|
|
||||||||







*
Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Nagoya, Japan; and
Department of Periodontology, School of Dentistry, Aichi-Gakuin University, Chikusa-ku, Nagoya, Japan
| Abstract |
|---|
|
|
|---|
and a specific inhibitor of PGE synthesis failed to block the
ODF mRNA increase by native LPS. Thus, LPS directly induced ODF mRNA.
Mouse osteoblasts and an osteoblast cell line constitutively expressed
Toll-like receptor (TLR) 2 and 4, which are known as putative LPS
receptors. ODF mRNA increases in response to synthetic lipid A were
defective in primary osteoblasts from C3H/HeJ mice that contain a
nonfunctional mutation in the TLR4 gene, suggesting that
TLR4 plays an essential role in the process. Altogether, our results
indicate that ODF gene expression is directly increased in osteoblasts
by LPS treatment via TLR, and this pathway may play an important role
in the pathogenesis of LPS-mediated bone disorders, such as
periodontitis. | Introduction |
|---|
|
|
|---|
Osteoclast differentiation factor
(ODF),3 also known as
receptor activator of NF-kB ligand (8)/tumor necrosis
factor-related activation-induced cytokine
(9)/osteoprotegrin ligand (10), RANKL,
receptor activator of NF-kB ligand; TRANCE, tumor necrosis
factor-related activation-induced cytokine; OPGL, osteoprotegrin
ligand; is a recently identified member of the TNF ligand family
(11). ODF is expressed as a membrane-associated protein by
osteoblasts and stromal cells. Both osteoblasts and stromal cells are
known to support the formation of osteoclast-like multinucleated cells
from their precursors in the presence of M-CSF (11). Mice
with disrupted ODF genes exhibit severe osteopetrosis and a defect in
tooth eruption (12). These mice completely lack
osteoclasts, suggesting that ODF is essential for
osteoclastogenesis. As TNF-
, IL-1, and
PGE2 induce ODF expression in osteoblasts
(11, 13, 14), LPS may stimulate osteoblasts and/or
surrounding cells to secrete these cytokines and, consequently, ODF,
resulting in induction of osteocalstogenesis. However, it is also
possible that LPS directly stimulate osteoblasts to express ODF, and
this possibility has never been explored extensively.
Toll-like receptors (TLRs) are a family of mammalian proteins homologous to Drosophila Toll. Toll was first identified as a protein controlling dorso-ventral pattern formation in the early development of Drosophila (15). Recent findings have found that Toll and its homologues play important roles in the host defense against pathogens (16). TLRs in mammals are believed to be pattern-recognition receptors, which recognize bacterial common structures (17). Although one of the human Toll homologues, TLR2, has been shown to be involved in LPS signaling (18, 19), recent studies including the generation of gene-disrupted mice have shown that TLR4, but not TLR2, is essential for LPS responsiveness in vivo (20). More recently, TLR2 has been suggested not only as an LPS signal transducer (18, 19) but also as a receptor for bacterial lipoproteins from Mycobacteria or Gram-positive bacteria (21, 22, 23, 24).
In the current study, we investigated the effects of LPS on the gene expression of ODF in primary mouse osteoblasts and a mouse osteoblastic cell line, MC3T3-E1. We found that LPS directly increased ODF mRNA level in osteoblasts. Both TLR2 and TLR4 mRNAs were constitutively expressed in these cells, and synthetic lipid A failed to increase ODF mRNA in primary mouse osteoblasts from C3H/HeJ mice, suggesting that TLR4 is essential for ODF mRNA up-regulation by synthetic lipid A. Thus, LPS may promote periodontitis by directly inducing ODF expression via TLR in osteoblasts.
| Materials and Methods |
|---|
|
|
|---|
MC3T3-E1, a mouse osteoblast cell line, ST2, a mouse stromal cell line, and RAW264.7, a mouse macrophage cell line, were obtained from RIKEN Cell Bank, (Tsukuba, Japan) and cultured in DMEM containing 10% FCS (Sigma, St. Louis, MO) at 37°C in 5% carbondioxide/95% air.
Osteoblastic cells from ddy, C3H/HeN, or C3H/HeJ mice were isolated
from the calvaria of 2-day-old fetal mice as described previously
(25). Six calvaria were collected and applied to routine
five sequential digestions, using a solution of
-MEM containing
0.1% collagenase (Wako Pure Chemical Industries, Osaka, Japan) and
0.2% dispase (Godo Shusei, Tokyo, Japan). Cells isolated in fraction 4
were combined and cultured for 7 days in a-MEM containing 10%
FCS.
Reagents
LPS from Escherichia coli (serotype B6:026) and cycloheximide, a protein synthesis inhibitor, wortmannin, a specific inhibitor of phosphoinositide 3-kinase (PI3K), were obtained from Sigma. Synthetic E. coli-type lipid A, ONO4007, was kindly provided by Ono Pharmaceutical (Tokyo, Japan) and described previously (26). LPS from A. actinomycetemcomitans Y4 was prepared as described previously (27). PD98059, a specific inhibitor of extracellular signal-regulated kinase (ERK) kinase, and SB208530, a specific inhibitor of p38 kinase, NS-398, a selective inhibitor of cyclooxygenase-2, and RO-31-8220, a specific inhibitor of protein kinase C (PKC) were purchased from Calbiochem-Novabiochem (La Jolla, CA). Cyclosporin A, a specific inhibitor of calcineurin, was purchased from Alexis Biochemicals (San Diego, CA). A monoclonal anti-mouse TNF receptor p55 Ab (anti-TNF-R) was purchased from Genzyme Diagnostics (Cambridge, MA). A mAb to ODF was purchased from IMGENEX (San Diego, CA). A neutralizing Ab against mouse TLR4, MTS510, was a generous gift from Dr. Kensuke Miyake (Saga Medical School, Nabeshima, Japan).
Northern blot analysis
Total cellular RNA was extracted from each cell culture by using TRIzol reagent (Life Technologies, Rockville, MD) according to the manufacturers instructions. For RNA blotting, 10-µg aliquots of the total RNA were electrophoresed in 1% agarose gels containing 20 mmol/L MOPS, 5 mmol/L sodium acetate, 1 mmol/L EDTA (pH 7.0), and 6% (v/v) formaldehyde. Equal loading of the aliquots in each lane was assessed by ethidium bromide staining. RNAs were transferred to a nylon membrane. After UV cross-linking, membranes were soaked in prehybridization solution (6x SSC, 5x Denhardts reagents, 0.5% SDS, 100 µg/ml denatured salmon sperm DNA, and 50% formamide) for 2 h at 65°C followed by the incubation with 32P-labeled probe in the prehybridization solution for 14 h at 65°C. The membranes were washed twice in 2x SSC and 0.1% SDS for 5 min at 65°C, washed twice in 0.1x SSC and 0.1% SDS for 15 min, and then exposed to films (Fuji RX-U films; Fuji Film, Tokyo, Japan).
RT-PCR
Total cellular RNA was prepared using TRIzol reagent. cDNA was
synthesized from 2 µg of total RNA by extension of random primers
with 200 U of Superscript II (Life Technologies). PCR of the cDNA was
performed in a final volume of 50 µl containing 2.5 mM
MgCl2, 2.5 U of AmpliTaq (Perkin-Elmer, Norwalk,
CT), and specific primers at 1 µM by using the geneAmp 2400 PCR
system (Perkin-Elmer). The primers were: mouse (m)
-actin sense,
TGGAATCCTGTGGCATCCATGAAAC; m
-actin antisense,
TAAAACGCAGCTCAGTAACAGTCCG; mODF sense, CTCTTGGTACCACGATCGAG; mODF
antisense, AAGCCCCAAAGTACGTC GCA; mouse osteoclastogenesis
inhibitory factor (mOCIF) sense, ATGCCGAGAGTGTAGAGAGGAT; mOCIF
antisense; AAACAGCCCAGTGGACCATTCCT. The numbers of PCR cycles were:
35 for mODF, 25 for mOCIF, and 20 for m
-actin. All PCRs were within
the exponential amplification range. The synthesized PCR products were
separated by electrophoresis on a 2% agarose gel and visualized by
ethidium bromide staining.
Extract preparation and immunoblotting
Cells were lysed in RIPA lysis buffer (150 mmol/L NaCl, 1% Nonidet P-40, 0.5% deoxycholic acid, 0.1% SDS, 50 mM Tris-HCl (pH 8.0), 2 µg/ml aprotinin, 10 µg/ml leupeptin, 1 mg/ml sodium orthovanadate, 1 mmol/L PMSF) at 108 cells/ml. The lysates were separated on SDS-polyacrylamide gels and then electrotransferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were blocked for 1 h in 5% nonfat dry milk/TBST (20 mmol/L Tris-HCl (pH 7.6), 0.15 mol/L NaCl, 0.1% Tween 20), incubated with primary Ab in TBST for 15 h, washed three times with TBST, and incubated for 1 h with HRP-conjugated anti-mouse IgG (Amersham Pharmacia Biotech, Piscataway, NJ) diluted 1:10,000 in TBST. After three washes in TBST, the blot was developed with the ECL system (Amersham Pharmacia Biotech) according to the manufacturers instruction.
| Results |
|---|
|
|
|---|
Although ODF is considered essential for the differentiation of
osteoclasts, it is not clear how ODF is involved in the LPS-mediated
periodonitis, in which differentiated osteoclasts cause bone
resorption. To explore the possibility that LPS induces ODF expression
in osteoblasts, mouse primary osteoblasts from ddy mice, and a mouse
osteoblastic cell line, MC3T3-E1, were examined for ODF mRNA expression
after LPS treatment. As shown in Fig. 1
A, ODF mRNA was significantly
up-regulated by LPS derived from E. coli or A.
actinomycetemcomitans or synthetic E. coli-type lipid A
in mouse osteoblasts in <2 h. In MC3T3-E1 and ST-2 cells, ODF mRNA was
also up-regulated by E. coli-derived LPS (Fig. 1
B). RT-PCR was used for the ODF mRNA analyses because the
ODF mRNA levels were relatively lower in this cell line. In contrast,
the gene expression of OCIF remained constant after stimulation with
LPS in these cells (Fig. 1
, A and B).
Additionally, to examine whether LPS actually induces the production of
ODF protein by osteoblasts, the amount of ODF protein after LPS
treatment was determined by Western blot analysis. The ODF protein
expression was increased within 4 h after LPS treatment (Fig. 1
C).
|
LPS stimulates osteoblasts to secrete osteolytic factors, IL-1
(28), TNF-
(29), and
PGE2 (30). Each of these factors is
also a known inducer of ODF from osteoblasts (11, 13, 14).
Thus, to investigate whether synthetic lipid A, the biological center
of LPS, directly mediates ODF mRNA up-regulation in osteoblasts, mouse
primary osteoblasts from ddy mice were treated with cycloheximide, a
protein synthesis inhibitor, before synthetic E. coli-type
lipid A stimulation. Cycloheximide rather enhanced synthetic E.
coli-type lipid A-mediated increase of ODF mRNA, suggesting that
the effect of synthetic lipid A on ODF gene expression is direct (Fig. 2
A). This result also
indicated that there might be an inhibitory feedback regulation against
the synthetic lipid A-mediated ODF gene expression that required new
protein synthesis.
|
synthesis. ODF mRNA up-regulation by LPS is dependent on the ERK activation pathway in mouse osteoblasts
LPS activates several mitogen-activated protein (MAP) kinases
including ERK (31, 32), c-Jun
NH2-terminal protein kinase (33, 34), and p38 MAP kinase (35, 36) in monocytes and
macrophages. To investigate whether these pathways are involved in the
ODF mRNA up-regulation, we pretreated MC3T3-E1 cells with specific
inhibitors of ERK (PD98059) or p38 kinase (SB208530) for 30 min
followed by 2 h stimulation with 1 µg/ml E. coli-LPS
(Fig. 3
A). Pretreatment with
PD98059 inhibited ODF mRNA increase at the concentration of 5 µM. The
inhibitory effect of PD98059 was also observed in synthetic lipid
A-treated mouse osteoblasts (Fig. 3
B). These findings
suggest that the ERK pathway is probably involved in mediating this
cellular response. In contrast, LPS-mediated ODF mRNA increase was not
inhibited by SB208530 treatment (Fig. 3
A).
|
Gene expression of TLR in mouse osteoblasts
CD14, a cell surface protein, is necessary for the efficient LPS
signaling. In addition, it has recently been reported that some types
of TLRs are essential for LPS responses. Amano et al. have reported
that osteoblasts from mouse calvaria express CD14 mRNA
(6). We also found that both primary osteoblasts and
MC3T3-E1 cells expressed CD14 on the cell surface (data not shown). To
determine the gene expression of the newly identified LPS receptors,
TLR2 and TLR4 in mouse osteoblasts, osteoblasts were isolated from the
calvaria of naive ddy mice and total RNAs were prepared in the presence
or absence of LPS derived from E. coli. As shown in Fig. 4
A, both TLR2 and TLR4 mRNAs
were constitutively expressed in osteoblasts. We have recently reported
that TLR2 mRNA, but not TLR4 mRNA, was increased in macrophages and T
cells after LPS stimulation (18). Consistently, when the
cells were stimulated with LPS, TLR2 mRNA was significantly increased
within 2 h, whereas TLR4 mRNA remained constant in osteoblasts
(Fig. 4
A). The same pattern of TLR2 and TLR4 gene expression
was also observed in MC3T3-E1 and ST-2 in the presence of LPS from
E. coli or A. actinomycetemcomitans (Fig. 4
B).
|
Synthetic lipid A increases ODF gene expression in mouse osteoblasts via TLR4
To determine whether the LPS-induced ODF mRNA induction is
mediated by TLRs, we examined primary mouse osteoblasts from C3H/HeJ
mice with the mutated TLR4 gene. As shown in Fig. 5
A, ODF mRNA was hardly
increased in osteoblasts from C3H/HeJ mice at any time point after
synthetic lipid A stimulation. In contrast, ODF mRNA was significantly
increased in osteoblasts from C3H/HeN mice by synthetic lipid A
treatment (Fig. 5
A).
|
| Discussion |
|---|
|
|
|---|
Osteoblasts also secrete a substantial amount of OCIF, a member of TNF
receptor family proteins, in the unstimulated state (39).
OCIF strongly inhibits osteoclast formation induced by osteotropic
factors. OCIF lacks apparent transmembrane domain (11) and
seems to act as a soluble inhibitory decoy receptor for ODF in the
process of osteoclastogenesis. Additionally, according to a recent
study, OCIF also inhibits osteoclast activity by directly binding to a
140-kDa protein in the osteoclast membrane (40). Thus,
osteoblasts seem to control osteoclastogenesis by expressing two
functionally conflicting factors, and it is assumed that the expression
ratio of ODF/OCIF is decisive for the osteoclastogenic activity of
osteoblasts. Our current data have indicated that LPS rapidly increased
ODF mRNA in both primary-cultured osteoblasts and an osteoblastic cell
line (Fig. 1, A and B). In contrast,
OCIF gene expression remained constant in these cells. The result of
Western blot analysis in this study also revealed that ODF protein was
increased <4 h after LPS treatment (Fig. 1
C). These results
suggest that LPS potently induce osteoclastogenic activity in mouse
osteoblasts.
Recent reports have shown that ODF mRNA in osteoblasts is up-regulated
by the bone-resorbing factors, such as vitamin D3, IL-11, and
parathyroid hormone (11). In addition, IL-1 and TNF-
also up-regulated expression of ODF gene in osteoblasts (13, 14). Because LPS has been shown to stimulate osteoblasts to
secrete the osteolytic factors IL-1 (28), IL-6
(41), TNF-
(29), and PGE
(30), it is reasonable to presume that ODF gene expression
by LPS may be indirectly mediated by one of these factors. However, in
the present study, we have demonstrated that a potent protein synthesis
inhibitor, cycloheximide, rather enhances synthetic lipid A-mediated
increase of ODF mRNA (Fig. 2
A). In addition, both a blocking
Ab to TNF receptor p55 and a specific inhibitor of PGE synthesis failed
to block the ODF mRNA increase by synthetic lipid A (Fig. 2
B). These results suggest that synthetic lipid A directly
increases ODF mRNA in osteoblasts.
LPS activates both NF-
B and various MAP kinase pathways
(31, 32, 33, 34, 35, 36). Our data using specific kinase inhibitors
indicate that ODF mRNA up-regulation by synthetic lipid A seems to be
dependent on ERK kinase activation (Fig. 3
, A and
B). The specific inhibitor of PKC, but not that of PI3K or
calcineurin-mediated pathways, blocked the ODF mRNA increase by
synthetic lipid A in osteoblasts (Fig. 3
C). Interestingly,
all these three chemicals inhibited TCR-mediated ODF gene activation in
T cells (37), indicating that molecular mechanisms of ODF
gene activation by synthetic lipid A in osteoblasts should be different
from that by TCR engagement in T cells. Recently, the promoter
structure of the mouse ODF gene has been reported (42).
They found inverted CAAT boxes and a putative Cbfa1/Osf2/AML3 binding
domain in the basic promoter structure with no obvious NF-
B binding
motifs. This is consistent with our results from kinase inhibitor
experiments, because both CAAT/enhancer binding protein (C/EBP) and
Cbfa1 are activated by ERKs (43). Also, a PKC inhibitor
blocks the growth hormone-dependent activation of C/EBP at
concentrations shown to inhibit activation of ERK
(44).
CD14, a component of the LPS receptor, is involved in LPS-mediated bone
resorption by osteoblasts, and CD14 is expressed on the surface of
osteoblasts (6). However, because CD14 is a GPI-anchored
protein without a transmembrane domain, the existence of a signaling
component was presumed in the LPS receptor complex. Both TLR2 and TLR4
have recently been suggested as LPS signal transducers (18, 19, 45, 46). We found that both TLR2 and TLR4 mRNAs were
constitutively expressed in osteoblasts from mouse calvaria and also an
osteoblastic cell line, MC3T3-E1 (Fig. 4
, A and
B). TLR2 and TLR4 mRNA was also detected in ST-2, a stromal
cell line, which is also a known source of ODF (Fig. 4
B). We
also found that TLR3 and TLR6 mRNAs were constitutively expressed in
osteoblasts (Fig. 4
C), whereas TLR5 or TLR9 mRNA was not
detected in osteoblasts (data not shown). At present, as the ligands
for these TLRs were not identified, the significance of these findings
is unclear.
Interestingly, TLR2 gene expression, but not that of TLR4, was
increased significantly by LPS stimulation. In our previous report, we
have shown that TLR2 mRNA is increased by IL-2, IL-15, and TCR
stimulation in mouse T cells, whereas TLR4 mRNA remained constant
(18). Also in macrophages, TLR2, but not TLR4, mRNA is
increased by treatment with LPS, TNF-
, IL-1
, IFN-
, IL-2, or
IL-15 (47). The promoter region of mouse TLR2 gene
contains two NF-
B-binding sites (T. Musikacharoen, manuscript in
preparation), and NF-
B activation seems to be essential for the TLR2
gene expression in macrophages (47). Our present finding
that TLR2 mRNA is also up-regulated in mouse osteoblasts suggests that
the TLR2 inducibility may be common to many cell types.
Because osteoblasts express both TLR2 and TLR4 mRNAs, it is interesting to know which TLR mediates the LPS signals in osteoblasts. Although several recent studies showed that TLR2 mediated LPS signaling in vitro (18, 19), the role of TLR2 in LPS signaling in vivo is controversial. Two recent studies found TLR4 gene in a single autosomal locus (lps) responsible for the LPS hyporesponsiveness of two mouse strains (C3H/HeJ and C57BL10/ScCr) (48, 49). Also, these studies identified a different type of mutation in the TLR4 gene in each mouse strain. This suggests that mTLR4 is essential for LPS responses. More recently, TLR2- and TLR4-deficient mice have been generated, and TLR4-deficient mice show LPS hyporesponsiveness very similar to the lpsd mouse strains (20), whereas TLR2-deficient mice show normal production of proinflammatory cytokines from macrophage after LPS stimulation, indicating that TLR2 is dispensable for LPS signaling.
Our current data provide some insight about the roles of TLRs in LPS
responses of osteoblasts. We demonstrated that ODF mRNA in primary
mouse osteoblasts from C3H/HeJ mice was hardly increased by synthetic
lipid A (Fig. 5
A). We also showed that synthetic lipid
A-induced ODF mRNA increase was inhibited by a blocking Ab against TLR4
(Fig. 5
B). Thus, we conclude that TLR4 is essential to
induce ODF gene expression in osteoblasts in response to synthetic
lipid A. Recently, it has been demonstrated that TLR2 may act as a
signaling receptor for other common bacterial structural patterns
including liparabinomannan (21, 22), lipoprotein
(23), peptidoglycan, and lipoteichoic acid
(24). TLR2-defective mice showed unresponsiveness to these
bacterial components (20). Thus, TLR2 may also be involved
in the ODF production of osteoblasts by recognizing lipoproteins or
peptidoglycan, which are also components of Gram-negative bacteria.
In conclusion, the present study has shown that ODF gene expression was directly increased in osteoblasts by stimulation with LPS. The activation of ERK and PKC pathways by LPS seems to play an important role in the activation of ODF gene. TLR4 seems essential to initiate this osteoblast response. These findings provide an insight into a therapeutic approach to controlling LPS-induced peroiodontitis.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Tetsuya Matsuguchi, Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550, Japan. ![]()
3 Abbreviations used in this paper: ODF, osteoclast differentiation factor; ERK, extracellular signal-regulated kinase; PKC, protein kinase C; TLR, Toll-like receptor; MAP, mitogen-activated protein; PI3K, phosphoinositide 3-kinase; OCIF, osteoclastogenesis inhibitory factor; C/EBP, CAAT/enhancer binding protein; m, mouse. ![]()
Received for publication July 10, 2000. Accepted for publication December 11, 2000.
| References |
|---|
|
|
|---|
and tumor necrosis factor-
, but not interleukin-6, stimulate osteoprotegerin ligand gene expression in human osteoblastic cells. Bone 25:255.[Medline]
stimulates osteoclast differentiation by a mechanism independent of the ODF/RANKL-RANK interaction. J. Exp. Med. 191:275.
in the differentiation and survival of osteoclasts induced by lipopolysaccharide from Actinobacillus actinomycetemcomitans Y4. J. Periodontal Res. 33:509.[Medline]
(TNF-
) translation: glucocorticoids inhibit TNF-
translation by blocking JNK/SAPK. Mol. Cell Biol. 17:6274.[Abstract]
(C/EBP
) and C/EBP
. Mol. Endocrinol. 9:108.This article has been cited by other articles:
![]() |
J.-D. Ji, K.-H. Park-Min, Z. Shen, R. J. Fajardo, S. R. Goldring, K. P. McHugh, and L. B. Ivashkiv Inhibition of RANK Expression and Osteoclastogenesis by TLRs and IFN-{gamma} in Human Osteoclast Precursors J. Immunol., December 1, 2009; 183(11): 7223 - 7233. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yang, Y. H. Ryu, C.-H. Yun, and S. H. Han Impaired osteoclastogenesis by staphylococcal lipoteichoic acid through Toll-like receptor 2 with partial involvement of MyD88 J. Leukoc. Biol., October 1, 2009; 86(4): 823 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sundaram, J. Senn, S. Yuvaraj, D. S. Rao, and S. V. Reddy FGF-2 Stimulation of RANK Ligand Expression in Paget's Disease of Bone Mol. Endocrinol., September 1, 2009; 23(9): 1445 - 1454. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu, S. Wang, P. Zhang, N. Said-Al-Naief, S. M. Michalek, and X. Feng Molecular Mechanism of the Bifunctional Role of Lipopolysaccharide in Osteoclastogenesis J. Biol. Chem., May 1, 2009; 284(18): 12512 - 12523. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Somayaji, S. Ritchie, M. Sahraei, I. Marriott, and M. C. Hudson Staphylococcus aureus Induces Expression of Receptor Activator of NF-{kappa}B Ligand and Prostaglandin E2 in Infected Murine Osteoblasts Infect. Immun., November 1, 2008; 76(11): 5120 - 5126. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Chang, L.-J. Raggatt, K. A. Alexander, J. S. Kuliwaba, N. L. Fazzalari, K. Schroder, E. R. Maylin, V. M. Ripoll, D. A. Hume, and A. R. Pettit Osteal Tissue Macrophages Are Intercalated throughout Human and Mouse Bone Lining Tissues and Regulate Osteoblast Function In Vitro and In Vivo J. Immunol., July 15, 2008; 181(2): 1232 - 1244. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lorenzo, M. Horowitz, and Y. Choi Osteoimmunology: Interactions of the Bone and Immune System Endocr. Rev., June 1, 2008; 29(4): 403 - 440. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Taniguchi, K. Yoshida, T. Ito, M. Tsuda, Y. Mishima, T. Furumatsu, L. Ronfani, K. Abeyama, K.-i. Kawahara, S. Komiya, et al. Stage-Specific Secretion of HMGB1 in Cartilage Regulates Endochondral Ossification Mol. Cell. Biol., August 15, 2007; 27(16): 5650 - 5663. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ishida, C. Kohda, Y. Yanagawa, H. Miyaoka, and T. Shimamura Epigallocatechin gallate suppresses expression of receptor activator of NF-{kappa}B ligand (RANKL) in Staphylococcus aureus infection in osteoblast-like NRG cells J. Med. Microbiol., August 1, 2007; 56(8): 1042 - 1046. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Alnaeeli, J. M. Penninger, and Y.-T. A. Teng Immune Interactions with CD4+ T Cells Promote the Development of Functional Osteoclasts from Murine CD11c+ Dendritic Cells. J. Immunol., September 1, 2006; 177(5): 3314 - 3326. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Nemoto, R.P. Darveau, B.L. Foster, G.R. Nogueira-Filho, and M.J. Somerman Regulation of Cementoblast Function by P. gingivalis Lipopolysaccharide via TLR2 Journal of Dental Research, August 1, 2006; 85(8): 733 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Tagariello, R Heller, A Greven, V M Kalscheuer, T Molter, A Rauch, W Kress, and A Winterpacht Balanced translocation in a patient with craniosynostosis disrupts the SOX6 gene and an evolutionarily conserved non-transcribed region J. Med. Genet., June 1, 2006; 43(6): 534 - 540. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yang, N. Takahashi, T. Yamashita, N. Sato, M. Takahashi, M. Mogi, T. Uematsu, Y. Kobayashi, Y. Nakamichi, K. Takeda, et al. Muramyl Dipeptide Enhances Osteoclast Formation Induced by Lipopolysaccharide, IL-1{alpha}, and TNF-{alpha} through Nucleotide-Binding Oligomerization Domain 2-Mediated Signaling in Osteoblasts J. Immunol., August 1, 2005; 175(3): 1956 - 1964. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Marriott, D. M. Rati, S. H. McCall, and S. L. Tranguch Induction of Nod1 and Nod2 Intracellular Pattern Recognition Receptors in Murine Osteoblasts following Bacterial Challenge Infect. Immun., May 1, 2005; 73(5): 2967 - 2973. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. N. Belibasakis, A. Johansson, Y. Wang, C. Chen, S. Kalfas, and U. H. Lerner The Cytolethal Distending Toxin Induces Receptor Activator of NF-{kappa}B Ligand Expression in Human Gingival Fibroblasts and Periodontal Ligament Cells Infect. Immun., January 1, 2005; 73(1): 342 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Amcheslavsky, W. Zou, and Z. Bar-Shavit Toll-like Receptor 9 Regulates Tumor Necrosis Factor-{alpha} Expression by Different Mechanisms: IMPLICATIONS FOR OSTEOCLASTOGENESIS J. Biol. Chem., December 24, 2004; 279(52): 54039 - 54045. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sato, N. Takahashi, K. Suda, M. Nakamura, M. Yamaki, T. Ninomiya, Y. Kobayashi, H. Takada, K. Shibata, M. Yamamoto, et al. MyD88 But Not TRIF Is Essential for Osteoclastogenesis Induced by Lipopolysaccharide, Diacyl Lipopeptide, and IL-1{alpha} J. Exp. Med., September 7, 2004; 200(5): 601 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.H. Nociti Jr., B.L. Foster, S.P. Barros, R.P. Darveau, and M.J. Somerman Cementoblast Gene Expression is Regulated by Porphyromonas gingivalis Lipopolysaccharide Partially via Toll-like Receptor-4/MD-2 Journal of Dental Research, August 1, 2004; 83(8): 602 - 607. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Roccisana, N. Kawanabe, H. Kajiya, M. Koide, G. D. Roodman, and S. V. Reddy Functional Role for Heat Shock Factors in the Transcriptional Regulation of Human RANK Ligand Gene Expression in Stromal/Osteoblast Cells J. Biol. Chem., March 12, 2004; 279(11): 10500 - 10507. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Okahashi, H. Inaba, I. Nakagawa, T. Yamamura, M. Kuboniwa, K. Nakayama, S. Hamada, and A. Amano Porphyromonas gingivalis Induces Receptor Activator of NF-{kappa}B Ligand Expression in Osteoblasts through the Activator Protein 1 Pathway Infect. Immun., March 1, 2004; 72(3): 1706 - 1714. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Suda, N. Udagawa, N. Sato, M. Takami, K. Itoh, J.-T. Woo, N. Takahashi, and K. Nagai Suppression of Osteoprotegerin Expression by Prostaglandin E2 Is Crucially Involved in Lipopolysaccharide-Induced Osteoclast Formation J. Immunol., February 15, 2004; 172(4): 2504 - 2510. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Fakruddin and J. Laurence HIV Envelope gp120-mediated Regulation of Osteoclastogenesis via Receptor Activator of Nuclear Factor {kappa}B Ligand (RANKL) Secretion and Its Modulation by Certain HIV Protease Inhibitors through Interferon-{gamma}/RANKL Cross-talk J. Biol. Chem., November 28, 2003; 278(48): 48251 - 48258. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Madrazo, S. L. Tranguch, and I. Marriott Signaling via Toll-Like Receptor 5 Can Initiate Inflammatory Mediator Production by Murine Osteoblasts Infect. Immun., September 1, 2003; 71(9): 5418 - 5421. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kikuchi, Y. Yoshikai, J. Miyoshi, M. Katsuki, T. Musikacharoen, A. Mitani, S. Tanaka, T. Noguchi, and T. Matsuguchi Cot/Tpl2 is Essential for RANKL Induction by Lipid A in Osteoblasts Journal of Dental Research, July 1, 2003; 82(7): 546 - 550. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zou, A. Amcheslavsky, and Z. Bar-Shavit CpG Oligodeoxynucleotides Modulate the Osteoclastogenic Activity of Osteoblasts via Toll-like Receptor 9 J. Biol. Chem., May 2, 2003; 278(19): 16732 - 16740. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Okahashi, A. Sakurai, I. Nakagawa, T. Fujiwara, S. Kawabata, A. Amano, and S. Hamada Infection by Streptococcus pyogenes Induces the Receptor Activator of NF-{kappa}B Ligand Expression in Mouse Osteoblastic Cells Infect. Immun., February 1, 2003; 71(2): 948 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-K. Choi, H. J. Lee, J. H. Kang, G. J. Jeong, C. K. Min, and Y.-J. Yoo Induction of Osteoclastogenesis and Matrix Metalloproteinase Expression by the Lipooligosaccharide of Treponema denticola Infect. Immun., January 1, 2003; 71(1): 226 - 233. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tsuboi, Y. Yoshikai, S. Matsuo, T. Kikuchi, K.-I. Iwami, Y. Nagai, O. Takeuchi, S. Akira, and T. Matsuguchi Roles of Toll-Like Receptors in C-C Chemokine Production by Renal Tubular Epithelial Cells J. Immunol., August 15, 2002; 169(4): 2026 - 2033. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Gasper, C. C. Petty, L. W. Schrum, I. Marriott, and K. L. Bost Bacterium-Induced CXCL10 Secretion by Osteoblasts Can Be Mediated in Part through Toll-Like Receptor 4 Infect. Immun., August 1, 2002; 70(8): 4075 - 4082. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |