|
|
||||||||




*
Department of Rheumatology, Education and Research Centre, St. Vincents University Hospital, Dublin, Ireland; and
College of Physicians and Surgeons, Columbia University, New York, NY 10032
| Abstract |
|---|
|
|
|---|

T cell receptor repertoire in joint fluid of
individuals with active psoriatic arthritis contained an average of 32
major oligoclonal expansions in many variable genes of the TCR
chain (BV) families, as shown by
-chain CDR3 length analysis.
Interestingly, a small number of oligoclonal expansions were shared
between simultaneous samples of joint fluid and blood; however, most
expansions found in joint fluid were not identifiable in blood
emphasizing the immunologic specificity of the clonal events for the
inflamed joint at a given point of time. The CD4 T cell joint fluid
repertoire contained fewer and smaller oligoclonal expansions also
largely restricted to the joint, suggesting that CD4 T cells
participate perhaps by interacting cognitively to generate the CD8
clones. The inferred amino acid sequence of a single CD8 oligoclonal
expansion revealed that they usually are composed of one or a few
structurally related clones at the amino acid sequence level with
-chains that encode identical or highly homologous CDR3 motifs.
These were not shared among patients. Moreover, several clones that
encoded the same amino acid sequence were found to be structurally
distinct at the nucleotide level, strongly implying clonal selection
and expansion is operating at the level of specific TCR-peptide
interactions. The findings support a model of psoriatic arthritis
inflammation involving extensive and selective Ag, likely autoantigen,
driven intra-articular CD4, and CD8 T cell clonal
expansions. | Introduction |
|---|
|
|
|---|
15% of individuals with psoriasis. Considerable
evidence implicates T cells in the pathogenesis of psoriatic
arthritis as well as psoriasis. This includes the presence of T cells
at sites of inflammation, the response of the disease to therapy
directed at T cells, and the association of disease susceptibility with
certain HLA alleles (1, 2, 3, 4, 5, 6). In particular, the specific
importance of CD8 lineage T cells in the pathogenesis of psoriatic
arthritis (7) is emphasized by three observations. First,
CD8 T cells comprise the majority of T cells in psoriatic arthritis
joint fluids and exhibit an activated CD45RO+
HLA-DR+ phenotype (8). Second, the
association of disease susceptibility is primarily with class I HLA
alleles (9, 10, 11, 12). Third, the disorder occurs at an
appreciable frequency in individuals with advanced HIV infection and
profound CD4 T cell depletion (13, 14). However, several significant questions remain unanswered regarding the role of the T cell in the pathogenesis of psoriatic arthritis. First, what is the nature of the immunologic drive responsible for the accumulation of T cells in sites of inflammation such as the synovial fluid? Does the joint fluid repertoire have the features of responding to a single or several immune recognition events, to a superantigen, or does it simply reflect secondary non Ag-specific T cell recruitment mediated by chemokines released by local joint inflammation? Related to this is the question of whether the immunologic processes in the joint are similar to or distinct from those occurring in blood and, reciprocally, the extent to which the two compartments are in equilibrium regarding T cell trafficking. Furthermore, do the immunologically driven alterations involve CD4 as well as CD8 lineage T cells? Although in the minority, CD4 T cells are present in joint fluid (8), leaving open the possibility that they could play a role. Possible support for an immune recognition event involving CD4 T cells is provided by the reports of the association of MHC class II alleles with susceptibility to psoriatic arthritis (15, 16, 17), as well as the important participation of CD4 T cells in the cognitive induction of CD8 T cells to effector status in a three cell complex involving dendritic cells (18, 19, 20). However, the absence of evidence of involvement of B cells, such as the lack of characteristic autoantibodies, the occurrence of psoriatic arthritis in advanced AIDS patients who lack the ability to mount effective immune responses to most Ags (13, 14), and the potential alternative explanation of linkage disequilibrium with class I alleles considered to drive susceptibility, have directed attention away from the class II associations and from a significant role for CD4 T cells and more toward non-Ag-specific T cell recruitment mechanisms.
Each of the possibilities advanced to explain the presence and immunologic character of T cells in psoriatic arthritis joint fluid implies finding a different pattern in the TCR repertoire of this inflammatory site. Non-Ag-specific recruitment of CD4 and CD8 T cells from blood into the joint in response to chemokines released in sites of synovial inflammation would give a primarily polyclonal repertoire that would mirror the repertoire of blood, lacking clonal expansions specific to the joint. Alternatively, a superantigen in the joint tissues could induce polyclonal expansion of both CD4 and CD8 T cell populations as suggested by the recognized role of antecedent streptococcal infection in guttate psoriasis (7). Conversely, the stimulation of T cell clones by a specific Ag would result in oligoclonal T cell expansions characterized by related sequence motifs in the CDR3 region.
In recent years there has been considerable progress in understanding
the structural and developmental biology of the somatically generated

TCR repertoire in health and in disease, an approach applicable
to advancing understanding of the questions on the pathogenesis of
psoriatic arthritis at the level of repertoire analysis. In the case of
the
-chain, recombination of different germline V, D, and J gene
segments creates clonotypically unique CDR3 regions capable of
recognizing the peptide Ag (21, 22, 23). As a result of the
recombination process, the
-chains are characterized by length
differences ranging over 30 nucleotides distributed in a near Gaussian
manner (24, 25). The post thymic TCR repertoire of early
life is modified by clonal selection through various Ags and subsequent
clonal expansion that alter the composition of the repertoire,
affecting the distribution of CDR3 lengths, and results in the
appearance of occasional CD4 and, more notably, CD8 T cell clonal
expansions in healthy individuals (26, 27).
Analysis of the repertoire can be performed at differing levels of
resolution, with determination of the bias in usage of variable gene(s)
of the TCR
chain
(BV)4 elements
affording a low-resolution method for establishing the presence of
unusual patterns in he combinatorial usage of the families of BV
elements. Intermediate resolution methods take advantage of the process
of junctional diversity involved in the joining of the V, D, and J
elements that determine the length and amino acid composition of
the
-chain CDR3 region. This method provides histograms of the
distributions of CDR3 length for each BV family and reveals the
presence of oligoclonal expansions (26, 28, 29, 30).
High-resolution methods involve nucleotide sequencing and, although
relatively arduous, offer the best opportunity to gain insights into
the clonal structure of the immune recognition motifs underlying the
oligoclonal expansions (31, 32, 33).
This study on the role of T cells in the pathogenic processes underlying the synovitis of psoriatic arthritis uses intermediate and high resolution techniques to study the synovial fluid T cell repertoire where the fluid phase CD4 and CD8 T cell populations permits assessment of their separate repertoires. A preliminary description of these results has appeared (34).
| Materials and Methods |
|---|
|
|
|---|
Paired blood and joint fluid samples were obtained from six patients with active psoriatic arthritis undergoing therapeutic knee aspirations. Three psoriatic arthritis patients had oligoarticular disease, whereas the remaining patients had polyarticular disease. All patients had plaque psoriasis and disease duration of 210.5 years. Three were not on medication, two were on methotrexate, and one was taking salazopyrine. The HLA-B locus alleles were 27052/5701, 0702/44031, 0801/3501, 0702/0801, 0801/5501, and 27052/1402. Although the HLA = B*27052 allele is shared by two individuals, none are HLA identical. Eight age and ethnically matched healthy individuals from the same geographic areas were selected as controls. Mononuclear cells were prepared as described (8). Positive selection of CD4 or CD8 T cell subsets was performed using either CD4 or CD8 mAbs together with magnetic particles (PerSeptive Biosystems, Cambridge, MA). The efficiency of isolation was analyzed by flow cytometry of the unbound cellular fraction using fluorochrome-conjugated CD3 and CD4 or CD8 Abs directed to different epitopes, and a second stage anti-mouse reagent to identify Ab-coated cells not removed by the beads. Only samples with >98% separation efficiency were used.
PCR and CDR3 length analysis
RNA was extracted from 13 x 106
positively selected cells using RNA Stat-60 reagent according to the
manufacturers instructions (Tel-Test, Friendswood, TX). cDNA (1020
ng) was prepared using oligo(dT) priming (35) and adjusted
to 50 µl. The TCR nomenclature used is as described (36, 37). The CDR3 length distribution method was performed as
described (26, 29, 30, 38) with the following
modifications. A fluorochrome-tagged primer for the constant region of
the
-chain (BC primer) along with the BV primer was used in the
initial PCR. This was performed by adding 1 µl cDNA to the PCR mix
(final volume 50 µl) that contained 100 mM KCl, 20 mM Tris-HCl (pH
8.3), 2.0 mM MgCl2, 35 pm BV and BC primer, 0.25
mM of dNTP, and 1.25 U of AmpliTaq gold DNA polymerase (Perkin-Elmer,
Norwalk, CT). Initial incubation at 95°C for 12 min was followed by
36 cycles of 96°C for 1 min and 65°C for 1.5 min. The panel of
primers recognizing the 23 expressed BV elements was optimized using
the DNAstar program Primer Select for reactivity at the above described
conditions. Primers included those published by Gregersen et al.
(39) for BV6 and BV23; by Robinson et al.
(40) for BV13A, BV13B, and BV20; and by Puisieux et al.
(38) for BV1, BV2, BV3, BV4, BV9, BV13, BV14, BV15, BV16,
BV18, BV22, BV24, and CB. Additional primers were designed using
classified BV genes (37) and included:
ctctgagctgaatgtgaacgcctt, BV5; cttctcacctgaatgccccaaca, BV7;
atgatgcggggactggagttgct, BV8; aggaaagaagatcactctggaatg, BV11;
gggcatgggctgaggctgatc, BV12; gtctctcgggagaagaaggaatc, BV17;
agagaggctcaaaggagtagact, BV21; and caggtatgcccaaggaaagatttt, BV25. The
labeled PCR product was run on a model 373 or 377 automated
DNA-sequencing apparatus (Perkin-Elmer-Applied Biosystems, Foster City,
CA) with internal carboxytetramethylrhodamine (a fluorescent label of
molecular weight standards Genescan 500)-labeled standards. Genescan
gels were analyzed using GeneScan Analysis 2.1 software
(Perkin-Elmer-Applied Biosystems). The CDR3 region was defined as the
nucleotides 3' to the conserved C A S motif found in all BV families
and 5' to the F G X G motif of all joining gene (element) of the TCR
chain (BJ) elements. The distribution histogram was exported and
analyzed in an Excel spreadsheet.
Calculation of repertoire distortions
The degree of clonality was calculated in two ways: 1) by using the Hamming distance, a statistic used as an overall measure of the extent that a given length probability distribution differs from a reference distribution, exactly as outlined by Gorochov et al. (41); and 2) by defining the number and size of oligoclonal expansions. The Hamming distance ranges from 0 (if the two distributions are identical) to 100 (if they are completely different). Reference distributions for the Hamming distance determinations were prepared for each BV family by averaging the values for the CD4 T cell repertoire obtained from eight age and ethnically matched controls from the same geographic area. The CD4 profiles from the control population were used for the analysis of both CD4 and CD8 because the CD8 T cell repertoires from healthy controls more frequently contain oligoclonal expansions (39). However, the Hamming distance does not enumerate individual oligoclonal expansions and provides less insight into the biological significance of alterations in the repertoire than does enumeration of oligoclonal expansions. In addition, Hamming distances may underestimate the repertoire distortion when multiple oligoclonal expansions are symmetrically distributed about the mean. Therefore, both enumeration of oligoclonal expansions and Hamming distances have been used as parallel measures of repertoire aberration.
The number of oligoclonal expansions present in the sample for each BV
family was calculated from a composite reference profile. This
composite profile was generated from the 140 length probability
distributions of all BV families in controls that had a Hamming
distance of <10. The 95th percentile at a particular CDR3 length was
obtained by adding 2 SD to the mean of that CDR3 length, forming the
upper limit of the expected. This 95th percentile level for each peak
was normalized against the median peak after giving it a value of
100%. The CDR3 length of the median was on average 66.5% of the total
area of the two surrounding peaks with the +2 SD value being 88.7%.
Hence expansion at the median could be detected if the area of the
median was >88.7% of the sum of the areas of the CDR3 lengths on
either side of the median. Major expansions were defined as those peaks
with an area 5% greater than the expected area for the given BV family
at the 95th percentile cutoff. An oligoclonal expansion was classified
as putatively shared if it was found at the same CDR3 length of a
particular BV family in both blood and joint fluid and if both
expansions exceeded the 5% cutoff for that CDR3 length. If a
significant expansion was found in only one compartment it was termed
restricted. Statistical significance was calculated using the
Mann-Whitney U Wilcoxon rank sum test in SPSS 6.1 (SPSS,
Chicago, IL).
2 analysis was performed to
compare differences between individual pairs of blood and joint fluid
at each CDR3 length. The length distributions were also tested for
closeness of fit to a normal distribution using the Kolmogoroff-Smirnov
(K-S) statistic.
For sequencing, the appropriate PCRs were repeated, and amplified products were then subcloned using a Topo TA Cloning Kit (Invitrogen, Carlsbad CA) according to the manufacturers instructions. Plasmid minipreps, sequencing, and analyses were performed as previously described (31). Plasmids were prepared in a separate area to PCR preparations to prevent cross-contamination. The CD4 and CD8 populations of joint fluid and blood in two patients for three BV families were selected for sequencing, with 90200 clones sequenced for each condition.
| Results |
|---|
|
|
|---|
Fig. 1
contains representative
examples of patterns illustrating that the CDR3 length distribution of
the CD8 and CD4 
T cell repertoire in psoriatic arthritis joint
fluid differs considerably from blood due to the presence of increased
numbers of oligoclonal expansions as marked by arrows in Fig. 1
. The
CD8 BV13 repertoire distribution of joint fluid in patient 2, Fig. 1
B, contains three distinctive oligoclonal expansions at
CDR3 lengths of 8, 9, and 12 that are restricted to joint fluid and not
evident in blood. The percent area occupied by each CDR3 length in a
distribution was calculated for each BV family. Subtraction of the
values of the composite reference distribution from the observed values
yields the number and quantitates the size of putative oligoclonal
expansions at each CDR3 length. The three expansions in this example
account for 44.6% of the BV13 repertoire in joint fluid. The Hamming
distance of 28 and K-S statistic of p < 0.0001 also
reflect that this profile departs considerably from the BV
family-specific reference distribution and a theoretical Gaussian
distribution.
|
2 analysis,
p
0.0001, Table I
|
Occurrence of CD4 oligoclonal expansions in blood and synovial fluid
Fig. 1
, EH, illustrates that CD4 T cell oligoclonal
expansions also occur in both blood and joint fluid repertoires either
occasionally as shared between joint fluid and blood or much more
commonly as restricted to either compartment. The blood repertoires for
BV7 and BV18 shown in Fig. 1
, E and G, reveal
primarily polyclonal distributions with only minor oligoclonal
expansions indicated by arrows and Hamming distances of 7 and 16. In
contrast, the repertoires of these BV families in the joint fluid
contain major CD4 T cell oligoclonal expansions with Hamming distances
of 16 and 30, respectively. Sequencing of the BV7 CD4 T cell
repertoires in this sample supported the designation of the oligoclonal
expansions as restricted to the joint fluid (data not illustrated).
Summarized repertoire characterization for all individuals using number of oligoclonal expansions
The CDR3 length distributions of the separated CD8 T cell
population of six pairs of blood and joint fluid were determined for
all 23 expressed BV families. This revealed an average of 32 major CD8
oligoclonal expansions found in the joint fluids of individuals with
psoriatic arthritis (Table I
). Twenty-four (75%) of these are
restricted to the joint, whereas the remaining eight are shared by
blood and joint fluid. A mean of 21 oligoclonal expansions are found in
the blood of the patient, p = 0.042. This number is
greater than, but not significantly different from, the number of
oligoclonal expansions (18) in healthy controls. For each
BV family, 29% of the joint fluid CD8 T cell repertoire is present in
oligoclonal expansions, compared with 17% of the repertoire in paired
blood samples. This latter value is identical with that of the healthy
controls.
The availability of a paired joint fluid and blood sample taken 3 years after the initial analysis afforded the opportunity to begin to gain insight into the behavior of the repertoire at two points in time. A total of 22 informative major CD8 T cell oligoclonal expansions (seven restricted to peripheral blood, 13 restricted to joint fluid, and two shared by both compartments) were found at the initial time, and 34 oligoclonal expansions (10 restricted to peripheral blood, 20 restricted to joint fluid, and four shared by both compartments) were found at the follow-up time. All but five of these 56 oligoclonal expansions occurred at different CDR3 length positions and in different BV families emphasizing that the major portion of the oligoclonal expansions characterizing each repertoire differed markedly over this time of observation. Of the five oligoclonal expansions appearing to be in common between the two time points, one was found restricted to the joint fluid at both time points, and one was shared by peripheral blood and joint fluid at both time points. Interestingly, the three remaining oligoclonal expansions were initially restricted to blood at the first time point, but at the second time point were found either shared by blood and joint fluid or restricted to joint fluid.
Analysis of the CD4 populations obtained from these six joint fluids shows that there is an average of 22 major CD4 oligoclonal expansions present per patient, of which 20 (91%) are restricted to that compartment; two clones are putatively shared with blood. In contrast, an average of eight CD4 oligoclonal expansions are found in blood, p = 0.0001. Excluding the two oligoclonal expansions shared with joint fluid, the remaining number of six oligoclonal expansions restricted to blood is identical with the number of oligoclonal expansions found in blood of healthy controls. Within each BV family 13% of the joint fluid CD4 repertoire is composed of oligoclonal expansions, 12% of which are restricted to the joint fluid, whereas the remaining 1% are shared with blood and joint fluid.
Summarized repertoire characterization for all individuals using Hamming distances
Using Hamming distance as a measure of the departure of the
distribution of CDR3 lengths from reference values, CD8 T cell
repertoire departures are greater than that found in CD4 T cells.
Similarly, the joint fluid of all patients have a greater derangement
of both the CD4 and CD8 T cell repertoires than is found in paired
blood samples. The average Hamming distance of the joint fluid CD8 T
cell repertoire is 29, which is significantly greater than the Hamming
distance of the paired blood sample, 22.4, p
0.0001.
This blood-derived CD8 T cell population in psoriatic arthritis is only
very slightly more oligoclonal than blood CD8 T cells in the healthy
control group (Hamming distance of 22.1). In the joint fluid-derived
CD4 T cell repertoire, the mean departure from the polyclonal reference
is 18, which is significantly greater than that of the paired blood
sample (13, p = 0.0002). In turn, this value is also
significantly greater than that of the blood CD4 T cell in healthy
controls (8, p
0.00001). However, in contrast to the
situation in the CD8 T cell repertoire of joint fluid, a large
proportion of the BV families in the joint fluid CD4 T cell repertoire
have Hamming distances in the range of the healthy control reference
population. This suggests that relatively more polyclonal CD4 T cells
are recruited into the joint fluid than polyclonal CD8 T cells. The
distortions in repertoire distributions due to oligoclonal expansions
in the CD4 and CD8 joint fluid T cells in different patients are
scattered across all BV families and not selectively found in any given
BV family. However, the repertoires of certain BV families, most
notably BV25 in CD4 and CD8 populations, were more likely to have
higher Hamming distances in both reference controls and patients.
Sequence analysis of the 
TCR repertoire
Sequence analysis performed on three BV families, BV7, BV16, and BV21 in two patients for both CD4 and CD8 lineages in blood and joint fluid, generally supports the subdivision of CD8 oligoclonal expansions into those shared by joint fluid and blood or restricted to either compartment. However, a few instances of small clonal expansions identifiable only on sequencing were encountered.
Table II
illustrates that the CD8 T cell
BV16 oligoclonal expansion at a CDR3 length of 9 shared between blood
and joint fluid (Fig. 1
, C and D) is composed of
multiple homologous clones. In blood, the 29 nucleotide sequences of
CDR3 length 9 comprise eight clones. The first three clones listed
differ from one another by two to five nucleotides only in the CDR3
region and use BJ2S3, but notably all three encode the same inferred
amino acid sequence motif SQSPGGT. The fourth sequence, comprising a
single sequence clone, contains the homologous sequence
SQSPDGT and also uses BJ2S3. A fifth clone containing four
sequences and accounting for 17% of the oligoclonal expansion at a
CDR3 length of 9 is characterized by the closely related amino acid
CDR3 sequence motif SQSMGGT involving only a
proline-to-methionine interchange but uses a different BJ element. The
remaining three sequences have no structural homology with the CDR3
sequence motif and likely reflect the polyclonal background in blood
present at that CDR3 length. Sequencing of the paired joint fluid
revealed that all 73 sequences of CDR3 length 9 in the joint fluid BV16
repertoire are made up of four clones that share the same SQS(P/M)GGT
motif. Two of these are identical in nucleotide sequence to those found
in blood. The dominant joint fluid clone, accounting for 57% of the
repertoire in the joint fluid of CDR3 length 9, was similar to the
dominant clone in blood. The fourth expanded clone encoding the related
SQSMGGT motif was identical at the nucleotide level to that
of the oligoclonal expansion in blood. In contrast to the findings in
blood, no structurally unrelated sequence was found, emphasizing the
low level of polyclonal CD8 T cell entrance into the joint and
directing attention to the selectivity of events regulating clonal
entrance and expansion in the joint fluid. The sequences comprising the
unusual oligoclonal expansions at a CDR3 length of 17 present in blood
and joint fluid (Fig. 1
, C and D) are shown in
the lower portion of Table II
. Two clones comprise this oligoclonal
expansion in joint fluid and blood. One of these clones, shared by both
sites, is characterized by the same amino acid CDR3 motif as the
dominant CDR3 9 length clones, SQSPGGT, whereas the other shared clone
is characterized by a conceivably related motif, SHLPGGT. Perhaps in
this case the unusually long
-chain folds to approximate the same
region of the CDR3 to the peptide in the groove of the MHC. This was
the only example of the sharing of CDR3 motifs between clones of
different CDR3 length that was encountered.
|
|
| Discussion |
|---|
|
|
|---|

T
cell receptor repertoire in joint fluids of individuals with active
psoriatic arthritis is characterized by a striking predominance of
oligoclonal expansions identified in a variety of BV families as shown
by
-chain CDR3 length analysis. The preponderance of these CD8 T
cell oligoclonal expansions were relatively restricted to joint fluid
in that they were not identified in sequencing samples of 90200
clones from blood. The nature of the immunologic drive responsible for
the accumulation of T cells in sites of synovial fluid inflammation
exhibits features of being a response to a limited number of distinct
immune recognition events. It lacks features suggesting a response to a
superantigen, or to non-Ag-specific T cell recruitment mediated by
chemokines released by local joint inflammation. These data imply that
entry of T cells into the joint fluid is a highly specific process that
is regulated at the clonal level by the recognition of certain
peptides, with evidence of relatively little nonspecific interchange or
rapid equilibrium between the repertoires of blood and joint fluid
evident at a given time point.
Higher resolution analysis of the composition of the CD8 T
cell-oligoclonal expansions by determining the TCR
-chain amino acid
sequence in selected BV families revealed a single CD8 oligoclonal
expansion to be usually composed of one or a few structurally related
clones with
-chains that encode identical or highly homologous CDR3
motifs. However, importantly, when the sequence results were analyzed
at the nucleotide level it was often found that several structurally
distinct clones defined at the level of primary nucleotide sequence
degenerately encoded the same sequence of amino acids, as illustrated
in Tables II
and III
. These data argue strongly that clonal selection
and expansion is occurring at the level of the Ag recognition function
of the expressed receptor and is not due to the alternative explanation
of the random entry of a small number of founder T cells. Taken
together, these findings strongly implicate a role for Ag-, and likely
autoantigen-, driven clonal expansion underlying the accumulation of
the CD8 T cells. Based on the preferential accumulation of clones in
the joint fluid, the inciting peptide Ag is likely to be selectively
expressed in the joint or related tissues such as the entheses. In view
of the major HLA associations of psoriatic arthritis with certain class
I alleles and the activation and differentiation state of the T cell
phenotype (8), the finding of CD8 clonal expansions
supports the hypothetical class I MHC molecule-autologous peptide-CD8 T
cell immune recognition event paradigm that has been proposed to
underlie psoriatic arthritis (7).
Recently, oligoclonal expansions have been reported in the joint
fluids of individuals with Reiters syndrome (42). The
similarity of those observations to the present findings in psoriatic
arthritis provides additional evidence emphasizing the analogy of
Reiters syndrome and psoriatic arthritis (7). However,
the present findings differed from those reported in Reiters syndrome
(42) in that the considerable sharing of CDR3 motifs
between different patients reported in Reiters syndrome was not
observed in psoriatic arthritis, despite a fairly extensive sequencing
endeavor. It is possible that the greater number of HLA susceptibility
alleles for psoriatic arthritis and the fact that none of the patients
sequenced were HLA identical might account for the lack of common
-chain motifs. Alternatively, such sharing may not be a feature of
the immune response that engenders psoriatic arthritis.
In contrast to the striking alterations of the joint fluid CD8 T cell repertoire, the blood CD8 T cell repertoire is much less distorted by oligoclonal expansions. The presence of a small number of oligoclonal expansions that were shared with joint fluid is the most striking feature of the blood T cell repertoire. However, if these are excluded, the remaining repertoire is essentially equivalent to the repertoire of matched normal individuals in terms of the number and size of oligoclonal expansions as reflected in Hamming distance analyses. It is possible that the small number of additional clones in the blood of individuals with psoriatic arthritis reflects a response related to the skin disease. Preliminary evidence was also obtained suggesting the possibility that the sequence of clonal traffic may be from the blood to the joint, based on the appearance of a small number of oligoclonal expansions in the joint fluid that at an earlier time point were found restricted to the blood. Conversely, no clones that were present in the joint fluid at the earlier time point were identified in the blood, emphasizing that the joint may be populated by clones that are first expanded in the blood. This would be consistent with the clinical observation that psoriatic skin lesions usually antedate the development of arthritis by many years and that the immune response to the skin Ags in some way initiates the joint response. The dynamics of the oligoclonal expansions as a function of time are currently being studied in greater detail to better define the temporal relationships of the events and characterize the precise differences at a sequence level that distinguishes recrudescent arthritis.
The CD8 T cell oligoclonal expansions shared by blood and joint
fluid were of particular interest because they were almost invariably
very large in size in the joint fluid and commonly accounted for the
major proportion of the joint fluid repertoire for the particular BV
family as shown in Fig. 1
, B and C. The
distribution of the individual clones comprising the oligoclonal
expansions as characterized by sequence analysis (Tables II
and III
)
revealed that the relative ratio of each individual clone between blood
and joint fluid was not necessarily uniform, suggesting separate
Ag-driven accumulation in each compartment, rather than extensive
interchange of the entire oligoclonal expansion. As opposed to the
primarily articular location of one putative driving antigenic peptide
that accounts for clones restricted to the joint fluid and suggests
that the responsible protein is expressed in the joint and entheses,
the presence of a clonal expansion shared between blood and synovial
fluid suggests that a second class of driving peptides may exist. The
protein giving rise to these peptides would be likely found in both the
joint and the other tissues of the body, such as the skin. The finding
of sharing of certain CD8 T cell oligoclonal expansions between blood
and joint fluid would provide a potential explanation for the recent
report of Tassiulas et al. (43) that demonstrated the same
-chain sequences in both skin lesions and synovium in psoriatic
arthritis. Although those authors did not identify the T cell lineage
of the clone bearing the TCR sequence shared between the two sites, in
light of the present results these cells may have been CD8 T cells.
The second principal finding of this study was that CD4 T cell
oligoclonal expansions were also present in the joint fluid, but
smaller in number and size compared with the CD8 expansions. The CD4 T
cell expansions were present at about two-thirds the number of CD8
clones and in the aggregate occupied only 13% of the BV repertoire
compared with 29% for the CD8 T cell clonal expansions. Nearly all
were restricted to the joint fluid. It is possible that more sensitive
analyses, using methods such as sequence-specific conformation
polymorphism (SSCP) would demonstrate additional CD4 T cell clones,
especially because CD4 clones do not expand to the same extent as CD8 T
cell clones. The findings in the psoriatic arthritis joint fluids are
opposite to the situation in rheumatoid arthritis, where a
preponderance of clonal expansions in the CD4 T cell repertoire are
reported in both joint fluid and blood (44, 45, 46, 47, 48, 49), with a
considerably smaller number of CD8 T cell clonal expansions also
identifiable (50, 51, 52). Indeed, Striebich et al.
(48) also demonstrated sets of related, but different CDR3
nucleotide sequences that encoded identical or highly homologous
-chain amino acid sequences within the synovial fluid-derived CD4 T
cell clones of rheumatoid arthritis patients. The identification of CD4
T cell oligoclonal expansions in psoriatic arthritis raises the
possibility that the long recognized, but poorly understood,
association of psoriatic arthritis susceptibility with particular MHC
class II alleles (15, 16, 17) in fact reflects a significant
event in the disease involving recognition of a peptide by CD4 T cells
in the context of class II MHC molecules as has been postulated to
occur in this disease (53). The MHC class II allele
associations with psoriatic arthritis have usually been ascribed to
linkage disequilibrium with class I susceptibility alleles. This
potentially could involve dual recognition of different peptides
derived from the same putative antigenic protein.
However, the observation of the CD4 clonal expansions in psoriatic arthritis is seemingly inconsistent with the earlier reports on the development of psoriatic arthritis and Reiters syndrome in individuals with advanced HIV infection who are nearly devoid of any CD4 T cells (13, 14). The report by Ridge et al. (19) potentially reconciles this apparent inconsistency by showing that viral infection of dendritic cells may bypass the requirement for the presence of CD4 T cells and allows the dendritic cell to directly activate the CD8 T cells. This may occur with HIV infection where it has been suggested that with relaxation of the genetic constraint for MHC class II complementation, HIV-positive dendritic cells present particular Ags that induce CD8 T cells to both break tolerance and be induced to CD8 effector status (53).
This study underlines the importance of identifying the nature of
the peptides driving the immune response responsible for psoriatic
arthritis. The finding of multiple clones in a given BV family
characterized by highly homologous CDR3 motifs restricted to the same
CDR3 length argues for considerable structural fidelity in the
selection by a given peptide of different T cell clones involved in
disease pathogenesis, and it supports an important role for the
-chain CDR3 in defining the peptide recognition region of the

TCR. This observation suggests that MHC peptide binding
degeneracy and TCR plasticity that are evident in some autoreactive CD4
T cell clones (54) may not be highly relevant to the CD8 T
cell clonal repertoire of psoriatic arthritis. The average of 32
oligoclonal expansions places a rough upper limit on the number of
peptides recognized in the psoriatic arthritis CD8 immune response.
This is a large number of distinct peptides and at face value suggests
the recognition of multiple protein targets. However, part of this
complexity could represent presentation of multiple peptides from the
same protein by more than one MHC molecule involving a spread to
subdominant and cryptic determinants (55) or even
recognition by different clones of the same peptide presented by the
same MHC molecule. Additional high-resolution repertoire analysis and
biological cloning of these T cells currently underway should allow
additional implications on similarities or differences of recognition
motifs to be drawn, the basis of MHC restriction, and how the process
changes with time.
| Footnotes |
|---|
2 The accession numbers of the sequences listed in this report range from AF317588 to AF317614. ![]()
3 Address correspondence and reprint requests to Dr. Patrick Costello, Department of Rheumatology, Education and Research Center, St. Vincents University Hospital, Elm Park, Dublin 4, Ireland. ![]()
4 Abbreviations used in this paper: BV, variable gene(s) of the TCR
chain; BJ, joining gene (element) of the T cell receptor
chain; K-S, Kolmogoroff-Smirnov. ![]()
Received for publication July 12, 2000. Accepted for publication December 1, 2000.
| References |
|---|
|
|
|---|
and
chains determine T cell specificity for myoglobin peptides. J. Exp. Med. 172:27.
T-cell receptor CDR3 region. Immunogenetics 42:10.[Medline]
chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90:4319.
chains in cells infiltrating the salivary gland in the sicca syndrome of HIV-1 infection: evidence of Ag-driven clonal selection suggested by restricted combinations of V
J
gene segment usage and shared somatically encoded amino acid residues. J. Clin. Invest. 92:495.
and
chains of the human T-cell antigen receptor recognizing HLA-A2 and influenza A matrix peptide. Proc. Natl. Acad. Sci. USA 88:8987.
, J
, C
, and V
gene segments is not proportional to gene number. Hum. Immunol. 35:60.[Medline]
-chain junctional sequences and cytotoxicity toward HLA-B27. J. Immunol. 162:3830.
3 TCR chains in the CD8+ T cell population of rheumatoid arthritis patients. J. Immunol. 156:852.[Abstract]
spectratyping in RA: evidence of clonal expansions in peripheral blood lymphocytes. Ann. Rheum. Dis. 57:319.This article has been cited by other articles:
![]() |
H. ROBINSON, S. KELLY, and C. PITZALIS Basic Synovial Biology and Immunopathology in Psoriatic Arthritis J Rheumatol Suppl, August 1, 2009; 83(0): 14 - 16. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D Canete, B. Santiago, T. Cantaert, R. Sanmarti, A. Palacin, R. Celis, E. Graell, B. Gil-Torregrosa, D. Baeten, and J. L Pablos Ectopic lymphoid neogenesis in psoriatic arthritis Ann Rheum Dis, June 1, 2007; 66(6): 720 - 726. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Wu, M. S. Maurer, R. A. Friedman, C. C. Marboe, E. M. Ruiz-Vazquez, R. Ramakrishnan, A. Schwartz, M. D. Tilson, A. S. Stewart, and R. Winchester The Lymphocytic Infiltration in Calcific Aortic Stenosis Predominantly Consists of Clonally Expanded T Cells J. Immunol., April 15, 2007; 178(8): 5329 - 5339. [Abstract] [Full Text] [PDF] |
||||
![]() |
D J Veale, C Ritchlin, and O FitzGerald Immunopathology of psoriasis and psoriatic arthritis Ann Rheum Dis, March 1, 2005; 64(suppl_2): ii26 - ii29. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Y Goedkoop, M C Kraan, M B M Teunissen, D I Picavet, M A de Rie, J D Bos, and P P Tak Early effects of tumour necrosis factor {alpha} blockade on skin and synovial tissue in patients with active psoriasis and psoriatic arthritis Ann Rheum Dis, July 1, 2004; 63(7): 769 - 773. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Curran, O. M. FitzGerald, P. J. Costello, J. M. Selby, D. J. Kane, B. Bresnihan, and R. Winchester Nucleotide Sequencing of Psoriatic Arthritis Tissue before and during Methotrexate Administration Reveals a Complex Inflammatory T Cell Infiltrate with Very Few Clones Exhibiting Features That Suggest They Drive the Inflammatory Process by Recognizing Autoantigens J. Immunol., February 1, 2004; 172(3): 1935 - 1944. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jiang, S. Curran, E. Ruiz-Vazquez, B. Liang, R. Winchester, and L. Chess Regulatory CD8+ T cells fine-tune the myelin basic protein-reactive T cell receptor V{beta} repertoire during experimental autoimmune encephalomyelitis PNAS, July 8, 2003; 100(14): 8378 - 8383. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Wedderburn, A. Patel, H. Varsani, and P. Woo Divergence in the degree of clonal expansions in inflammatory T cell subpopulations mirrors HLA-associated risk alleles in genetically and clinically distinct subtypes of childhood arthritis Int. Immunol., December 1, 2001; 13(12): 1541 - 1550. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |