The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Afanassieff, M.
Right arrow Articles by Miller, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Afanassieff, M.
Right arrow Articles by Miller, M. M.
The Journal of Immunology, 2001, 166: 3324-3333.
Copyright © 2001 by The American Association of Immunologists

At Least One Class I Gene in Restriction Fragment Pattern-Y (Rfp-Y), the Second MHC Gene Cluster in the Chicken, Is Transcribed, Polymorphic, and Shows Divergent Specialization in Antigen Binding Region1 ,2

Marielle Afanassieff3,*,{dagger}, Ronald M. Goto*, Jennifer Ha*, Mark A. Sherman{ddagger}, Lingwen Zhong*, Charles Auffray§, Françoise Coudert{dagger}, Rima Zoorob§ and Marcia M. Miller4,*

* Department of Molecular Biology, Beckman Research Institute, City of Hope National Medical Center, Duarte, CA 91010; {dagger} Institut National de la Recherche Agronomique, Station de Pathologie Aviaire et Parasitologie, Nouzilly, France; {ddagger} Department of Biology, Beckman Research Institute, City of Hope National Medical Center, Duarte, CA 91010; and § Centre National de la Recherche Scientifique, Unité Propre de Recherche 420, Génétique Moléculaire et Biologie du Développement, Villejuif, France


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MHC genes in the chicken are arranged into two genetically independent clusters located on the same chromosome. These are the classical B system and restriction fragment pattern-Y (Rfp-Y), a second cluster of MHC genes identified recently through DNA hybridization. Because small numbers of MHC class I and class II genes are present in both B and Rfp-Y, the two clusters might be the result of duplication of an entire chromosomal segment. We subcloned, sequenced, and analyzed the expression of two class I loci mapping to Rfp-Y to determine whether Rfp-Y should be considered either as a second, classical MHC or as a region containing specialized MHC-like genes, such as class Ib genes. The Rfp-Y genes are highly similar to each other (93%) and to classical class Ia genes (73% with chicken B class I; 49% with HLA-A). One locus is disrupted and unexpressed. The other, YFV, is widely transcribed and polymorphic. Mature YFV protein associated with {beta}2m arrives on the surface of chicken B (RP9) lymphoma cells expressing YFV as an epitope-tagged transgene. Substitutions in the YFV Ag-binding region (ABR) occur at four of the eight highly conserved residues that are essential for binding of peptide-Ag in the class Ia molecules. Therefore, it is unlikely that Ag is bound in the YFV ABR in the manner typical of class Ia molecules. This ABR specialization indicates that even though YFV is polymorphic and widely transcribed, it is, in fact, a class Ib gene, and Rfp-Y is a region containing MHC genes of specialized function.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
MHC class I genes are often described as being either classical (class Ia) or nonclassical (class Ib). Class Ia genes are ubiquitously expressed encoding the polymorphic transplantation Ags that are the basis of rapid graft rejection. They include human HLA-A, -B, and -C; murine H2-K, -D, and -L; two loci in the chicken B system; and additional loci in a number of other species. Class Ia molecules present peptide-Ag to CTL. At the cell surface class Ia molecules are tripartite, composed of the polymorphic heavy chain, bound peptide, and {beta}2-microglobulin ({beta}2m).5 By contrast, the MHC class Ib genes, such as human HLA-E, -F, -G, H, I, and J; murine H2-Q, -T, and -M; mammalian CD1, Hfe, and Xenopus NCI genes, are generally not polymorphic in the manner of class Ia; but, there are exceptions, such as Q2 (1). Nonclassical molecules generally have weak influences in graft rejection. Some class Ib loci lie within or near the MHC, and a portion of these are phylogenetically close to class Ia loci. Other, usually older class Ib loci are located in paralogous regions on entirely different chromosomes. Many class Ib molecules are restricted in expression to particular tissues. Some class Ib molecules have critical roles in regulating NK cell activity (2), and trafficking of these to the cell surface can be dependent upon the binding in the Ag binding region (ABR) of peptide derived from signal sequences of other class I molecules (3). Still others, such as FcRn (4) and Hfe (5), function in the delivery of particular molecules across cellular boundaries via molecular interactions independent of the ABR. Although divergent to various degrees in primary sequences, the class Ib and class Ia heavy chain molecules share many elements of tertiary structure in common. Many, but not all, class Ib molecules bind {beta}2m.

A characteristic often useful for distinguishing between class Ia and class Ib molecules is a set of 8 aa present in the {alpha}1 and {alpha}2 domains of the class I heavy chain (6, 7). These amino acids in the ABR are effectively invariant in all class Ia molecules and contrast strikingly with the many polymorphic residues in the region. These residues are essential in sequence-independent anchoring of peptide-Ag. Substitutions are present at one or more of these eight positions in nearly all class Ib molecules, although a few exceptions to this are found among H2-Q and H2-T loci. In some class Ib molecules, particular substitutions are associated with anchoring special forms of Ag (8). For example, N-formylated peptides (9) are bound by the mouse-nonclassical H2-M3 molecules in an ABR made more hydrophobic by the presence of phenylalanine and leucine at two of the eight critical positions. Glycolipids and lipoglycans are presented by transporter associated with Ag processing (TAP)-independent CD1 molecules (10, 11). In the ABR of CD1 there are multiple, generally hydrophobic substitutions occurring at the eight residues. Other substitutions are present in other class Ib molecules and are associated with other modifications of the ABR, such as closing of the groove in FcRn (12).

Restriction fragment pattern-Y (Rfp-Y) and B are two genetically independent clusters of MHC class I and class II{beta} genes in the chicken that map to a single microchromosome (chromosome 16) (13, 14, 15, 16). Also mapping to chromosome 16 is the single nucleolar organizer region found within the chicken genome (17) and a single nonpolymorphic classical class II{alpha} locus (18). A chromosomal region supporting highly frequent meiotic recombination, perhaps associated with the nucleolar organizer region, separates B and Rfp-Y such that the two clusters are genetically unlinked even though they are located on the same microchromosome (15, 16). This arrangement is quite different from the arrangement of class I loci in the mouse into H-2K and H-2D where the loci remain linked despite physical separation. Rfp-Y was detected initially when two sets of polymorphic restriction fragments revealed by B system class I and class II probes were found to assort independently of one another in families of fully pedigreed animals (13). Rfp-Y was later found to correspond to the cosmid clusters II/IV and III in the molecular map (19) of chicken MHC genes (14, 15).

At least two class I{alpha} heavy chain genes (YFV and YFVI), three class II{beta} genes (YL{beta}III, YL{beta}IV, and YL{beta}V) (20), a c-type lectin gene (21), and two additional genes (13.1 and 17.8) of unknown identity map to Rfp-Y. The classical B system is a compact gene region that determines rapid allograft rejection. A large portion of the B cluster has been sequenced and found to contain 19 genes within a 92-kb region, virtually all of which have counterparts in the human MHC (22). Included among these are two polymorphic class I heavy chain and two polymorphic class II{beta} loci (19, 23, 24, 25).

Because the small number of chicken class I{alpha} heavy chain and class II{beta} chain genes are essentially equally divided between B and Rfp-Y, the two clusters might originate from duplication of an entire chromosomal segment providing duplicate sets of loci with similar functions. Alternatively each may perform specialized, complementary functions as is becoming apparent for mammalian classical and nonclassical regions (8). For example, the Rfp-Y loci might in some instances provide molecules supplementing the less than comprehensive Ag presentation that is so characteristic of the B system (26). To begin to define the basis of the organization of chicken MHC genes into two genetically independent clusters, we subcloned and fully sequenced the YFV and YFVI loci located in the Rfp-Y cosmid cluster map. We analyzed the sequences of these loci with respect to those of known class Ia and class Ib loci and evaluated their polymorphism. We extensively analyzed gene transcription and the capacity of YFV cDNA to produce mature Rfp-Y class I molecules upon transfection.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals

Clone c{beta}10 was isolated from a cosmid library made from line CB (B*12, Yw*7.1) (27). (We use the w* notation with all Rfp-Y haplotypes to indicate that assignments are subject to further refinement.) For transcription analysis 12- and 19-day-old line CB embryos were provided by Pierrick Thoraval from stock maintained at Institut National de la Recherche Agronomique (Nouzilly, France). One-year-old male birds from line C were provided by Larry Bacon from stock maintained at the US Department of Agriculture Avian Disease and Oncology Laboratory (ADOL) (East Lansing, MI). Lines C and CB both originate from the Reaseheath line RH-C. Lines CB and C are inbred and homozygous for the same B and Rfp-Y haplotypes. Other Rfp-Y haplotypes analyzed include Yw*1.3, Yw*2.1, Yw*3.1, and Yw*6.1 from Northern Illinois University (13); Yw*4.2 and Yw*5.3 from University of New Hampshire (R.L. Taylor, Jr. and M.M., unpublished data); and Yw*7.2, Yw*8.1, and Yw*9.1, provided by Larry Bacon (28).

Subcloning and sequencing of YFV and YFVI

The 3.55- and 4.8-kb BglII fragments of c{beta}10 (27) containing the YFVw*7.1 and YFVIw*7.1 genes, respectively, were subcloned into the BamHI site in Bluescript II KS (Stratagene, La Jolla, CA) to provide pYFVw*7.1 and pYFVIw*7.1. Sequences of the YFVw*7.1 and YFVIw*7.1 genes were obtained through the successive application of two techniques. First, the sequences of exons 2, 3, 4, and 5, and introns 2, 3, and 4 of each gene were defined by sequencing of products obtained by PCR with primers designed from the B-FIV*12 gene sequence (29). Two hundred nanograms of cosmid c{beta}10 clone DNA, 10 ng of pYFVw*7.1 and pYFVIw*7.1 plasmid DNA were used as templates. PCR amplifications consisted of 35 cycles of 95°C for 1 min, 60°C for 45 s, and 72°C for 45 s using Taq DNA polymerase buffer with 400 nM of each primer, 200 µM of each dNTP (Pharmacia, Piscataway, NJ), and 1 U of Taq DNA polymerase (PE Biosystems, Foster City, CA). A fraction of each reaction product was cloned using the TA cloning vector (Invitrogen, San Diego, CA), and the nucleotide sequence of the insert was fully determined by dideoxy chain termination with a Prism Ready Reaction Dye Terminator Cycle Sequencing Kit and a 370A DNA Sequencer (PE Biosystems). To identify any errors due to misincorporation by Taq polymerase, three to six independent PCR were conducted for each primer set and 4–10 clones per PCR were fully sequenced. The sequences upstream of exon 2 and downstream of exon 5 were obtained by direct sequencing of the pYFVw*7.1 and pYFVIw*7.1 plasmids with annealing primers designed from previously determined sequences.

Isolation of additional YFV clones

A YF-specific clone, 163/164f, was generated by PCR from YFVw*3.2 DNA and corresponds to exons for Cy1, Cy2, Cy3, and portions of surrounding introns of YFV (see Fig. 1Go). Clone 163/164f was used in turn to isolate a full-length cDNA clone, c36f, from a cDNA library made from the small intestine of a UCD line 330 young adult bird. An additional clone, cos2, was also obtained by 163/164f screening from a SuperCos I cosmid library (Stratagene) produced from a bird (wb3078) heterozygous for two additional Rfp-Y haplotypes designated Yw*1.1 and Yw*5.1. Cos2 was determined to originate from Yw*5.1 by restriction fragment pattern. A YFV subclone, pcr75171–3, was derived from cos2 and sequenced from the clone margins.



View larger version (67K):
[in this window]
[in a new window]
  		FIGURE 1. Nucleotide sequences of the YFVw*7.1 and YFVIw*7.1 loci are aligned with the sequence of chicken classical class I locus BFIV*12. Exon sequences are presented as codons, and introns as uninterrupted sequence. Intron boundary sequences and the ATG start site are in bold print and underlined. The sequence of the hexanucleotide repeat region in YFVIw*7.1, the gene regions in YFVw*7.1 amplified with the YF{alpha}1-5' and YF{alpha}1-3' primer pair, the gene region corresponding to the YF gene-specific probe 163/164f, and the polyadenylation signal sequence are labeled and in bold print. Identity is marked by a dot, and a gap is shown as a dash. The GenBank accession numbers are AF218783 (YFVw*7.1) and AF218784 (YFVIw*7.1).

 
RNA purification

RNA was extracted from frozen tissues with RNAzol B (Tel-Test, Friendswood, TX). For 12-day-old whole embryos and 19-day-old embryo tissues RNA was purified on cesium chloride gradients.

Southern blot analysis

Samples containing 10 µg of genomic DNA were digested with restriction endonucleases, electrophoresed in 1% agarose gels, and analyzed by Southern hybridization (13). Probes included 1) a 32P-labeled oligonucleotide (TGGGGCTGGGGCTGGGGCT) designed from the exon 1 of YFVIw*7.1; 2) a 0.9-kb SacI fragment of pYFVIw*7.1 corresponding to exons 1 to 2; and 3) 163/164f.

Transcript analysis and single-stranded conformational polymorphism (SSCP) assays

Transcription analysis by RT-PCR was performed as follows: 1) first-strand cDNA was synthesized for 15 min at 37°C using 1 µg of total RNA, 40 nM primer, 200 µM dNTPs, 20 U of AMV transcriptase (Life Sciences, St. Petersburg, FL) in reverse transcriptase buffer, and a single oligonucleotide reverse primer RTBYF{alpha}2 (CCTCGAGGATGTCACAGCC) corresponding to a site in exon 3 identical in the BF and YF genes; 2) cDNA was tested for purity with PCR performed using primer pairs that span the {alpha}1 exon/intron/{alpha}2 exon boundary so that any product originating from genomic DNA can be recognized by product length; RTBYF{alpha} with BFIV{alpha}1-5' (GGGCAGCCGTGGTTCGTGACT) and with YF{alpha}1-5' (GTGGACGACAAAATCTTCGGTA). Products of the PCR (35 cycles at 95°C for 1 min, at 60°C for 45 s, and at 72°C for 45 s) were analyzed for fragment length on agarose gels; 3) cDNA free of genomic DNA was used as template for PCR performed with primers specific for the two YF loci consisting of YF{alpha}1-5' and YF{alpha}1-3' (TTTGTTGTAGCGTTCCGGCAGCC). For BFI the primer pair was BFI{alpha}1-5' (GGGCTGCCGTGGTTCGTGGAC) and BFI{alpha}1-3' (GTGTTCAAGCTCACTTCCACAC). For BFIV the primer pair was BFIV{alpha}1-5' and BFIV{alpha}1-3' (ATGCCCAGGTTCTCGCGGTCAA); and 4) presence and absence of the BF and YF transcripts were scored on the presence or absence of amplicon in agarose gels. To distinguish the locus of origin for YF amplicons obtained with YF{alpha}1-5' and YF{alpha}1-3' primers were analyzed by SSCP (30). For this, 1–3 µl of the PCR products were denatured in formamide at 80°C for 5 min and electrophoresed for 105 min at 200 V in 10% polyacrylamide, 0.5% TBE (44.5 mM Tris-borate, 44.5 mM boric acid, 1 mM EDTA) gels in a Miniprotean II apparatus (Bio-Rad, Richmond, CA). The gels were fixed and stained with a Silver Stain Plus Kit (Bio-Rad) and dried in gel wrap (BioDesign, New York, NY). The resulting patterns were scored in comparison with those provided by PCR in which line C DNA, c{beta}10, pYFVw*7.1, and pYFVIw*7.1 served as template.

Transfection, immunoprecipitation, and immunoblotting

A FLAG epitope tag sequence was incorporated into the YFV cDNA clone c36f for tagging mature protein at the N-terminal end. The modified clone was transferred into the replication-competent RCASBP(A) vector (31), the viral plasmid was transfected into avian DF1 cells (32), and packaged virus in the DF1 culture supernatant was used to infect avian RP9 cells (33). Extracts were made of intact RP9 cells expressing FLAG-tagged c36F YFV molecule and control cells (uninfected RP9 cells, RP9 cells infected with RCASBP(A) containing FLAGc36f in the nonsense orientation, and RP9 cells expressing FLAGBFIV21; Ref. 34), electrophoresed, blotted, and developed using M2 anti-FLAG mAb and ECL reagents (Amersham Pharmacia Biotech, Piscataway, NJ). Proteins were also immunoprecipitated with M2 anti-FLAG mAb (Sigma, St. Louis, MO) or with anti-chicken {beta}2m mAb (35), generously provided by Jim Kaufman (Institute for Animal Health, Compton, U.K.). The immunoprecipitates were electrophoresed and blotted as above.

Sequence analysis

Sequences were assembled with PC Gene and DNAStar. Similarity indices were determined with Wilbur-Lipman (DNA) and Lipman-Pearson (protein) algorithms. Deduced amino acid sequences were aligned using a mutation matrix, together with visual inspection of the modeled structures of YFVw*7.1 and B-FIV*12 and with Megalign (DNAStar). Pileup (GCG) and PaupSearch (maximum parsimony) were used to construct gene trees and to assign bootstrap values.

Molecular modeling

A homology model of the YFVw*7.1 structure was built using Insight II (Molecular Simulations, San Diego, CA) software. File 2clr.ent (HLA-A*0201) was chosen from the protein database as the template. HLA-A*0201 was one of several class Ia molecules giving essentially equal scores in FASTA alignments with YFVw*7.1 sequence. None of the class Ib molecules scored well when aligned with YFV. Amino acid insertions and deletions were readily placed between secondary structure elements at positions minimizing disruption of the overall fold by searching a high-resolution subset of the Brookhaven database for loops having the required length and similar context. Wherever more than one loop was present, the loop of the highest sequence homology was chosen. Once all coordinates were assigned and several conflicting side chains repositioned, the models were energy minimized with DISCOVER within Insight II using the consistent valence force field and default parameters. Similar steps were followed in modeling the avian {beta}2m chain on the structure of human {beta}2m.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
YFVw*7.1 and YFVIw*7.1 are class I-like loci, but only YFVw*7.1 is intact

BglII subclones containing YFVw*7.1 and YFVIw*7.1 were prepared from the cosmid c{beta}10 (14, 27) and fully sequenced. The two loci are oriented with 3' ends opposed and are separated by 11.5 kb. The sequences of both loci are presented in Fig. 1Go aligned with the sequence of the BFIV*12 (29), an allele at the classical class I locus that is most strongly expressed in the chicken and with which the Rfp-Y class I genes are highly similar. The exon/intron junctions for the YFVw*7.1 and YFVIw*7.1 were deduced based on the sequence of BFIV*12 and confirmed by sequencing a YFV cDNA (c36f) clone. The intron and exon organization in all three chicken genes is typical of class I genes. Eight exons are present, and their size is generally conserved with variations in the Rfp-Y genes confined to one or two codon differences from BFIV*12. Introns are generally small compared with mammalian class I genes with intron length varying between Rfp-Y and B system genes by 1–29 nucleotides. The Rfp-Y class I genes are C+G rich as has been noted for the B system class I loci (36).

The two YF loci are highly similar (93%) in nucleotide sequence (Table IGo) except for a large repeat sequence (48 copies of the hexanucleotide GGGCTG) that disrupts exon 1 of YFVIw*7.1 (Fig. 1Go). This insertion and the absence of a polyadenylation signal sequence downstream of the stop codon indicate that YFVI w*7.1 is most likely unexpressed. As noted below, no transcripts from the YFVI locus were found in any organs examined in RT-PCR assays. To determine whether the hexanucleotide repeat is present in other YFVI alleles in other Rfp-Y haplotypes two probes were prepared for Southern hybridizations. When an oligonucleotide containing three hexanucleotide repeats and a subclone of exon 1 from YFVIw*7.1 were used to probe DNA representing seven additional Rfp-Y haplotypes, only one was found to hybridize (data not shown), indicating that the repeat is not commonly present in other Rfp-Y haplotypes.


View this table:
[in this window]
[in a new window]
  		Table I. Sequence similarity indices among YFw*7.1 loci and classical class I genes

 
There is substantial sequence similarity between the sequence of YFVw*7.1 and other MHC class I genes in extracellular domains (Table IGo). Overall the nucleotide/predicted amino acid sequence similarities for YFVw*7.1 with BFIV*12 and HLA-A2 are 73%/60% and 49%/38%, respectively, and the similarity is generally uniform over the exons corresponding to extracellular domains. However, YFVw*7.1 and BFIV*12 are relatively less similar to each other in exon 2/{alpha}1 domain sequences (66%/49%) than they are in other extracellular exon/domain sequences suggesting that the {alpha}1 domains of YFV and BFIV molecules have divergent functional constraints. The exons corresponding to transmembrane and cytoplasmic domains of YFVw*7.1, BFIV*12, and HLA-A2 are mostly dissimilar suggesting further specialization associated with the Rfp-Y locus. As with other class Ib molecules, YFV-encoded molecules lack the phosphorylation motif found in mouse and human MHC class Ia molecules (37).

The predicted, mature product of the YFVw*7.1 gene is a 332-residue protein that has a single potential n-glycosylation site at the same residue found in many class Ia molecules (noted by • in Fig. 2GoA). The amino acids critical for folding of class I molecules are generally conserved in the YFVw*7.1 amino acid sequence. The four cysteine residues that form the basis of the highly conserved class I disulfide loops (C98C101-C161C164, C199C203-C255C259) are present (the superscript denotes the position in HLA-A2). All 18 invariant residues (noted by I in Fig. 2GoA) known to form various contacts within and between class I domains that are strictly conserved in the sequences of class I molecules (38) are present in YFVw*7.1. Molecular modeling of YFVw*7.1 provides a structure highly similar to that of HLA-A2 (Fig. 2GoB). The structural integrity of the {beta} strands and the {alpha} helices forming the ABR is mostly conserved in the YFV protein, even though the YFV ABR is three residues shorter than that of HLA-A2. The positions of the "missing" residues are easily assigned to the margins of the {beta} strand and {alpha} helical regions and most likely do not disrupt domain folding. As reflected in the model, a proline substitution at P51E53 in YFVw*7.1 is likely to disrupt the H1 helical region typical of the {alpha}1 domain of classical class I molecules. In addition, the presence of a contiguous pair of flexible glycine residues G67A69 G68H70 in YFVw*7.1 indicate that the long H2 helical region of the {alpha}1 domain may be broken into two shorter helices. Also, the natural break in the {alpha}2 domain {alpha} helix is further accentuated in YFV by the insertion of a glycine between positions 150 and 151 (HLA-A2 numbering). In summary, it is likely that YFVw*7.1 will have a structure overall highly similar to HLA-A2 with the ABR displaying a degree of specialization associated with the locus, a feature commonly encountered in comparisons between class Ia and class Ib molecules.



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 2. Comparison of the predicted amino acid sequence of YFVw*7.1 with the sequences of human (HLA-A2) and chicken (BFIV*12) classical class I molecules. A, Structure-based alignment of the deduced amino acid sequences of three YFV alleles with chicken class Ia (BFIV*12) and human class Ia (HLA-A2) sequences. Polymorphic residues in the YFV sequences are noted in red with the position underlined. B, Stereoview of the model for the three extracellular domains of YFVw*7.1 and chicken {beta}2m (both in red) modeled after the crystal structures of HLA-A2 and human {beta}2m (both in black). YFVw*7.1 apparently lacks the H1 helical region (noted by arrow) found in the {alpha}1 domain of HLA-A2 and other class Ia molecules.

 
YFVw*7.1 encodes a distinctive class Ib molecule

In class Ia molecules eight highly conserved residues define the "left" (Y7, Y59, Y159, and Y171) and "right" (Y84, T143, K146, and W147) pockets of the ABR and secure peptide Ag by bonding with main chain atoms. In YFV two of the left-pocket tyrosine residues are replaced by H57Y59 and E156Y159. Further substitutions occur in the right pocket. Position 84 in YFV is polymorphic occupied by R, Q, and C in different Rfp-Y alleles. A further, albeit conserved substitution, R143K146, is also present in the right pocket. These left and right pocket substitutions make it highly unlikely that YFV class I molecules present Ag in the manner of class Ia molecules. Hence the YFV locus fails to meet a major criterion for inclusion in the class Ia category and, therefore, should be considered a class Ib locus.

The substitutions that are found in the predicted YFV molecules at four of the eight subclass-defining residues in the ABR are extremely rare among class Ib molecules. The E156Y159 substitution is unique. Substitution of Y159 is generally rare with substitutions of phenylalanine (H2-M9, H2-Q5k, H2-Mb-1, DLA79, FcRn), glycine (H2-T10), aspartic acid (H2-T9, H2-T22), tryptophan (Mr1), alanine (MICA), and leucine (hCD1c and mCD1) occurring in a limited number of class Ib molecules. The H57Y59 substitution is shared so far only with Mr1 and some Xenopus class Ib loci. The Y59 is conserved at most class Ib loci with other substitutions such as phenylalanine (H2-M9) and leucine (mCD1) only rarely occurring. The substitution of three different amino acids at tyrosine 84 (R/Q/C82Y84) in different alleles at any class I locus is unprecedented. Generally alternatives to tyrosine at this position are very rare with isoleucine and glutamic acid found at mouse H2-Mb-1 and CD1. Finally, the R143K146 substitution occurs occasionally in class Ib molecules (H2-M3, FcRn) and is common among chicken class Ia (BFIV) alleles. Thus no other known class I locus is closely similar to YFV in the substitutions at these four positions suggesting that YFV defines a new type of class Ib locus.

YFVw*7.1 is a recently derived class Ib locus

The {alpha}3 domain sequences of the Rfp-Y class Ib loci were aligned using PileUp (Genetics Computer Group, Madison, WI) with the corresponding sequences from class Ia and class Ib molecules from several vertebrate species. The alignment was analyzed with phylogenetic analysis using parsimony to generate the gene tree and bootstrap values presented in Fig. 3Go (class Ib are underlined). The two Rfp-Y class Ib {alpha}3 sequences are closely similar to those of chicken and quail class Ia molecules (see large bracket). This group forms a clade restricted to gallinaceous birds indicating that the Rfp-Y loci may be relatively young genes sharing recent ancestors with class Ia genes in gallinaceous birds. Similar relationships occur in other taxa between class Ib loci and class Ia loci as can be seen in the other bracketed regions of the tree where Xenopus, humans, and mice also form clades in which class Ib and class Ia share recent ancestry. Most of the class Ib molecules within these clades are known to require TAP for processing of specialized Ag indicating that these relatively recently derived class Ib share Ag processing pathways with class Ia (8). These molecules contrast with more distantly derived class Ib molecules known to be TAP independent in the presentation of specialized Ag.



View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 3. Gene tree showing the relationship of YFVw*7.1 and YFVIw*7.1 to selected vertebrate class Ia and class Ib (underlined) genes in the {alpha}3 domain. Note that the appearance of YFVw*7.1 and YFVIw*7.1 predates the separation of chicken and Japanese quail (larger bracket). These genes share a relationship with class Ia genes similar to the relationship among class Ia and subsets of class Ib molecules in Xenopus, human, and mouse (smaller brackets).

 
YF class Ib genes display both haplotypic and allelic variation

Because polymorphism or the lack thereof is another characteristic that is often used to separate class Ia from class Ib loci, we examined Rfp-Y class I genes for evidence of haplotypic and allelic polymorphism. We first examined Rfp-Y class I haplotypic variability using a Rfp-Y class I specific probe, 163/164f, in Southern blots. Nine different TaqI restriction fragment patterns were obtained from nine previously defined Rfp-Y haplotypes (Fig. 4GoA). Surprisingly, the number of restriction fragments varies among the haplotypes from only two in Yw*1.3 and Yw*7.2 to at least 10 in Yw*4.2 and Yw*6.1. Similar differences were found in PstI and BglI restriction fragment patterns (data not shown). It is likely that the number of class I loci varies among Rfp-Y haplotypes. Similar variation in gene number occurs in the class Ib region in H-2 haplotypes (39).



View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 4. Evidence for genetic polymorphism associated with Rfp-Y class I genes. A, Southern blot analysis. Restriction fragment polymorphism of YF class Ib loci in nine different Rfp-Y haplotypes revealed by a YF-specific probe, 163/164f, in TaqI-digested DNA. B, Stereoview of {alpha}-carbon backbone of the {alpha}1 and {alpha}2 domains of the YFVw*7.1 model structure. Residues that are polymorphic among the three Rfp-Y sequences in Fig. 2GoA are marked by black circles with the amino acids variants presented in single letter code.

 
Predicted amino acid sequences for YFVw*7.1, YFVw*3.2, and YFVw*5.1 are aligned in Fig. 2GoA. It is likely that these three sequences all originate from the YFV locus. YFVw*7.1 and YFVw*3.2 are identical in cytoplasmic domains and differ by only one amino acid in the transmembrane domain (TM). In contrast, YFVw*3.2 differs from YFVIw*7.1 by 15 of 34 aa over the same regions making it highly unlikely that YFVw*3.2 originates from the YFVI locus. The third clone, YFVw*5.1, was obtained by PCR using primers designed for YFV specificity and differs from YFVw*7.1 by only a single amino acid in transmembrane domain sequence.

The three clones display considerable sequence variability (Fig. 2Go, A and B). The {alpha}1 domain variability among the three sequences (21%, 18 of 87 aa) is nearly as great as the variability that is present among BFIV alleles (27%, 24 of 88 aa in 11 alleles) (40). This variability is almost entirely confined to the helical region of the {alpha}1 domain and to the floor of the ABR with a small remainder of variation present in loop regions (Fig. 2GoB). Amino acid replacements are most often nonconservative. For example, charged residues are interchanged with neutral, nonpolar (70R/L, 59D/A, 67D/G, 85K/I, 87K/G) or with neutral, polar residues (37D/N, 55Q/R, 66Q/R, 73D/C, 82R/Q/C). In other instances neutral, polar residues are interchanged with neutral, nonpolar residues (32N/I, 35T/I, 60T/A, 78W/G, 75N/F/L, 77N/G). Conservative substitutions (47V/A and 71D/E) in these regions are more rare.

The {alpha}2 domain is less variable (10%, 9 of 92 aa). Substitutions are mostly confined to two {beta} sheet strands in the floor of the ABR, as they are in the classical BFIV alleles (40). The residues are often hydrophobic, and substitutions are often conservative. One nonpolar residue often substitutes for another (92L/M, 95 M/I, 96I/F, 120L/I), or charged residues are interchanged (117R/K). In other instances the substitutions are nonconservative (91T/M, 94 M/R, 119F/H/Y, and 178R/T). Similar to the chicken class Ia molecules, some variability is also present in the {alpha}3 domain (Fig. 2GoA). Whether this reflects functional specialization among the YFV alleles is not yet understood.

Nonsynonymous-to-synonymous substitution ratios vary across {alpha} helical and {beta} sheet regions of the {alpha}1 and {alpha}2 domains of the three YFV sequences (data not shown). Briefly, the {alpha} helical portion of the {alpha}1 domain has a high ratio compared with the {beta} sheet region suggesting that, as in class Ia loci (40, 41), this region may be under selection for interactions with diverse Ag or variability in a counterreceptor. In contrast, in the {alpha}2 domain the values for the nonsynonymous-to-synonymous substitution ratios are reversed. The YFV {alpha}2 {alpha} helical region has an extremely low ratio indicating that diversification of this region of the molecule is restricted, as apparently it is in BFIV alleles (40). So although YFV molecules are nonclassical and unlikely to bind typical peptide Ag, they are polymorphic with the distribution of sequence variability among alleles not unlike the classical class Ia molecules of the chicken.

YFV is transcriptionally active in many organs and can be expressed as a transduced gene

To determine whether the YFVw*7.1 and YFVIw*7.1 are transcriptionally active and to learn whether transcription is confined to particular organs as often is found for class Ib genes, we performed RT-PCR SSCP assays using a YF gene-specific primer set. With the exception of small regions immediately upstream of the start site, the regulatory and promoter sequence elements (see GenBank sequences) of YFVw*7.1 (and YFVIw*7.1) genes are similar to those of class Ia genes suggesting that YF could be generally active in many tissues. RNA free of genomic DNA was obtained from embryos and from a number of organs of young adult line C birds (Fig. 5Go and Table IIGo). The YF-specific primers provided a means of specifically detecting transcripts from the Rfp-Y class I loci, and SSCP provided a means of distinguishing between YFVw*7.1 and YFVIw*7.1 transcripts. RT-PCR assays for BFI and BFIV served as positive controls. YFVw*7.1 transcripts were detected in all organs tested, except for three (brain, heart, and pancreas). No evidence was found for transcriptional activity of YFVIw*7.1 locus. Results of the full analysis are summarized in Table IIGo and are consistent with a limited number of RNase protection assays demonstrating the presence of YFVw*7.1 transcripts in several tissues (42). We conclude that YFVw*7.1 is constitutively transcriptionally active in many organs much like MHC class Ia genes. It remains to be determined whether YFV transcription is inherent in all or many of the tissues in these organs or whether transcription is limited to a particular cellular subset with perhaps only limited quantities of YFV reaching the surface of these cells.



View larger version (62K):
[in this window]
[in a new window]
  		FIGURE 5. Illustration of the RT-PCR SSCP assays used for scoring YF gene expression in organs from line C birds. The SSCP step was used to distinguish between transcripts originating from YFVw*7.1 and YFVIw*7.1 loci. Controls include SSCP patterns for PCR products originating from line C DNA, cosmid c{beta}10, and plasmids separately containing the YFVw*7.1 and YFVIw*7.1 genes. Results of the full analysis are presented in Table IIGo.

 

View this table:
[in this window]
[in a new window]
  		Table II. Distribution of Rfp-Y and B class I transcripts determined using RT-PCR

 
To determine whether mature protein can be produced from expression of YFV cDNA, the clone c36f was FLAG-epitope tagged, inserted into the RCASBP(A) retroviral vector, and expressed in the chicken B cell lymphoma line RP9. FLAG-tagged protein was found by flow cytometry to be at the surface of cells expressing FLAGc36f inserted into the vector in the sense orientation but not in the nonsense orientation (data not shown). In immunoprecipitations with the anti-FLAG mAb M2, RP9 cells expressing FLAGc36f and the positive control FLAGBFIV*21 were both found to produce FLAG-tagged protein with masses (~48 kDa) typical of class I molecules (Fig. 6GoA). The FLAGc36f encoded protein could also be immunoprecipitated with an anti-chicken {beta}2m mAb (Fig. 6GoB) providing evidence for association between YFV protein and {beta}2m. Hence protein similar to typical class I molecules in molecular mass and in {beta}2m association can be obtained by expressing the YFV cDNA c36f as a transgene.



View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 6. Immunoblot and immunoprecipitation of FLAG-tagged YFV molecules. A, Immunoblot was developed with anti-FLAG M2 mAb. Lysates are from RP9 cells expressing FLAGBFIV*21 (positive control), FLAGc36f in anti-sense (-) and sense (+) orientations, and uninfected cells. B, Proteins were immunoprecipitated with anti-FLAG M2 or anti-chicken {beta}2m mAb from lysates of RP9 cells expressing FLAGc36f in anti-sense (-) and sense (+) orientations. Immunoblot was developed with anti-FLAG M2 mAb. The Ig H and L chains are derived from the precipitating mAbs. Approximate mass of the FLAG-tagged products is noted with arrowheads.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In these experiments we have shown that the YFV locus shares many qualities with MHC class Ia genes. As summarized in the structural model in Fig. 2GoB, the YFV molecule is likely to be structurally similar to class Ia, as are several other class Ib molecules. The unusual substitutions in the putative ABR of the YFV molecules are the strongest characteristic separating YFV from class Ia loci. Alleles at the YFV locus differ from one another by multiple changes in predicted amino acid sequence. Many of the polymorphic residues surround the ABR. Over 20 aa differences in the ABR separate the three YFV alleles in this study from each other. Such variability is on par with the differences between alleles at class Ia loci and between alleles at the one previously identified highly polymorphic class Ib locus, H2-Q2 (1). In addition, there may be many YFV alleles. SSCP analyses of the Rfp-Y class I exon 2 sequences in a variety of genetic lines provide indirect evidence for many more YFV alleles than the three presented here (M.M., unpublished data). As with class Ia loci, polymorphism and the relatively high ratios of nonsynonymous-to-synonymous substitutions over portions of the YFV ABR indicate that this region may be under selection for diversity. YFVw*7.1 and YFVIw*7.1 occupy positions in the evolutionary tree in Fig. 3Go that further emphasize their close relationship with class Ia genes in gallinaceous birds. The gene tree in Fig. 3Go indicates that the YFVw*7.1 and YFVIw*7.1 were derived relatively recently with their appearance likely predating only the separation of gallinaceous taxa (Fig. 3Go). Perhaps YFVw*7.1 and YFVIw*7.1 are intermediates in the evolutionary tide postulated by Shawar and colleagues (37) to flow between loci encoding molecules with less selective (class Ia) and highly selective (class Ib) ABRs.

Given the close relationship the YF loci have with avian class Ia genes and their sequence polymorphism, it seems likely that YFV molecules bind peptide Ag. The unique substitutions of glutamic acid and histidine in the left pocket of the ABR may provide a means for selecting a particular form of Ag. Perhaps the charged residues form salt bridges with Ag in the ABR providing a means for selection of a particular subset of Ags. Or alternatively, perhaps the left end of the putative ABR of YFV is actually closed by interactions between these and other residues surrounding this region of the groove. In this instance, shorter forms of peptide might fill the remaining open portion of the groove through a selective interaction based on another characteristic of antigenic peptide, such as hydrophobicity of amino acid side chains. Because YFV molecules are apparently close relatives of the MHC class Ia molecules, it seems likely that peptide Ag load into the ABR through a TAP-dependent pathway. It would make sense that the YFV Ag is peptide, but this remains to be determined. How YFV molecules bind Ag and what form the Ag has will be the subject of additional experiments, as will be the consequence of YFV expression in cellular interactions with cytotoxic T and NK cells.

The YF loci have other features that define them as class Ib. Most class Ib loci have little or only weak influences in graft rejection. The structural identification of YFV as a class Ib gene is consistent with conclusions drawn by Pharr and colleagues (28) on the influence of Rfp-Y incompatibility on transplantation immunity. In experiments conducted with carefully defined genetic stock, Pharr et al. found skin graft rejections attributable to Rfp-Y incompatibilities occurred at moderate rates. They were clearly slower than B incompatibilities but significantly faster than Rfp-Y-compatible grafts. These authors suggested that one reason for the observed intermediate rate of graft rejection with Rfp-Y incompatibility might be the presence of class I-like (nonclassical) loci within the Rfp-Y gene region.

The YFV locus may share another feature with class Ib genes. There may be little YFV normally on the surface of cells despite the presence of YFV transcripts. Other investigators have found no evidence that Y-FV molecules are immunoprecipitated by anti-chicken {beta}2m (43) and so YFV molecules may be normally less abundant at the cell surface than, for example, chicken class Ia molecules derived from the BFIV locus. It will be interesting to learn whether there are conditions under which surface expression of YFV becomes abundant. Because the Ag for YFV is likely to be atypical, it may be that it is not normally abundant and that trafficking of YFV to the cell surface is limited by Ag availability. This would be particularly interesting to explore given the evidence that in some but not all instances Rfp-Y haplotype has been found to influence resistance to virally induced tumors in chickens (44, 45, 46). If YFV is dependent on TAP molecules encoded in the B system for Ag processing, it could also be that interaction with chicken TAP affects YFV surface expression. Because chicken TAP genes are themselves polymorphic (47) and the YFV and TAP loci are unlinked, it might be that in particular combinations of TAP and YFV alleles there is either less or more YFV at the cell surface even in the presence of ample YFV Ag.

Finally, the organization of chicken class I genes into two genetic units composed of class Ia and class Ib loci is not unique. The class Ia and class Ib loci in Xenopus are also located in two independent genetic units and, just as in chickens, the two regions map to the same chromosome (48) separated by a region supporting highly frequent recombination. Considering the evolutionary relationship that exists between class Ia and class Ib genes in these two species, as illustrated in Fig. 3GoA, it is likely that this manner of organizing class I genes has been arrived at independently in these two species. Genetic separation of the two class I subclasses could be a means by which the integrity of class Ia and class Ib loci are maintained. Perhaps the class Ia loci isolated by this arrangement evolve in concert with adjacent Ag processing loci as has been suggested by others (47, 48), whereas the class Ib loci are free to evolve in a different manner. In isolation the class Ib loci may be able to change in number, allelic variation, and ABR specificity through a variety of recombination events in a system for selective Ag presentation that evolves rapidly in response to disease challenge.


   Acknowledgments
 
We thank Larry Bacon for providing C line birds and DNA from Cornell line N and P; Henry Hunt for providing RP9 cells expressing FLAGBFIV*21; Pierrick Thoraval for providing tissue from line CB embryos; and Jim Kaufman for providing anti-{beta}2m mAb. Elwood Briles and Robert Taylor, Jr. generously provided blood samples from Rfp-Y-typed birds. We thank Larry Bacon, Pamela Bjorkman, Louis DuPasquier, Henry Hunt, and Iwona Stroynowski for helpful discussions.


   Footnotes
 
1 This material is based upon work supported in part by the U.S. Department of Agriculture/National Research Initiative Competitive Grants Program (92-37204-8244), the U.S. Department of Agriculture/Foreign Agricultural Service/International Collaborative Research/Research and Scientific Exchange Division (58-3148-5-023), and by the National Science Foundation under Grants 9118199 and 9604589. Back

2 Sequences submitted to the GenBank database are Y-FVw*7.1 (AF218783) and Y-FVIw*7.1 (AF218784). Back

3 Current address: Laboratoire de Biologie Moléculaire et Cellulaire, Centre National de la Recherche Scientifique Unité Mixte de Recherche 5665, Institut National de la Recherche Agronomique, LA 913, Ecole Normale Supérieure de Lyon, Lyon, France. Back

4 Address correspondence and reprint requests to Dr. Marcia M. Miller, Department of Molecular Biology, Beckman Research Institute of the City of Hope National Medical Center, 1450 East Duarte Road, Duarte, CA 91010-3011. Back

5 Abbreviations used in this paper: {beta}2m, {beta}2-microglobulin; Rfp-Y, restriction fragment pattern-Y, ABR, Ag binding region; SSCP, single-stranded conformational polymorphism. Back

Received for publication June 12, 2000. Accepted for publication December 11, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cullen, M. K., L. A. Lapierre, K. V. Kesari, J. Geliebter. 1993. Identification of a recombinogenic major histocompatibility complex Q gene with diverse alleles. J. Exp. Med. 177:1803.[Abstract/Free Full Text]
  2. Chang, C. S., L. Brossay, M. Kronenberg, K. P. Kane. 1999. The murine nonclassical class I major histocompatibility complex-like CD1.1 molecule protects target cells from lymphokine-activated killer cell cytolysis. J. Exp. Med. 189:483.[Abstract/Free Full Text]
  3. Lee, N., D. R. Goodlett, A. Ishitani, H. Marquardt, D. E. Geraghty. 1998. HLA-E surface expression depends on binding of TAP-dependent peptides derived from certain HLA class I signal sequences. J. Immunol. 160:4951.[Abstract/Free Full Text]
  4. Simister, N. E., K. E. Mostov. 1989. An Fc receptor structurally related to MHC class I antigens. Nature 337:184.[Medline]
  5. Feder, J. N., A. Gnirke, W. Thomas, Z. Tsuchihashi, D. A. Ruddy, A. Basava, F. Dormishian, Jr R. Domingo, M. C. Ellis, A. Fullan, et al 1996. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat. Genet. 13:399.[Medline]
  6. Madden, D. R.. 1995. The three-dimensional structure of peptide-MHC complexes. Annu. Rev. Immunol. 13:587.[Medline]
  7. Kaufman, J., J. Salomonsen, M. Flajnik. 1994. Evolutionary conservation of MHC class I and class II molecules—different yet the same. Semin. Immunol. 6:411.[Medline]
  8. Braud, V. M., A. J. McMichael. 1999. Regulation of NK cell functions through interaction of the CD94/NKG2 receptors with the nonclassical class I molecule HLA-E. Curr. Top. Microbiol. Immunol. 244:85.[Medline]
  9. Lindahl, K. F., D. E. Byers, V. M. Dabhi, R. Hovik, E. P. Jones, G. P. Smith, C. R. Wang, H. Xiao, M. Yoshino. 1997. H2–M3, a full-service class Ib histocompatibility antigen. Annu. Rev. Immunol. 15:851.[Medline]
  10. Sieling, P. A., D. Chatterjee, S. A. Porcelli, T. I. Prigozy, R. J. Mazzaccaro, T. Soriano, B. R. Bloom, M. B. Brenner, M. Kronenberg, P. J. Brennan, R. L. Modlin. 1995. CD1-restricted T cell recognition of microbial lipoglycan antigens. Science 269:227.[Abstract/Free Full Text]
  11. Moody, D. B., B. B. Reinhold, M. R. Guy, E. M. Beckman, D. E. Frederique, S. T. Furlong, S. Ye, V. N. Reinhold, P. A. Sieling, R. L. Modlin, et al 1997. Structural requirements for glycolipid antigen recognition by CD1b- restricted T cells. Science 278:283.[Abstract/Free Full Text]
  12. Burmeister, W. P., L. N. Gastinel, N. E. Simister, M. L. Blum, P. J. Bjorkman. 1994. Crystal structure at 2.2 A resolution of the MHC-related neonatal Fc receptor. Nature 372:336.[Medline]
  13. Briles, W. E., R. M. Goto, C. Auffray, M. M. Miller. 1993. A polymorphic system related to but genetically independent of the chicken major histocompatibility complex. Immunogenetics 37:408.[Medline]
  14. Miller, M. M., R. Goto, A. Bernot, R. Zoorob, C. Auffray, N. Bumstead, W. E. Briles. 1994. Two Mhc class I and two Mhc class II genes map to the chicken Rfp-Y system outside the B complex. Proc. Natl. Acad. Sci. USA 91:4397.[Abstract/Free Full Text]
  15. Miller, M. M., R. M. Goto, Jr R. L. Taylor, R. Zoorob, C. Auffray, R. W. Briles, W. E. Briles, S. E. Bloom. 1996. Assignment of Rfp-Y to the chicken major histocompatibility complex/NOR microchromosome and evidence for high-frequency recombination associated with the nucleolar organizer region. Proc. Natl. Acad. Sci. USA 93:3958.[Abstract/Free Full Text]
  16. Fillon, V., R. Zoorob, M. Yerle, C. Auffray, A. Vignal. 1996. Mapping of the genetically independent chicken major histocompatibility complexes B and RFP-Y to the same microchromosome by two-color fluorescent in situ hybridization. Cytogenet. Cell Genet. 75:7.[Medline]
  17. Bloom, S. E., L. D. Bacon. 1985. Linkage of the major histocompatibility (B) complex and the nucleolar organizer in the chicken: assignment to a microchromosome. J. Hered. 76:146.
  18. Kaufman, J., N. Bumstead, M. Miller, P. Riegert, J. Salomonsen. 1995. The chicken class II {alpha} gene is located outside the B complex. T. F. Davison, and N. Bumstead, and P. Kaiser, eds. Advances in Avian Immunology Research Carfax Publishing Company, Abingdon, U.K. p. 119.
  19. Guillemot, F., C. Auffray. 1989. A molecular map of the chicken B complex. Prog. Clin. Biol. Res. 307:169.[Medline]
  20. Zoorob, R., A. Bernot, D. M. Renoir, F. Choukri, C. Auffray. 1993. Chicken major histocompatibility complex class II B genes: analysis of interallelic and interlocus sequence variance. Eur. J. Immunol. 23:1139.[Medline]
  21. Bernot, A., R. Zoorob, C. Auffray. 1994. Linkage of a new member of the lectin supergene family to chicken Mhc genes. Immunogenetics 39:221.[Medline]
  22. Kaufman, J., S. Milne, T. W. Gobel, B. A. Walker, J. P. Jacob, C. Auffray, R. Zoorob, S. Beck. 1999. The chicken B locus is a minimal essential major histocompatibility complex. Nature 401:923.[Medline]
  23. Kaufman, J., H. Volk, H. J. Wallny. 1995. A "minimal essential Mhc " and an "unrecognized Mhc": two extremes in selection for polymorphism. Immunol. Rev. 143:63.[Medline]
  24. Kaufman, J., J. Salomonsen. 1997. The "minimal essential MHC " revisited: both peptide-binding and cell surface expression level of MHC molecules are polymorphisms selected by pathogens in chickens. Hereditas 127:67.[Medline]
  25. Jacob, J. P., S. Milne, S. Beck, J. Kaufman. 2000. The major and a minor class II {beta}-chain (B-LB) gene flank the Tapasin gene in the B-F/B-L region of the chicken major histocompatibility complex. Immunogenetics 51:138.[Medline]
  26. Kaufman, J., J. Jacob, I. Shaw, B. Walker, S. Milne, S. Beck, J. Salomonsen. 1999. Gene organisation determines evolution of function in the chicken. MHC. Immunol. Rev. 167:101.
  27. Guillemot, F., A. Billault, O. Pourquie, G. Behar, A. M. Chausse, R. Zoorob, G. Kreibich, C. Auffray. 1988. A molecular map of the chicken major histocompatibility complex: the class II {beta} genes are closely linked to the class I genes and the nucleolar organizer. EMBO J. 7:2775.[Medline]
  28. Pharr, G. T., R. L. Vallejo, L. D. Bacon. 1997. Identification of Rfp-Y (Mhc-like) haplotypes in chickens of Cornell lines N and P. J. Hered. 88:504.[Abstract/Free Full Text]
  29. Kroemer, G., R. Zoorob, C. Auffray. 1990. Structure and expression of a chicken MHC class I gene. Immunogenetics 31:405.[Medline]
  30. Oto, M., S. Miyake, Y. Yuasa. 1993. Optimization of nonradioisotopic single strand conformation polymorphism analysis with a conventional minislab gel electrophoresis apparatus. Anal. Biochem. 213:19.[Medline]
  31. Hughes, S. H., J. J. Greenhouse, C. J. Petropoulos, P. Sutrave. 1987. Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors. J. Virol. 61:3004.[Abstract/Free Full Text]
  32. Schaefer-Klein, J., I. Givol, E. V. Barsov, J. M. Whitcomb, M. VanBrocklin, D. N. Foster, M. J. Federspiel, S. H. Hughes. 1998. The EV-O-derived cell line DF-1 supports the efficient replication of avian leukosis-sarcoma viruses and vectors. Virology 248:305.[Medline]
  33. Okazaki, W., R. L. Witter, C. Romero, K. Nazerian, J. M. Sharma, A. Fadly, D. Ewert. 1980. Induction of lymphoid leukosis transplantable tumours and the establishment of lymphoblastoid cell lines. Avian Pathol. 9:311.[Medline]
  34. Fulton, J. E., E. L. Thacker, L. D. Bacon, H. D. Hunt. 1995. Functional analysis of avian class I (BFIV) glycoproteins by epitope tagging and mutagenesis in vitro. Eur. J. Immunol. 25:2069.[Medline]
  35. Crone, M., M. Simonsen, K. Skjodt, K. Linnet, L. Olsson. 1985. Mouse monoclonal antibodies to class I and class II antigens of the chicken MHC: evidence for at least two class I products of the B complex. Immunogenetics 21:181.[Medline]
  36. Kaufman, J., R. Andersen, D. Avila, J. Engberg, J. Lambris, J. Salomonsen, K. Welinder, K. Skjodt. 1992. Different features of the MHC class I heterodimer have evolved at different rates: chicken B-F and {beta}2-microglobulin sequences reveal invariant surface residues. J. Immunol. 148:1532.[Abstract]
  37. Shawar, S. M., J. M. Vyas, J. R. Rodgers, R. R. Rich. 1994. Antigen presentation by major histocompatibility complex class I-B molecules. Annu. Rev. Immunol. 12:839.[Medline]
  38. Grossberger, D., P. Parham. 1992. Reptilian class I major histocompatibility complex genes reveal conserved elements in class I structure. Immunogenetics 36:166.[Medline]
  39. Klein, J., H. Ono, D. Klein, C. O’hUigin. 1993. The accordian model of Mhc evolution. J. Gergely, and G. Petranyi, eds. Progress in Immunology 137. Springer-Verlag, Heidelberg.
  40. Hunt, H. D., J. E. Fulton. 1998. Analysis of polymorphisms in the major expressed class I locus (B-FIV) of the chicken. Immunogenetics 47:456.[Medline]
  41. Parham, P., D. A. Lawlor, C. E. Lomen, P. D. Ennis. 1989. Diversity and diversification of HLA-A,B,C alleles. J. Immunol. 142:3937.[Abstract]
  42. Afanassieff, M., R. M. Goto, J. Ha, R. Zoorob, C. Auffray, F. Coudert, W. E. Briles, M. M. Miller. 2000. Are Chicken Rfp-Y Class I Genes Classical or Non-Classical?. 6th International Workshop on MHC Evolution. May 25–29, 1999. M. Kasahara, ed. Springer-Verlag, Hayama, Kanagawa, Japan :236.
  43. Kaufman, J., H. J. Wallny. 1996. Chicken MHC molecules, disease resistance and the evolutionary origin of birds. Curr. Top. Microbiol. Immunol. 212:129.[Medline]
  44. Wakenell, P. S., M. M. Miller, R. M. Goto, W. J. Gauderman, W. E. Briles. 1996. Association between the Rfp-Y haplotype and the incidence of Marek’s disease in chickens. Immunogenetics 44:242.[Medline]
  45. LePage, K. T., M. M. Miller, W. E. Briles, Jr R. L. Taylor. 2000. Rfp-Y genotype affects the fate of Rous sarcomas in B2B5 chickens. Immunogenetics 51:751.[Medline]
  46. Vallejo, R. L., G. T. Pharr, H. C. Liu, H. H. Cheng, R. L. Witter, L. D. Bacon. 1997. Non-association between Rfp-Y major histocompatibility complex-like genes and susceptibility to Marek’s disease virus-induced tumours in 6(3) x 7(2) F2 intercross chickens. Anim. Genet. 28:331.[Medline]
  47. Kaufman, J.. 1999. Co-evolving genes in MHC haplotypes: the "rule" for nonmammalian vertebrates?. Immunogenetics 50:228.[Medline]
  48. Courtet, M., M. Flajnik, L. Du Pasquier. 2001. Major histocompatibility complex and immunoglobulin loci visualized by in situ hybridization on Xenopus chromosomes. Dev. Comp. Immunol. 25:149.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
T. Shiina, W. E. Briles, R. M. Goto, K. Hosomichi, K. Yanagiya, S. Shimizu, H. Inoko, and M. M. Miller
Extended Gene Map Reveals Tripartite Motif, C-Type Lectin, and Ig Superfamily Type Genes within a Subregion of the Chicken MHC-B Affecting Infectious Disease
J. Immunol., June 1, 2007; 178(11): 7162 - 7172.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. A. Moon, S. M. Veniamin, J. A. Parks-Dely, and K. E. Magor
The MHC of the Duck (Anas platyrhynchos) Contains Five Differentially Expressed Class I Genes
J. Immunol., November 15, 2005; 175(10): 6702 - 6712.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. Shiina, S. Shimizu, K. Hosomichi, S. Kohara, S. Watanabe, K. Hanzawa, S. Beck, J. K. Kulski, and H. Inoko
Comparative Genomic Analysis of Two Avian (Quail and Chicken) MHC Regions
J. Immunol., June 1, 2004; 172(11): 6751 - 6763.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Afanassieff, M.
Right arrow Articles by Miller, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Afanassieff, M.
Right arrow Articles by Miller, M. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS