| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Mig) and Chemokine Responsive to -2 (Crg-2)1
*
Laboratory of Experimental Immunology, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD 21702;
IRSP, Science Applications International Corporation, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD 21702;
Pediatric Oncology Branch, National Institutes of Health, Bethesda, MD;
Greenbaum Cancer Center, University of Maryland Medical School, Baltimore, MD; and
¶ Laboratory of Molecular Immunoregulation, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD 21702
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-inducible proteins monokine induced by IFN- (Mig)
and chemokine responsive to -2 (Crg-2) can contribute to
IL-12-induced antiangiogenic and leukocyte-recruiting activities, but
the extent to which leukocytes vs parenchymal cells in different organs
contribute to the production of these molecules remains unclear. The
results presented herein show that IFN--dependent induction of Mig
and Crg-2 gene expression can occur in many nonlymphoid organs, and
these genes are rapidly induced in purified hepatocytes isolated from
mice treated with IL-2 plus IL-12, or from Hepa 1-6 hepatoma cells
treated in vitro with IFN-. In addition to depending on IFN-, the
ability of IL-12 or IL-2/IL-12 to induce Mig and Crg-2 gene expression
in purified hepatocytes also is accompanied by the coordinate
up-regulation of the IFN- R 
and 
-chains, in the absence of
IL-12R components. Supernatants of primary hepatocytes obtained from
mice treated in vivo with IL-2/IL-12 or from hepatocytes treated in
vitro with IFN- contain increased chemotactic activity for enriched
human and mouse CD3+ T cells, as well as mouse
DX5+ NK cells. The hepatocyte-derived chemotactic activity
for mouse T cells but not NK cells was ablated by Abs specific for Mig
and Crg-2. These results suggest that parenchymal cells in some organs
may contribute substantially to initiation and/or amplification of
inflammatory or antitumor responses. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(Mig)4 and the mouse
homolog of IFN-inducible protein-10 (IP-10, otherwise termed chemokine
responsive to -2; Crg-2) that are active as chemotactic factors for
stimulated T cells (10, 11, 12, 13). These chemokines have been
reported to promote damage to established tumor vasculature, cause
tumor necrosis (14, 15), and contribute to the antitumor
activities of IL-12 (16). Recent studies from our
laboratory have demonstrated that the combination of IL-2 and IL-12
yields enhanced therapeutic efficacy in a variety of murine tumor
models (17) in association with increased local expression
of the Mig and Crg-2 genes (34).
The most important intermediate cytokine for induction of Mig and Crg-2
by IL-12 is IFN-, and leukocytes, some nonleukocytes, and tumor
cells can all produce Mig and Crg-2 (12, 13, 18). We have
demonstrated that both Mig and Crg-2 gene expression can be induced in
several nonlymphoid organs by administration of IL-12 or IL-2/IL-12 to
mice. These results raise the issue of whether all of the observed gene
expression in nonlymphoid organs can be attributed to resident tissue
macrophages and transient blood monocytes and lymphocytes, or whether
parenchymal cells (PC) also contribute substantially to this effect. If
PC can be induced to produce functional proteins that contribute to
leukocyte recruitment, then these cells may represent an important
innate immune component for initiating or sustaining biological
activities vital to the success of cytokine therapy or may contribute
to pathogenic inflammatory responses in nonlymphoid organs. In this
report, we use the liver as a model to demonstrate that hepatocytes can
produce chemotactic activity for mouse T cells that is dependent on Mig
and Crg-2 as well as chemotactic activity for NK cells that is
independent of Mig and Crg-2.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Normal male BALB/c mice were obtained from the Animal Production
Area, Harlan Sprague-Dawley at National Cancer Institute-Frederick
Cancer Research and Development Center (Frederick, MD), and
IFN--/- knockout mice were obtained from our
own specific pathogen-free breeding colony that was initiated from mice
kindly donated by Dyana Dalton (Hoffman-LaRoche, Nutley, NJ). The mice
were used at 8–10 wk of age. Animal care was provided in accordance
with procedures outlined in the "Guide for the Care and Use of
Laboratory Animals" (National Institutes of Health publication no.
86-23, 1985).
Reagents
Recombinant murine IL-12 (specific activity, 2.7 x
106 U/mg) and IL-2 (16 x
106 IU/mg) were generously provided by Genetics
Institute (Cambridge, MA) and Chiron Corporation (Emeryville, CA),
respectively. Recombinant mouse (rm)IFN- was kindly provided by
Genentech (South San Francisco, CA).
In vivo cytokine administration
Chemokine gene expression was induced in vivo by using
IL-12, IL-2, or the combination of IL-2/IL-12, which has been shown
previously to induce complete regression of the Renca murine renal
carcinoma in mice (17). Mice were given 300,000 IU IL-2
(or HBSS plus syngeneic normal mouse serum) i.p. on day 0, and IL-12
(0.5 µg) or PBS plus mouse serum was administered by daily i.p.
injection on days 0–3. Groups of mice were euthanized for analyses on
days 1, 4, and 11. In some studies, mice were treated i.p. and i.v.
with 50,000 U rmIFN- on days 0–3 and tissues were harvested on
day 4.
Isolation of PC and nonparenchymal cells (NPC) from the liver
PC were prepared by a modification of the method described
previously by Kedderis and Held (19). Briefly, after
CO2 inhalation and cervical dislocation, mice
were perfused with EGTA solution at 37°C (flow rate, 5 ml/min) for 8
min followed by a 0.33% collagenase solution for 10–12 min. The
perfused livers were then dissociated by mild agitation, and the
recovered cell suspension was passed through a 100-µm nylon filter
and centrifuged at 50 x g for 60 s. The cell
pellet was gently resuspended in ice-cold William’s media E, mixed
with 45% Percoll (Pharmacia LKB Biotechnology, Uppsala, Sweden) and
centrifuged again at 50 x g for 8 min. The viable PC,
which pellet at the bottom, were resuspended in cold William’s media E
and washed twice. These PC preparations then were stained with trypan
blue. Microscopic and flow cytometric analyses confirmed these
preparations to be >90% hepatocytes. Purified PC were kept ice cold
until used for RT-PCR analyses, or overnight culture in William’s
media E plus 5% FBS. Where indicated, the hepatocyte cultures also
included 200 U/ml rmIFN-. NPC containing lymphocytes, Kupffer cells,
and endothelial cells were obtained by using a 30% metrizamide
(Accurate Chemical and Scientific, Westbury, NY) gradient technique as
described previously (20). The final preparation contains
varying numbers of T, NK, or NK/T cells, and Kupffer cells, depending
on the nature of preceding in vivo treatments.
Hepa 1-6 cell culture
The Hepa 1-6 cell line (obtained from the American Type Culture
Collection, Mannassas, VA) was cultured in DMEM containing 10% FBS.
For the induction of Mig and Crg-2 gene expression, cells were treated
with 200 U/ml rmIFN- for 2, 6, and 24 h, harvested in Trizol
solution, and then used for RT-PCR analyses.
RT-PCR
For the analysis of gene expression in various tissues and cells, total cellular RNA was isolated from snap-frozen tissue specimens and cultured cells by the Trizol method (Life Technologies, Gaithersburg, MD). Reverse transcription was performed in a 50-µl reaction mixture containing 50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 250 µM dATP, 250 µM dCTP, 250 µM dTTP, 250 µM dGTP, 0.75 U/µl RNase inhibitor, 5 U/µl Moloney murine leukemia virus reverse transcriptase, 2.5 µM oligo(dT) primer, and 10 µg denatured RNA. The reverse transcription reaction mixture was incubated at 42°C for 60 min at 95°C for 5 min and then stored at -20°C until further use. The PCR was performed in a 25-µl reaction mixture containing 10 mM tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 200 µM dATP, 200 µM dCTP, 200 µM dTTP, 200 µM dGTP, 0.6 U Taq DNA polymerase, 0.5 mM sense primer, 0.5 µM sense primer, 0.5 58 M anti-sense primer, and 2.5 µl of the products of the reverse transcription reaction. Amplification was performed in a thermocycler (Gene Amp PCR System 2400, Perkin-Elmer, Cetus, Norwalk, CT) as follows: 94°C for 3 min (1 cycle), 94°C for 30 s, 56–57°C for 1 min, 72°C for 45 s (optimized at between 20–28 cycles depending on the primer pair and tissue source used); and 72°C for 5 min (1 cycle). The sequence of primer pairs for the respective genes evaluated in these studies was for G3PDH: sense, GCCACCCAGAAGACTGTGGATGGC; antisense, CATGTAGGCCATGAGGTCCACCAC; for MIG: sense; GATCAAACCTGCCTAGATCC; antisense, GGCTGTGTAGAACACAGAGT; and for IP-10: sense, ACCATGAACCCAAGTGCTGCCGTC; antisense, GCTTCACTCCAGTTAAGGAGCCCT.
PCR products were then separated on 1% agarose gels impregnated with 0.5 µg/ml ethidium bromide. Density of the DNA band was measured by using the image PC program and relative intensity was calculated by following formula; relative intensity = density of target DNA band/density of G3PDH DNA band.
RNase protection assays (RPA)
Total RNA from PC was isolated by using Trizol reagent (Life
Technologies). RPA were performed by using RiboQuant Transcription and
RPA kit (BD PharMingen, San Diego, CA) according to the manufacturer’s
instructions with the exception that the Multiprobe templates (BD
Phar-Mingen) and Mig probes were purified with a Tris-EDTA micro
select G25 spin column (5 Prime
3 Prime, Boulder, CO). The mouse Mig
416 probe was prepared by PCR cloning of Mig fragment into TOPO vector
(Invitrogen) using the following primer pairs: Mig: sense,
5'-GAAGTCCGCTGTTCTTTTCC; antisense, 5'-GATTCAGGGTGCTTGTTGGT.
The protected bands were separated on a 5% sequencing gel (National Diagnostics) and analyzed using a Beckman Phosphor imager (Beckman Coulter, Fullerton, CA).
Intracellular cytokine analysis
Purified liver leukocytes were washed in PBS plus 0.5% BSA and
counted. Intracellular labeling was performed by adding 1 x
106 cells per well using a 96-well round-bottom
micro titer plate. The wells were sealed with tape, the cells were
pelleted at 400 x g for 2 min at 4°C, and the
supernatant was removed by aspiration. Cells then were resuspended in
50 µl/well PBS followed by addition of 50 µl/well of 8%
paraformaldehyde in PBS to fix the cells. Then, the cells were
incubated at 37°C for 5 min and pelleted, the supernatants were
removed, and the fixed cells were washed in PBS plus 0.1%
BSA, and permeablized by a wash in staining buffer (0.1% BSA + 0.01 M
HEPES plus 0.1% saponin in PBS). The supernatant was removed from the
pelleted cells and 10 µl of optimally titered anti-mouse IFN-
(clone XMG1.2 BD, BD PharMingen) diluted in HBSS plus 0.1% BSA plus
NaN3 was added per well to detect intracellular
IFN-. The wells were taped, the cells were mixed by manual shaking,
incubated at 4°C for 15 min, and centrifuged at 400 x
g for 2 min at 4°C. The supernatant was aspirated, the
cells were washed twice in staining buffer, resuspended in HBSS plus
0.1% BSA plus NaN3, and transferred to 12
x 75-mm polystyrene test tubes. Cells (10,000) were analyzed for the
percentage of cells bearing mouse IFN- by using a FACScan flow
cytometer affixed with a 488-nm laser (Becton Dickinson, Mountain View,
CA). Isotype-matched controls were used to quantitate nonspecific
background binding that was subtracted from all results.
Purification of CD3+ T cells or DX5+ NK cells
T and NK cells were obtained for use as responders in microchemotaxis assays as follows: mouse and human T cells were purified by using negative-selection T cell enrichment columns (R&D Systems, Minneapolis, MN) as recommended by the manufacturer. For human T cells, the starting population was Ficoll-Hypaque-separated PBL, and spleen cell preparations were the source for mouse T cells. The purity of human and mouse CD3+ cell preparations as confirmed by flow cytometry was routinely >95%. Enriched mouse NK cells were obtained from spleen cell preparations as described previously (21). The resulting preparation routinely contained >75% DX5+, CD3- NK cells as assessed by flow cytometry. Enriched mouse T or NK cells were cultured for 7 days in 50 U/ml IL-2 and then were used as responders in the microchemotaxis assay described below.
In vitro chemotaxis assay
T or NK cell migration was assessed by a 48-well microchemotaxis chamber technique. A 25-µl aliquot of hepatocyte supernatant diluted in chemotaxis medium (RPMI 1640 with 1% BSA) was placed in the lower compartment and 50 µl of enriched T or NK cell suspensions (5 x 106 cells/ml) were placed in the upper compartment of the chamber. The two compartments were separated by a polycarbonate filter (5-µm pore size; Nucleopore, Pleasanton, CA) coated with 10 µg/ml fibronectin (Sigma, St. Louis, MO) via incubation at 4°C overnight or at 37°C for 2 h. The chamber was incubated at 37°C for 3 h in humidified air with 5% CO2. At the end of the incubation period, the nonmigrating cells were removed from the filter that was then fixed and stained with Diff-Quik (Harleco, Gibbstown, NJ). The number of migrated cells in three high-power fields (x400) was counted by light microscopy after coding the samples. From the mean (± SD) value of the migration in triplicate samples, the results are expressed as chemotaxis index calculated by the following formula: chemotaxis index = migration in response to chemokine/migration to control medium. For Ab neutralization, the supernatants were treated with anti-mCrg-2, anti-mMig, or a combination of the two Abs at 50 µg/ml each for 30 min at 37°C before chemotaxis assays. The significance of the differences in cell migration between test and control groups was compared by Student’s t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-dependent induction of Mig and Crg-2 genes by IL-12 ±
IL-2 in vivo
Initial studies demonstrated by RT-PCR analysis that IL-12 or
IL-2/IL-12 efficiently induced expression of both the Mig and Crg-2
genes in various organs within 24 h, with maximal expression in
this setting for 4 days and enhanced gene expression still evident on
day 11, whereas IL-2 alone was relatively ineffective in inducing the
expression of either gene at any time point (Fig. 1
A). Densitometric analysis of
the intensity of the induced bands (Fig. 1B) suggested that
the IL-2/IL-12 regimen was more efficient for inducing the expression
of both of these genes by day 1 than was IL-12 alone, and therefore the
IL-2/IL-12 regimen was selected for further study. Because both Mig and
Crg-2 are known to be IFN--inducible genes (12) and the
IL-2/IL-12 regimen enhances the expression of IFN-
(34), studies were performed to determine whether IFN-
administration could substitute for IL-2/IL-12 for the induction of Mig
and Crg-2 gene expression in parenchymal tissue sites. The data
presented in Fig. 2 demonstrates that the
daily administration of 50,000 U rmIFN- for 4 days clearly induced
expression of both genes in the spleen, liver, and lung, with minimal
induction of these genes also seen in the kidney. Based on these
results, we speculated that at least some of the Mig and Crg-2 gene
induction by IL-2/IL-12 was IFN- dependent and the studies presented
in Fig. 3 were designed to investigate
this issue. In this experiment, IL-2/IL-12 was injected into wild-type
and IFN--/- mice and gene expression was
assessed on day 4. The results show that IL-2/IL-12 induced expression
of both Mig and Crg-2 genes in wild-type mice but not in
IFN--/- mice. These data demonstrate that
all of the gene expression for IL-2/IL-12 in these organs is IFN-
dependent, irrespective of whether it may occur in tissue-associated
leukocytes or PC.
|
|
|
The results shown in
Figs. 1–3
demonstrate that administration of
IL-2 ± IL-12 induced Mig and Crg-2 gene expression in a variety
of nonlymphoid organs, and that this induction occurs via an
IFN--dependent mechanism. However, it is unclear to what extent
transiting or resident leukocytes (such as macrophages) vs tissue PC
may contribute to this gene expression, and ultimately to the
biological effects induced IL-2 ± IL-12. Therefore, the liver was
used as a model organ to study induction of the Mig and Crg-2 genes in
highly purified PC (>90% hepatocytes) and NPC (>94% leukocytes and
endothelial cells). RT-PCR analyses showed that IL-2/IL-12 induced both
Mig and Crg-2 gene expression at day 4 in PC as well as NPC (Fig. 4A) and subsequent RPA
analyses confirmed this finding in PC (Fig. 4B). It should
be noted that low levels of Mig and Crg-2 gene expression can sometimes
be observed by RT-PCR analysis in unstimulated hepatocytes. In such
cases, as shown in Fig. 4A, the levels of expression can
fall below detection by RPA (Fig. 4B), suggesting that
expression of these genes in unstimulated hepatocytes is generally
minimal. To further confirm the ability of hepatocyte-lineage cells to
express the Mig and Crg-2 genes, the hepatoma line (Hepa 1-6) was
treated with 100 U/ml IFN- for 2, 6, and 24 h, and RT-PCR
analysis showed that the Mig and Crg-2 genes also were rapidly
up-regulated in these cells (Fig. 4C). Thus, both PC and
PC-derived cell lines can be induced to express the Mig and Crg-2 genes
in response to IL-2/IL-12 treatment in vivo or by exposure to IFN-
in vitro, suggesting that the up-regulation of these chemokine genes in
PC could contribute to local cytokine-induced inflammatory and
antitumor effects.
|
and expression of TH1
cytokine receptors on purified hepatocytes
The data presented above demonstrates that the induction of the
Mig and Crg-2 chemokine genes in lymphoid and nonlymphoid tissues by
IL-2/IL-12 is critically dependent on induction of IFN- gene
expression (Fig. 3) and that direct administration of IFN- also
induces a similar pattern of expression of these genes in vivo (Fig. 2). We speculated that these IFN--dependent effects on
hepatocyte-derived Mig and Crg-2 could simply result from increased
production of the ligand (IFN-) that is clearly required (Fig. 3),
or that the effects of increased levels of IFN- could be further
magnified by a coordinate induction of IFN-R components on the
hepatocytes. Increased local production of IFN- was detected by day
2 in NPC isolated from mice treated with IL-2/IL-12 (Fig. 5). Intracellular staining of NPC with an
Ab specific for mouse IFN- revealed a 3-fold increase in the
percentage of liver-associated leukocytes synthesizing IFN-. These
results formally document an enhanced local production of the IFN-
ligand in the liver. In conjunction with these studies, RPA analysis of
TH1 cytokine receptor expression presented in
Fig. 6 demonstrates that the genes for
both the - and -chains of the IFN-R are constitutively
expressed in freshly isolated hepatocytes, and expression of both
chains is further increased by in vivo administration of IL-12 alone
and even more so by IL-2/IL-12. In contrast, expression of genes
encoding the respective components of the IL-2 or IL-12 receptors was
not detected in these hepatocyte preparations. Therefore, this data
suggests that the IL-2/IL-12-induced IFN--dependent increase in Mig
and Crg-2 gene expression by hepatocytes results exclusively from
induction of IFN- and not from direct stimulation of hepatocytes by
IL-2 or IL-12. Furthermore, this effect may be potentiated by
concurrent increases in the expression of the IFN-R on hepatocytes.
In addition, there is very strong induction of the gene for the p55
chain of the TNFR by IL-2 ± IL-12. Because TNF- has been
reported to synergize with IFN- for CXC chemokine induction in human
liver (22), it is possible that modulation of TNFR
components also may contribute to enhanced expression of the Mig and
Crg-2 genes.
|
|
The data presented above demonstrates that administration of
IL-2/IL-12 can rapidly enhance expression of the Crg-2 and Mig genes in
hepatocytes, suggesting that stimulated hepatocytes might produce
functional chemotactic activity for activated T cells. To test this
hypothesis, purified hepatocytes from normal mice or mice treated with
IL-2/IL-12 were cultured in media or 200 U/ml rmIFN- for 24 h,
and supernatants were tested in vitro for their ability to chemoattract
purified, IL-2-activated human CD3+ T cells that
were placed in the upper compartments. The results of these studies
demonstrated that culture supernatants from hepatocytes obtained from
IL-2/IL-12-treated mice did induce significant chemotactic activity for
these purified CD3+ T cells (Fig. 7). Supernatants from hepatocytes of
untreated mice did not contain detectable chemotactic activity unless
they were pretreated in vitro with 200 U/ml IFN-. The level of
chemotactic activity produced by IL-2/IL-12-derived hepatocytes was
equivalent to that exhibited by 1 ng/ml of recombinant human IP-10.
|
confirmed the presence of T cell
chemoattractant activity in the supernatants of hepatocytes obtained
from mice treated with IL-2/IL-12 but did not specifically address the
role of Crg-2 or Mig protein in this process. Therefore, the study
shown in Fig. 7, with mouse T lymphocytes and/or enriched NK cells was
performed to define the role of Mig or Crg-2 in hepatocyte-derived
chemotactic activity. Both highly purified IL-2-activated
CD3+ T cells (Fig. 8A) or enriched
DX5+ NK cells (Fig. 8B) were
chemoattracted to supernatants derived from appropriately induced
hepatocytes. Specifically, the in vivo treatment of mice with
IL-2/IL-12 or in vitro treatment of hepatocytes from normal mice with
IFN- was able to induce the production of chemoattractant activity
for these purified T cells, and in vitro treatment of normal
hepatocytes with IFN- was also able to induce chemoattractant
activity for DX5+ NK cells. The
hepatocyte-derived chemoattractant activity for mouse
CD3+ T cells was partially neutralized by Abs
specific for Crg-2 (p < 0.05) or Mig and
totally ablated by a combination of both Abs. Interestingly, the
IFN--induced, hepatocyte-derived chemotactic activity for purified
IL-2-activated NK cells (Fig. 7B) was not significantly
reduced by treatment with these Abs.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and the IFN--inducible genes Mig and Crg-2
(34). However, the relative roles of PC, NPC, and
blood-borne leukocytes in these processes remain ill-defined. By using
the IL-2/IL-12 regimen as a model, our results show the induction of
the Mig and Crg-2 genes and biologically active chemoattractant
activities for T vs NK cells by liver-derived PC (hepatocytes).
The liver is an interesting model in which to study the expression and
function of chemokine genes because enriched populations of hepatic PC
and NPC can be easily obtained (19, 20), and there is
considerable information available about inflammatory,
anti-microbial, and antitumor responses mediated by T, NK/T, and NK
cells in the liver. The leukocyte composition of the liver can vary
considerably in response to infection or cytokine therapies. We have
demonstrated that IL-12 and IL-2 have distinct effects on leukocyte
recruitment to the liver (26, 27), whereas the combination
of IL-2 plus IL-12 has enhanced antitumor effects (17).
Our studies show that the ability of IL-2/IL-12 to induce Mig and Crg-2
expression in a variety of organs is IFN- dependent, which extends
previous conclusions for a variety of infections (25) or
systemic administration of IFN- (28). However, it
should be noted that the endogenous IFN--dependent induction of Mig
and Crg-2 genes by IL-2/IL-12 can be easily and reproducibly detected,
whereas the ability of exogenously administered IFN- to induce these
genes seems less effective. This may be a result of higher and/or more
sustained levels of IFN- occurring in the liver due to local
production than can be achieved by exogenous administration of IFN-
protein. Alternatively, maximal IFN--dependent gene induction may
occur in concert with expression of other gene products such as
TNF-. To address this possiblity, studies are planned that use mice
deficient in TNF-, lymphotoxin, or both. Other studies have shown
that some chemokine genes can be induced by LPS in Kupffer
cell-depleted livers, implying gene expression by nonmacrophages
(29). Chemokine gene expression also has been documented
in transformed mouse hepatocytes (30, 31). In our studies,
low-level expression of Mig and Crg-2 genes can be sometimes detected
by RT-PCR but not by RPA, suggesting that under homeostatic conditions,
the expression of these genes in hepatocytes is minimal to negative.
Our studies demonstrate for the first time that IL-2/IL-12 efficiently
induces gene expression of Mig and Crg-2 in purified primary
hepatocytes and reveals that all of the detectable expression of these
genes in the liver and other nonlymphoid organs in response to
IL-2/IL-12 is IFN- dependent. In addition, the amplification of Mig
and Crg-2 genes in hepatocytes by IL-12 or IL-2/IL-12 also may relate
to the ability of these cytokines to up-regulate IFN-R components on
those hepatocytes. The ligand-binding -chain and the accessory
-chain of the IFN-R are constitutively expressed at low to
moderate levels on many cell types and can be regulated in some cell
types by external stimuli (32). Thus, IL-12 and IL-2/IL-12
might increase the expression of Mig and Crg-2 genes via the coordinate
induction of both IFN- from leukocytes as well as its receptor on
the target cell (hepatocytes) population. It should be noted that the
lack of expression of either IL-2 or IL-12 receptor gene components in
hepatocytes strongly argues against any direct effects of IL-2 or IL-12
on hepatocytes. However, it remains possible that additional stimuli
may contribute to induction of Mig and Crg-2 in this model. In
particular, it is intriguing that both the p55 and p75 components of
the TNFR are constitutively expressed on hepatocytes and that
IL-12 ± IL-2 strongly up-regulate the p55 chain. Because a
previous study (22) has demonstrated that TNF-
synergizes with IFN- for CXC chemokine induction in human liver, a
similar role for the TNF/TNFR system could play a role in our studies.
Further studies with TNFR or TNF--/- mice
will be required to define contributions of TNF- to Mig and Crg-2
gene induction in vivo.
Because we have previously demonstrated that the administration of
either IL-2 or IL-12 to mice results in a rapid recruitment of T
lymphocytes and NK cells to the liver, and the IFN--inducible Mig
and Crg-2 genes are rapidly induced in the liver by the IL-2/IL-12
combination, we speculated that culture supernatants from purified
primary hepatocytes obtained from these mice would have chemotactic
activity for T and NK cells. The results demonstrate for the first time
that IL-2/IL-12 treatment in vivo, as well as IFN- treatment in
vitro, induces hepatocytes to produce chemotactic activity for human T
cells as well as mouse T and/or NK cells. The hepatocyte-derived
chemoattractant activity for T cells is mediated by a combination of
Mig and Crg-2, whereas the chemoattractant activity for NK cells is
largely independent of Mig and Crg-2. This latter finding may be
consistent with a recent report by Salazar-Mather et al.
(33) who demonstrated that murine CMV-induced NK cell
infiltration into the liver was dependent on a CC chemokine, MIP-1.
Therefore, T cell recruitment to the liver in the setting of IL-2/IL-12
therapy may be initially induced by Mig/Crg-2, whereas NK cell
recruitment may be regulated via Mip-1 and/or other as yet
unidentified factors.
Overall, our results demonstrate for the first time that purified
primary mouse hepatocytes can be induced by IL-2/IL-12 to express the
genes for Mig, Crg-2, and IFN- R, and to produce Mig and Crg-2 at
levels sufficient to chemoattract T cells in vitro. Therefore, these
results suggest that expression of these genes by primary PC in vivo
may constitute an important component of the innate immune response in
the initiation and/or progression of immune responses against cancer or
infectious agents in nonlymphoid organs.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Department of Immunology, Keimyung University School of Medicine, No. 194 Dongsan-Dong, Jung-Gu, Taegu, Korea, 700-712.
3 Address correspondence and reprint requests to Dr. Robert H. Wiltrout, National Cancer Institute-Frederick Cancer Research and Development Center, Building 560, Room 31-93, Frederick, MD 21702-1201.
4 Abbreviations used in this paper: Mig, monokine induced by IFN-; IP-10, IFN-inducible protein-10; PC, parenchymal cells; rm, recombinant mouse; NPC, nonparenchymal cells; RPA, RNase protection assays.
Received for publication July 24, 2000. Accepted for publication January 2, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in mediating the antitumor efficacy of interleukin-12. J. Immunother. Emphasis Tumor Immunol. 17:71.[Medline]
production. J. Immunol. 153:1697.[Abstract]
and interleukin-2. Am. J. Pathol. 144:747.[Abstract]
affect tumorigenicity and response to IL-12 therapy and antiangiogenesis. Immunity 9:25.[Medline]
with patterns of tissue expression that suggest nonredundant roles in vivo. J. Immunol. 157:4511.[Abstract]
and VCAM-1 and is rapidly down-regulated by a mechanism involving T cells and expression of Fas. J. Immunol. 161:6014.. J. Leukocyte Biol. 52:27.[Abstract]
receptor: a paradigm for cytokine receptor signaling. Annu. Rev. Immunol. 15:563.[Medline]
(MIP-1)-dependent pathways. J. Exp. Med. 187:1.This article has been cited by other articles:
|
|
 |
|
  B. Jaruga, F. Hong, W.-H. Kim, and B. Gao IFN-{gamma}/STAT1 acts as a proinflammatory signal in T cell-mediated hepatitis via induction of multiple chemokines and adhesion molecules: a critical role of IRF-1 Am J Physiol Gastrointest Liver Physiol, November 1, 2004; 287(5): G1044 - G1052. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Robertson Role of chemokines in the biology of natural killer cells J. Leukoc. Biol., February 1, 2002; 71(2): 173 - 183. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kakimi, T. E. Lane, S. Wieland, V. C. Asensio, I. L. Campbell, F. V. Chisari, and L. G. Guidotti Blocking Chemokine Responsive to {gamma}-2/Interferon (IFN)-{gamma} Inducible Protein and Monokine Induced by IFN-{gamma} Activity In Vivo Reduces the Pathogenetic but not the Antiviral Potential of Hepatitis B Virus-specific Cytotoxic T Lymphocytes J. Exp. Med., December 17, 2001; 194(12): 1755 - 1766. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kakimi, T. E. Lane, F. V. Chisari, and L. G. Guidotti Cutting Edge: Inhibition of Hepatitis B Virus Replication by Activated NK T Cells Does Not Require Inflammatory Cell Recruitment to the Liver J. Immunol., December 15, 2001; 167(12): 6701 - 6705. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
