg. 1996. T-cell mediated rejection of gene modified HIV-specific cytotoxic T lymphocytes in HIV-infected patients. Nat. Med. 2:216.[Medline]
  66. Loftus, D. J., C. Castelli, T. M. Clay, P. Squarcina, F. M. Marcinola, M. I. Nishimura, G. Parmiani, E. Appella, L. Rivoltini. 1996. Identification of epitope mimics recognized by CTL reactive to the melanoma/melanocyte-derived peptide MART-1(27–35). J. Exp. Med. 184:647.[Abstract/Free Full Text]
  67. Hill, A., P. Jugovic, I. York, G. Russ, J. Bennink, J. Yewdell, H. Ploegh, D. Johnson. 1995. Herpes simplex virus turns off the TAP to evade host immunity. Nature 375:411.[Medline]
  68. Gilbert, M. J., S. R. Riddell, B. Plachter, P. D. Greenberg. 1996. Cytomegalovirus selectively blocks antigen processing and presentation of its immediate-early gene product. Nature 383:720.[Medline]
  69. Wills, M. R., A. J. Carmichael, K. Mynard, X. Jin, M. P. Weekes, B. Plachter, J. G. P. Sissons. 1996. The human cytotoxic T-lymphocyte (CLT) response to cytomegalovirus is dominated by structural protein pp65: frequency, specificity, and T-cell receptor usage of pp65-specific CTL. J. Virol. 70:7569.[Abstract]
  70. Kern, F., I. P. Surel, N. Faulhaber, C. Frommel, J. Schneider-Mergener, C. Schonemann, P. Reinke, H.-D. Volk. 1999. Target structures of the CD8+ T cell response to human cytomegalovirus: the 72-kilodalton major immediate early protein revisited. J. Virol. 73:8179.[Abstract/Free Full Text]
  71. McLean, G., F. Rixon, N. Langeland, L. Haarr, H. Marsden. 1990. Identification and characterization of the virion protein products of herpes simplex type 1 gene UL47. J. Gen. Virol. 71:2953.[Abstract/Free Full Text]
  72. Zhang, Y., D. A. Sirko, J. L. C. McKnight. 1991. Role of herpes simplex virus type 1 UL46 and UL47 in {alpha}TIF-mediated transcriptional induction: characterization of three viral deletion mutants. J. Virol. 65:829.[Abstract/Free Full Text]
  73. Barker, D. E., B. Roizman. 1990. Identification of three genes nonessential for growth in cell culture near the right terminus of the unique sequences of long component of herpes simplex virus type 1. Virology 177:684.[Medline]
  74. Everett, R. D.. 2000. ICP0, a regulator of herpes simplex virus during lytic and latent infection. Bioessays 22:761.[Medline]
  75. Yao, F., R. J. Courtney. 1992. Association of ICP0 but not ICP27 with purified virions of herpes simplex virus type 1. J. Virol. 66:2709.[Abstract/Free Full Text]
  76. de la Salle, H., E. Houssaint, M.-A. Peyrat, D. Arnold, J. Salamero, D. Pinczon, S. Stevanovic, H. Bausinger, D. Fricker, E. Gomard, et al 1997. Human peptide transporter deficiency: importance of HLA-B in the presentation of TAP-independent EBV antigens. J. Immunol. 158:4555.[Abstract]
  77. Lopez, D., B. C. Gil-Torregrosa, C. Bergmann, M. Del Val. 2000. Sequential cleavage by metallopeptidases and proteosomes is involved in processing HIV-1 ENV epitope for endogenous MHC class I antigen processing. J. Immunol. 164:5070.[Abstract/Free Full Text]
  78. Hosken, N. A., M. J. Bevan. 1993. An endogenous antigenic peptide bypasses the class I antigen presentation defect in RMA-S. J. Exp. Med. 175:719.[Abstract/Free Full Text]
  79. Mikloska, A., A. L. Cunningham. 1998. Herpes simplex virus type 1 glycoproteins gB, gC, and gD are major targets for CD4 T-lymphocyte cytotoxicity in HLA-DR expressing human epidermal keratinocytes. J. Gen. Virol. 79:353.[Abstract]
  80. Van Voorhis, W. C., L. K. Barrett, D. M. Koelle, J. M. Nasio, F. A. Plummer, S. A. Lukehart. 1996. Primary and secondary syphilis lesions contain mRNA for Th1 cytokines and activated cytolytic T cells. J. Infect. Dis. 173:491.[Medline]
  81. Torseth, J. W., T. C. Merigan. 1986. Significance of local {gamma} interferon in recurrent herpes simplex infection. J. Infect. Dis. 153:979.[Medline]
  82. Verjans, G. M., M. E. M. Dings, J. McLauchlan, A. van der Kooi, P. Hoogerhout, H. F. Brugghe, H. A. M. Timmermans, G. S. Baarsma, A. D. M. E. Osterhaus. 2000. Intraocular T cells of patients with herpes simplex (HSV)-induced acute retinal necrosis recognize HSV tegument proteins VP11/12 and VP13/14. J. Infect. Dis. 182:923.[Medline]
  83. Elliott, G., P. O’Hare. 2000. Cytoplasm-to-nucleus translocation of a herpesvirus tegument protein during cell division. J. Virol. 74:2131.[Abstract/Free Full Text]
  84. Elliott, G., P. O’Hare. 1999. Intercellular trafficking of VP22-GFP fusion proteins. Gene Therapy 6:149.[Medline]
  85. Dilber, M. S., A. Phelan, A. Aints, A. J. Mohamed, G. Elliott, C. I. E. Smith, P. O’Hare. 1999. Intercellular delivery of the thymidine kinase prodrug activating enzyme by the herpes simplex virus protein VP22. Gene Ther. 6:12.[Medline]
  86. Davido, D. J., D. A. Leib. 1998. Analysis of the basal and inducible activities of the ICP0 promoter of herpes simplex virus type 1. J. Gen. Virol. 79:2093.[Abstract]



This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
W. J. Muller, L. Dong, A. Vilalta, B. Byrd, K. M. Wilhelm, C. L. McClurkan, M. Margalith, C. Liu, D. Kaslow, J. Sidney, et al.
Herpes simplex virus type 2 tegument proteins contain subdominant T-cell epitopes detectable in BALB/c mice after DNA immunization and infection
J. Gen. Virol., May 1, 2009; 90(5): 1153 - 1163.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Jing, D. H. Davies, T. M. Chong, S. Chun, C. L. McClurkan, J. Huang, B. T. Story, D. M. Molina, S. Hirst, P. L. Felgner, et al.
An Extremely Diverse CD4 Response to Vaccinia Virus in Humans Is Revealed by Proteome-Wide T-Cell Profiling
J. Virol., July 15, 2008; 82(14): 7120 - 7134.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
D. M. Koelle, A. Magaret, C. L. McClurkan, M. L. Remington, T. Warren, F. Teofilovici, and A. Wald
Phase I Dose-Escalation Study of a Monovalent Heat Shock Protein 70-Herpes Simplex Virus Type 2 (HSV-2) Peptide-Based Vaccine Designed To Prime or Boost CD8 T-Cell Responses in HSV-Naive and HSV-2-Infected Subjects
Clin. Vaccine Immunol., May 1, 2008; 15(5): 773 - 782.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. Chentoufi, X. Zhang, K. Lamberth, G. Dasgupta, I. Bettahi, A. Nguyen, M. Wu, X. Zhu, A. Mohebbi, S. Buus, et al.
HLA-A*0201-Restricted CD8+ Cytotoxic T Lymphocyte Epitopes Identified from Herpes Simplex Virus Glycoprotein D
J. Immunol., January 1, 2008; 180(1): 426 - 437.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
I. Bettahi, A. B. Nesburn, S. Yoon, X. Zhang, A. Mohebbi, V. Sue, A. Vanderberg, S. L. Wechsler, and L. BenMohamed
Protective Immunity against Ocular Herpes Infection and Disease Induced by Highly Immunogenic Self-Adjuvanting Glycoprotein D Lipopeptide Vaccines
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4643 - 4653.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Jing, T. M. Chong, B. Byrd, C. L. McClurkan, J. Huang, B. T. Story, K. M. Dunkley, L. Aldaz-Carroll, R. J. Eisenberg, G. H. Cohen, et al.
Dominance and Diversity in the Primary Human CD4 T Cell Response to Replication-Competent Vaccinia Virus
J. Immunol., May 15, 2007; 178(10): 6374 - 6386.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. Zhu, D. M. Koelle, J. Cao, J. Vazquez, M. L. Huang, F. Hladik, A. Wald, and L. Corey
Virus-specific CD8+ T cells accumulate near sensory nerve endings in genital skin during subclinical HSV-2 reactivation
J. Exp. Med., March 19, 2007; 204(3): 595 - 603.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. A. Diaz and D. M. Koelle
Human CD4+ CD25high Cells Suppress Proliferative Memory Lymphocyte Responses to Herpes Simplex Virus Type 2.
J. Virol., August 1, 2006; 80(16): 8271 - 8273.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
N. Hosken, P. McGowan, A. Meier, D. M. Koelle, P. Sleath, F. Wagener, M. Elliott, K. Grabstein, C. Posavad, and L. Corey
Diversity of the CD8+ T-Cell Response to Herpes Simplex Virus Type 2 Proteins among Persons with Genital Herpes.
J. Virol., June 1, 2006; 80(11): 5509 - 5515.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Jing, T. M. Chong, C. L. McClurkan, J. Huang, B. T. Story, and D. M. Koelle
Diversity in the Acute CD8 T Cell Response to Vaccinia Virus in Humans
J. Immunol., December 1, 2005; 175(11): 7550 - 7559.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Bosnjak, M. Miranda-Saksena, D. M. Koelle, R. A. Boadle, C. A. Jones, and A. L. Cunningham
Herpes Simplex Virus Infection of Human Dendritic Cells Induces Apoptosis and Allows Cross-Presentation via Uninfected Dendritic Cells
J. Immunol., February 15, 2005; 174(4): 2220 - 2227.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
G. N. Milligan, C.-F. Chu, C. G. Young, and L. R. Stanberry
Effect of Candidate Vaginally-Applied Microbicide Compounds on Recognition of Antigen by CD4+ and CD8+ T Lymphocytes
Biol Reprod, November 1, 2004; 71(5): 1638 - 1645.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. M. Koelle, Z. Liu, C. L. McClurkan, R. C. Cevallos, J. Vieira, N. A. Hosken, C. A. Meseda, D. C. Snow, A. Wald, and L. Corey
Immunodominance among herpes simplex virus-specific CD8 T cells expressing a tissue-specific homing receptor
PNAS, October 28, 2003; 100(22): 12899 - 12904.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
W. A. Macdonald, A. W. Purcell, N. A. Mifsud, L. K. Ely, D. S. Williams, L. Chang, J. J. Gorman, C. S. Clements, L. Kjer-Nielsen, D. M. Koelle, et al.
A Naturally Selected Dimorphism within the HLA-B44 Supertype Alters Class I Structure, Peptide Repertoire, and T Cell Recognition
J. Exp. Med., September 2, 2003; 198(5): 679 - 691.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. BenMohamed, G. Bertrand, C. D. McNamara, H. Gras-Masse, J. Hammer, S. L. Wechsler, and A. B. Nesburn
Identification of Novel Immunodominant CD4+ Th1-Type T-Cell Peptide Epitopes from Herpes Simplex Virus Glycoprotein D That Confer Protective Immunity
J. Virol., September 1, 2003; 77(17): 9463 - 9473.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
F.-X. Mbopi-Keou, L. Belec, J. Dalessio, J. Legoff, G. Gresenguet, P. Mayaud, D. W. G. Brown, and R. Ashley Morrow
Cervicovaginal Neutralizing Antibodies to Herpes Simplex Virus (HSV) in Women Seropositive for HSV Types 1 and 2
Clin. Vaccine Immunol., May 1, 2003; 10(3): 388 - 393.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
D. M. Koelle and L. Corey
Recent Progress in Herpes Simplex Virus Immunobiology and Vaccine Research
Clin. Microbiol. Rev., January 1, 2003; 16(1): 96 - 113.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Gierynska, U. Kumaraguru, S.-K. Eo, S. Lee, A. Krieg, and B. T. Rouse
Induction of CD8 T-Cell-Specific Systemic and Mucosal Immunity against Herpes Simplex Virus with CpG-Peptide Complexes
J. Virol., June 5, 2002; 76(13): 6568 - 6576.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. M. Koelle, H. B. Chen, C. M. McClurkan, and E. W. Petersdorf
Herpes simplex virus type 2-specific CD8 cytotoxic T lymphocyte cross-reactivity against prevalent HLA class I alleles
Blood, May 15, 2002; 99(10): 3844 - 3847.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koelle, D. M.
Right arrow Articles by Corey, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koelle, D. M.
Right arrow Articles by Corey, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS