|
|
||||||||




*
Department of Immunology, Osaka Medical Center for Cancer and Cardiovascular Diseases, Higashinari-ku, Osaka, Japan;
Division of Environmental Pharmacology, Department of Pharmaceutical Sciences,
Institute for Protein Research, and
§
Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan; and
¶
Organization for Pharmaceutical Safety and Research, Tokyo, Japan
| Abstract |
|---|
|
|
|---|
and IL-12 p40 by human monocytes and DCs.
Either lipid or signal peptide at the N-terminal portion of monomer was
required for expression of this function. In contrast, murine
macrophages produced TNF-
in response to wild type, but not to any
recombinant form of M161Ag, suggesting the species-dependent response
to rM161Ag. Wild-type and both monomeric and dimeric SP+
forms possessed the ability to activate complement via the alternative
pathway. Again, the hydrophobic portion was associated with this
function. These results, together with the finding that macrophages
from TLR2-deficient mice did not produce TNF-
in response to M161Ag,
infer that the N-terminal hydrophobic structure of M161Ag is important
for TLR2-mediated cell activation and complement
activation. | Introduction |
|---|
|
|
|---|
TLRs consist of an extracellular domain with leucine-rich repeats and a
C-terminal flanking region, and a cytoplasmic domain with sequence
homology to the type I IL-1R termed a Toll/IL-1R domain
(3). The extracellular leucine-rich repeat domains are
involved in the recognition of bacterial products, and the cytoplasmic
domains trigger activation of NF-
B, p38 mitogen-activated protein
kinase, and Jun N-terminal kinase, leading to the induction of
proinflammatory genes (20).
Mycoplasma fermentans, a human pathogen, is a potent activator of monocytes/macrophages. Several studies demonstrated the ability of this mycoplasma to enter human cells and the possibility that it acts as accessory factors in the activation of AIDS (21, 22, 23). M. fermentans DNA has been detected in the PBMCs of AIDS patients by PCR (24, 25). In addition, the products of M. fermentans affect the host immune system via B or T cell activation, monocyte/macrophage stimulation, and cytocidal ability, which are not restricted to human cells (26, 27, 28, 29). The ability of M. fermentans to modulate host immune responses may contribute to its pathogenic property.
M161Ag is an unglycosylated 43-kDa membrane lipoprotein of M.
fermentans capable of inducing proinflammatory cytokines (IL-1
,
TNF-
, IL-6, IL-8, IL-10, and IL-12) by human monocytes/macrophages
and activating human complement on mycoplasma-infected cells
(30, 31, 32). It possesses a unique
NH2-terminal lipo-amino acid,
S-diacylglyceryl cysteine, followed by 403 aa, including
five tryptophan residues encoded by TGA codons (31, 33).
Biosynthetic labeling of cells revealed the palmitoylation of M161Ag
(31). The N-terminal 14 aa of M161Ag were quite similar to
those of macrophage-activating lipopeptide (MALP)-2 (29).
Later, this molecule was demonstrated to be a proteolytic cleavage
product of MALP-404, which is identical with M161Ag
(34).
Interestingly, Lien et al. (35) reported that a synthetic dipalmitoyl lipopeptide based upon MALP-2 (sMALP-2) activated cells through TLR2 similarly to several lipidated peptides from Borrelia burgdorferi OspA/OspC and Treponema pallidum 47-kDa major lipoprotein possessing tripalmitoyl-S-glyceryl-cysteine (Pam3Cys) at their N-termini, whereas the nonlipidated peptides completely lacked stimulatory activity, suggesting that the ester-linked not amido-bound fatty acids are important for their functions. Furthermore, it was shown that the configuration of the lipid moiety affected the MALP-2-mediated cell responses through a TLR2- and MyD88-dependent signaling pathway (36). Because M161Ag is an intact molecule with dual functions, C3 (third component of complement) activation and cytokine induction in monocytes/macrophages, we attempted to identify the structural motifs sustaining the functions of M161Ag using native and unlipidated rM161Ag.
| Materials and Methods |
|---|
|
|
|---|
Human monocytic THP-1 cells were obtained from the Japanese Cancer Research Resources Bank and maintained in RPMI 1640 supplemented with 10% heat-inactivated FCS (CSL, Victoria, Australia) and antibiotics. PBMC were prepared from 400 ml of citrate-phosphate dextrose-supplemented human blood by methylcellulose sedimentation and density-gradient centrifugation with Ficoll-Paque (Amersham Pharmacia Biotech AB, Piscataway, NJ) (37). Monocytes were isolated from PBMC with a magnetic cell sorting system using anti-CD14-coated microbeads (Miltenyi Biotec, Gladbach, Germany). Immature dendritic cells (iDCs) were generated from monocytes (5 x 105 cells/ml) by culturing for 6 days in RPMI 1640 supplemented with 10% heat-inactivated FCS in the presence of 500 IU/ml of human rGM-CSF (PeproTech EC, London, U.K.) and 100 IU/ml of human rIL-4 (PeproTech EC) (38). mAb against M161Ag (MK53) was prepared in our laboratory, as described (23). Anti-human C3b mAb (C5G) and anti-human C3bi mAb (G3E) were gifts from Dr. K. Iida (Takeda Chemical Industries, Osaka, Japan) (39). Polymyxin B, LPS from Escherichia coli serotype 0111:B4, and mouse IgG were obtained from Sigma (St. Louis, MO). Anti-CD83 mAb was purchased from Cosmo Bio (Tokyo, Japan), anti-CD86 mAb was from Ancell (Bayport, MN), and FITC-labeled anti-mouse IgG was from American Qualex Abs (San Clemente, CA). M161Ag was purified from an infected human cell line P39+, as described (31). A synthetic lipopeptide based upon the full-length MALP-2 (sMALP-2) was prepared using dipalmitoyl-S-glyceryl cysteine, as described (29). Lipopeptide was frozen at -20°C as 200 µM stock solution in 25 mM octyl glucoside. Normal human serum (NHS) was collected from 20 healthy donors and stored in aliquots at -70°C. A 1:20 volume of 40 mM Mg2+-200 mM EGTA (pH 7.4) or 200 mM EDTA (pH 7.4) was added to NHS in the preparation of either Mg2+-EGTA-NHS or EDTA-NHS.
Preparation of recombinant forms of M161Ag
Five TGA codons in the M161Ag cDNA coding region were mutated to
TGG with a QuickChange Site-Directed Mutagenesis Kit (Stratagene, La
Jolla, CA). Three kinds of unlipidated rM161Ag with 6x His tag at the
COOH terminus were prepared with the pET system (Novagen, Madison, WI).
The M161Ag-His expression vector was constructed by amplifying the
coding region of mutated M161Ag by PCR, and cloning the fragment into
the pET 19b vector (Novagen) at NcoI and BamHI
sites. The 5' oligonucleotide primer used to prepare unlipidated
rM161Ag with signal peptide (SP+) was
GCCATGGAAAAGTCAAAAAAAATTTTATTAGGATTG; and unlipidated rM161Ag
without signal peptide (SP-),
GCCATGGGAAACAACGATGAATCC. The 3' primer was
CGGATCCTTAATGATGATGATGATGATGTTTTGCTGCCTTGTTAATAGC. pET construct for
the monomeric form of rM161Ag with signal peptide
(SP+C25S), in which the serine residue at
position 25 was substituted for a cysteine residue, was made by
site-directed mutagenesis. The unlipidated status of these rM161Ag and
the presence or absence of SP were confirmed by matrix-assisted laser
desorption/ionization time of flight mass spectroscopy (MALDI-MS)
(40). The lipobox comprised of four residues (AVSC) in the
C-terminal part of M161Ag SP, which constitutes the cleavage site for
the lipoprotein-specific signal peptidase, was not recognized by signal
peptidase II in E. coli, resulting in the generation of
unlipidated protein with SP (41).
rM161Ag(SP+) was dimerized through the cysteine
residue during purification with a Ni2+ column
(see Fig. 1
). The rM161Ag contained <1 endotoxin U/ µg, as
determined by modified Limulus amebocyte assay (Seikagaku,
Tokyo, Japan). Native and rM161Ag were treated with polymyxin B (5
µg/ml) for 1 h at 37°C before stimulation of the cells.
|
B reporter assayThe coding region of human TLR2 minus the respective NH2-terminal signal sequence was amplified by RT-PCR from total RNA isolated from human monocyte-derived iDCs. The predicted amino acid sequence matched that previously published (5). The Flag-TLR2 expression vector was constructed by inserting the cDNA fragment into the mammalian expression vector pFlag-CMV-1 (Sigma) at HindIII and KpnI sites, in which the preprotrypsin leader sequence precedes an NH2-terminal Flag epitope. The dominant-negative version of human TLR2 plasmid (pFlag-TLR2-DN), which lacks C-terminal 155 aa of human TLR2, was provided by Dr. R. Medzhitov (Yale University School of Medicine, New Haven, CT). The plasmids were prepared with an endotoxin-free Plasmid Maxi kit (Qiagen, Valencia, CA).
THP-1 cells (2.5 x 106) were transfected
with a mixture of DNA (1.5 µg) using Effectene (50 µl; Qiagen) in a
60-mm dish. The DNA mix consisted of NF-
B reporter plasmid encoding
luciferase (0.5 µg; Stratagene) and control pFlag-CMV-1 vector (1
µg) or pFlag-TLR2-DN vector (1 µg). Twenty-four hours after
transfection, cells were harvested, seeded into 24-well plate (5
x 105/well), and stimulated with medium alone,
polymyxin B-treated native M161Ag (5 ng/ml), and rM161Ag
(SP+C25S) (1 µg/ml) for 6 h. The cells
were lysed using reporter lysis buffer (PicaGene; Toyo Ink, Tokyo,
Japan), and 20 µl of lysate was assayed for luciferase activity
according to the manufacturers instructions.
Cytokine assay
Human monocytes or iDCs (1 x 106/ml)
were stimulated with polymyxin B-treated native (5 ng/ml) and
unlipidated rM161Ag (10, 100, and 1000 ng/ml) for 24 h. For
control stimulation, polymyxin B-treated and untreated LPS (10 ng/ml)
were used. Concentrations of TNF-
in culture supernatants were
measured by ELISA (Amersham Pharmacia Biotech AB). Production of IL-12
p40 was also measured by ELISA (Genzyme, Cambridge, MA). In the case of
THP-1 cells, cells (5 x 105) were
stimulated with medium alone, polymyxin B-treated native M161Ag (5
ng/ml), and rM161Ag (SP+C25S) (1 µg/ml) for
24 h. Concentration of IL-8 in culture supernatants was measured
by ELISA (Amersham Pharmacia Biotech AB).
Peritoneal macrophages were prepared from wild-type (C57BL/6),
TLR4-deficient, and TLR2-deficient mice (F2
interbred from 129/Ola x C57BL/6), as described previously
(13), and were cultured (2.5 x
105/ml) with LPS (10 ng/ml), polymyxin B-treated
native M161Ag (5 ng/ml), and unlipidated rM161Ag (1 µg/ml) for
24 h. Concentrations of TNF-
in culture supernatants were
measured by ELISA (Genzyme).
C3-deposition assay
Native M161Ag (0.5 and 2.5 ng), various rM161Ag (0.1, 0.5, 1, and 2.5 µg), sMALP-2 (1, 10, and 100 ng), or LPS (1, 10, and 100 ng) were blotted onto nitrocellulose sheets (1 cm x 1 cm). After blocking with 10% skimmed milk for 1 h at 37°C, the sheets were washed three times with Dulbeccos PBS containing 0.05% Tween 20, and then incubated with either 25% EDTA-NHS or 25% Mg2+-EGTA-NHS for 20 min at 37°C. Deposited C3 fragments were detected with anti-human C3b/C3bi mAbs, HRP-labeled secondary Ab, and an ECL kit (Amersham Pharmacia Biotech AB) (42).
DC maturation
iDCs (1 x 106/ml) were stimulated
with polymyxin B-treated native M161Ag (5 ng/ml) and unlipidated
rM161Ag (1 µg/ml), or LPS (10 ng/ml). After 24 h, cells were
harvested and the expression levels of CD83 and CD86 were analyzed by
flow cytometry using FACSCalibur (Becton Dickinson, San Jose, CA).
Production of IL-12 p40 and TNF-
(data not shown) was measured by
ELISA.
MALDI-MS and circular dichroism (CD) measurements
Mass-spectrometric measurements were performed using a Voyager
Elite XL time of flight mass spectrometer equipped with a delayed
extraction system (PE Biosystems, Foster, CA) with flight paths of 4.2
and 6.5 m for the linear mode and reflector mode, respectively.
Protein or peptide solutions (about 1 µl, containing 15 pmol) were
mixed with the matrix solution, the supernatant of a 50% or a 33%
acetonitrile/water solution saturated with
-cyano-4-hydroxycinnamic
acid or sinapinic acid, respectively, and then air dried on the flat
surface of a stainless steel plate. Other measurement conditions were
as described previously (40).
CD measurements were performed with a Jasco spectropolarimeter, model
J-720. The temperature was controlled at 20°C with a thermostatically
controlled cell holder. Spectra were measured with a 1-mm cell at a
protein concentration of 0.2 mg/ml (43). The instrument
was calibrated with ammonium d-10-camphorsulfonic acid. The
results were expressed as the mean residue ellipticity,
[
], which was defined as [
] =
100
obs/lc, in which
obs is the observed ellipticity in
degrees, c is the concentration in residue moles per liter,
and l is the length of the light path in centimeters.
| Results |
|---|
|
|
|---|
was measured. Macrophages from wild-type
and TLR4-deficient mice secreted TNF-
in response to native M161Ag
(Fig. 2
, indicating that M161Ag mediates
cell activation through TLR2 similarly to MALP-2 (35, 36).
The lipid moiety of M161Ag participates in cell activation, because
rM161Ag lacking fatty acids could not induce TNF-
production by
macrophages isolated from wild-type or TLR4-deficient mice (Fig. 2
|
and IL-12 p40 in response
to monomeric form of rM161Ag with signal peptide
(SP+C25S), when its concentration was
sufficiently high (Fig. 3
or IL-12
p40 by human monocytes. Because these activities were not abolished by
treatment with polymyxin B sulfate, which completely destroyed LPS
activity, cytokine production was induced by the unlipidated monomeric
form of rM161Ag and not by contaminating endotoxin.
|
B reporter gene
assay using THP-1 cells to confirm TLR2-mediated cell activation by
rM161Ag (SP+C25S). Human monocytic THP-1 cells
endogenously express TLR2 (44) and secreted IL-8 in
response to native M161Ag and rM161Ag(SP+C25S),
similar to human monocytes (Fig. 4
B induced by native and rM161Ag was
decreased in THP-1 cells transiently transfected with the DN version of
human TLR2. These results indicate that rM161Ag
(SP+C25S) induces cell activation through TLR2.
Thus, human and murine TLR2 differentially recognize unlipidated
rM161Ag.
|
or TNF-
(37, 45, 46, 47).
Native M161Ag up-regulated the expression of CD83 and CD86 and IL-12
p40 production in iDCs, suggesting that M161Ag is a DC maturation
inducer similarly to LPS (Figs. 5
|
|
|
|
| Discussion |
|---|
|
|
|---|
and IL-12 p40 by human monocytes and iDCs, suggesting the
species-dependent recognition of rM161Ag by TLR2; 3) M161Ag-induced DC
maturation (up-regulation of CD83 and CD86) is dependent on the lipid
moiety; 4) the N-terminal hydrophobic portion is associated with
complement-activating function.
Several microbial lipoproteins/lipopeptides stimulate NF-
B
signaling and trigger activation of the host defense system through
TLR2 (15, 16, 35, 36). MALP-2 also induces AP-1 and
NF-
B activity and cytokine secretion in murine macrophages via
activation of the mitogen-activated protein kinase pathway
(48). Interestingly, nonacylated forms of lipopeptide
completely lacked stimulatory activity (15, 35), and the
synthetic lipo-amino Pam3Cys and the monoacylated
synthetic lipopeptide, PamCysSerLys4, did not activate
NF-
B luciferase reporter gene in 293 cells expressing human TLR2
(16). These results suggested that the di- or triacyl
groups and peptide moieties might be critical for TLR2-dependent cell
activation, although activating efficiency was different among
lipopeptides (35, 36).
However, our experiments demonstrated that the unlipidated rM161Ag could induce TLR2-mediated cytokine production by human monocytes and iDCs, if a hydrophobic SP was present at the N terminus. There were no differences in CD spectra between bioactive and inactive rM161Ag. Hence, an N-terminal hydrophobic element, either lipid or SP, and a subsequent hydrophilic portion may represent a molecular pattern of lipoproteins recognized by human TLR2 (49).
Recently, Takeuchi et al. (36) showed that the configuration of the lipid moiety in MALP-2 affected the TLR2-mediated cell responses (release of cytokines, chemokines, and NO); R-stereoisomer of the MALP-2 was >100 times more active than S-MALP in both human and murine cells. Taken together with our results that the lipidated form of M161Ag was >200-fold more active than the SP form in human cells, preferential recognition of M161Ag by TLR2 may be dependent on the N-terminal hydrophobic structure. In addition, the differences in responsiveness of murine and human macrophages to rM161Ag suggested the species-dependent recognition of rM161Ag by TLR2. Similar species-dependent discrimination has been reported on TLR4 in terms of intact LPS vs tetra-acyl LPS (50).
The native M161Ag is a maturation inducer of iDC because of the up-regulation of a maturation marker, CD83 and CD86, and induction of IL-12 p40 production (51). Monocyte-derived iDCs express TLR2, TLR4, and MD-2, but not CD14 (M. Matsumoto and T. Seya, unpublished data), suggesting that LPS and M161Ag stimulate iDCs through TLR4-MD-2 complex and TLR2, respectively. The monomeric form of rM161Ag with SP could not up-regulate CD83 expression in iDCs, but induced IL-12 p40 production. There may be some differences in the TLR2-mediated signaling pathway between cytokine production and CD83/CD86 expression. These studies demonstrated that the microbial constituents act as inducers of DC maturation as well as cytokine production by monocytes/macrophages, at least in humans, and the cell responses may be dependent on the ligand structure.
The complement-activating ability of M161Ag is associated with the N-terminal hydrophobic portion, although the lipid form is more active than the SP form. Complement is a pivotal factor in the innate immune system. C3 fragment deposition onto microbial components allows the components to provide the second ligand for host immune receptors. Complement receptors, CR1, CR2, CR3, and CR4, can be activated by the postformed C3 ligands. Many microbial products, such as high doses of LPS, peptidoglycan, and zymosan, all stimulating TLRs, serve as targets for complement, and C3 fragments are deposited on them via the alternative pathway (52, 53, 54). It is still unknown whether the consensus sequence or motif is required for stable C3 convertase formation on the complement-activating molecules. In M161Ag, the N-terminal fatty acids and following stretch of amino acids are required for complement activation, because sMALP-2 could not activate complement at concentrations capable of stimulating the cells. A homology search of the nucleotide databases revealed that there is an M161Ag-like consensus motif conserved in lipoproteins of several bacteria (Mycoplasma arginini, B. burgdorferi, T. pallidum, and Listeria monocytogenes) (32, 34). It will be of interest to determine in future studies whether the immune modulatory functions observed in M161Ag are conserved in these proteins.
An intriguing implication of these observations is an application of M161Ag to innate immune therapy for cancer. Bacillus Calmette-Guérin cell wall skeleton (BCG-CWS) induces DC maturation, which contributes to the induction of tumor immunity (38, 55, 56). In murine macrophages, both TLR2 and TLR4 participate in BCG-CWS-mediated cell activation (38, 57). BCG-CWS and M161Ag activate the innate immune system in different ways. Identification of the ligand structure and their signaling events through TLR2 and TLR4 in macrophages/DCs may be important for advanced tumor immune therapy.
In summary, M161Ag is a pathogen-associated molecular pattern (PAMP) affecting at least two receptors, TLR2 and complement receptors. In our recent studies, another representative PAMP, BCG-CWS, was shown to use two receptors, TLR and a novel lectin receptor (S. Tsuji, J. Vehori, and T. Seya, unpublished data). An attractive hypothesis is a two-receptor theory, in which PAMP simultaneously stimulates two sorts of receptors, TLR and others. TLR mainly participates in intracellular signaling for cell maturation and survival, while the partner receptors act in phagocytosis. Further studies of PAMP and their receptors are needed to consolidate this hypothesis.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Tsukasa Seya, Department of Immunology, Osaka Medical Center for Cancer and Cardiovascular Diseases, Higashinari-ku, Osaka 537-8511, Japan. ![]()
3 Abbreviations used in this paper: TLR, Toll-like receptor; BCG-CWS, bacillus Calmette-Guérin cell wall skeleton; C3, third component of complement; CD, circular dichroism; DC, dendritic cell; DN, dominant-negative; iDC, immature DC; MALDI-MS, matrix-assisted laser desorption/ionization time of flight mass spectroscopy; MALP, macrophage-activating lipopeptide; NHS, normal human serum; Pam3Cys, tripalmitoyl-S-glyceryl-cysteine; PAMP, pathogen-associated molecular pattern; sMALP, synthetic dipalmitoyl lipopeptide based upon MALP; SP, signal peptide. ![]()
Received for publication June 23, 2000. Accepted for publication November 30, 2000.
| References |
|---|
|
|
|---|
B through Toll-like receptor 4 (TLR4) in cultured human dermal endothelial cells. J. Biol. Chem. 275:11058.
B activity and cytokine secretion in macrophages via the activation of mitogen-activated protein kinase pathways. J. Biol. Chem. 273:34391.This article has been cited by other articles:
![]() |
S. Liang, K. B. Hosur, S. Lu, H. F. Nawar, B. R. Weber, R. I. Tapping, T. D. Connell, and G. Hajishengallis Mapping of a Microbial Protein Domain Involved in Binding and Activation of the TLR2/TLR1 Heterodimer J. Immunol., March 1, 2009; 182(5): 2978 - 2985. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shingai, M. Azuma, T. Ebihara, M. Sasai, K. Funami, M. Ayata, H. Ogura, H. Tsutsumi, M. Matsumoto, and T. Seya Soluble G protein of respiratory syncytial virus inhibits Toll-like receptor 3/4-mediated IFN-beta induction Int. Immunol., September 1, 2008; 20(9): 1169 - 1180. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tsukamoto, K. Hazeki, M. Hoshi, K. Nigorikawa, N. Inoue, T. Sasaki, and O. Hazeki Critical Roles of the p110{beta} Subtype of Phosphoinositide 3-Kinase in Lipopolysaccharide-Induced Akt Activation and Negative Regulation of Nitrite Production in RAW 264.7 Cells J. Immunol., February 15, 2008; 180(4): 2054 - 2061. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shimizu, Y. Kida, and K. Kuwano Mycoplasma pneumoniae-Derived Lipopeptides Induce Acute Inflammatory Responses in the Lungs of Mice Infect. Immun., January 1, 2008; 76(1): 270 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shingai, T. Ebihara, N. A. Begum, A. Kato, T. Honma, K. Matsumoto, H. Saito, H. Ogura, M. Matsumoto, and T. Seya Differential Type I IFN-Inducing Abilities of Wild-Type versus Vaccine Strains of Measles Virus J. Immunol., November 1, 2007; 179(9): 6123 - 6133. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. W. Kauf, R. F. Rosenbusch, M. J. Paape, and D. D. Bannerman Innate Immune Response to Intramammary Mycoplasma bovis Infection J Dairy Sci, July 1, 2007; 90(7): 3336 - 3348. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liang, M. Wang, K. Triantafilou, M. Triantafilou, H. F. Nawar, M. W. Russell, T. D. Connell, and G. Hajishengallis The A Subunit of Type IIb Enterotoxin (LT-IIb) Suppresses the Proinflammatory Potential of the B Subunit and Its Ability to Recruit and Interact with TLR2 J. Immunol., April 15, 2007; 178(8): 4811 - 4819. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Asai, Y. Makimura, and T. Ogawa Toll-like receptor 2-mediated dendritic cell activation by a Porphyromonas gingivalis synthetic lipopeptide J. Med. Microbiol., April 1, 2007; 56(4): 459 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liang, M. Wang, R. I. Tapping, V. Stepensky, H. F. Nawar, M. Triantafilou, K. Triantafilou, T. D. Connell, and G. Hajishengallis Ganglioside GD1a Is an Essential Coreceptor for Toll-like Receptor 2 Signaling in Response to the B subunit of Type IIb Enterotoxin J. Biol. Chem., March 9, 2007; 282(10): 7532 - 7542. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ishii, A. Matsuo, H. Sawa, T. Tsujita, K. Shida, M. Matsumoto, and T. Seya Lamprey TLRs with Properties Distinct from Those of the Variable Lymphocyte Receptors J. Immunol., January 1, 2007; 178(1): 397 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Fabisiak, F. Gao, R. G. Thomson, R. M. Strieter, S. C. Watkins, and J. H. Dauber Mycoplasma fermentans and TNF-beta interact to amplify immune-modulating cytokines in human lung fibroblasts Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L781 - L793. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hazeki, S. Kinoshita, T. Matsumura, K. Nigorikawa, H. Kubo, and O. Hazeki Opposite Effects of Wortmannin and 2-(4-Morpholinyl)-8-phenyl-1(4H)-benzopyran-4-one Hydrochloride on Toll-Like Receptor-Mediated Nitric Oxide Production: Negative Regulation of Nuclear Factor-{kappa}B by Phosphoinositide 3-Kinase Mol. Pharmacol., May 1, 2006; 69(5): 1717 - 1724. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hashimoto, K. Tawaratsumida, H. Kariya, K. Aoyama, T. Tamura, and Y. Suda Lipoprotein is a predominant Toll-like receptor 2 ligand in Staphylococcus aureus cell wall components Int. Immunol., February 1, 2006; 18(2): 355 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shimizu, Y. Kida, and K. Kuwano A Dipalmitoylated Lipoprotein from Mycoplasma pneumoniae Activates NF-{kappa}B through TLR1, TLR2, and TLR6 J. Immunol., October 1, 2005; 175(7): 4641 - 4646. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shingai, N. Inoue, T. Okuno, M. Okabe, T. Akazawa, Y. Miyamoto, M. Ayata, K. Honda, M. Kurita-Taniguchi, M. Matsumoto, et al. Wild-Type Measles Virus Infection in Human CD46/CD150-Transgenic Mice: CD11c-Positive Dendritic Cells Establish Systemic Viral Infection J. Immunol., September 1, 2005; 175(5): 3252 - 3261. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Weigt, C. Nassenstein, T. Tschernig, P. F. Muhlradt, N. Krug, and A. Braun Efficacy of Macrophage-activating Lipopeptide-2 Combined with Interferon-{gamma} in a Murine Asthma Model Am. J. Respir. Crit. Care Med., September 1, 2005; 172(5): 566 - 572. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Uehori, K. Fukase, T. Akazawa, S. Uematsu, S. Akira, K. Funami, M. Shingai, M. Matsumoto, I. Azuma, K. Toyoshima, et al. Dendritic Cell Maturation Induced by Muramyl Dipeptide (MDP) Derivatives: Monoacylated MDP Confers TLR2/TLR4 Activation J. Immunol., June 1, 2005; 174(11): 7096 - 7103. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakao, K. Funami, S. Kikkawa, M. Taniguchi, M. Nishiguchi, Y. Fukumori, T. Seya, and M. Matsumoto Surface-Expressed TLR6 Participates in the Recognition of Diacylated Lipopeptide and Peptidoglycan in Human Cells J. Immunol., February 1, 2005; 174(3): 1566 - 1573. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Rharbaoui, A. Westendorf, C. Link, S. Felk, J. Buer, M. Gunzer, and C. A. Guzman The Mycoplasma-Derived Macrophage-Activating 2-Kilodalton Lipopeptide Triggers Global Immune Activation on Nasal Mucosa-Associated Lymphoid Tissues Infect. Immun., December 1, 2004; 72(12): 6978 - 6986. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tsujita, H. Tsukada, M. Nakao, H. Oshiumi, M. Matsumoto, and T. Seya Sensing Bacterial Flagellin by Membrane and Soluble Orthologs of Toll-like Receptor 5 in Rainbow Trout (Onchorhynchus mikiss) J. Biol. Chem., November 19, 2004; 279(47): 48588 - 48597. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Pioli, E. Amiel, T. M. Schaefer, J. E. Connolly, C. R. Wira, and P. M. Guyre Differential Expression of Toll-Like Receptors 2 and 4 in Tissues of the Human Female Reproductive Tract Infect. Immun., October 1, 2004; 72(10): 5799 - 5806. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Gao, A. Barchowsky, A. A. Nemec, and J. P. Fabisiak Microbial Stimulation by Mycoplasma fermentans Synergistically Amplifies IL-6 Release by Human Lung Fibroblasts in Response to Residual Oil Fly Ash (ROFA) and Nickel Toxicol. Sci., October 1, 2004; 81(2): 467 - 479. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Epelman, D. Stack, C. Bell, E. Wong, G. G. Neely, S. Krutzik, K. Miyake, P. Kubes, L. D. Zbytnuik, L. L. Ma, et al. Different Domains of Pseudomonas aeruginosa Exoenzyme S Activate Distinct TLRs J. Immunol., August 1, 2004; 173(3): 2031 - 2040. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Begum, K. Ishii, M. Kurita-Taniguchi, M. Tanabe, M. Kobayashi, Y. Moriwaki, M. Matsumoto, Y. Fukumori, I. Azuma, K. Toyoshima, et al. Mycobacterium bovis BCG Cell Wall-Specific Differentially Expressed Genes Identified by Differential Display and cDNA Subtraction in Human Macrophages Infect. Immun., February 1, 2004; 72(2): 937 - 948. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Akazawa, H. Masuda, Y. Saeki, M. Matsumoto, K. Takeda, K. Tsujimura, K. Kuzushima, T. Takahashi, I. Azuma, S. Akira, et al. Adjuvant-Mediated Tumor Regression and Tumor-Specific Cytotoxic Response Are Impaired in MyD88-Deficient Mice Cancer Res., January 15, 2004; 64(2): 757 - 764. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Oshiumi, M. Sasai, K. Shida, T. Fujita, M. Matsumoto, and T. Seya TIR-containing Adapter Molecule (TICAM)-2, a Bridging Adapter Recruiting to Toll-like Receptor 4 TICAM-1 That Induces Interferon-{beta} J. Biol. Chem., December 12, 2003; 278(50): 49751 - 49762. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Saito, T. Yajima, H. Nishimura, K. Aiba, R. Ishimitsu, T. Matsuguchi, T. Fushimi, Y. Ohshima, Y. Tsukamoto, and Y. Yoshikai Soluble Branched {beta}-(1,4)Glucans from Acetobacter Species Show Strong Activities to Induce Interleukin-12 in Vitro and Inhibit T-helper 2 Cellular Response with Immunoglobulin E Production in Vivo J. Biol. Chem., October 3, 2003; 278(40): 38571 - 38578. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fujita, T. Into, M. Yasuda, T. Okusawa, S. Hamahira, Y. Kuroki, A. Eto, T. Nisizawa, M. Morita, and K.-i. Shibata Involvement of Leucine Residues at Positions 107, 112, and 115 in a Leucine-Rich Repeat Motif of Human Toll-Like Receptor 2 in the Recognition of Diacylated Lipoproteins and Lipopeptides and Staphylococcus aureus Peptidoglycans J. Immunol., October 1, 2003; 171(7): 3675 - 3683. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matsumoto, K. Funami, M. Tanabe, H. Oshiumi, M. Shingai, Y. Seto, A. Yamamoto, and T. Seya Subcellular Localization of Toll-Like Receptor 3 in Human Dendritic Cells J. Immunol., September 15, 2003; 171(6): 3154 - 3162. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Uehori, M. Matsumoto, S. Tsuji, T. Akazawa, O. Takeuchi, S. Akira, T. Kawata, I. Azuma, K. Toyoshima, and T. Seya Simultaneous Blocking of Human Toll-Like Receptors 2 and 4 Suppresses Myeloid Dendritic Cell Activation Induced by Mycobacterium bovis Bacillus Calmette-Guerin Peptidoglycan Infect. Immun., August 1, 2003; 71(8): 4238 - 4249. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Muroi, T. Ohnishi, S. Azumi-Mayuzumi, and K.-i. Tanamoto Lipopolysaccharide-Mimetic Activities of a Toll-Like Receptor 2-Stimulatory Substance(s) in Enterobacterial Lipopolysaccharide Preparations Infect. Immun., June 1, 2003; 71(6): 3221 - 3226. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Kurt-Jones, L. Mandell, C. Whitney, A. Padgett, K. Gosselin, P. E. Newburger, and R. W. Finberg Role of Toll-like receptor 2 (TLR2) in neutrophil activation: GM-CSF enhances TLR2 expression and TLR2-mediated interleukin 8 responses in neutrophils Blood, August 13, 2002; 100(5): 1860 - 1868. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Luhrmann, U. Deiters, J. Skokowa, M. Hanke, J. E. Gessner, P. F. Muhlradt, R. Pabst, and T. Tschernig In Vivo Effects of a Synthetic 2-Kilodalton Macrophage-Activating Lipopeptide of Mycoplasma fermentans after Pulmonary Application Infect. Immun., July 1, 2002; 70(7): 3785 - 3792. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-K. Lee, J. Lee, and P. S. Tobias Two Lipoproteins Extracted from Escherichia coli K-12 LCD25 Lipopolysaccharide Are the Major Components Responsible for Toll-Like Receptor 2-Mediated Signaling J. Immunol., April 15, 2002; 168(8): 4012 - 4017. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Vasselon and P. A. Detmers Toll Receptors: a Central Element in Innate Immune Responses Infect. Immun., March 1, 2002; 70(3): 1033 - 1041. [Full Text] [PDF] |
||||
![]() |
K. L. Davis and K. S. Wise Site-Specific Proteolysis of the MALP-404 Lipoprotein Determines the Release of a Soluble Selective Lipoprotein-Associated Motif-Containing Fragment and Alteration of the Surface Phenotype of Mycoplasma fermentans Infect. Immun., March 1, 2002; 70(3): 1129 - 1135. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fukui, N. Inoue, M. Matsumoto, M. Nomura, K. Yamada, Y. Matsuda, K. Toyoshima, and T. Seya Molecular Cloning and Functional Characterization of Chicken Toll-like Receptors. A SINGLE CHICKEN TOLL COVERS MULTIPLE MOLECULAR PATTERNS J. Biol. Chem., December 7, 2001; 276(50): 47143 - 47149. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. C. Almeida and R. T. Gazzinelli Proinflammatory activity of glycosylphosphatidylinositol anchors derived from Trypanosoma cruzi: structural and functional analyses J. Leukoc. Biol., October 1, 2001; 70(4): 467 - 477. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Narita, H. Tanaka, S. Yamada, S. Abe, T. Ariga, and Y. Sakiyama Significant Role of Interleukin-8 in Pathogenesis of Pulmonary Disease Due to Mycoplasma pneumoniae Infection Clin. Vaccine Immunol., September 1, 2001; 8(5): 1028 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Mitsuzawa, I. Wada, H. Sano, D. Iwaki, S. Murakami, T. Himi, N. Matsushima, and Y. Kuroki Extracellular Toll-Like Receptor 2 Region Containing Ser40-Ile64 but Not Cys30-Ser39 Is Critical for the Recognition of Staphylococcus aureus Peptidoglycan J. Biol. Chem., October 26, 2001; 276(44): 41350 - 41356. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |