|
|
||||||||

*
Schepens Eye Research Institute and Pulmonary and Critical Care Division, Department of Medicine, Brigham and Womens Hospital, Harvard Medical School, Boston, MA 02114; and
Massachusetts Institute of Technology, Undergraduate Research Opportunities Program, Cambridge, MA 02139
| Abstract |
|---|
|
|
|---|
). Moreover, either blocking CD40/CD40L interactions
with the Ab or using IL-12 knockout recipient mice prevented the
increased collagen deposition (accumulation of hydroxyproline) in the
lungs during HIPIF induction. We conclude that second signals
(CD40/CD40L interactions) are required for elicitation of secondary
immune responses that lead to PIF in vivo. The results support the
notion that CD40/CD40L interactions are involved in the pathogenesis of
an ongoing autoimmune disease. | Introduction |
|---|
|
|
|---|
Although CD8+ T cells, eosinophils, mast cells,
basophils, and NK cells are able to express the molecule, CD40L is
expressed primarily by activated CD4+ T cells
(2, 3). When CD40L ligates CD40 on dendritic cells or
macrophages, B7 coreceptor molecules are up-regulated and inflammatory
cytokines (IL-12, TNF-
, and IL-1) are produced (3, 8, 9, 10, 11). Moreover, CD40/CD40L interactions are crucial in
priming, expansion, and maturation of CD4+ T
cells (2, 9, 12, 13) and are critical for the initiation
and maintenance of macrophage/dendritic cell-mediated inflammation
(7, 14, 15, 16). Blocking CD40/CD40L interactions reduces
allograft rejection and prolongs graft survival (3, 17).
It is well established that CD40/CD40L interactions are absolutely
required for initiation of primary immune responses and accompanying
inflammatory responses.
In contrast to what is known about CD40 and primary immune responses there are only a few studies evaluating the role of CD40 binding during secondary immune responses in vivo. Recently, Gerritse and colleagues showed that in vivo administration of anti-CD40L Ab inhibited the elicitation of experimental allergic encephalitis (EAE) in mice (16). Also, anti-CD40L immunotherapy reduced the severity of ongoing lupus nephritis (18). However, CD40 was not important for the elicitation of secondary immune responses observed by others. CD40/CD40L interactions were not critical for clearance of tumors after challenge in a vaccinated animal (2) nor modulated the outcome of colitis after induction by hapten 2,4,6-trinitrobenzene sulfonic acid (TNBS) (19).
The role of CD40 in pulmonary fibrosis was recently addressed by Phipps and colleagues when they showed that the blockade of CD40/CD40L interactions prevented fibrosis in lung injury models mediated by oxygen or radiation (nonimmune inflammation) (20, 21). Treatment of the mice with CD40L blocking Ab (MR1) before the oxygen or radiation exposure and even 48 h after oxygen exposure reduced the production of the proinflammatory enzyme cyclooxygenase-2 and blunted the injury-induced inflammation and lung fibrosis (20, 21). However, no studies have reported a role for CD40/CD40L interactions in secondary immune responses that lead to immune-mediated fibrosis.
Haptens include known protein-reactive chemicals, metals, salts, and drugs that are considered major environmental noxae targeting the immune system of vertebrates (22). Haptens are nonimmunogenic but, because of their chemical reactivity, covalently bind to proteins and lipids as carriers and stimulate immune responses (22, 23, 24). Like viruses, haptens alter self-Ags, and part of the ensuing immune response includes an autoimmune component (22). Previously we reported that pulmonary interstitial fibrosis (PIF) was elicited in the lungs of hapten-sensitized mice after a local pulmonary challenge of the immunizing hapten (25). The intratracheally (i.t.) administered hapten induced a local recall cell-mediated immune response against self-Ag modified by hapten TNBS that eventuated into a chronic immune response alveolitis and fibrosis (26, 27, 28). The experimental model for pulmonary fibrosis is called hapten immune PIF (HIPIF) and resembles human idiopathic PIF, not only because of its abnormal regulation of inflammation in the lung and unresolved fibrosis, but also because it shares an autoimmune etiology (29, 30).
The elicitation of HIPIF is Ag specific and dependent on the genetic susceptibility of mouse strain to express a contact hypersensitivity response toward TNBS (25, 26, 28). HIPIF does not occur in mice that are made tolerant to the Ag and can be adoptively transferred with sensitized cells to naive mice before i.t. challenge with TNBS (25, 31). Using a modified HIPIF model called adoptively transferred HIPIF (ADT-HIPIF) where we adoptively transferred sensitized cells into naive recipient mice, we showed that sensitized CD4+ and CD8+ cells from donor mice and alveolar macrophages from recipient mice were absolutely required for the elicitation of HIPIF (28, 32). These studies also showed that alveolar macrophages were necessary for the effective recruitment of inflammatory cells (IL-12R+ cells, activated T cells, and monocytes/immature dendritic cells) into the lung.
We reasoned that if HIPIF were to occur there must be a change in the normally suppressive phenotype of the alveolar macrophage to allow the recruitment of the inflammatory cells from the periphery and, perhaps, even promote the chronic secondary immune responses in the lung. Indeed data presented show that bronchoalveolar lavage (BAL) cells (including alveolar macrophages and infiltrating monocytes) produced inflammatory cytokines and expressed CD40 coreceptors on their surface. Importantly, CD40 was needed for a secondary immune response and fibrosis to occur because blocking the CD40/CD40L interactions reduced the amount of hydroxyproline (fibrosis) deposited in the lungs of sensitized and challenged mice. These results support the concept that CD40/CD40L interactions are required for secondary immune responses in vivo in general and for a pathogenic immune response in the lung in particular.
| Materials and Methods |
|---|
|
|
|---|
Female BALB/c ByJ mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and maintained in the Schepens Eye Research Institute Vivarium until they reached the desired weight (2024 g) for the experiments. The IL-12 p35 p40 knockout (0) mouse (BALB/c background) breeding pair was a gift from Dr. Keith Bishop (University of Michigan, Ann Arbor, MI), and mice used in the studies were bred in the Schepens Eye Research Institute Vivarium. All animals were treated humanely in accordance with National Institutes of Health guidelines and the approval of the Schepens Animal Care and Use Committee.
Reagents
TNBS, rat IgG, crystal violet, alkaline phosphatase-conjugated
ExtrAvidin, and substrate p-nitrophenyl phosphate were
purchased from Sigma (St. Louis, MO). Anti-CD40L Ab (MR1) was purchased
from Bio Express (West Lebanon, NH). Normal Armenian hamster serum was
purchased from Cytogen (West Roxbury, MA), and the hamster IgG was
purified from the serum using protein A-agarose (Life Technologies,
Grand Island, NY) column. Biotin- and PE-conjugated anti-CD40 Abs
(3/23), purified anti-IL-12 (p70) Ab (9A5), anti-IL-12 (p40/70)
Ab (C15.6), biotin-conjugated anti-IL-12 (p40/p70) Ab (C17.8), Fc
blocker (2.4G2), and rat IgG2a (R35-95) were purchased from BD
PharMingen (San Diego, CA). A TNF-
ELISA kit (DuoSeT) was purchased
from Genzyme (Cambridge, MA). PermeaFix reagent was purchased from
Ortho Diagnostic Systems (Raritan, NJ). R-PE-conjugated streptavidin
was purchased from Jackson ImmunoResearch (West Grove, PA). Recombinant
mouse (rm) IL-12 (p70) was purchased from R&D Systems
(Minneapolis, MN).
Animal model
HIPIF. Mice were sensitized on the abdomens with a water-soluble form of the hapten TNBS (3% in PBS, 100 µl/mouse) at day 0. Five days after sensitization, the mice were inoculated i.t. with 50 µl of 1% TNBS (28).
ADT-HIPIF. Donor mice were skin sensitized with 100 µl of 3% TNBS. Five to seven days after skin sensitization, spleen and draining lymph nodes (axillary, inguinal, and brachial) were harvested and dissociated into a single cell suspension before determining the cell viability by the trypan blue exclusion method. Spleen and draining lymph node cells were mixed, counted, and used as donor cells for adoptive transfer. The spleen and lymph node cells from naive mice were similarly collected and adoptively transferred as control. Recipient mice were irradiated (200 rad, Mark 1 irradiator; J.L. Shepherd and Associates, Glendale, CA) 24 h before donor cells (3 x 107/mouse) were transferred through tail vein inoculation. One day after the adoptive transfer, recipient mice were challenged i.t. with 50 µl of 1% TNBS in PBS.
CD40L neutralizing Ab (MR1) and rmIL-12 (p70) treatment
Recipient mice were given Ab (MR1 or normal Armenian hamster IgG) (200 µg/mouse, i.p.) 1 day before i.t. challenge. The recipient mice received additional Ab (100 µg/mouse, intranasally) at 4 h, and 1, 3, and 7 days after i.t. challenge. rmIL-12 (p70) (100 or 500 ng) was inoculated i.p. per mouse on the day of i.t. challenge and was repeated 3 days after i.t. challenge. Each group for each dose contained five mice.
Flow cytometry analyses and sorting
BAL cells were collected by washing the lung with a total of 10 ml of PBS per lung (1 ml per wash). Cells in staining buffer (PBS, 1% BSA, 0.1% sodium azide) were incubated with blocking reagent (Fc blocker, 2 µg/106 cells, rat IgG 20 µg/106 cells), and then biotin-conjugated anti-CD40 or rat IgG2a (1 µg/106 cell) followed by PE-conjugated streptavidin. All cells were incubated on ice for 20 min and washed twice before the next reagent was added. To quench macrophage autofluorescence, cells were permeabilized and fixed with PermeaFix reagent to allow intracellular access of crystal violet (33) before the samples were analyzed by flow cytometry (EPICS XL; Beckman Coulter, Miami, FL).
For CD40+ cell sorting, the lavage cells were stained with PE-conjugated anti-CD40 Ab or control rat IgG2a (1 µg/106 cells) for 40 min on ice. CD40+ cells were sorted using flow cytometry (EPICS ELITE; Beckman Coulter). Cytospin preparations (Cytospin 2; Shandon Southern Products, Astmoor, U.K.) were prepared from the sorted cells (5 x 104 cells/slide), followed by staining with Wright Giemsa staining (HEMA 3 Stain set; Fisher Scientific, Pittsburgh, PA), and then analyzed by light microscopy (oil, x40 and x60) (Nikon ECLIPSE E-800; Nikon, Melville, NY). Alveolar macrophages were identified by their large size (with a large cytoplasmic region and a single round nucleus); monocytes showed a kidney-shaped nucleus with light blue granules in the cytoplasm; lymphocytes had a spherical nucleus that was dark blue and surrounded by a small cytoplasm region; neutrophils had a nucleus consisting of two to five lobes linked by fine threads of chromatin; and eosinophils contained a bilobed nucleus with pink granules in the cytoplasm.
Cytokine ELISA
The lung lavage was collected from each individual mouse as the
return volume on 1 ml of PBS inserted i.t. The lavage wash was
centrifuged at 200 x g for 10 min, and the supernatant
was used for the ELISA. TNF-
ELISA was performed using the TNF-
ELISA kit according to the manufacturers instruction. IL-12 (p40/p70)
ELISA was performed by using the capture Ab (C15.6, 2 µg/ml) and the
detecting Ab (C17.8, 1 µg/ml) followed by alkaline
phosphatase-conjugated ExtrAvidin (1:10,000 dilution) and substrate
p-nitrophenyl phosphate. We used anti IL-12 mAbs, 9A5 (2
µg/ml) for the capture Ab and C17.8 (1 µg/ml) for the detecting Ab
in an IL-12p70 ELISA.
Hydroxyproline assay
Changes in collagen deposition in the lung were measured by a colorimetric hydroxyproline assay (34). In brief, lungs recovered from the experimental mice were minced and hydrolyzed in 6 N HCl (2 ml/lung) for 16 h at 110°C. The samples were filtered through Whatman no. 1 filter paper, diluted with H2O, neutralized with 10 N NaOH, and assessed spectrophotometrically. The amount of hydroxyproline in the lungs was calculated according to the standard curve generated using a serial dilution of trans-4-hydroxy-L-proline (Sigma).
RT-PCR
Total RNA was extracted from cells by Trizol reagent (Life
Technologies, Rockville, MD). RNA purified from 3 x
106 BAL cells was dissolved in 30 µl diethyl
procarbonate-treated H2O. One microliter of the
RNA sample was used for the one-step RT-PCR amplification using the
Access RT-PCR system (Promega, Madison, WI) and Gene Amp PCR System
9600 (Perkin-Elmer, Norwalk, CT). The primer pairs for IL-12 p35
(sense: ggctactagagagacttcttcc, anti-sense:
gtgaagcaggatgcagagcttc), IL-12 p40 (sense: cgtgctcatggctggtgcaaag,
anti-sense: gaacacatgcccacttgctg) (35), TNF-
(sense: atgagcacagaaagcatgatccgc, anti-sense:
ccaaagtagacctgcccggactc) (36), and
-actin (sense:
gtgggccgctctaggcaccaa, anti-sense: ctctttgatgtcacgcacgatttc)
(37) were generated by Oligos Etc. (Wilsonville, OR). The
RT reaction was one cycle of 48°C for 45 min followed by 94°C for 2
min. The PCR amplification was 40 cycles of 94°C for 30 s,
60°C for 1 min, and 68°C for 2 min followed by one cycle of 68°C
for 7 min. The PCR products were separated on a 1% agarose gel and
visualized using GelStar nucleic acid gel stain (FMC BioProducts,
Rockland, ME) and UV illumination. The density of the bands on the gel
was measured using Gel Doc 2000 (Bio-Rad, Hercules, CA).
Statistical analyses
ANOVA and post hoc tests were used to evaluate the difference
among experimental groups. Values of p
0.05 were
considered significant. In some cases, individual p values
are given.
| Results |
|---|
|
|
|---|
The elicitation of immune responses in sensitized mice is thought to involve different and perhaps fewer signals than needed for the induction of a primary immune response (2, 19). Because there is a controversy as to the absolute requirement for CD40 during elicitation of secondary immune responses, we began by measuring the expression of CD40 in the autoimmune fibrosis model, HIPIF.
In contrast to unsensitized mice that receive a single inoculation of
hapten in their lungs, HIPIF mice that are sensitized before the i.t.
challenge with hapten develop a lasting fibrosis (28).
Moreover, adherent cells from the lungs of HIPIF mice are immune
supporting, whereas the adherent cells from the lungs of challenge-only
mice are immune suppressive (32). Thus, we reasoned that
the functional phenotype of the BAL-adherent cells would differ in
HIPIF mice. As a marker for activated and effective accessory cells, we
assessed the expression of CD40 on BAL cells from the various
experimental groups with flow cytometry. BAL cells were obtained from
the experimental mice 2 days post i.t. challenge with hapten and
stained with anti-CD40 Ab. The BAL cells from naive mice (C group)
that were 9095% alveolar macrophages (data not shown) expressed low
level (mean fluorescence intensity of CD40 Ab vs isotype Ab staining
was 0.876 vs 0.623, respectively) of CD40 on their surface. The BAL
cells from sensitized and challenged mice (A group) contained a
subpopulation of cells (8%) expressing high level (mean fluorescence
intensity of CD40 Ab vs isotype Ab staining was 12.9 vs 0.886,
respectively) of CD40 on their surface (Fig. 1
). Challenge-only mice (B group) had no
CD40 on their surface. The expression of CD40 on BAL cells was also
increased 1 and 3 days after i.t. challenge in HIPIF mice compared with
control (data not shown).
|
Because the BAL cells from sensitized or naive mice that were i.t.
challenged contained both alveolar macrophages and infiltrating
monocytes, both of which have the potential for expressing CD40
(2, 3), we identified the CD40bright
cells in HIPIF mice by their morphology. The
CD40bright cells from BAL cells collected 1 day
post i.t. challenge were enriched by FACS sorting, stained with Wright
Giemsa, and examined by light microscopy (Fig. 2
). About 80% of the sorted cells as
analyzed by flow cytometry were CD40bright, and
the same percentage of the sorted cells exhibited morphology consistent
with their being monocytes. The rest of the sorted cells (
20%) were
identified as neutrophils and did not express CD40.
|
The consequence of CD40/CD40L interactions in elicitation of
hapten responses in the lungs of sensitized mice was studied first
indirectly by monitoring inflammatory cytokine production. The level of
IL-12 mRNA in lavage cells was measured by RT-PCR analysis in
experimental and control mice 2 days after i.t. challenge (Fig. 3
). Evaluation of IL-12 mRNA showed no
differences in the p40 mRNA level in BAL cells collected from the
various experimental groups of mice, but p35 mRNA level was
consistently higher in BAL cells from HIPIF mice as compared with those
from control mice at both 2 and 5 days after i.t. challenge. Reports
show that the expression of IL-12 p35 is both transcriptionally and
translationally regulated because multiple isoforms of p35 are
expressed in different types of cells and stages of activation
(38, 39). Therefore, we interpreted the double band seen
in day 5 as two isoforms of p35. We included both bands in the
densitometry analyses of the p35 RT-PCR product. During the elicitation
of HIPIF, monocytes and T cells are recruited into the lung
(32). Three days after i.t. challenge with TNBS, the HIPIF
mice have significantly higher numbers of monocytes (9.58 ±
1.11 x 104 vs 5.28 ± 0.97 x
104) and T cells (5.54 ± 0.52 x
104 vs 2.09 ± 0.06 x
104) in BAL compared with the mice i.t.
challenged-only (32). In addition, the cells in the HIPIF
BAL are more activated (increased CD40 expression, IL-12 receptor
expression, and TNF-
production) than the BAL cells from the control
mice (32) (Fig. 1
). Thus, the elevated level of IL-12 p35
mRNA in HIPIF BAL cell samples could be a result of increased numbers
of infiltrating monocytes and enhanced activation of both monocytes and
alveolar macrophages.
|
|
|
mRNA and
protein production because there was a dose-dependent decrease of
TNF-
mRNA in BAL cells and a reduction of TNF-
protein in BAL
fluid from the mice treated with 200 µg CD40L Ab (Figs. 4
mRNA levels were also reduced in BAL cells from
anti-CD40L (200 µg)-treated HIPIF mice that were collected 2 and
3 days (53 and 51% reduction, respectively) after i.t. challenge (data
not shown). These results support the postulate that CD40/CD40L
interactions contribute to the effector phase of the hapten immune
response in the lung by enhancing the production of proinflammatory
cytokines IL-12 and TNF-
. IL-12 is associated with the accumulation of hydroxyproline in HIPIF mice
To analyze the role of IL-12 in HIPIF,
IL-120 BALB/c mice were used as recipient mice in
ADT-HIPIF. TNBS-sensitized spleen and lymph node cells were collected
from wild-type (WT) mice that were sensitized on their abdomen 5 days
earlier and transferred to either WT or IL-120
mice. Recipient mice were challenged with TNBS (i.t.) 1 day later. The
accumulation of hydroxyproline was measured in the lungs of
experimental mice 14 days after i.t. challenge (Fig. 6
). The IL-120
recipient mice had significantly less (p
0.05) hydroxyproline deposition in the lung compared with the WT
recipient mice. Thus, IL-12 not only contributes to the process that
eventuates into fibrosis, but also must be produced by monocytes and
macrophages from the recipient mice after the i.t. challenge with
Ag.
|
Thus far, data show that CD40/CD40L interactions promote the
production of proinflammatory and fibrogenic cytokines that lead to the
development of pulmonary fibrosis. To evaluate the role of CD40/CD40L
in pulmonary fibrosis, recipient mice (ADT-HIPIF model) were treated
with CD40L blocking Ab, and hydroxyproline accumulation in the lung was
measured. Compared with the HIPIF mice treated with hamster IgG
(control Ab), the HIPIF mice treated with anti-CD40L Ab developed
less accumulation of hydroxyproline (Fig. 7
). Therefore, both the production of
inflammatory cytokines and hydroxyproline accumulation were dependent
on CD40/CD40L interactions. When HIPIF mice that were treated with
CD40L Ab were given rmIL-12 (p70), the accumulation of hydroxyproline
in the lung was restored (Fig. 8
). These
results indicate that IL-12 from CD40/CD40L interaction is biologically
significant and is critical for the fibrogenic process in the
HIPIF lung.
|
|
| Discussion |
|---|
|
|
|---|
Studies in several autoimmune disease models (EAE, lupus nephritis)
show that CD40/CD40L interactions are important in both the priming and
the effector phase of the disease process (2, 3). Blocking
the CD40/CD40L interactions using anti-CD40L Ab prevents the
development of the disease and dramatically suppresses clinical signs
even when treatment starts after onset of disease in both EAE and lupus
nephritis models (16, 18). However, in TNBS-induced
colitis, a model for Th1-mediated and autoimmune inflammatory bowel
disease, blocking CD40/CD40L interactions prevents the induction phase
of the disease but has no effect on the disease after the onset
(19). Although HIPIF and TNBS-induced colitis are elicited
by the same hapten TNBS and mediated by Th1 type immune responses,
their requirement for the cosignaling molecule CD40 is different. This
may suggest a role of local environment in regulating immune response
and disease process. The intestine is home to a large variety of
indigenous bacteria (intestinal microflora). Normally, hosts exhibit
tolerance toward the indigenous intestinal flora; however, in the
inflammatory bowel disease process, the tolerance is broken and the
hyperresponsiveness toward intestinal flora is crucial in the
pathogenesis of the disease (40). Therefore, the immune
response toward the bacteria in the intestine may act as an adjuvant to
bypass the total dependence on CD40 cosignaling in the ongoing colitis.
In contrast, the lung, although not sterile, is not populated with an
abundance of natural flora and therefore lacks the adjuvant effect. In
the environment of the lung, resting alveolar macrophages suppress
dendritic cell Ag-presenting function, and TGF
from epithelial cells
can further down-regulate inflammatory responses (41, 42, 43).
This suppressive environment may raise the threshold for elicitation of
an immune response in the lung. Our data support this notion because
CD40/CD40L interactions are critical for elicitation of a secondary
immune response in the lung.
It is known that multiple cell types within the lung express CD40 on
their surface (3, 20, 44, 45). We and others showed that
alveolar macrophages express low levels of CD40. During the elicitation
of HIPIF, infiltrating monocytes express high levels of CD40 and can be
distinguished from the CD40dim populations as
CD40bright. Many studies report that signals
derived from CD40/CD40L interactions increase the production of
proinflammatory cytokines (IL-12, TNF-
) and expression of B7
costimulatory molecules on macrophages, monocytes, and dendritic cells
(3, 8, 9, 10, 11). Activation of fibroblast and vascular
endothelial cells through CD40 molecules stimulates their expression of
adhesion molecules CD54 (ICAM-1) and CD106 (VCAM-1), and chemotactic
factors (3). Wiley and colleagues showed that exogenous
CD40L administered into the lung induces recruitment of
polymorphonuclear leukocytes and accumulation of macrophages with
up-regulated Ia expression (44) presumably by binding to
CD40 on lung epithelial cells and macrophages. Recent data from our
laboratory showed that alveolar macrophage-derived TNF-
was
important for the recruitment of monocytes and the development of
fibrosis in HIPIF (32). Therefore, we propose that in
HIPIF mice the local TNBS challenge induces the infiltration of
proinflammatory monocytes and presensitized activated T cells. The
CD40L on these T cells interacts with CD40 on alveolar macrophages,
epithelial cells, and, more importantly, infiltrating monocytes, and
perpetuates the production of TNF-
, IL-12, and GM-CSF. These signals
activate the resting alveolar macrophages and further enhance the
inflammatory cascade and recruitment of immune inflammatory cells by
promoting chemokine production and adhesion molecule up-regulation on
endothelial cells and epithelial cells. The chronic immune inflammation
in the lung eventually leads to matrix destruction and collagen
deposition.
Haptens are nonimmunogenic small reactive chemicals that conjugate to proteins and lipids (carrier molecules) to become immunogenic (22, 23, 24). Haptens are commonly used as tools to dissect Th1 and inflammatory responses in the skin and colon (19, 22, 23, 40, 46, 47). Here we show that pulmonary challenge with hapten in the lungs of sensitized mice leads to an abnormally regulated destructive immune response eventuating in fibrosis. Small reactive chemicals with haptenic properties are ubiquitous in our domestic and industrial environment and therefore potentially are part of the unknown etiology of human idiopathic pulmonary fibrosis.
PIF in humans manifests as persistent inflammation and enhanced collagen deposition in the lung. Many types of abnormal immune regulation are described in the fibrotic lungs, which include the existence of anti- small nuclear protein Ab and immune complex deposition in the lung, infiltration of neutrophils, monocytes, and activated T cells (29, 30). Although the insults that cause a large percentage of PIF remain unknown, the disease process is considered to have an underlying autoimmune mechanism. Therapeutically, blocking CD40/CD40L interactions may be a benefit for fibrosis patients who exhibit an associated expression of CD40L on lymphocytes. Reagents that block CD40/CD40L interactions have been tested extensively in allotransplantation models. With the success of humanized CD40L blocking Ab (hu5C8) in preventing acute rejection in allotransplantation in primates (17), it is possible that innovative treatments may be forthcoming for the treatment of PIF patients.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Joan Stein-Streilein, Schepens Eye Research Institute, 20 Staniford Street, Boston, MA 02114. ![]()
3 Abbreviations used in this paper: CD40L, CD40 ligand; PIF, pulmonary interstitial fibrosis; HIPIF, hapten immune PIF; ADT-HIPIF, adoptively transferred HIPIF; BAL, bronchoalveolar lavage; EAE, experimental allergic encephalitis; i.t., intratracheal(ly); TNBS, 2,4,6-trinitrobenzene sulfonic acid; WT, wild type; rm, recombinant mouse; 0, knockout. ![]()
Received for publication July 3, 2000. Accepted for publication December 8, 2000.
| References |
|---|
|
|
|---|
are required for IL-12 but not prostaglandin E2 secretion by microglia during antigen presentation to Th1 cells. J. Immunol. 162:1384.
epitopes recognized by autoantibodies in idiopathic pulmonary fibrosis. Clin. Exp. Immunol. 114:339.

T cells with potent cytotoxicity in the liver of mice via production of IL-12 from Kupffer cells. J. Immunol. 156:2436.[Abstract]
-dependent inducible expression of the human interleukin-12 p35 gene in monocytes initiates from a TATA-containing promoter distinct from the CpG-rich promoter active in Epstein-Barr virus-transformed lymphoblastoid cells. Blood 91:4645.
2 by primary cultures of bronchial epithelial cells. J. Clin. Invest. 90:1379.
This article has been cited by other articles:
![]() |
A. Liu, A. Guardino, L. Chinsangaram, M. J. Goldstein, D. Panicali, and R. Levy Therapeutic Vaccination against Murine Lymphoma by Intratumoral Injection of Recombinant Fowlpox Virus Encoding CD40 Ligand Cancer Res., July 15, 2007; 67(14): 7037 - 7044. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Wagner-Ballon, H. Chagraoui, E. Prina, M. Tulliez, G. Milon, H. Raslova, J.-L. Villeval, W. Vainchenker, and S. Giraudier Monocyte/Macrophage Dysfunctions Do Not Impair the Promotion of Myelofibrosis by High Levels of Thrombopoietin. J. Immunol., June 1, 2006; 176(11): 6425 - 6433. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Marchal-Somme, Y. Uzunhan, S. Marchand-Adam, D. Valeyre, V. Soumelis, B. Crestani, and P. Soler Cutting Edge: Nonproliferating Mature Immune Cells Form a Novel Type of Organized Lymphoid Structure in Idiopathic Pulmonary Fibrosis J. Immunol., May 15, 2006; 176(10): 5735 - 5739. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Pryhuber, H. L. Huyck, J. M. Roper, J. Cornejo, M. A. O'Reilly, R. H. Pierce, and E. N. Tsitsikov Acute Tumor Necrosis Factor-{alpha}-Induced Liver Injury in the Absence of Tumor Necrosis Factor Receptor-Associated Factor 1 Gene Expression Am. J. Pathol., June 1, 2005; 166(6): 1637 - 1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hashimoto, T. Kawabe, K. Imaizumi, T. Hara, M. Okamoto, K. Kojima, K. Shimokata, and Y. Hasegawa CD40 Plays a Crucial Role in Lipopolysaccharide-Induced Acute Lung Injury Am. J. Respir. Cell Mol. Biol., June 1, 2004; 30(6): 808 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang-Hoover and J. Stein-Streilein Tolerogenic APC Generate CD8+ T Regulatory Cells That Modulate Pulmonary Interstitial Fibrosis J. Immunol., January 1, 2004; 172(1): 178 - 185. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tsutsumi, K.-H. Sonoda, K. Egashira, H. Qiao, T. Hisatomi, S. Nakao, M. Ishibashi, I. F. Charo, T. Sakamoto, T. Murata, et al. The critical role of ocular-infiltrating macrophages in the development of choroidal neovascularization J. Leukoc. Biol., July 1, 2003; 74(1): 25 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhao, Y. Qian, D. Wald, Y.-F. Xia, J.-G. Geng, and X. Li IFN Regulatory Factor-1 Is Required for the Up-Regulation of the CD40-NF-{kappa}B Activator 1 Axis During Airway Inflammation J. Immunol., June 1, 2003; 170(11): 5674 - 5680. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Atamas, I. G. Luzina, H. Dai, S. G. Wilt, and B. White Synergy Between CD40 Ligation and IL-4 on Fibroblast Proliferation Involves IL-4 Receptor Signaling J. Immunol., February 1, 2002; 168(3): 1139 - 1145. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |