|
|
||||||||
in Human B Lymphocytes: Possible Adjuvants for Th1 Responses1
Department of Pathophysiology, Division of Immunopathology, University of Vienna, Vienna, Austria
| Abstract |
|---|
|
|
|---|
in
murine macrophages. The goal of the present study was to evaluate the
release of TNF-
in human cells by a CpG-ODN proven to induce Th1
immune responses in cells from atopic individuals and in mice. CpG-ODN
induced TNF-
in cells from atopic and healthy individuals. However,
the amounts were low, as determined by comparison with commonly used
Ags. Intracellular cytokine staining of PBMC revealed that
CpG-ODN-induced TNF-
derived exclusively from B lymphocytes. TNF-
contributed to the CpG-ODN-augmented proliferation and Ig synthesis in
PBMC, but was not involved in IFN-
synthesis. In conclusion, our
findings indicate that certain CpG-ODN induce low amounts of TNF-
in
human B lymphocytes and may therefore be used to modulate Th2-biased
immune responses in allergic patients. | Introduction |
|---|
|
|
|---|
(6). The vaccine routinely used
for SIT consists of standardized total allergen extracts adsorbed to
aluminum hydroxide. However, aluminum hydroxide has been shown to
induce Th2-type rather than Th1-type immune responses (7).
In case of atopic allergy, the use of vaccine adjuvants fostering
Th1-like immune responses could certainly augment the efficacy of the
treatment.
Bacterial DNA and synthetic oligodeoxynucleotides containing CpG-motifs
(CpG-ODN) have attracted attention because they acted as Th1-promoting
adjuvants in mice (8, 9). Furthermore, CpG-ODN triggered
protective and curative Th1 responses in leishmaniasis (10, 11). Treatment of mice suffering from experimentally induced
bronchial asthma with CpG-ODN prevented airway eosinophilia and
subsequent inflammation, characteristics of allergic asthmatic
inflammation (12, 13). In addition to the effects in
rodents, CpG-ODN were demonstrated to enhance the immunogenicity of
vaccines in monkeys (14, 15). At present, descriptions of
immunostimulatory effects of CpG-ODN in humans are still restricted to
in vitro studies. CpG-ODN induced proliferation and Ig synthesis in B
lymphocytes (16, 17). Furthermore, B cells activated with
CpG-ODN secreted IL-6 and IL-10 and increased the expression of the
surface costimulatory molecules, MHC class II, CD40, CD54, and CD86
(17, 18). APCs, such as monocytes and dendritic cells,
were described to mature and to synthesize IL-12 and IL-18 in response
to CpG-ODN, which induced NK cells to secrete increased levels of
IFN-
(19, 20, 21). Taken together, these findings support
the concept that CpG-ODN represent promising adjuvants for humans when
a Th1-like immune response is desired (22). However, when
considering ODN containing CpG motifs as possible immunomodulating
adjuvants, potential disadvantages and/or harmful effects have to be
evaluated. CpG-ODN were shown to cause the sequence-dependent induction
of large amounts of TNF-
in murine macrophages (23, 24). Furthermore, CpG-ODN-induced TNF-
caused lethal shock
due to liver cell apoptosis (25). The information about
the ability of CpG-ODN to induce TNF-
synthesis in human cells is
still limited (19, 26).
We have previously reported that a phosphorothioate-modified ODN
containing three CpG motifs augmented Th1-type cytokines in PBMC from
atopic donors (AD) and reduced the synthesis of IgE Ab
(21). Moreover, in a murine model of type I allergy, this
CpG-ODN modulated the allergic Th2 response to Bet v 1, the major birch
pollen allergen (27). In the present study we evaluated
the capacity of this CpG-ODN to induce TNF-
production in human
cells, a characteristic that would limit its potential application as
adjuvant. We determined which cell types produced TNF-
and
investigated the dependence of CpG-ODN-induced proliferation, Ig
secretion, and IFN-
synthesis on TNF-
. Our evaluations may be of
importance for the development of Th1-promoting vaccine adjuvants that
are both active and safe.
| Materials and Methods |
|---|
|
|
|---|
Patients suffering from birch pollen and/or grass pollen allergy (AD) and individuals without atopic background (NAD) were included in this study. Type I allergy was documented by typical case histories, positive skin prick test, and positive radioallergosorbent test (RAST >3; Pharmacia, Uppsala, Sweden). None of the AD had previously undergone SIT.
Oligodeoxynucleotides and reagents
The phosphorothioate-modified oligomeric sequences were synthesized by MWG (Munich, Germany). The CpG-containing DNA sequence (CpG-ODN) was ATCGACTCTCGAGCGTTCTC. A non-CpG-ODN with CG inverted to GC served as the negative control (ATGCACTCTGCAGGCTTCTC). Each ODN was used at a concentration of 3 µM throughout the study, a concentration determined in previous studies (21). Endotoxin was measured using the Limulus amebocyte lysate assay (BioWhittaker, Walkersville, MD). The lower detection limit of the Limulus amebocyte lysate assay in our hands was 0.03 endotoxin units (EU)/ml. No endotoxin could be detected in ODN. The LPS sample (Sigma, St. Louis, MO) used had an activity of 45.5 pg/EU. The following reagents were commercially obtained: polymyxin B (Sigma), tick-borne encephalitis virus vaccine (Baxter, Vienna, Austria), purified protein derivative (Staten Serum Institute, Copenhagen, Denmark), and tetanus toxoid (Calbiochem, La Jolla, CA).
Cell culture and proliferation assays
PBMC were obtained from peripheral blood by Ficoll-Hypaque
density gradient centrifugation (Pharmacia). PBMC (2 x
106) were cultured in 200 µl of Ultra Culture
medium (BioWhittaker) supplemented with 2 x
10-5 M 2-ME and 2 mM glutamine in 96-well tissue
culture plates (Costar, Cambridge, MA). B lymphocytes were isolated by
negative selection from PBMC using magnetic beads (B cell negative
isolation kit; Dynal, New York, NY). The kit uses a mixture of mouse
mAb specific for human CD2, CD3, CD7, CD14, CD16, and CD56 and
subsequently magnetic beads coated with anti-mouse IgG. The
obtained cell fractions contained consistently <2%
CD3+, <1% CD14+, and
<1% CD16/56+ cells as determined by flow
cytometry. B cells (2 x 105) were cultured
in round-bottom 96-well tissue culture plates (Nunclone; Nunc,
Roskilde, Denmark) in the medium described above. Proliferation was
evaluated after 48 h by pulsing the cells with
[3H]thymidine (0.5 µCi/96 tissue culture
well) followed by liquid scintillation analysis. All determinations
were performed in duplicate. In inhibition experiments, a neutralizing
anti-human TNF-
Ab (5 µg/ml; PharMingen, San Diego, CA) was
added simultaneously with CpG-ODN to the cultures. An isotype-matched
Ab (PharMingen) served as the control. The addition of the isotype
control Ab did not influence the effects of CpG-ODN. To evaluate Ig
production, 4 x 106 PBMC were cultured in
24-well tissue culture plates (Costar) with the CpG-ODN for 8 days.
Anti-human TNF-
Ab and the isotype control were added on days 0, 3,
and 6.
Detection of cytokines and Ig
Cell-free supernatants (SN) were collected at different time
points (496 h) and analyzed for TNF-
using ELISA with Endogen
Matched Ab Pairs (Endogen, Woburn, MA) according to the manufacturers
instructions. In brief, 96-well plates (Maxisorp; Nunc) were coated
overnight at room temperature with anti-human TNF-
mAb (2
µg/ml). After saturation, SN and standards (Endogen) were incubated
for 1 h at room temperature, and bound TNF-
was detected using
the matched biotin-labeled anti-human TNF-
mAb (0.9 µg/ml PBS
containing 0.5% Tween 20 and 4% BSA). After incubation with
HRP-conjugated streptavidin (Endogen), the color reaction was developed
using tetramethylbenzidine substrate (Endogen). The sensitivity limit
was 0.6 pg/ml. IFN-
ELISA (Cytoscreen; BioSource, Camarillo, CA) and
Ig ELISA were performed as described previously (21).
Flow cytometry
PBMC were cultured for 10 h with CpG-ODN, non-CpG-ODN, LPS,
Staphylococcus aureus Cowan strain I (SAC; Calbiochem), or
medium alone in the presence of 1 µg/ml brefeldin A (Sigma). Surface
and intracellular cytokine stainings were performed as previously
described (21). PBMC were stained with anti-CD3-PerCP,
anti-CD14-FITC, anti-CD19-FITC, and anti-CD56-APC (Becton
Dickinson, San Jose, CA). To stain intracellular TNF-
, PE-conjugated
anti-TNF-
(PharMingen) was used. The level of background
staining was assessed by the use of an isotype-matched PE-conjugated
mouse Ig (PharMingen). Cells were analyzed on a FACSCalibur (Becton
Dickinson). Data were analyzed with the computer program CellQuest
(version 3.2.1; Becton Dickinson). Before statistical analysis, isotype
control Ab-positive cells were subtracted from
anti-TNF-
-positive cells.
Statistical analysis
Statistical significance of differences was determined by the Wilcoxon signed rank test. Differences were considered statistically significant for p < 0.05.
| Results |
|---|
|
|
|---|
by CpG-ODN
To investigate whether ODN containing CpG motifs increased the
synthesis of TNF-
, PBMC from 13 atopic and 13 healthy control
subjects were incubated in medium alone or in medium containing 3 µM
CpG-ODN or 3 µM non-CpG-ODN. In addition, cells from NAD were
stimulated with LPS (0.1 ng/ml). Cell culture SN were harvested at
several time points (496 h) and analyzed using ELISA. However,
including AD and NAD, CpG-ODN significantly increased TNF-
production compared with medium alone (p <
0.001) or non-CpG-ODN (p < 0.001; Table I
). The optimal time point to detect
TNF-
synthesis in PBMC was 12 h (Table I
), since TNF-
levels
were decreased at the later time points (data not shown). Background
levels of TNF-
production varied considerably among individuals. No
significant difference was observed between AD and the healthy control
subjects. Polymyxin B, a specific inhibitor of LPS, did not affect
CpG-ODN-induced TNF-
production, indicating that TNF-
production
was not due to endotoxin contamination (data not shown).
|
by different Ags
To estimate the CpG-ODN-induced amount of TNF-
, PBMC from 16
individuals (8 AD and 8 NAD) were stimulated with the tick-borne
encephalitis virus vaccine (250 ng/ml), purified protein derivative (10
µg/ml), and tetanus toxoid (1 µg/ml). CpG-ODN were used at the
concentration of 3 µM corresponding to a concentration of 19 µg/ml.
TNF-
levels were assessed by ELISA and are summarized in Table II
. Again, the optimal incubation period
was 12 h. CpG-ODN-induced TNF-
levels were generally lower than
the amounts induced by Ags, which are commonly used in humans.
|
derives from B lymphocytes, but not from
monocytes
To determine the cell type(s) responsible for CpG-ODN-induced
TNF-
production, staining of cell surface markers and intracellular
cytokines was performed in PBMC. The two-color dot plots depicted in
Fig. 1
show that TNF-
secretion in
CD19+ cells markedly increased when PBMC were
stimulated with CpG-ODN compared with non-CpG-ODN or medium alone. SAC,
a stimulator of TNF-
in B cells, served as a positive control. For B
cells the optimal time point for intracellular TNF-
detection was
10 h, compared with 20 and 30 h (not shown). Fig. 2
shows the pooled flow cytometry results
from PBMC obtained from six AD and six NAD. Stimulation with CpG-ODN
led to a significant rise in the percentage of TNF-
-producing
CD19+ lymphocytes. The efficiency of non-CpG-ODN
was significantly lower than that of CpG-ODN. Neither monocytes
(CD14+), T lymphocytes
(CD3+), nor NK cells
(CD56+) significantly secreted TNF-
in
response to CpG-ODN at 10, 20, or 30 h of incubation. As expected,
LPS induced significant TNF-
production in monocytes, whereas B
cells were not affected. Thus, B lymphocytes represent the sole cell
type secreting TNF-
in response to CpG-ODN.
|
|
synthesis
B cells were negatively selected from peripheral blood of six
individuals (three AD and three NAD), and SN were analyzed by ELISA
(Table III
). Again, the optimal time
point was 12 h. Purified B lymphocytes synthesized TNF-
in
response to CpG-ODN, as suggested by the experiments with PBMC.
Non-CpG-ODN also induced increased amounts of TNF-
compared with
medium alone. These data indicate that TNF-
induction by CpG-ODN is
a direct effect on B cells without the contribution of other cell
types.
|
is involved in CpG-ODN-induced proliferation and Ig
production, but not IFN-
synthesis, in PBMC
B cells have been shown to proliferate when PBMC were cultured
with CpG-ODN (17). Since TNF-
is an autocrine growth
factor for B lymphocytes, we investigated whether the mitogenic effects
of CpG-ODN on PBMC depended on TNF-
. As shown in Fig. 3
A, the addition of a
neutralizing anti-human TNF-
Ab significantly inhibited
CpG-ODN-triggered proliferation in PBMC derived from nine individuals
compared with the isotype-matched control Ab. Moreover, the
anti-TNF-
Ab significantly reduced CpG-ODN-augmented synthesis
of IgG (Fig. 3
C) and IgM (Fig. 3
D) in cells
derived from five AD. On the other hand, the CpG-ODN-induced synthesis
of IFN-
in PBMC was not significantly affected by the anti-human
TNF-
Ab (Fig. 3
B).
|
| Discussion |
|---|
|
|
|---|
(>100 pg/ml of blood) can
cause systemic shock-like reactions in humans (28). It was
reported that CpG-DNA is capable to induce TNF-
in a
sequence-dependent manner (24). Therefore, we analyzed
whether an ODN containing three CpG-motifs, which represents a
promising adjuvant candidate for SIT of allergic patients, triggered
the synthesis of TNF-
. Here, we show that this
phosphorothioate-modified DNA sequence induces TNF-
in PBMC derived
from atopic as well as healthy individuals. However, the amounts of
TNF-
are relatively low and comparable to the amounts induced by
common immunological stimuli, e.g., by Ags routinely used in humans.
Our study reveals that CpG-ODN-induced TNF-
derives exclusively from
human B lymphocytes and represents a key cytokine involved in
CpG-ODN-induced proliferation and Ig secretion in PBMC. The capability
of CpG-ODN to induce IFN-
in PBMC is, however, independent of B
cell-derived TNF-
.
The goal of the present study was to evaluate possible harmful
cytokine-mediated effects of a CpG-ODN proven to induce Th1 cytokines
in human cells and mice (21, 27). We observed that the
stimulation of human PBMC with CpG-ODN induced a significant increase
in TNF-
production in vitro. This effect was identical in AD and
healthy control subjects. However, several indications suggest that the
synthesis of TNF-
can be regarded as a phenomenon of less
importance: we found that 2 EU/ml LPS, an amount beyond the allowed
limit for LPS in parenteralia according to the Pharmacopoea
Europea, elicited markedly higher levels of TNF-
in cells
from every individual tested. Furthermore, the comparison with Ags such
as tetanus toxoid, purified protein derivative, and the tick-borne
encephalitis virus vaccine revealed that these substances stimulated
the production of similar levels of endogenous TNF-
. Although it is
difficult to extrapolate in vitro data to the situation in vivo, our
data provide evidence that this particular DNA sequence will not induce
systemically active amounts of TNF-
when administered as vaccine
adjuvant.
Recently, Sparwasser et al. (25, 29) suggested a possible
role for bacterial DNA and certain synthetic ODN displaying
unmethylated CpG motifs in the septic shock syndrome, since certain
CpG-ODN induced murine macrophages to release high amounts of TNF-
.
Along with T cells, the predominant cell type responsible for TNF-
production in general is the macrophage. It is therefore of importance
that, according to our findings, B lymphocytes represented the sole
source of CpG-ODN-stimulated TNF-
synthesis in human peripheral
blood. In contrast to CD19+ cells, monocytes did
not significantly accumulate TNF-
in response to CpG-ODN, as
determined by intracellular cytokine staining (Fig. 2
). Apart from
that, these observations provide further evidence that CpG-ODN and LPS
substantially differ in their ability to induce immunological effects
(26). CpG-ODN stimulated the synthesis of TNF-
in
purified B lymphocytes, a fact that was also observed in chronic
lymphocytic leukemia B cells (30). Together, these data
strongly suggest that CpG-ODN directly induce TNF-
in B cells
without the contribution of other cell types or exogenous cytokines. As
the control ODN also induced measurable TNF-
synthesis in purified B
cells and PBMC, we determined whether the presence of the hexameric
palindrome was responsible for these effects. Two additional CpG-ODN
(1668, A2) that do not contain a palindrome and their respective
controls containing inverted GC motifs were examined (31).
The TNF-
levels induced by these CpG-ODN were comparable to those
induced by the DNA sequence under investigation in our study (data not
shown). The control GC-ODNs also stimulated TNF-
synthesis in some
individuals, however, significantly less than the respective CpG-ODN
(data not shown). From this we cannot exclude a contribution of the
phosphorothioate backbone itself to the observed B cell activation as
has been reported previously (16).
Several studies have suggested an important role for TNF-
in the
regulation of B cell proliferation and differentiation
(32). B lymphocytes have been shown to synthesize TNF-
upon appropriate stimulation, including pharmacologic and natural
stimuli, e.g., EBV and HIV (33). ODN containing CpG motifs
might trigger TNF-
synthesis in B cells analogous to viral
infections. This corroborates the hypothesis that CpG motifs are sensed
as danger/infection signals in potentially pathogenetic DNA.
Neutralizing anti-TNF-
Ab significantly reduced CpG-ODN-induced
proliferation in PBMC, which was mainly attributed to B cells, and the
synthesis of IgG and IgM (17). This leads to the
speculation that the mitogenic effects of CpG-ODN on B cells are
regulated by TNF via an autocrine loop, again in analogy with the
behavior of EBV-transformed B cells (34). In addition,
SAC-induced proliferation in PBMC could be reduced by the
anti-TNF-
Ab, whereas in cultures stimulated with LPS no
proliferation was detected (data not shown). On the other hand, TNF-
did not significantly influence CpG-ODN-induced IFN-
synthesis,
which predominantly derives from NK cells (21).
The success of SIT, the treatment of choice in certain forms of type I
allergy, can be attributed to a change from Th2 toward Th1 immune
responses at the level of allergen-specific T lymphocytes. Recently,
allergen-specific T lymphocytes were shown to develop into Th1-like
cytokine-secreting effector cells by phosphorothioate ODN
(35). We have previously shown that polyclonal IgE
production is reduced by CpG-ODN (21). Therefore, the use
of CpG-ODN as vaccine adjuvants represents a promising strategy for
future SIT (36). However, potential undesired effects,
such as the induction of high levels of TNF-
, need to be excluded.
We show that CpG-ODN-induced TNF-
derives exclusively from B
lymphocytes and can be considered an epiphenomenon.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Barbara Bohle, Department of Pathophysiology (formerly Department of General and Experimental Pathology), Division of Immunopathology, University of Vienna, Währinger Gürtel 18-20, A-1090 Vienna, Austria. ![]()
3 Abbreviations used in this paper: SIT, specific immunotherapy; AD, atopic donors; CpG-ODN, oligodeoxynucleotides containing CpG motifs; NAD, nonatopic donors; SAC, Staphylococcus aureus Cowan strain I; SN, supernatant. ![]()
Received for publication August 9, 2000. Accepted for publication January 2, 2001.
| References |
|---|
|
|
|---|
-dependent mechanisms. Proc. Natl. Acad. Sci. USA 96:6970.
production in cells from allergic individuals and inhibit IgE synthesis in vitro. Eur. J. Immunol. 29:2344.[Medline]
production by stimulation of interleukin-12 and tumor necrosis factor-
. Cell. Immunol. 167:72.[Medline]
-mediated shock. Eur. J. Immunol. 27:1671.[Medline]
. Proc. Natl. Acad. Sci. USA 93:2879.
(TNF-
) and interleukin-6 (IL-6) in B-lymphocyte function. Methods 11:128.[Medline]
This article has been cited by other articles:
![]() |
M. Gerstmayr, N. Ilk, I. Schabussova, B. Jahn-Schmid, E. M. Egelseer, U. B. Sleytr, C. Ebner, and B. Bohle A Novel Approach to Specific Allergy Treatment: The Recombinant Allergen-S-Layer Fusion Protein rSbsC-Bet v 1 Matures Dendritic Cells That Prime Th0/Th1 and IL-10-Producing Regulatory T Cells J. Immunol., December 1, 2007; 179(11): 7270 - 7275. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Bohle, A. Breitwieser, B. Zwolfer, B. Jahn-Schmid, M. Sara, U. B. Sleytr, and C. Ebner A Novel Approach to Specific Allergy Treatment: The Recombinant Fusion Protein of a Bacterial Cell Surface (S-Layer) Protein and the Major Birch Pollen Allergen Bet v 1 (rSbsC-Bet v 1) Combines Reduced Allergenicity with Immunomodulating Capacity J. Immunol., June 1, 2004; 172(11): 6642 - 6648. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gursel, D. Verthelyi, I. Gursel, K. J. Ishii, and D. M. Klinman Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide J. Leukoc. Biol., May 1, 2002; 71(5): 813 - 820. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |