| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Infectious Diseases and
Cell Biology Research Laboratory, Tokai University School of Medicine, Isehara, Kanagawa, Japan; and
Department of Virology, Medical Institute of Bioregulation, Kyushu University, Fukuoka, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is
not impaired in NOS2-/- mice after MCMV infection. The
peritoneal macrophages from NOS2-/- mice, however,
exhibited a lower antiviral activity than those from
NOS2+/+ mice, resulting in an enhanced viral replication in
macrophages themselves. Treatment of these cells from
NOS2+/+ mice with a selective NOS2 inhibitor decreased the
antiviral activity to a level below that obtained with
NOS2-/- mice. In addition, the absence of NOS2 and
NOS2-mediated antiviral activity of macrophages resulted in not only an
enhanced MCMV replication and a high mortality but also a consequent
risk of the latency. It was thus concluded that the NOS2-mediated
antiviral activity of macrophages via NO plays a protective role
against MCMV infection at an early and late stage of the
infection. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-herpesviruses are ubiquitous microbes that commonly
infect many hosts, including humans and mice. CMV causes no apparent
clinical manifestations in immunocompetent individuals; however, it
does cause severe diseases such as encephalitis, pneumonitis,
retinitis, hepatitis, gastritis, and colitis, especially in
immunocompromised hosts including fetuses, transplant recipients, and
AIDS patients. Murine CMV
(MCMV)3 infection in
mice resembles its human counterpart in many ways with respect to the
establishment of acute, persistent, and latent infections and
host-virus interaction (1). Indeed, MCMV has a
considerable homology to human CMV on molecular and biological levels
(2). Like all herpesviruses, persistent CMV infection
occurs in multiple organs after acute infection, resulting in latency
and a consequent risk of reactivation (1). The immune responses to acute viral infection can be classified into two categories: the innate response in the early phase; and specific responses in the late phase. In innate immunity to MCMV infection, NK cells (3, 4), macrophages (5, 6), and cytokines collaboratively act as the first line of antivirus defense. In contrast, the specific immune responses by CD4+ and CD8+ T cells help remove the virus late in infection, thus resulting in a protective effect from the virus-associated pathogenicities (7, 8). Although the complete clearance of the virus may require specific T cell immunity, the innate immunity in the early phase plays a critical role in controlling the overall extent of viral replication and spread, thereby reducing the overall mortality.
Proinflammatory cytokines, such as IFN- and TNF-
, are also
involved in the elimination of the virus early or late in infection
(9, 10, 11). Among them, Th1-associated cytokine IFN-
produced by NK cells or T cells have been shown to play an important
role in the clearance of MCMV (12, 13, 14). Moreover, this
factor also plays an important role in augmenting the early NK cell
response (15) and late protective T cell response
(16) to MCMV infection.
When comparing the protective role of NK cells and various cytokines,
the role of macrophages in innate immunity against CMV infection had
yet to be elucidated. Macrophages use NO as an antiviral effector
(17, 18). NO is produced by the NO synthase (NOS)
isoforms, which convert arginine and oxygen to citrulline and NO
(19, 20). One of the isoforms, NOS type 2 (NOS2), is
expressed by macrophages after stimulation by IFN- (21, 22). The expression of NOS2 leads to a high output production of
NO from these cells in viral infection (18). NOS2-derived
NO appears to inhibit the early steps of microbial replication by
modulating their DNA synthesis (23, 24), resulting in the
microbial clearance. Indeed, NOS2-derived NO is reported to be
important in the elimination of such viruses as the vaccinia virus
(25), HSV-1 (26, 27), and EBV
(28), and the RNA viruses such as JEV (29),
CVB3 (30), and vesicular stomatitis virus
(31).
Recent works also indicated that NO inhibits CMV replication in vitro (32, 33). Moreover, Tay et al. (34) showed the importance of NOS2 activity for the clearance of CMV in vivo. However, these prior studies on the NO function in viral infections have been performed by pharmacological assays using common NOS inhibitors. The use of NOS inhibitors to investigate the role of NOS2 in CMV infection is considered to be inconclusive, because these inhibitors have non-isoform-selective nature and variation in the bioavailability. We therefore examined the in vivo role of NO in MCMV infection using NOS2-deficient mice. Using these mice, the relationship between the viral clearance by innate immunity and the resultant viral latency was also examined.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Breeding pairs of 129/SvEv x C57BL/6 mice with a disrupted NOS2 genes (NOS2-/-) were made by Drs. J. Mudgett, J. MacMicking, and C. Nathan (35) and kindly provided by Merck (Rahway, NJ). C57BL/6 and 129/SvEv were purchased from Clea Japan (Tokyo, Japan) and Biological Research Laboratories (Füllinsdorf, Switzerland), respectively, and their F1 generation was used as wild-type controls (NOS2+/+). These mice were bred in specific pathogen-free conditions in our animal facility and then were used at 6 wk. The mice in the all experiments were sacrificed after anesthetization with Nembutal. A disruption of the NOS2 in NOS2-/- mice was confirmed by RT-PCR, showing no expression of NOS2 mRNA in the peritoneal exudate cells of these mice, which had received 400 µg LPS 6 h before (data not shown). Both RNA extraction and RNA-PCR were done as described below.
Virus and virus titration
The Smith strain of MCMV (VR194) was obtained from the American Tissue Culture Collection (Manassas, VA). The stock solution was prepared from salivary glands from MCMV-infected BALB/c mice as described previously (36). The virus concentration of this MCMV stock suspension was 2.0 x 107 PFU/ml. This concentration and the virus titers in the organs of NOS2+/+ and NOS2-/- mice were determined by a plaque assay using subconfluent 3T3/Swiss albino cells as previously reported (37).
Light microscopy and transmission electron microscopy
The organs, including the salivary gland, lung, and liver, were removed after exsanguination and then fixed in 3.7% formaldehyde at room temperature for 18 h. The sections were stained with hematoxylin-eosin (38). Thin sections of the salivary gland were prepared for a morphological analysis by electron microscopy (JEM-2000EX; JEOL, Tokyo, Japan) according to the method described elsewhere (37).
NK cell cytotoxicity
The NK cell cytotoxicity was determined as described previously (15). In brief, spleen cells were prepared from both NOS2-/- and NOS2+/+ mice infected with 2 x 104 PFU MCMV on day 0. A single-cell suspension of these cells was obtained on days 1, 2, 3, and 4 after the infection and then layered on Ficoll-Paque (Pharmacia LKB, Uppsala, Sweden) and centrifuged at 400 x g for 30 min at 18°C. The lymphocytes layers were then harvested and washed twice with RPMI 1640 and used as effector cells. For the preparation of target cells, YAC-1 cells were labeled with 3.7 MBq 51Cr (per ml) (ICN Biomedicals, Costa Mesa, CA). The target cells and effector cells were mixed in 0.2 ml RPMI 1640 on a round-bottom microplate and then incubated for 4 h at 37°C. After centrifugation, the amount of radioactivity in the supernatant was measured. The NK cell activity of the effector cells was expressed as follows: % specific lysis = [(experimental 51Cr release - spontaneous 51Cr release)/(maximal 51Cr release - spontaneous 51Cr release)] x 100. Maximum release was obtained by counting acid-lysed target cells. Spontaneous release was obtained by incubating target cells in the absence of effector cells.
Cytolytic effector cell assay
Peritoneal exudate cells (PECs) from both MCMV-infected NOS2-/- and NOS2+/+ mice were harvested 2 days after the i.p. injection of 1.0 ml 10% proteose peptone by irrigating the peritoneal cavity of the mice with RPMI 1640 as previously reported (15). The PEC suspension obtained on days 3, 5, and 7 after the infection with 2 x 104 PFU of MCMV on day 0 was incubated in a culture dish at 37°C for 45 min while changing the dish twice, and then nonadherent cells were obtained for use as effector cells. To prepare target cells, MCMV-infected primary mouse embryonic fibroblasts (MEFs) were prepared from C57BL/6 as described previously (39), and then labeled with 3.7 MBq 51Cr (per ml) (40). The target cells and nonadherent PECs were mixed at various ratios in 0.2 ml RPMI 1640 on a V-bottom 96-well microplate and then incubated for 4 h at 37°C. After centrifugation, the amount of radioactivity in the supernatant was measured. The cytolytic activity was expressed by the same formula as that used in the NK cell cytotoxicity assay. Maximum and spontaneous releases were obtained by the same methods used in the NK cell cytotoxicity assay.
Cell preparations
To enrich NK cells and CD4+ T cells, B
cells and CD8+ T cells were depleted from the
spleen cells by immunomagnetic negative selection (41). In
brief, spleen cells from NOS2+/+ or
NOS2-/- mice were incubated at 4°C with
magnetic particles bound to goat anti-mouse IgG (PerSeptive
Biosystems, Framingham, MA). The magnetic particles attached to cells
were then removed using a magnet (PerSeptive Biosystems), while leaving
behind any surface IgG-negative cells. Such B cell-depleted spleen
cells were further depleted of CD8+ T cells by
incubation with magnetic particles bound to anti-CD8 (Lyt2) (Dynal,
Oslo, Norway). The depletion of B cells and CD8+
T cells was confirmed by flow cytometry using the Abs FITC-conjugated
anti-CD45R/B220 (RA3-6B2; PharMingen, San Diego) and
anti-CD8 (5-6.7; PharMingen) (data not shown).
Cytokine measurement
A cytokine production assay was performed as reported previously
(42). The spleen cells devoid of both B cells and
CD8+ T cells were resuspended at a final
concentration of 2.5 x 106/ml and then were
cultured in 1.0 ml of aliquots containing 10 µg/ml Con A in a 24-well
plate. The supernatants were harvested after 48 h, and the
cytokine level was quantified using the sandwich ELISA technique.
Briefly, a 96-well ELISA plate was coated with anti-cytokine Ab.
After washing and blocking, the well was incubated with samples or
standards, and then biotinylated anti-cytokine Ab was added. Next,
streptavidin-peroxidase and a peroxidase substrate were added to induce
a colorimetric reaction. To assay the cytokines, the following coating
Abs, biotinylated Abs, and standards were used: IFN-, R4-6A2
(PharMingen, San Diego, CA); XMG1.2 (PharMingen); rIFN- (Life
Technologies, Gaithersburg, MD); IL-4, BVD4-1D11 (PharMingen);
BVD4-24G2 (PharMingen); and rIL-4 (Life Technologies).
Collection of proteose peptone-induced peritoneal macrophages
Proteose peptone-induced peritoneal macrophages were prepared as follows. The mice were injected i.p. with 10% proteose peptone. At 2 days after the injection, PECs were harvested in HBSS. After centrifugation, these cells were suspended in RPMI 1640 supplemented with 10% FCS and cultured in a 24-well plate for 12 h at 37°C in a 5% CO2 atmosphere. Next, adherent cells were gently washed with PBS after removing any nonadherent cells and were used as protease peptone-induced peritoneal macrophages.
RNA-PCR for NOS2
Both RNA extraction and RNA-PCR were conducted as previously
reported (38). In brief, RNA from the peritoneal
macrophages of MCMV-infected mice was extracted using ISOGEN (Nippon
Gene, Toyama, Japan) according to the manufacturer’s manual. RNA-PCR
was performed with the mRNA-PCR kit (Takara Shuzo, Shiga, Japan). The
primers for a disrupted region of NOS2 were selected from the published
sequence data (19, 20). The base sequences were follows:
NOS2–5'-primer CTTGCCCCTGGAAGTTTCTCTT (189–210), NOS2–3'-primer
GCTGGTAGGTTCCTGTTGTTTC (686–707). RNA-PCR for -actin was
performed as previously reported (38), using commercially
available primers (Clontech, Palo Alto, CA).
Measurement of NO from peritoneal macrophages
Proteose peptone-induced peritoneal macrophages from infected NOS2+/+ or NOS2-/- mice were prepared as mentioned above. These cells after a new in vitro infection (multiplicity of infection (MOI), 0.005) were cultured in a 24-well plate at 1 x 107/well for 24 h at 37°C in a 5% CO2 atmosphere, and then the culture supernatants were harvested. The measurement of NO (NO2-/NO3-) in the supernatants was performed using the assay kit (NO2/NO3 assay kit-Fluometric; Dojindo, Kumamoto, Japan) as described previously (43). In brief, 80 µl of the sample were added to the well of a 96-well fluoroplate (Fluoroplate LS9502867; Iwaki Glass, Cjiba, Japan). Then, 10 µl nitrate reductase, which converted nitrate to nitrite, and 10 µl NADPH, which initiated the reaction, were added. The samples were incubated for 1 h at 37°C. Next, the samples were incubated for 15 min at room temperature after the addition of the substrate, 2,3-diaminonaphthalene, and the reaction was terminated by adding 10 µl NaOH. The fluorescence of the wells was measured by a fluorometric ELISA reader (Fluoroscan II, excitation 365 nm, emission 450 nm; Dainippon Seiyaku, Osaka, Japan). The standard curve was obtained by the control solution of the kit.
In vitro analysis of anti-MCMV activity of peritoneal macrophages
Proteose peptone-induced peritoneal macrophages were prepared as described above. These cells were placed in a 96-well microplate at 1 x 106/well, and then the cells were infected with MCMV (MOI, 0.005). At various times after the new in vitro infection, the supernatant was harvested. The productive virus in the supernatant was determined by a plaque assay as described above. The intrinsic antiviral activity was determined by measuring the amount of productive virus in the supernatant. In some experiments, MEG ((2-mercaptoethyl)guanidine; Cayman Chemical, Ann Arbor, MI) was used to inhibit the NOS2 activity of peritoneal macrophages in this assay.
Phagocytic activity of peritoneal macrophages
The peritoneal macrophages were prepared as described above. These cells were pulsed with fluorescent FluoSpheres beads (Molecular probes, Eugene, OR) in a 24-well plate and then incubated at 37°C. At selected time points, the cells were harvested, and the bead accumulation was analyzed in a FACScan.
Detection of MCMV DNA in organs
DNA extraction from the organs and DNA-PCR for detection of MCMV DNA were performed as described previously (36). In short, the MCMV-DNA of the immediate early (IE) region was enhanced by PCR using two oligonucleotide primers (primer 1, 1701–1730; primer 2, 2371–2400) as reported previously (43). This primer pair amplified the 700-bp segment. PCR was performed in an automated thermal cycler (Program Temperature Control System PC-700; Astec, Fukuoka, Japan) after the addition of Taq polymerase (Ex taq; Takara Shuzo, Otsu, Shiga, Japan). The samples were then electrophoresed on 2% (w/v) agarose gel containing 1 µg/ml ethidium bromide in Tris-acetate buffer, and visualized by UV fluorescence (44).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
At first, the susceptibility of NOS2-/-
mice against MCMV was examined by changing the inoculation doses of
MCMV (Fig. 1
). The inoculation of MCMV
led to early mortality in NOS2-/- mice when
given only 3.7 x 104 PFU of the virus. In
contrast, the NOS2+/+ mice were still resistant
to such a viral load; however, they began to succumb at 3.3 x
105 PFU, which was about a 10 times larger number
than that for NOS2-/- mice.
NOS2-/- mice thus appear to be highly
susceptible to infection with MCMV in comparison with
NOS2+/+ mice.
|
The absence of NOS2 led to a high mortality in MCMV infection
(Fig. 1
). We next investigated the role of NOS2 in viral replication.
NOS2+/+ and NOS2-/- mice
were sublethally infected with 2.0 x 104
PFU MCMV, and the infectious virus number in the organs was determined
by a plaque assay (Fig. 2). The salivary
gland, the optimal organ for MCMV replication, generated a much higher
virus titer in NOS2-/- mice than in
NOS2+/+ mice (Fig. 2A). The titer in
NOS2-/- mice reached a peak 4 wk after
infection. (log10 PFU/organ = 10.5), whereas
that in NOS2+/+ mice peaked 2 wk postinfection
(log10 PFU/organ = 6.3). Consistent with
these observations, an electron microscopic analysis showed a large
amount of MCMV in the salivary gland of NOS2-/-
mice, whereas only a few virus particles were noted in the organ of
NOS2+/+ mice (Fig. 3). The productive virus was transiently
detected in the spleen, lung, and liver of
NOS2-/- mice, whereby it was not detected in
these organs of NOS2+/+ mice (Fig. 2B). It is thus demonstrated that the lack of NOS2 activity
led to a marked increase of the virus number in the organs after MCMV
infection. Whereas a large number of the virus were generated in the
salivary gland, and to a lesser extent in the other organs including
the lung and liver of NOS2-/- mice,
histological examinations of these organs showed no apparent tissue
injury or abnormality at this sublethal dose (Fig. 4, A and B, and
data not shown). In contrast, the lung and liver of
NOS2-/- mice exhibited a marked tissue
inflammation and injury with a higher lethal dose, 1.1 x
105 PFU of the virus (Fig. 4C),
resulting in virus-induced diseases including pneumonitis and hepatitis
with necrosis and bleeding (45), resulting in death
(Fig. 1).
|
|
|
The early nonspecific responses by NK cells have been clearly
shown to provide resistance in acute stage of MCMV infection (3, 4), and the CTL is critical in the late stage of the infection
(8). We therefore examined how a high mortality
accompanied with a high virus titer in NOS2-/-
mice is concerned with the immune responses to MCMV in these mice. As
shown in Fig. 5, the MCMV-induced NK cell
cytotoxicity in NOS2-/- mice was comparable to
that from NOS2+/+ mice. Moreover, the specific
CTL response to this virus was not impaired in MCMV-infected
NOS2-/- mice (Fig. 6). As a result, the cell-mediated
immunity to MCMV infection was intact in
NOS2-/- mice, thus suggesting that the
susceptibility to this virus infection is due to the absence of
NOS2.
|
|
after acute infection
Th1-associated cytokine IFN-, especially produced by NK cells
(13) or CD4+ T cells
(9), is also important for MCMV clearance early or late in
infection. Moreover, the T cell-dependent IFN- production has been
found to play a critical role in the augmentation of NK cell activity
(15). We therefore measured the ability of IFN-
production in NOS2-/- mice to examine whether a
failure in such cytokine production is involved in the susceptibility
to MCMV infection. As shown in Fig. 7A, CD4+
T cell-enriched spleen cells from MCMV-infected
NOS2-/- mice successively produced a large
amount of IFN- lasting up to day 14 after infection when stimulated
with Con A, whereas production by those from
NOS2+/+ mice was transient with a peak on day 7.
In contrast, the production of Th2-associated cytokine, IL-4, was
undetectable in NOS2-/- mice on days 7 and 14
after MCMV infection (Fig. 7B). As a result, the unimpaired
IFN- productivity and the skewing to Th1 response in immunity were
observed in NOS2-/- mice. These results
indicated that the high susceptibility to MCMV infection in
NOS2-/- mice is not due to the defect of the
IFN- productivity.
|
NOS2-/- mice showed a high susceptibility
to MCMV infection (
Figs. 1–3) despite the normal immune responses
(
Figs. 5–7). We next examined whether macrophages, a dominant source
of NOS2-derived NO, contribute to the control of MCMV infection in the
acute phase. The enhanced expression of NOS2 mRNA in peritoneal
macrophages of NOS2+/+ mice was observed on day 3
after infection, lasting up to day 7, whereas no NOS2 mRNA was
expressed in NOS2-/- mice (Fig. 8A). This result implied that
NOS2-associated antiviral activity of macrophages play a role in
inhibiting the viral replication and eliminating the virus in vivo. It
has been demonstrated that the proficiency of MCMV replication in the
macrophages themselves determines the virulence and the virus-induced
pathogenesis in vivo (6, 45, 46). The efficiency of
inhibiting viral replication in macrophages themselves has been defined
as the intrinsic antiviral activity of these cells (45).
We therefore examined the intrinsic antiviral activity of the
macrophages from NOS2+/+ and
NOS2-/- mice. The intrinsic antiviral activity
of naive macrophages from NOS2-/- mice was
comparable with that from NOS2+/+ mice on day 3
after in vitro MCMV infection (the productive virus titer in the
culture supernatant was 213 ± 83.3 PFU/ml in
NOS2-/- mice and 200 ± 40.0 PFU/ml in
NOS2+/+ mice). However, the activity of these
cells from NOS2-/- mice was lower than that
from NOS2+/+ mice on day 9 after the in vitro
infection (the productive virus titer in the supernatant was 1800
± 174 PFU/ml in NOS2-/- mice and 653 ±
92.4 PFU/ml in NOS2+/+ mice) (Fig. 8B). The treatment of these cells from
NOS2+/+ mice with MEG, a selective NOS2
inhibitor, decreased the antiviral activity to a level below that
obtained in the NOS2-/- mice (Fig. 8B). The phagocytic activity in the macrophages of the both
mice was intact (data not shown). Consistent with this finding, the
peritoneal macrophages from NOS2+/+ mice on day 3
of infection, in which a high expression of NOS2 mRNA (Fig. 8A) was observed, produced a higher amount of NO in the
culture supernatant on in vitro reinfection
(NO2-/NO3- on days 1
and 2 after the reinfection was 12.9 ± 0.8 and 18.6 ± 2.3
µM in NOS2+/+ mice and 9.3 ± 0.9 and
10.7 ± 0.8 µM in NOS2-/- mice,
respectively), thus leading to a significantly higher intrinsic
antiviral activity in these cells (Fig. 8C). However, the
productive virus titer increased after the cells from
NOS2+/+ mice were treated with MEG, thus
resulting in a marked reduction of the antiviral activity (Fig. 8C). As a result, NOS2-derived NO produced by macrophages
and/or the NOS2-associated antiviral function may greatly help control
MCMV infection at an early stage of infection.
|
MCMV latently infects its host for a long time after acute
infection. A latent MCMV infection, which is determined as the presence
of viral DNA without any infectious particles, has been observed in a
wide variety of organs, including the lung, spleen, kidney, and
salivary gland (1). We, therefore, investigated the role
of NOS2 in latent MCMV infection using a PCR analysis
(47). No infectious virus was observed in the lung of
NOS2+/+ or NOS2-/- mice 4
wk after infection (Fig. 2B). In contrast, MCMV- DNA was
definitely detected in the lung of NOS2-/- mice
up to 32 wk after infection (Table I; see
the boxed data). Furthermore, the NOS2-/- mice
exhibited a delayed clearance of MCMV-DNA in the salivary gland,
spleen, and kidney. It is thus indicated that NOS2 plays a significant
role not only in the initial clearance but also in its latency after
acute MCMV infection.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
There are three well-characterized isoforms of NOS including NOS1 (neuronal NOS), NOS2, and NOS3 (endothelial NOS) (17). In particular, NOS2-derived NO has appeared to be important in the elimination of many viruses including CMV in vitro and in vivo (32, 33, 34). However, the role of NOS2-derived NO in CMV infection has been unclear, especially in vivo, because most of these studies used common NOS inhibitors that exhibit nonspecific effects. We resolved this issue using an in vivo mouse model.
Immune responses are engaged in both the clearance of the virus from
infected cells and the inhibition of virus dissemination among the
cells, which thus results in a reduced viral burden in the host. The
importance of NK cells or T cells in controlling MCMV infection has
been definitely established (49). In the present study,
however, the susceptibility to MCMV infection in
NOS2-/- mice (
Figs. 1–3) is not due to a
failure of such immune responses as NK cell activity, CTL response, and
IFN- productivity, because these responses to the virus are intact
even in NOS2-/- mice after infection (
Figs. 5–7). These findings also suggested that the NOS2-dependent pathway
plays a critical role in controlling MCMV infection.
As for NK cell cytotoxicity in microbial infections, Diefenbach et al.
(50) recently showed that the activity to Leishmania
major infection is significantly reduced in
NOS2-/- mice, and NOS2 is required for the
induction of this activity. This impairment of NK activity may be due
to a defect in the NO-mediated JAK/STAT signaling pathway via IL-12 and
IFN- in NK cells (51). In the current study,
however, the NK activity was not impaired even in
NOS2-/- mice after MCMV infection (Fig. 5).
Consistent with our findings, Bartholdy et al. (52)
reported that the NK activity to lymphocytic choriomeningitis virus or
vesicular stomatitis virus infection remains intact in
NOS2-/- mice. The discrepancy between the
results may be attributable to cytokine release (i.e., IL-18) after
infection, because the IL-18-dependent NK activity, which is
independent of the JAK/STAT signaling pathway (53), can be
induced during MCMV infection (54). In contrast to the
situation in microbial infection, NOS2-derived NO appears not to be
involved in the enhancement of the NK activity after virus
infections.
Specific immune responses including Th and CTL are required to remove
the virus (49). These responses are strictly regulated by
the Th1/Th2 balance. This balance is therefore critical for obtaining
effective immunity in microbial infection (55). Our
current study shows a Th1 bias (predominant IFN- production) in
NOS2-/- mice after MCMV infection that appears
to be induced by the lack of NOS2 activity (Fig. 7). Indeed, the data
from many laboratories have shown that NO affects the Th1/Th2
immunoregulatory balance and specifically down-regulates the Th1-type
cytokine IL-2 and IFN- and/or increases the Th2-associated cytokine
IL-4 (56). In addition, increased Th1 responses in the
absence of NO have been reported in the mouse in vivo model of
leishmaniasis (57), toxic shock syndrome
(35), bacterial septic arthritis (58),
vaccination with attenuated Schistosoma mansoni
(59), HSV-1 infection (60), and influenza
virus infection (61). These findings strongly suggested
that Th1 bias in some microbial infections is due to the absence of
NOS2-derived NO. Th1 bias, however, does not seem to be detrimental to
NOS2-/- mice infected with MCMV, because
IFN-, a potent antiviral cytokine, is produced much after infection
in these mice (Fig. 7A). Moreover, IFN- and/or other
Th1-related cytokines seem to play an essential role in establishing
late cell-mediated protective function including T or B cell response
(16, 62). In fact, CTL activity is not impaired in
NOS2-/- mice (Fig. 6). Such effectors as CTL
and IFN- may contribute to the final clearance of MCMV in the late
phase of infection even in the NOS2-/-
mice.
Macrophages appear to have dual, even paradoxical, roles:
one as a host for CMV replication; and another as an effector cell for
eliminating the virus. Hanson (46) recently reported that
the proficiency of MCMV replication in macrophages themselves
positively correlates with virulence in vivo. Indeed, macrophages, a
dominant source of NOS2-derived NO, play a protective role against MCMV
infection by the expression of the intrinsic antiviral activity
(6, 45). These findings show the possibility that the
absence of NOS2-mediated antiviral activity of macrophages may enhance
the viral replication in these cells, hence severe virus-induced
pathogenicity. In line with these findings, our data show that
NOS2-/- mice exhibit a high susceptibility to
MCMV infection such as a high virus titer and increased mortality
(
Figs. 1–3). The immune response to MCMV including NK cells and CTL is
intact even in NOS2-/- mice (
Figs. 5–7);
however, these mice exhibit a reduced NOS2-dependent intrinsic
antiviral activity of macrophages at an early stage of infection (Fig. 8). In addition, a DNA-PCR analysis showed that the DNA copy number of
MCMV in peritoneal macrophages of NOS2-/- mice
on day 7 of infection is about 10 times larger than that of
NOS2+/+ mice (data not shown), also suggesting
that macrophages of NOS2-/- mice themselves are
good reservoirs of MCMV in vivo because of the lower intrinsic
antiviral activity. These results strongly demonstrated that NOS2 is
required for the induction of antiviral activity of macrophages and
that NOS2-derived NO from these cells plays a crucial role in
controlling MCMV infection in the acute phase.
Latent and/or persistent CMV infection causes serious clinical symptoms
and a consequent establishment of reactivation is a major obstacle in
immunocompromised individuals. In this study, we further examined the
role of NOS2 in MCMV latency. Viral latency is determined as the
presence of viral DNA without infectious viral particles. Thus far, the
demonstration of viral latency has primarily been based on PCR assay
used in many experiments. Therefore, in the present experiment, DNA-PCR
was used to detect the MCMV-DNA, given that this method has been
reported to be sensitive (47). As a result, MCMV-DNA was
shown to latently remain in such organs as the lung, salivary gland,
spleen, and kidney of NOS2-/- mice, while it
became undetectable more rapidly in the same organs of
NOS2+/+ mice (Table I). Regarding the salivary
glands, it appears that the establishment of a latent infection
correlates with the amount of viral burden during acute infection (Fig. 2). Therefore, the tendency of MCMV latency in
NOS2-/- mice to remain may be due to the
failure of NOS2-dependent initial clearance of the virus. However,
MCMV-DNA latently remained in the lungs of
NOS2-/- mice even after 16 wk of infection to
the same extent as in the salivary glands of those mice (detection
rate, 25% in both (Table I)), whereas the infectious virus could
transiently be detected at 2 wk postinfection in the lungs (Fig. 2).
Numerous reports have been published on the predilection of the lungs
as organs for CMV latency and persistency (63). Such a
predilection might also be prominent in NOS2-/-
mice. NOS2 thus plays an important role not only in the initial
clearance but also in its latency after acute MCMV infection.
In conclusion, NOS2-derived NO plays a crucial role in controlling MCMV infection through macrophages in the early stage of infection, including antiviral immunity, viral replication, and the establishment of the viral latency. Therefore, the NOS2-mediated control of MCMV infection may render it possible to reduce the virus-induced pathogenicity.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Satoshi Noda, Department of Infectious Diseases, Tokai University School of Medicine, Isehara, Kanagawa 259-1193, Japan.
3 Abbreviations used in this paper: MCMV, murine CMV; NOS, NO synthase; PECs, peritoneal exudate cells; MEFs, mouse embryonic fibroblasts; MEG, (2-mercaptoethyl)guanidine; IE, immediate early; MOI, multiplicity of infection.
Received for publication August 21, 2000. Accepted for publication December 26, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and tumor necrosis factor. J. Gen. Virol. 75:101. interferon and tumor necrosis factor in macrophage activation during murine cytomegalovirus and herpes simplex virus infections. J. Virol. 69:904.[Abstract]
regulates acute and latent murine cytomegalovirus infection and chronic disease of the great vessels. J. Exp. Med. 188:577.-Interferon-dependent clearance of cytomegalovirus infection in salivary gland. J. Virol. 66:1977. in defense against murine cytomegalovirus infection and enhancement of this defense pathway by interleukin 12 administration. J. Exp. Med. 182:1045., and TNF effects on antiviral state and NK cell responses during murine cytomegalovirus infection. J. Immunol. 156:4746.[Abstract]
interferon combats viral escape. J. Virol. 68:289.-induced nitric oxide synthase. Science 261:1445.-induced indoleamine 2,3-dioxygenase and inducible nitric oxide synthase in the replication of human cytomegalovirus in retinal pigment epithelial cells. J. Immunol. 162:957./) and type 2 nitric oxide synthase regulate the innate immune response to a protozoan parasite. Immunity 8:77.[Medline]
-dependent clearance of Influenza A virus and protection from consolidating pneumonitis in nitric oxide synthase-deficient mice. J. Exp. Med. 188:1541.This article has been cited by other articles:
|
|
 |
|
  C. M. Rosenberger, A. E. Clark, P. M. Treuting, C. D. Johnson, and A. Aderem ATF3 regulates MCMV infection in mice by modulating IFN-{gamma} expression in natural killer cells PNAS, February 19, 2008; 105(7): 2544 - 2549. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. R. Humphreys, C. de Trez, A. Kinkade, C. A. Benedict, M. Croft, and C. F. Ware Cytomegalovirus exploits IL-10-mediated immune regulation in the salivary glands J. Exp. Med., May 14, 2007; 204(5): 1217 - 1225. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zhang, J. Zhou, B. Marshall, H. Xin, and S. S. Atherton Lack of iNOS Facilitates MCMV Spread in the Retina Invest. Ophthalmol. Vis. Sci., January 1, 2007; 48(1): 285 - 292. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Jayasekera, C. G. Vinuesa, G. Karupiah, and N. J. C. King Enhanced antiviral antibody secretion and attenuated immunopathology during influenza virus infection in nitric oxide synthase-2-deficient mice. J. Gen. Virol., November 1, 2006; 87(Pt 11): 3361 - 3371. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Noda, S. A. Aguirre, A. Bitmansour, J. M. Brown, T. E. Sparer, J. Huang, and E. S. Mocarski Cytomegalovirus MCK-2 controls mobilization and recruitment of myeloid progenitor cells to facilitate dissemination Blood, January 1, 2006; 107(1): 30 - 38. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Strobl, I. Bubic, U. Bruns, R. Steinborn, R. Lajko, T. Kolbe, M. Karaghiosoff, U. Kalinke, S. Jonjic, and M. Muller Novel Functions of Tyrosine Kinase 2 in the Antiviral Defense against Murine Cytomegalovirus J. Immunol., September 15, 2005; 175(6): 4000 - 4008. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Freude, J. Hausmann, M. Hofer, N. Pham-Mitchell, I. L. Campbell, P. Staeheli, and A. Pagenstecher Borna Disease Virus Accelerates Inflammation and Disease Associated with Transgenic Expression of Interleukin-12 in the Central Nervous System J. Virol., October 25, 2002; 76(23): 12223 - 12232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Kosugi, H. Kawasaki, Y. Arai, and Y. Tsutsui Innate Immune Responses to Cytomegalovirus Infection in the Developing Mouse Brain and Their Evasion by Virus-Infected Neurons Am. J. Pathol., September 1, 2002; 161(3): 919 - 928. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-E. Janelle, A. Gravel, J. Gosselin, M. J. Tremblay, and L. Flamand Activation of Monocyte Cyclooxygenase-2 Gene Expression by Human Herpesvirus 6. ROLE FOR CYCLIC AMP-RESPONSIVE ELEMENT-BINDING PROTEIN AND ACTIVATOR PROTEIN-1 J. Biol. Chem., August 16, 2002; 277(34): 30665 - 30674. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
