| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Pediatric Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5–10% of Src homology 2
domain-containing tyrosine phosphatase (SHP-1) is constitutively
associated with plasma membrane, and nearly 50% of SHP-2 is
translocated to plasma membrane after vanadate treatment. Similar to
transmembrane PTP, CD45, the membrane-associated populations of SHP-1
and SHP-2 are essentially excluded from lipid rafts, where other
signaling molecules such as Lck, linker for activation of T cells, and
CD3
are enriched. We further demonstrated that CD3-induced tyrosine
phosphorylation of these substrates is largely restricted to lipid
rafts, unless PTPs are inhibited. It suggests that a restricted
partition of PTPs among membrane subdomains may regulate protein
tyrosine phosphorylation in T cell membrane. To test this hypothesis,
we targeted SHP-1 into lipid rafts by using the N-terminal region of
Lck (residues 1–14). The results indicate that the expression of
Lck/SHP-1 chimera inside lipid rafts profoundly inhibits CD3-induced
tyrosine phosphorylation of CD3/
, IL-2 generation, and nuclear
mobilization of NF-AT. Collectively, these results suggest that the
exclusion of PTPs from lipid rafts may be a mechanism that potentiates
TCR/CD3 activation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1, (8, 9).
Recent studies suggest that the compartmentalization of membrane
structure imposed by lipid rafts is essential for TCR-mediated
signaling (10, 11, 12). Lipid rafts have been described as a
mobile and dynamic membrane structure with a diameter of 70–300 nm
(13). Previous studies that used confocal microscopy have
shown that stimulation by TCR, CD2, or CD3/CD28 induces reorganization
and clustering of lipid raft microdomains at the site of engagement,
which lead to enhanced TCR signaling and a higher and more stable
protein tyrosine phosphorylation (10, 11, 12). Discrete lipid
rafts are enriched in molecules involved in signal transduction, such
as Src family kinases, Ras, and G proteins, as well as sphingolipid,
cholesterol, and a subset of GPI-linked proteins (14, 15, 16, 17).
Studies in T cells revealed that CD3, coreceptor CD4 and CD8, Src
family kinase Lck and Fyn, and transmembrane adaptor LAT are also
concentrated in lipid rafts (18, 19, 20). In contrast, CD45, a
receptor-type protein tyrosine phosphatase (PTP), is so far the only
phosphatase that has been shown to be excluded from lipid rafts
(21). It is known that T cell activation is controlled by
the coordinated action of protein tyrosine kinases (PTKs) and PTPs
(22, 23, 24). However, it is not clear whether the segregation
of PTKs and PTPs on T cell membrane is important for T cell
activation.
In addition to CD45, PTPs Src homology 2 domain-containing tyrosine phosphatase (SHP-1) and SHP-2 have also been implicated in the regulation of T cell activation (22, 23, 24). SHP-1 is expressed primarily in hemopoietic cells and plays a critical role in the negative regulation of signaling and development. Accordingly, thymocytes derived from motheaten (me) mice, which lack the expression of functional SHP-1, hyperproliferate in response to TCR stimulation (25, 26, 27). In contrast, SHP-2 is known for its requirement for the activation of Ras/mitogen-activated protein kinase pathways in nonhemopoietic cells and is expressed ubiquitously (28, 29, 30). In T lymphocytes, SHP-2 has also been shown to associate with TCR through its interaction with CTLA-4 and possibly to contribute to the dephosphorylation of CD3 subunits (31, 32, 33). Nevertheless, the precise functions of SHP-1 and SHP-2 as regulators in T cell membrane have yet to be determined.
Previously, we reported that when isolated T cell membranes were
incubated with PTP inhibitors
H2O2 or vanadate in the
presence of ATP, the molecules enriched in lipid rafts, such as CD3
and protein kinases Lck, Fyn, Syk, and ZAP70, were tyrosine
phosphorylated (34). In this report, we show that PTP
activity is found predominantly outside the lipid rafts and identify
SHP-1 and SHP-2 as two important membrane-associated PTPs in T cells.
The functional significance of restricted distribution of PTPs in
membrane microdomains was further demonstrated by the inhibition of
CD3-induced protein tyrosine phosphorylation, IL-2 generation, and
NF-AT activation in T cells with SHP-1 targeted to lipid rafts. Taken
together, our results suggest that restricted distribution of PTPs in
membrane microdomains may play a critical role in the initiation of
TCR/CD3 signaling.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Jurkat T cell line J77, a variant of clone E6–1 (American Type
Culture Collection (ATCC), Manassas, VA) was cultured in RPMI 1640
medium supplemented with 10% FCS at 37°C in a 5%
CO2 humidified atmosphere.
JCD45- (J45.01) Jurkat T cells were obtained
from ATCC. Anti-phosphotyrosine Ab (anti-pTyr; RC20) and
anti-SHP-1 mAbs were purchased from BD Transduction Laboratories
(Lexington, KY). Anti-CD3 and anti-CD45 mAbs as well as
anti-SHP-2 polyclonal Ab were purchased from Santa Cruz
Biotechnology (Santa Cruz, CA). Anti-LAT and anti-Lck polyclonal
Abs were purchased from Upstate Biotechnology (Lake Placid, NY).
Anti-CD3 Ab (OKT3) and anti-Myc Ab were prepared from a hybridoma
obtained from ATCC.
T cell stimulation, immunoprecipitation, and immunoblotting
Jurkat T cells (5 x 107) were washed
and resuspended in 1 ml of PBS. For CD3 stimulation, cells were
incubated with OKT3 (2 µg/ml) for 5 min on ice, cross-linked by
rabbit anti-mouse IgG (5 µg/ml) on ice for an additional 5 min,
then incubated at 37°C for 3 min. For
H2O2 stimulation, cells
were incubated with 5 mM
H2O2 at 37°C for 3 min.
After washing with PBS, cells were lysed in 1 ml of Nonidet P-40
(NP-40) lysis buffer (1% Nonidet P-40, 150 mM NaCl, 20 mM Tris, pH
7.4, 0.5% sodium deoxycholate, 50 mM NaF, 1 mM PMSF, 1 µg/ml
leupeptin, 2 µg/ml antipain) at 4°C for 30 min. The NP-40 lysate
was centrifuged at 12,000 x g for 15 min at 4°C.
Immunoprecipitation was conducted at 4°C overnight or at room
temperature for 4 h with protein A-Sepharose beads. The beads were
washed twice with 0.1% Triton X-100/TBS and once with TBS. Proteins
were eluted from the beads by boiling for 5 min in 50 µl of Laemmli
reducing SDS sample buffer. Proteins from 107
cells were subjected to SDS-PAGE and transferred to a polyvinylidene
fluoride membrane. Membrane were blocked with 3% BSA in TBST and
incubated with Abs in TBST for 2 h at room temperature. After four
15-min washes with TBST, the membranes were incubated with
HRP-conjugated Ab for 30 min, washed three times for 5 min with TBST,
and developed using the ECL system (Amersham, Buckinghamshire,
U.K.).
Subcellular fractionation
After washing in PBS, Jurkat T cells (2 x 108) were incubated in 2 ml of hypotonic buffer (42 mM KCl, 10 mM HEPES, pH 7.4, 5 mM MgCl2) for 15 min at 4°C. Cells were passed through a 30-gauge needle 10 times, follwed by centrifugation at 250 x g for 10 min to remove the nuclei and intact cells. The supernatant was centrifuged at 150,000 x g for 30 min at 4°C to separate the cytoplasm from the membrane fraction. For sucrose density gradient centrifugation, the membrane fraction was lysed for 1 h at 4°C in 1 ml of 1% Triton X-100, 10 mM Tris (pH 7.5), 150 mM NaCl, 5 mM EDTA, and a panel of protease inhibitors (Sigma, St. Louis, MO). The lysate was adjusted to 1.33 M sucrose by adding 1 ml of 85% sucrose in TNE buffer (10 mM Tris, pH 7.5, 150 mM NaCl, 5 mM EDTA). In a SW41 centrifuge tube, the lysate was overlaid with 7 ml of 30% and 3.5 ml of 5% sucrose in TNE buffer. The samples were centrifuged for 16–17 h at 38,000 rpm. After equilibrium centrifugation, the gradients were fractionated from the top by 1.5 ml volume.
Phosphatase activity assays
For assays that used p-nitrophenyl phosphate (pNpp) as the substrate, 50 µl of membrane suspension (OD600 = 6.0) was mixed with 50 µl of 2x assay buffer containing 100 mM pNpp, 100 mM 2-(N-morpholino)ethanesulfonic acid at pH 5.5, 10 mM DTT, 150 mM NaCl, and 2 mM EDTA and incubated at 25°C for 20 min. After centrifugation, the supernatant was transferred to cuvettes containing 0.9 ml of 1% NaOH for OD reading at 450 nm. For assays with T cell membrane as the substrate, the membrane fraction was first incubated with 1 mM vanadate at 4°C for 10 min to inhibit PTP activity. The membrane was then pelleted by centrifugation at 13,000 rpm for 10 min and washed twice with 1.5 ml of cold hypotonic buffer, and then adjusted to concentration of 6.0 OD reading at 600 nm wavelength. Fifty microliters of vanadate-treated membrane suspension was used as substrate in 100 µl of reaction mixture, which was incubated at 4°C for 10 min. One millimolar ATP was then added to the mixture for 3 min at 37°C. The membrane was precipitated by centrifugation at 13,000 rpm for 10 min and then solublized in NP-40 lysis buffer. The tyrosine phosphorylation of membrane proteins was determined by anti-pTyr (4G10) immunoprecipitation followed by anti-pTyr (RC20) immunoblotting. For assays with purified phosphatases, the Escherichia coli-overexpressed GST fusion proteins were purified by glutathione-Sepharose affinity column, and the activity was determined by pNpp assay with the enzyme unit of T cell PTP (New England Biolabs, Beverly, MA) as standard.
Construction, transfection, and stable expression of Lck/SHP-1 plasmid in Jurkat T cells
To construct Lck/SHP-1 fusion plasmid, PCR was performed with
human SHP-1 template with PCR primers
5'-ATGGGCTGTGGCTGCAGCTCACACCCGGAAGATGACTGGATGGAGACCCTGCTCAAGGGCCGAGGTGTC
(underlined 42 nucleotides are from the N terminus of Lck) and
5'-CTTCCTCTTGAGGGAACCCTTGCTCTTC. The PCR product was subcloned into
mammalian expression vector pEF1/Myc-His
(Invitrogen, Carlsbad, CA). To generate Lck/SHP-1 (
P), Lck/SHP-1 was
digested by BglII and EagI and religated by
blunt-end ligation, which removed a DNA fragment of 144 bp. Lck/SHP-1
(P) cDNA encodes a mutant SHP-1 protein with a 48-aa truncation from
residues 409–457. The sequence was confirmed by DNA sequencing. Five
micrograms of plasmids were transfected into Jurkat T cells (1 x
107/500 µl) by electroporation with the
settings of 800 µF, low ohm, and 250 V. The clones with stable
expression of Lck/SHP-1 or Lck/SHP-1 (P) were selected in medium
containing neomycin (G418) at 2.5 mg/ml.
Luciferase assays
Luciferase assay was conducted with dual-luciferase reporter
assay system (Promega, Madison, WI). Jurkat T cells (2 x
107) with stable expression of Lck/SHP-1 or
Lck/SHP-1 (P) were transiently transfected with 5 µg of
pNF-AT-Luciferase together with 1 µg of pRenilla-luciferase, and then
cultured in 25 ml of medium for 16–20 h. Cells were aliquoted into a
24-well plate to a density of 2 x 106 per
well in 500 µl of culture medium for subsequent stimulation. Cells
were either left unstimulated, stimulated with plate-bound CD3 plus PMA
(50 ng/ml), or stimulated with PMA plus 1 µM ionomycin. After 6–8 h,
cells were harvested and washed with 1 ml of PBS. Harvested cells were
lysed in 100 µl of lysis buffer provided by the manufacturer and
dual-luciferase activity was quantitated according to the
manufacturer’s instruction with a monolight luminometer (Analytical
Luminescence Laboratory, Ann Arbor, MI). Luciferase activity was
determined in triplicate for each experimental condition.
ELISA of IL-2 in supernatants
Anti-CD3 mAb (OKT3, 100 µl of 10 µg/ml) was immobilized on an enzyme immunoassay RIA 96-well Costar microtiter plate (Cambridge, MA) in sterile PBS overnight at 4°C. Wells were washed three times with PBS followed by the addition of 105 Jurkat T cells to wells containing PMA (Calbiochem, La Jolla, CA) or ionomycin (Calbiochem). After 24 h, supernatants were measured for IL-2 by standard ELISA techniques with paired capture and detection anti-IL-2 Abs (OptEIA; BD PharMingen, San Diego, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To date, the distribution of phosphatases in the cytoplasmic
membrane of T lymphocytes has not been fully characterized. Given our
knowledge of the importance of lipid rafts in the propagation of signal
transduction, we sought to identify the location of phosphatases in
relation to lipid microdomains. To this end, we segregated the plasma
membrane of Jurkat T cells into nine fractions with sucrose gradient
sedimentation, of which fractions 3 and 4 are enriched in lipid rafts
(insoluble in Triton X-100) and fractions 8 and 9 are derived from
outside the lipid rafts (soluble in Triton X-100; Fig. 1
). We first identified the position of
phosphatases by measuring PTP activities in each gradient fraction
(Fig. 1, middle and right). The results show that
PTP activity is essentially located in fractions 8 and 9, or outside
the lipid rafts. A likely candidate of membrane-associated phosphatase
would be CD45, a transmembrane PTP known to be excluded from lipid
rafts (21). To address this possibility, we compared the
total PTP activity in the plasma membrane of Jurkat T cells to its
mutant cell line (J45.01) lacking the expression of CD45. We found that
the membrane of J45.01 T cells still contained 40% of the PTPs
activity as compared with its parental cell line (Fig. 1, left). The phosphatases that remain in J45.01 T cells shared
a similar distribution of PTP activity as the parental Jurkat T cells
(Fig. 1, right). We conclude that the majority of CD45 and
other membrane-resident phosphatases are basically excluded from lipid
microdomains.
|
, CD5, leukocyte-associated Ig-like receptor-1, and
signal-regulatory proteins (SIRP or SHPS-1; Refs. 26, 35, 36, 37, 38, 39). In additional to CTLA-4, SHP-2 also has been shown to
associate with membrane anchor proteins such as SIRP or SHPS-1 and
Protein Zero Related (PZR) (40, 41). Given their
importance in regulating TCR signaling, we attempted to examine whether
SHP-1 and SHP-2 could be associated with cytoplasmic membrane. To
address this issue, Jurkat T cells were fractionated into cytosolic or
membrane fractions with or without vanadate, an inhibitor of PTPs known
to induce potent tyrosine phosphorylation (Fig. 2A, top). Our results indicate
that 5–10% of SHP-1 was associated with T cell membrane, and this
level increased after vanadate treatment. SHP-2 did not associate with
T cell membrane in basal state. However, after vanadate treatment,
nearly half of SHP-2 was recruited to the cell membrane. This
population of SHP-2 appeared to migrate at a higher position on
SDS-PAGE, which is probably because of tyrosine phosphorylation (Fig. 2A, bottom). Consistent with the distribution of
PTP activity in lipid microdomains, Fig. 2B shows that,
after vanadate treatment, the majority of SHP-1 and SHP-2 were present
in Triton X-100 soluble fractions 8 and 9 or outside the lipid rafts.
Of note, a small amount of SHP-2 was also detected in fraction
3.
|
, Lck, and LAT, which are enriched in lipid
rafts. As shown in Fig. 2
C, we found that SHP-1, SHP-2, and
CD45 PTPs were highly concentrated in fractions 8 and 9 or outside the
lipid rafts, whereas CD3, Lck and LAT were enriched in Triton
X-100-insoluble fractions 3 and 4. Stimulation by anti-CD3 Ab did
not alter the distribution of SHP-1. Likewise, SHP-2 was not found in
the plasma membrane until the cells were stimulated with anti-CD3
Ab. Although the distribution of Lck and LAT appeared unchanged
after stimulation, the amount of CD3 in lipid rafts (fractions 3
and 4) appeared to have increased slightly. All together, these results
indicate that SHP-1 and SHP-2 as well as CD45 phosphatases are excluded
from lipid rafts, and their distribution is consistent with the
location of bulk PTP activity (Fig. 1).
CD3-induced tyrosine phosphorylation of CD3 and CD3 was
detected predominantly in Triton X-100-insoluble lipid raft membrane
fractions
To investigate whether the restricted distribution of PTPs in
membrane subdomains could affect CD3-induced tyrosine phosphorylation
(pTyr), we analyzed the protein tyrosine phosphorylation in membrane
subdomains. As shown in Fig. 3A, CD3-induced tyrosine
phosphorylation of CD3 and CD3 was observed mainly in fractions
3, 4, and 5, which corresponded to materials derived from lipid
rafts. Tyrosine phosphorylation of CD3 and CD3 in fractions 8
or 9, where they colocalize with phosphatases, was only minimal.
However, Jurkat T cells treated with vanadate exhibited a remarkably
different pattern of tyrosine phosphorylation (Fig. 3B).
Proteins, including CD3 and CD3, were phosphorylated in virtually
all the membrane fractions, including those where phosphatases were
located (fraction 8 and 9). A relative high level of basal tyrosine
phosphorylation was observed in Fig. 3B. But basal
phosphorylation of CD3 and CD3 was consistently detected only in
lipid raft fractions as shown in Fig. 3A. These results
indicate that CD3-induced tyrosine phosphorylation may be restricted to
lipid rafts by phosphatases like SHP-1, SHP-2, and CD45.
Phosphorylation of substrates outside the lipid rafts may be suppressed
by the dominance of phosphatases.
|
To investigate whether SHP-1 and SHP-2 are involved in the
regulation of tyrosine phosphorylation in T cell membrane, we compared
the relative efficiencies of SHP-1, SHP-2, and CD45 phosphatases in
inhibiting protein tyrosine phosphorylation. As shown in Fig. 4A, both purified SHP-1 and
SHP-2 could quantitatively block the overall protein tyrosine
phosphorylation in T cell membrane. The effect of purified SHP-1,
SHP-2, and CD45 on substrate dephosphorylation were further compared in
a time course (Fig. 4B). We observed that both SHP-1 and
SHP-2 dephosphorylated proteins within 5 min of incubation. In
comparison, CD45 was less effective at the same catalytic units, as the
dephosphorylation of proteins was less apparent even after 10
min.
|
If perpetual exclusion of PTPs from lipid microdomains is
necessary to protect phosphorylated molecules from phosphatases, the
presence of PTPs in lipid rafts may diminish CD3-induced tyrosine
phosphorylation and T cell activation. To test this hypothesis, we
targeted SHP-1 phosphatase into lipid microdomains by using the
N-terminal region of Lck, which contains sites of palmitoylation known
for anchoring proteins to lipid rafts (42, 43). Lck/SHP-1
chimeric molecule was constructed by fusion of the 14-aa N-terminal of
Lck to a full-length SHP-1 phosphatase (Fig. 5A). The control fusion
molecule was made with a catalytically inactive SHP-1 (P), which has
a 48-aa deletion in the PTP domain. These constructs were stably
expressed as C-terminal Myc-tagged proteins in Jurkat T cells. To
control for the expression of Lck/SHP-1and Lck/SHP-1 (P), cell lines
were selected based on equivalent levels of anti-Myc
immunoblotting. Fig. 5B shows the expression and subcellular
distribution of Lck/SHP-1 and Lck/SHP-1 (P) molecules in Jurkat T
cell lines. The top band detected by both anti-SHP-1 and
anti-Myc Ab is Lck/SHP-1, which is 24 aa longer than the endogenous
SHP-1 (middle band). The bottom band is Lck/SHP-1(P), which is 24 aa
shorter than the endogenous SHP-1. In contrast to endogenous SHP-1,
most of which were cytosolic, more of the overexpressed Lck/SHP-1 and
Lck/SHP-1 (P) were detected in the membrane. More importantly, both
Lck/SHP-1and Lck/SHP-1(P) were enriched in lipid rafts whereas the
patterns of membrane distribution of CD3, Lck, and LAT were
basically not altered and resemble that as seen in wild-type Jurkat T
cells (Figs. 3 and 5C). Therefore, the 14-aa N-terminal of
Lck is sufficient for targeting SHP-1 into lipid microdomains.
|
To examine the effects of targeting SHP-1 into lipid microdomains,
Jurkat T cells expressing Lck/SHP-1 were stimulated with anti-CD3
Ab to induce tyrosine phosphorylation. As shown in Fig. 6, Jurkat T cells that expressed
Lck/SHP-1 chimeric molecules were refractory to CD3-induced tyrosine
phosphorylation of CD3 and CD3 in the lipid raft fraction.
However, in Jurkat T cells expressing the mutant Lck/SHP-1(P)
construct, tyrosine phosphorylation of CD3 and CD3 appeared
similar to that detected in wild-type Jurkat T cells. The inhibition of
CD3-induced phosphorylation is dependent on the catalytic domain of
SHP-1 phosphatase, and the mechanism of inhibition is not attributable
to simple displacement of endogenous Lck from lipid rafts.
|
demonstrated that the
presence of Lck/SHP-1 in lipid rafts inhibited profoundly the
mobilization of NF-AT and IL-2 generation after stimulation with OKT3
plus PMA (left panel). This inhibition is again
dependent on an intact catalytic domain of SHP-1, as cells expressing
Lck/SHP-1 (P) were largely not inhibited from activating
NF-AT-mediated transcription and IL-2 generation (Fig. 7, left). The proximal events of TCR-induced activation can be
bypassed with PMA plus ionomycin. Accordingly, we showed that PMA plus
ionomycin could circumvent the defect seen in Jurakat T cells
transfected with Lck/SHP-1; thus, the inhibition imposed by Lck/SHP-1
lies upstream of Ras/mitogen-activated protein kinase pathways. Taken
together, by allowing phosphatases to enter lipid rafts, the
physiological boundary imposed by lipid microdomains is disrupted, and
the cells are no longer capable of responding to agonist ligands.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Previously, CD45, an abundant
transmembrane receptor-like PTP, was shown to be excluded from lipid
rafts (21). Here, we provide evidence showing that
membrane-associated population of SHP-1 and SHP-2 are also excluded
from lipid rafts (Fig. 2). Because SHP-1 and SHP-2 are more potent than
CD45 in the inhibition of protein tyrosine phosphorylation (Fig. 4),
this observation suggests that exclusion of SHP-1and SHP-2 from lipid
rafts may be important for the initiation of TCR activation.
Aggregated lipid rafts may provide the molecular basis for segregating
PTPs from PTKs. In resting state, various molecules involved in T cell
activation are sequestered among the small and discrete clusters of
lipid rafts. In this physical state, phosphatases like SHP-1 and CD45
can readily dominate and interfere with the initiation of protein
tyrosine phosphorylation. However, when lipid rafts are aggregated by
receptor cross-linking or when concentrated in a specific contact area
between T cells and APCs, a large patch of the membrane formed by the
coalescence of smaller clusters of lipid rafts may bring together
molecules like CD3, Lck, and LAT and expel PTPs from the contact
area. Aggregated lipid rafts may impose a physical barrier that further
distances phosphatases from their potential substrates, thus creating
an environment within lipid rafts that would favor unrestrained kinase
activity. Therefore, our finding reinforced the notion that exclusion
of PTPs from T cell activation domain or segregation of PTPs from
receptor/PTKs complexes by lipid rafts may potentiate the initiation of
receptor tyrosine phosphorylation. This is supported by our results
demonstrating that CD3-induced tyrosine phosphorylation of CD3 is
largely restricted to lipid rafts (Fig. 3).
Our observations indicate that a fraction of SHP-1 was constitutively
associated with T cell membrane. The molecular basis for this
association is currently unclear. A plausible explanation would be the
association between Src homology 2 domains of SHP-1 and
tyrosine-phosphorylated residues of transmembrane receptors or anchors,
such as the recently identified leukocyte-associated Ig-like receptor-1
and SHPS-1 (38, 39). This would be consistent with the
increased association of SHP-1 with plasma membrane of vanadate-treated
cells (Fig. 2A). SHP-1 in untreated cells could be
associated with transmembrane receptors that have a low level of basal
phosphorylation.
The association of SHP-2 with T cell membrane is dependent on vanadate
or anti-CD3 stimulation. Several transmembrane proteins, such as
CTLA-4, SIRP (SHPS-1), and PZR contain the immunoreceptor
tyrosine-based inhibitory motifs that are potential membrane anchors
for SHP-2 (31, 32, 33, 40, 41). It is interesting, though,
that a small but significant amount of SHP-2 was detected in lipid
rafts on T cell stimulation (Fig. 2). This could be mediated by the
association of Grb2 with SHP-2, because Grb2 has been shown to enter
lipid rafts upon phosphorylation (20). SHP-2 is so far the
only PTPs shown to translocate into lipid rafts on T cell activation,
and the biological significance of this observation warrants further
studies.
To address the biological significance of PTP exclusion from lipid
rafts, we targeted SHP-1 into lipid rafts by using the 14-aa N-terminal
of Lck, which contains a lipid rafts targeting motif (Fig. 5). Our
results indicate that the presence of Lck/SHP-1 in lipid rafts
inhibited CD3-induced tyrosine phosphorylation of CD3, as well as
IL-2 generation and NF-AT-mediated transcriptional activation (Figs. 6 and 7). As reported previously, overexpression of the wild-type SHP-1
in Jurkat T cells did not affect T cell function; thus, it is unlikely
that the increased phosphatase activity of Lck/SHP-1 alone is
responsible for the inhibition (35). Also, by using the
14-aa N-terminal of Lck as a targeting strategy did not result in the
displacement of endogenous Lck from lipid rafts, as the control
Lck/SHP-1 (P) chimera did not inhibit CD3-induced signaling.
Therefore, we surmise that the Lck/SHP-1 chimeric molecule was able to
breach the physical barrier imposed by lipid rafts, gaining access to
the potential substrates that otherwise would not be available.
Collectively, our results strongly support the notion that
phosphatases, such as SHP-1, SHP-2, and CD45, are normally excluded
from lipid rafts, and their restricted distribution may serve a unique
function in regulating T cell activation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Abbreviations used in this paper: LAT, linker for activation of T cells; PTP, protein tyrosine phosphatase; PTK, protein tyrosine kinase; anti-pTyr: anti-phosphotyrosine Ab; NP-40 Nonidet P-40; pNpp, p-nitrophenyl phosphate; SHP, Src homology protein 2 domain-containing tyrosine phosphatase; SIRP or SHPS-1, signal-regulatory proteins.
Received for publication September 19, 2000. Accepted for publication January 5, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-chain is associated with a tyrosine kinase and upon T-cell antigen receptor stimulation associates with ZAP-70, a 70-kDa tyrosine phosphoprotein. Proc. Natl. Acad. Sci. USA 88:9166. chain. Cell 71:649.[Medline]
-chain. Biochem. Biophys. Acta 222:50.
This article has been cited by other articles:
|
|
 |
|
  Z. Chen, L. Chen, S.-W. Qiao, T. Nagaishi, and R. S. Blumberg Carcinoembryonic Antigen-Related Cell Adhesion Molecule 1 Inhibits Proximal TCR Signaling by Targeting ZAP-70 J. Immunol., May 1, 2008; 180(9): 6085 - 6093. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Adam, N. K. Mukhopadhyay, J. Kim, D. Di Vizio, B. Cinar, K. Boucher, K. R. Solomon, and M. R. Freeman Cholesterol Sensitivity of Endogenous and Myristoylated Akt Cancer Res., July 1, 2007; 67(13): 6238 - 6246. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sankarshanan, Z. Ma, T. Iype, and U. Lorenz Identification of a Novel Lipid Raft-Targeting Motif in Src Homology 2-Containing Phosphatase 1 J. Immunol., July 1, 2007; 179(1): 483 - 490. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Y. Kim, S. J. Park, E.-h. Joe, and I. Jou Raft-mediated Src Homology 2 Domain-containing Proteintyrosine Phosphatase 2 (SHP-2) Regulation in Microglia J. Biol. Chem., April 28, 2006; 281(17): 11872 - 11878. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Matallanas, V. Sanz-Moreno, I. Arozarena, F. Calvo, L. Agudo-Ibanez, E. Santos, M. T. Berciano, and P. Crespo Distinct Utilization of Effectors and Biological Outcomes Resulting from Site-Specific Ras Activation: Ras Functions in Lipid Rafts and Golgi Complex Are Dispensable for Proliferation and Transformation Mol. Cell. Biol., January 1, 2006; 26(1): 100 - 116. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Xiao, H. Nishimoto, H. Hong, J. Kitaura, S. Nunomura, M. Maeda-Yamamoto, Y. Kawakami, C. A. Lowell, C. Ra, and T. Kawakami Positive and Negative Regulation of Mast Cell Activation by Lyn via the Fc{epsilon}RI J. Immunol., November 15, 2005; 175(10): 6885 - 6892. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. C. J. Fawcett and U. Lorenz Localization of Src Homology 2 Domain-Containing Phosphatase 1 (SHP-1) to Lipid Rafts in T Lymphocytes: Functional Implications and a Role for the SHP-1 Carboxyl Terminus J. Immunol., March 1, 2005; 174(5): 2849 - 2859. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Young, X. Zheng, D. Holowka, and B. Baird Reconstitution of Regulated Phosphorylation of Fc{epsilon}RI by a Lipid Raft-excluded Protein-tyrosine Phosphatase J. Biol. Chem., January 14, 2005; 280(2): 1230 - 1235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. M. Vyas, H. Maniar, C. E. Lyddane, M. Sadelain, and B. Dupont Ligand Binding to Inhibitory Killer Cell Ig-Like Receptors Induce Colocalization with Src Homology Domain 2-Containing Protein Tyrosine Phosphatase 1 and Interruption of Ongoing Activation Signals J. Immunol., August 1, 2004; 173(3): 1571 - 1578. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Y. Kim, E. J. Park, E.-h. Joe, and I. Jou Curcumin Suppresses Janus Kinase-STAT Inflammatory Signaling through Activation of Src Homology 2 Domain-Containing Tyrosine Phosphatase 2 in Brain Microglia J. Immunol., December 1, 2003; 171(11): 6072 - 6079. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. E. Kilgore, J. D. Carter, U. Lorenz, and B. D. Evavold Cutting Edge: Dependence of TCR Antagonism on Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Activity J. Immunol., May 15, 2003; 170(10): 4891 - 4895. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-i. Yusa and K. S. Campbell Src Homology Region 2-Containing Protein Tyrosine Phosphatase-2 (SHP-2) Can Play a Direct Role in the Inhibitory Function of Killer Cell Ig-Like Receptors in Human NK Cells J. Immunol., May 1, 2003; 170(9): 4539 - 4547. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Z. Fernandis, R. P. Cherla, and R. K. Ganju Differential Regulation of CXCR4-mediated T-cell Chemotaxis and Mitogen-activated Protein Kinase Activation by the Membrane Tyrosine Phosphatase, CD45 J. Biol. Chem., March 7, 2003; 278(11): 9536 - 9543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Fragoso, D. Ren, X. Zhang, M. W.-C. Su, S. J. Burakoff, and Y.-J. Jin Lipid Raft Distribution of CD4 Depends on its Palmitoylation and Association with Lck, and Evidence for CD4-Induced Lipid Raft Aggregation as an Additional Mechanism to Enhance CD3 Signaling J. Immunol., January 15, 2003; 170(2): 913 - 921. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ostrovidov, L. M. Howard, M. Ikeda, A. Ikeda, and C. Waltenbaugh Restoration of ethanol-compromised Th1 responses by sodium orthovanadate Int. Immunol., November 1, 2002; 14(11): 1239 - 1245. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Guerra, F. Michel, A. Gati, C. Gaudin, Z. Mishal, B. Escudier, O. Acuto, S. Chouaib, and A. Caignard Engagement of the inhibitory receptor CD158a interrupts TCR signaling, preventing dynamic membrane reorganization in CTL/tumor cell interaction Blood, September 26, 2002; 100(8): 2874 - 2881. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Guntermann and D. R. Alexander CTLA-4 Suppresses Proximal TCR Signaling in Resting Human CD4+ T Cells by Inhibiting ZAP-70 Tyr319 Phosphorylation: A Potential Role for Tyrosine Phosphatases J. Immunol., May 1, 2002; 168(9): 4420 - 4429. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Alonso and J. Millan The role of lipid rafts in signalling and membrane trafficking in T lymphocytes J. Cell Sci., March 13, 2002; 114(22): 3957 - 3965. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Y. Hawash, K. P. Kesavan, A. I. Magee, R. L. Geahlen, and M. L. Harrison The Lck SH3 Domain Negatively Regulates Localization to Lipid Rafts through an Interaction with c-Cbl J. Biol. Chem., February 8, 2002; 277(7): 5683 - 5691. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. M. Vyas, K. M. Mehta, M. Morgan, H. Maniar, L. Butros, S. Jung, J. K. Burkhardt, and B. Dupont Spatial Organization of Signal Transduction Molecules in the NK Cell Immune Synapses During MHC Class I-Regulated Noncytolytic and Cytolytic Interactions J. Immunol., October 15, 2001; 167(8): 4358 - 4367. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
