The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishiguchi, M.
Right arrow Articles by Seya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishiguchi, M.
Right arrow Articles by Seya, T.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2001, 166: 2610-2616.
Copyright © 2001 by The American Association of Immunologists

Mycoplasma fermentans Lipoprotein M161Ag-Induced Cell Activation Is Mediated by Toll-Like Receptor 2: Role of N-Terminal Hydrophobic Portion in its Multiple Functions1

Miyuki Nishiguchi*,{dagger}, Misako Matsumoto*, Toshifumi Takao{ddagger}, Masaru Hoshino{ddagger}, Yasutsugu Shimonishi{ddagger}, Shoutaro Tsuji*, Nasim A. Begum*, Osamu Takeuchi§, Shizuo Akira§, Kumao Toyoshima* and Tsukasa Seya2,*

* Department of Immunology, Osaka Medical Center for Cancer and Cardiovascular Diseases, Higashinari-ku, Osaka, Japan; {dagger} Division of Environmental Pharmacology, Department of Pharmaceutical Sciences, {ddagger} Institute for Protein Research, and § Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan; and Organization for Pharmaceutical Safety and Research, Tokyo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
M161Ag is a 43-kDa surface lipoprotein of Mycoplasma fermentans, serving as a potent cytokine inducer for monocytes/macrophages, maturing dendritic cells (DCs), and activating host complement on affected cells. It possesses a unique N-terminal lipo-amino acid, S-diacylglyceryl cysteine. The 2-kDa macrophage-activating lipopeptide-2 (MALP-2), recently identified as a ligand for Toll-like receptor 2 (TLR2), is derived from M161Ag. In this study, we identified structural motifs sustaining the functions of M161Ag using wild-type and unlipidated rM161Ag with (SP+) or without signal peptides (SP-). Because the SP+ rM161Ag formed dimers via 25Cys, we obtained a monomeric form by mutagenesis (SP+C25S). Only wild type accelerated maturation of human DCs as determined by the CD83/86 criteria, suggesting the importance of the N-terminal fatty acids for this function. Wild-type and the SP+ form of monomer induced secretion of TNF-{alpha} and IL-12 p40 by human monocytes and DCs. Either lipid or signal peptide at the N-terminal portion of monomer was required for expression of this function. In contrast, murine macrophages produced TNF-{alpha} in response to wild type, but not to any recombinant form of M161Ag, suggesting the species-dependent response to rM161Ag. Wild-type and both monomeric and dimeric SP+ forms possessed the ability to activate complement via the alternative pathway. Again, the hydrophobic portion was associated with this function. These results, together with the finding that macrophages from TLR2-deficient mice did not produce TNF-{alpha} in response to M161Ag, infer that the N-terminal hydrophobic structure of M161Ag is important for TLR2-mediated cell activation and complement activation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The innate immune responses against infectious pathogens precede the cell-mediated immunity (1, 2). The cells of the innate immune system recognize constituents of microbes by specific receptors, which transmit signals into the cells (1, 2). Recently, mammalian Toll-like receptors (TLRs)3 were cloned and identified as signal-transducing molecules involved in innate immune defense (3, 4, 5, 6). TLR2 and TLR4 are mainly implicated in the recognition of various bacterial components. TLR4 is involved in the recognition of Gram-negative bacterial LPS and Gram-positive bacterial lipoteichoic acids, while TLR2 recognizes Gram-positive bacterial peptidoglycans, zymosan, and several bacterial lipoproteins (7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18). Bacterial lipoproteins are characterized by a unique NH2-terminal lipo-amino acid, N-acyl-S-diacylglyceryl cysteine (19), and this lipid element and peptide moieties are critical for cell activation through TLR2 (15, 16, 17).

TLRs consist of an extracellular domain with leucine-rich repeats and a C-terminal flanking region, and a cytoplasmic domain with sequence homology to the type I IL-1R termed a Toll/IL-1R domain (3). The extracellular leucine-rich repeat domains are involved in the recognition of bacterial products, and the cytoplasmic domains trigger activation of NF-{kappa}B, p38 mitogen-activated protein kinase, and Jun N-terminal kinase, leading to the induction of proinflammatory genes (20).

Mycoplasma fermentans, a human pathogen, is a potent activator of monocytes/macrophages. Several studies demonstrated the ability of this mycoplasma to enter human cells and the possibility that it acts as accessory factors in the activation of AIDS (21, 22, 23). M. fermentans DNA has been detected in the PBMCs of AIDS patients by PCR (24, 25). In addition, the products of M. fermentans affect the host immune system via B or T cell activation, monocyte/macrophage stimulation, and cytocidal ability, which are not restricted to human cells (26, 27, 28, 29). The ability of M. fermentans to modulate host immune responses may contribute to its pathogenic property.

M161Ag is an unglycosylated 43-kDa membrane lipoprotein of M. fermentans capable of inducing proinflammatory cytokines (IL-1{beta}, TNF-{alpha}, IL-6, IL-8, IL-10, and IL-12) by human monocytes/macrophages and activating human complement on mycoplasma-infected cells (30, 31, 32). It possesses a unique NH2-terminal lipo-amino acid, S-diacylglyceryl cysteine, followed by 403 aa, including five tryptophan residues encoded by TGA codons (31, 33). Biosynthetic labeling of cells revealed the palmitoylation of M161Ag (31). The N-terminal 14 aa of M161Ag were quite similar to those of macrophage-activating lipopeptide (MALP)-2 (29). Later, this molecule was demonstrated to be a proteolytic cleavage product of MALP-404, which is identical with M161Ag (34).

Interestingly, Lien et al. (35) reported that a synthetic dipalmitoyl lipopeptide based upon MALP-2 (sMALP-2) activated cells through TLR2 similarly to several lipidated peptides from Borrelia burgdorferi OspA/OspC and Treponema pallidum 47-kDa major lipoprotein possessing tripalmitoyl-S-glyceryl-cysteine (Pam3Cys) at their N-termini, whereas the nonlipidated peptides completely lacked stimulatory activity, suggesting that the ester-linked not amido-bound fatty acids are important for their functions. Furthermore, it was shown that the configuration of the lipid moiety affected the MALP-2-mediated cell responses through a TLR2- and MyD88-dependent signaling pathway (36). Because M161Ag is an intact molecule with dual functions, C3 (third component of complement) activation and cytokine induction in monocytes/macrophages, we attempted to identify the structural motifs sustaining the functions of M161Ag using native and unlipidated rM161Ag.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells and reagents

Human monocytic THP-1 cells were obtained from the Japanese Cancer Research Resources Bank and maintained in RPMI 1640 supplemented with 10% heat-inactivated FCS (CSL, Victoria, Australia) and antibiotics. PBMC were prepared from 400 ml of citrate-phosphate dextrose-supplemented human blood by methylcellulose sedimentation and density-gradient centrifugation with Ficoll-Paque (Amersham Pharmacia Biotech AB, Piscataway, NJ) (37). Monocytes were isolated from PBMC with a magnetic cell sorting system using anti-CD14-coated microbeads (Miltenyi Biotec, Gladbach, Germany). Immature dendritic cells (iDCs) were generated from monocytes (5 x 105 cells/ml) by culturing for 6 days in RPMI 1640 supplemented with 10% heat-inactivated FCS in the presence of 500 IU/ml of human rGM-CSF (PeproTech EC, London, U.K.) and 100 IU/ml of human rIL-4 (PeproTech EC) (38). mAb against M161Ag (MK53) was prepared in our laboratory, as described (23). Anti-human C3b mAb (C5G) and anti-human C3bi mAb (G3E) were gifts from Dr. K. Iida (Takeda Chemical Industries, Osaka, Japan) (39). Polymyxin B, LPS from Escherichia coli serotype 0111:B4, and mouse IgG were obtained from Sigma (St. Louis, MO). Anti-CD83 mAb was purchased from Cosmo Bio (Tokyo, Japan), anti-CD86 mAb was from Ancell (Bayport, MN), and FITC-labeled anti-mouse IgG was from American Qualex Abs (San Clemente, CA). M161Ag was purified from an infected human cell line P39+, as described (31). A synthetic lipopeptide based upon the full-length MALP-2 (sMALP-2) was prepared using dipalmitoyl-S-glyceryl cysteine, as described (29). Lipopeptide was frozen at -20°C as 200 µM stock solution in 25 mM octyl glucoside. Normal human serum (NHS) was collected from 20 healthy donors and stored in aliquots at -70°C. A 1:20 volume of 40 mM Mg2+-200 mM EGTA (pH 7.4) or 200 mM EDTA (pH 7.4) was added to NHS in the preparation of either Mg2+-EGTA-NHS or EDTA-NHS.

Preparation of recombinant forms of M161Ag

Five TGA codons in the M161Ag cDNA coding region were mutated to TGG with a QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). Three kinds of unlipidated rM161Ag with 6x His tag at the COOH terminus were prepared with the pET system (Novagen, Madison, WI). The M161Ag-His expression vector was constructed by amplifying the coding region of mutated M161Ag by PCR, and cloning the fragment into the pET 19b vector (Novagen) at NcoI and BamHI sites. The 5' oligonucleotide primer used to prepare unlipidated rM161Ag with signal peptide (SP+) was GCCATGGAAAAGTCAAAAAAAATTTTATTAGGATTG; and unlipidated rM161Ag without signal peptide (SP-), GCCATGGGAAACAACGATGAATCC. The 3' primer was CGGATCCTTAATGATGATGATGATGATGTTTTGCTGCCTTGTTAATAGC. pET construct for the monomeric form of rM161Ag with signal peptide (SP+C25S), in which the serine residue at position 25 was substituted for a cysteine residue, was made by site-directed mutagenesis. The unlipidated status of these rM161Ag and the presence or absence of SP were confirmed by matrix-assisted laser desorption/ionization time of flight mass spectroscopy (MALDI-MS) (40). The lipobox comprised of four residues (AVSC) in the C-terminal part of M161Ag SP, which constitutes the cleavage site for the lipoprotein-specific signal peptidase, was not recognized by signal peptidase II in E. coli, resulting in the generation of unlipidated protein with SP (41). rM161Ag(SP+) was dimerized through the cysteine residue during purification with a Ni2+ column (see Fig. 1Go). The rM161Ag contained <1 endotoxin U/ µg, as determined by modified Limulus amebocyte assay (Seikagaku, Tokyo, Japan). Native and rM161Ag were treated with polymyxin B (5 µg/ml) for 1 h at 37°C before stimulation of the cells.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. SDS-PAGE analysis and N-terminal amino acid sequence of rM161Ag. Purified proteins were subjected to SDS-PAGE (10% gel) under nonreducing conditions. Positions of m.w. markers are shown to the left. Under reducing conditions, rM161Ag(SP+) showed the same mobility as rM161Ag(SP+C25S), indicating that it dimerized through cysteine residues during purification. rM161Ag(SP-) showed a major peak at 46210.4 by MALD-MS; rM161Ag(SP+), 97363.9; rM161Ag(SP+C25S), 48671.1. The boxed sequences indicate leader sequences carrying tetrapeptide lipidation motif, which was not recognized by signal peptidase II in E. coli, resulting in the generation of unlipidated protein with SP. The asterisk indicates the substitution of serine for cysteine. The second amino acid (glutamic acid) in the signal sequence was substituted for lysine in the primary sequence.

 
DNA cloning and NF-{kappa}B reporter assay

The coding region of human TLR2 minus the respective NH2-terminal signal sequence was amplified by RT-PCR from total RNA isolated from human monocyte-derived iDCs. The predicted amino acid sequence matched that previously published (5). The Flag-TLR2 expression vector was constructed by inserting the cDNA fragment into the mammalian expression vector pFlag-CMV-1 (Sigma) at HindIII and KpnI sites, in which the preprotrypsin leader sequence precedes an NH2-terminal Flag epitope. The dominant-negative version of human TLR2 plasmid (pFlag-TLR2-DN), which lacks C-terminal 155 aa of human TLR2, was provided by Dr. R. Medzhitov (Yale University School of Medicine, New Haven, CT). The plasmids were prepared with an endotoxin-free Plasmid Maxi kit (Qiagen, Valencia, CA).

THP-1 cells (2.5 x 106) were transfected with a mixture of DNA (1.5 µg) using Effectene (50 µl; Qiagen) in a 60-mm dish. The DNA mix consisted of NF-{kappa}B reporter plasmid encoding luciferase (0.5 µg; Stratagene) and control pFlag-CMV-1 vector (1 µg) or pFlag-TLR2-DN vector (1 µg). Twenty-four hours after transfection, cells were harvested, seeded into 24-well plate (5 x 105/well), and stimulated with medium alone, polymyxin B-treated native M161Ag (5 ng/ml), and rM161Ag (SP+C25S) (1 µg/ml) for 6 h. The cells were lysed using reporter lysis buffer (PicaGene; Toyo Ink, Tokyo, Japan), and 20 µl of lysate was assayed for luciferase activity according to the manufacturer’s instructions.

Cytokine assay

Human monocytes or iDCs (1 x 106/ml) were stimulated with polymyxin B-treated native (5 ng/ml) and unlipidated rM161Ag (10, 100, and 1000 ng/ml) for 24 h. For control stimulation, polymyxin B-treated and untreated LPS (10 ng/ml) were used. Concentrations of TNF-{alpha} in culture supernatants were measured by ELISA (Amersham Pharmacia Biotech AB). Production of IL-12 p40 was also measured by ELISA (Genzyme, Cambridge, MA). In the case of THP-1 cells, cells (5 x 105) were stimulated with medium alone, polymyxin B-treated native M161Ag (5 ng/ml), and rM161Ag (SP+C25S) (1 µg/ml) for 24 h. Concentration of IL-8 in culture supernatants was measured by ELISA (Amersham Pharmacia Biotech AB).

Peritoneal macrophages were prepared from wild-type (C57BL/6), TLR4-deficient, and TLR2-deficient mice (F2 interbred from 129/Ola x C57BL/6), as described previously (13), and were cultured (2.5 x 105/ml) with LPS (10 ng/ml), polymyxin B-treated native M161Ag (5 ng/ml), and unlipidated rM161Ag (1 µg/ml) for 24 h. Concentrations of TNF-{alpha} in culture supernatants were measured by ELISA (Genzyme).

C3-deposition assay

Native M161Ag (0.5 and 2.5 ng), various rM161Ag (0.1, 0.5, 1, and 2.5 µg), sMALP-2 (1, 10, and 100 ng), or LPS (1, 10, and 100 ng) were blotted onto nitrocellulose sheets (1 cm x 1 cm). After blocking with 10% skimmed milk for 1 h at 37°C, the sheets were washed three times with Dulbecco’s PBS containing 0.05% Tween 20, and then incubated with either 25% EDTA-NHS or 25% Mg2+-EGTA-NHS for 20 min at 37°C. Deposited C3 fragments were detected with anti-human C3b/C3bi mAbs, HRP-labeled secondary Ab, and an ECL kit (Amersham Pharmacia Biotech AB) (42).

DC maturation

iDCs (1 x 106/ml) were stimulated with polymyxin B-treated native M161Ag (5 ng/ml) and unlipidated rM161Ag (1 µg/ml), or LPS (10 ng/ml). After 24 h, cells were harvested and the expression levels of CD83 and CD86 were analyzed by flow cytometry using FACSCalibur (Becton Dickinson, San Jose, CA). Production of IL-12 p40 and TNF-{alpha} (data not shown) was measured by ELISA.

MALDI-MS and circular dichroism (CD) measurements

Mass-spectrometric measurements were performed using a Voyager Elite XL time of flight mass spectrometer equipped with a delayed extraction system (PE Biosystems, Foster, CA) with flight paths of 4.2 and 6.5 m for the linear mode and reflector mode, respectively. Protein or peptide solutions (about 1 µl, containing 1–5 pmol) were mixed with the matrix solution, the supernatant of a 50% or a 33% acetonitrile/water solution saturated with {alpha}-cyano-4-hydroxycinnamic acid or sinapinic acid, respectively, and then air dried on the flat surface of a stainless steel plate. Other measurement conditions were as described previously (40).

CD measurements were performed with a Jasco spectropolarimeter, model J-720. The temperature was controlled at 20°C with a thermostatically controlled cell holder. Spectra were measured with a 1-mm cell at a protein concentration of 0.2 mg/ml (43). The instrument was calibrated with ammonium d-10-camphorsulfonic acid. The results were expressed as the mean residue ellipticity, [{theta} ], which was defined as [{theta} ] = 100{theta} obs/lc, in which {theta} obs is the observed ellipticity in degrees, c is the concentration in residue moles per liter, and l is the length of the light path in centimeters.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Three kinds of unlipidated rM161Ag with or without SP are shown in Fig. 1Go. Comparative analysis between native and recombinant M161Ag was performed using murine macrophages lacking either TLR2 or TLR4. Peritoneal macrophages from wild-type, TLR2-deficient, and TLR4-deficient mice were cultured with various polymyxin B-treated rM161Ag and native M161Ag, or LPS for 24 h, and the production of TNF-{alpha} was measured. Macrophages from wild-type and TLR4-deficient mice secreted TNF-{alpha} in response to native M161Ag (Fig. 2Go). In contrast, TLR2-deficient macrophages did not produce TNF-{alpha}, indicating that M161Ag mediates cell activation through TLR2 similarly to MALP-2 (35, 36). The lipid moiety of M161Ag participates in cell activation, because rM161Ag lacking fatty acids could not induce TNF-{alpha} production by macrophages isolated from wild-type or TLR4-deficient mice (Fig. 2Go).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. M161Ag induces TNF-{alpha} production by murine macrophages through TLR2. Thioglycolate-elicited peritoneal macrophages from wild-type, TLR2-deficient, and TLR4-deficient mice were cultured with medium alone, polymyxin B-treated native M161Ag (5 ng/ml), polymyxin B-treated various rM161Ag (1 µg/ml), and LPS (10 ng/ml) for 24 h. The concentrations of TNF-{alpha} in culture supernatants were measured by ELISA. Determinations were performed in duplicate, and results are expressed as means ± SD. Results are representative of three separate experiments.

 
In contrast, human monocytes secreted TNF-{alpha} and IL-12 p40 in response to monomeric form of rM161Ag with signal peptide (SP+C25S), when its concentration was sufficiently high (Fig. 3Go). The sample of the SP+C25S contained no lipid-attached form based on the mass-spectrometric analysis, excluding the possibility that a lipid-attached form contributes to the cytokine-inducing activity. In contrast, dimeric form of rM161Ag (SP+) and rM161Ag without signal peptide (SP-) did not induce release of TNF-{alpha} or IL-12 p40 by human monocytes. Because these activities were not abolished by treatment with polymyxin B sulfate, which completely destroyed LPS activity, cytokine production was induced by the unlipidated monomeric form of rM161Ag and not by contaminating endotoxin.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 3. Unlipidated monomeric form of rM161Ag with SP induces cytokine production by human monocytes. Monocytes were stimulated with polymyxin B-treated native M161Ag, polymyxin B-treated various rM161Ag, LPS, and polymyxin B-treated LPS. After 24 h, the concentrations of TNF-{alpha} and IL-12 p40 in the supernatants were measured by ELISA. Determinations were performed in duplicate, and results are expressed as means ± SD. Results are representative of three separate experiments.

 
These results on human and murine cells suggested the species-dependent recognition of rM161Ag by TLR2. We then performed NF-{kappa}B reporter gene assay using THP-1 cells to confirm TLR2-mediated cell activation by rM161Ag (SP+C25S). Human monocytic THP-1 cells endogenously express TLR2 (44) and secreted IL-8 in response to native M161Ag and rM161Ag(SP+C25S), similar to human monocytes (Fig. 4GoA). As shown in Fig. 4GoB, activation of NF-{kappa}B induced by native and rM161Ag was decreased in THP-1 cells transiently transfected with the DN version of human TLR2. These results indicate that rM161Ag (SP+C25S) induces cell activation through TLR2. Thus, human and murine TLR2 differentially recognize unlipidated rM161Ag.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 4. Unlipidated monomeric form of rM161Ag with SP induces cell activation through TLR2. A, THP-1 cells secrete IL-8 in response to M161Ag and unlipidated rM161Ag. Cells (5 x 105) were stimulated with medium alone, polymyxin B-treated native M161Ag (5 ng/ml), and rM161Ag (SP+C25S) (1 µg/ml) for 24 h. The concentrations of IL-8 in culture supernatants were measured by ELISA. B, NF-{kappa}B activation induced by native and rM161Ag was reduced in THP-1 cells expressing TLR2-DN. THP-1 cells were transiently cotransfected with NF-{kappa}B reporter plasmid encoding luciferase (0.5 µg) and either pFlag-CMV-1 empty vector (pFlag; 1 µg) or pFlag-TLR2-DN vector (TLR2-DN; 1 µg). After 24 h, the cells were stimulated with medium alone, polymyxin B-treated native M161Ag (5 ng/ml), and rM161Ag (SP+C25S) (1 µg/ml) for 6 h, and NF-{kappa}B activation was measured by luciferase activity in cell lysates and normalized to protein content. Determinations were performed in duplicate, and results are expressed as means ± SD. Results are representative of three separate experiments.

 
We next examined the responses of human monocyte-derived iDCs to native and unlipidated rM161Ag, because bacterial products such as LPS induce iDC maturation as well as IL-1{beta} or TNF-{alpha} (37, 45, 46, 47). Native M161Ag up-regulated the expression of CD83 and CD86 and IL-12 p40 production in iDCs, suggesting that M161Ag is a DC maturation inducer similarly to LPS (Figs. 5Go and 6Go). In contrast, the monomeric form of rM161Ag with SP did not affect CD83 expression in iDCs, but induced IL-12 P40 production. Again, rM161Ag without SP and dimeric form of rM161Ag with SP had no effect on iDCs. When stimulated with LPS, iDCs produced large amounts of IL-12 p40 (Fig. 5Go) and IL-12 p70 (300–400 pg/ml, data not shown), while native and monomeric forms of rM161Ag could not induce IL-12 p70 production (data not shown). These results suggested that the lipid moiety of M161Ag is critical for TLR2-mediated cytokine production by murine macrophages, but not by human monocytes/iDCs. They also showed that, in human iDCs, cytokine production and CD83/CD86 expression were independently induced by M161Ag through TLR2.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 5. Unlipidated monomeric form of rM161Ag with SP induces IL-12 p40 production by human iDCs. Monocyte-derived iDCs (1 x 106/ml) were stimulated with polymyxin B-treated native M161Ag (5 ng/ml), polymyxin B-treated various rM161Ag (1 µg/ml), LPS (10 ng/ml), and polymyxin B-treated LPS (10 ng/ml). After 24 h, the concentrations of IL-12 p40 in the supernatants were measured by ELISA. Determinations were performed in duplicate, and results are expressed as means ± SD. Results are representative of three separate experiments.

 


View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 6. Native M161Ag up-regulates CD83 and CD86 expression in immature DCs. Monocyte-derived iDCs (1 x 106/ml) were stimulated with polymyxin B-treated native M161Ag (5 ng/ml) and various rM161Ag (1 µg/ml), or LPS (10 ng/ml). After 24 h, the cells were harvested, and the expression levels of CD83 and CD86 were analyzed by flow cytometry. Unstimulated cells were cultured in parallel without stimulation. Mean fluorescence shift was indicated in each panel.

 
Interestingly, complement-activating ability was reserved in rM161Ag with SP, but not in rM161Ag without SP (Fig. 7Go). When blotted onto nitrocellulose sheets, native M161Ag and both monomeric and dimeric forms of rM161Ag with SP activated complement via the alternative pathway, followed by deposition of C3 fragments after incubation with Mg2+-EGTA-NHS. In contrast, rM161Ag without SP did not. Again, higher doses of rM161Ag with SP (>0.5 µg) were required for complement activation than those of native form (Fig. 7Go). In contrast, sMALP-2 and LPS did not induce C3 deposition on itself in the range of 1–100 ng (Fig. 7Go, data not shown). No C3 fragments bound to native or rM161Ag were detected after treatment with EDTA-NHS (data not shown).



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 7. Activation of human complement via the alternative pathway by unlipidated rM161Ag with the SP. A, Native M161Ag (2.5 ng), various rM161Ag (2.5 µg), sMALP-2 (0.1 µg), and LPS (0.1 µg) were blotted onto nitrocellulose sheets. After blocking with 10% skimmed milk, the sheets were incubated in either 25% EDTA-NHS or 25% Mg2+-EGTA-NHS. Deposited C3 fragments were detected with anti-human C3bi mAb (G3E) or anti-human C3b mAb (C5G). Mouse IgG was used as a control Ab. Right, Blotted protein was detected with anti-M161Ag mAb, MK53, and HRP-labeled secondary Ab. LPS and sMALP-2 did not induce C3 deposition on themselves at the indicated concentrations. No C3 fragments were detected after incubation with EDTA-NHS (data not shown). B, Dose-response activation of human complement by SP+C25S. Varying amounts of the SP+C25S form of rM161Ag were blotted onto the sheets and incubated with human serum as in A. Deposited C3 fragment was determined by anti-human C3b mAb (C5G).

 
Major structural difference between bioactive (SP+C25S) and inactive (SP-) rM161Ag relied on the presence or absence of SP (Fig. 1Go). To test the possibility that the presence of N-terminal hydrophobic SP affects the tertiary structure of rM161Ag, CD spectra of these rM161Ag were measured. As shown in Fig. 8Go, there were no differences in CD spectra between bioactive and inactive rM161Ag, suggesting that bioactivity of rM161Ag is dependent on the N-terminal hydrophobic SP and not the tertiary structure of rM161Ag.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 8. Far-UV CD spectra of rM161Ag at pH 7 and 20°C.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we focused on the structural motifs sustaining the functions of mycoplasma lipoprotein M161Ag and its signaling through TLR. The findings were as follows: 1) The lipid moiety of M161Ag is critical for TLR2-mediated cytokine production by murine macrophages; 2) in contrast, monomeric form of rM161Ag with an N-terminal hydrophobic portion, either lipid or SP, is required for induction of TNF-{alpha} and IL-12 p40 by human monocytes and iDCs, suggesting the species-dependent recognition of rM161Ag by TLR2; 3) M161Ag-induced DC maturation (up-regulation of CD83 and CD86) is dependent on the lipid moiety; 4) the N-terminal hydrophobic portion is associated with complement-activating function.

Several microbial lipoproteins/lipopeptides stimulate NF-{kappa}B signaling and trigger activation of the host defense system through TLR2 (15, 16, 35, 36). MALP-2 also induces AP-1 and NF-{kappa}B activity and cytokine secretion in murine macrophages via activation of the mitogen-activated protein kinase pathway (48). Interestingly, nonacylated forms of lipopeptide completely lacked stimulatory activity (15, 35), and the synthetic lipo-amino Pam3Cys and the monoacylated synthetic lipopeptide, PamCysSerLys4, did not activate NF-{kappa}B luciferase reporter gene in 293 cells expressing human TLR2 (16). These results suggested that the di- or triacyl groups and peptide moieties might be critical for TLR2-dependent cell activation, although activating efficiency was different among lipopeptides (35, 36).

However, our experiments demonstrated that the unlipidated rM161Ag could induce TLR2-mediated cytokine production by human monocytes and iDCs, if a hydrophobic SP was present at the N terminus. There were no differences in CD spectra between bioactive and inactive rM161Ag. Hence, an N-terminal hydrophobic element, either lipid or SP, and a subsequent hydrophilic portion may represent a molecular pattern of lipoproteins recognized by human TLR2 (49).

Recently, Takeuchi et al. (36) showed that the configuration of the lipid moiety in MALP-2 affected the TLR2-mediated cell responses (release of cytokines, chemokines, and NO); R-stereoisomer of the MALP-2 was >100 times more active than S-MALP in both human and murine cells. Taken together with our results that the lipidated form of M161Ag was >200-fold more active than the SP form in human cells, preferential recognition of M161Ag by TLR2 may be dependent on the N-terminal hydrophobic structure. In addition, the differences in responsiveness of murine and human macrophages to rM161Ag suggested the species-dependent recognition of rM161Ag by TLR2. Similar species-dependent discrimination has been reported on TLR4 in terms of intact LPS vs tetra-acyl LPS (50).

The native M161Ag is a maturation inducer of iDC because of the up-regulation of a maturation marker, CD83 and CD86, and induction of IL-12 p40 production (51). Monocyte-derived iDCs express TLR2, TLR4, and MD-2, but not CD14 (M. Matsumoto and T. Seya, unpublished data), suggesting that LPS and M161Ag stimulate iDCs through TLR4-MD-2 complex and TLR2, respectively. The monomeric form of rM161Ag with SP could not up-regulate CD83 expression in iDCs, but induced IL-12 p40 production. There may be some differences in the TLR2-mediated signaling pathway between cytokine production and CD83/CD86 expression. These studies demonstrated that the microbial constituents act as inducers of DC maturation as well as cytokine production by monocytes/macrophages, at least in humans, and the cell responses may be dependent on the ligand structure.

The complement-activating ability of M161Ag is associated with the N-terminal hydrophobic portion, although the lipid form is more active than the SP form. Complement is a pivotal factor in the innate immune system. C3 fragment deposition onto microbial components allows the components to provide the second ligand for host immune receptors. Complement receptors, CR1, CR2, CR3, and CR4, can be activated by the postformed C3 ligands. Many microbial products, such as high doses of LPS, peptidoglycan, and zymosan, all stimulating TLRs, serve as targets for complement, and C3 fragments are deposited on them via the alternative pathway (52, 53, 54). It is still unknown whether the consensus sequence or motif is required for stable C3 convertase formation on the complement-activating molecules. In M161Ag, the N-terminal fatty acids and following stretch of amino acids are required for complement activation, because sMALP-2 could not activate complement at concentrations capable of stimulating the cells. A homology search of the nucleotide databases revealed that there is an M161Ag-like consensus motif conserved in lipoproteins of several bacteria (Mycoplasma arginini, B. burgdorferi, T. pallidum, and Listeria monocytogenes) (32, 34). It will be of interest to determine in future studies whether the immune modulatory functions observed in M161Ag are conserved in these proteins.

An intriguing implication of these observations is an application of M161Ag to innate immune therapy for cancer. Bacillus Calmette-Guérin cell wall skeleton (BCG-CWS) induces DC maturation, which contributes to the induction of tumor immunity (38, 55, 56). In murine macrophages, both TLR2 and TLR4 participate in BCG-CWS-mediated cell activation (38, 57). BCG-CWS and M161Ag activate the innate immune system in different ways. Identification of the ligand structure and their signaling events through TLR2 and TLR4 in macrophages/DCs may be important for advanced tumor immune therapy.

In summary, M161Ag is a pathogen-associated molecular pattern (PAMP) affecting at least two receptors, TLR2 and complement receptors. In our recent studies, another representative PAMP, BCG-CWS, was shown to use two receptors, TLR and a novel lectin receptor (S. Tsuji, J. Vehori, and T. Seya, unpublished data). An attractive hypothesis is a two-receptor theory, in which PAMP simultaneously stimulates two sorts of receptors, TLR and others. TLR mainly participates in intracellular signaling for cell maturation and survival, while the partner receptors act in phagocytosis. Further studies of PAMP and their receptors are needed to consolidate this hypothesis.


    Acknowledgments
 
We are grateful to Drs. H. Koyama, H. Akedo, and M. Tatsuta (Osaka Medical Center, Osaka, Japan) for support of this work, and to Drs. K. Miyake (Saga Medical School, Saga, Japan), K. Hazeki, M. Nomura (Osaka Medical Center), and Y. Nishizawa (Osaka University, Osaka, Japan) for thoughtful discussions. We also thank Dr. R. Medzhitov (Yale University School of Medicine) for providing the plasmid, and Ms. S. Kikkawa, M. Taniguchi, and K. Shida for technical support. Thanks are also due to Mr. Y. Satomi (Osaka University) for measurement of MALDI-MS.


    Footnotes
 
1 This work was supported in part by Organization for Pharmaceutical Safety and Research, and Grant-in-Aid from the Ministry of Public Welfare of Japan. Back

2 Address correspondence and reprint requests to Dr. Tsukasa Seya, Department of Immunology, Osaka Medical Center for Cancer and Cardiovascular Diseases, Higashinari-ku, Osaka 537-8511, Japan. Back

3 Abbreviations used in this paper: TLR, Toll-like receptor; BCG-CWS, bacillus Calmette-Guérin cell wall skeleton; C3, third component of complement; CD, circular dichroism; DC, dendritic cell; DN, dominant-negative; iDC, immature DC; MALDI-MS, matrix-assisted laser desorption/ionization time of flight mass spectroscopy; MALP, macrophage-activating lipopeptide; NHS, normal human serum; Pam3Cys, tripalmitoyl-S-glyceryl-cysteine; PAMP, pathogen-associated molecular pattern; sMALP, synthetic dipalmitoyl lipopeptide based upon MALP; SP, signal peptide. Back

Received for publication June 23, 2000. Accepted for publication November 30, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fearon, D. T., R. M. Locksley. 1996. The instructive role of innate immunity in the acquired immune response. Science 272:50.[Abstract]
  2. Medzhitov, R., Jr C. A. Janeway. 1997. Innate immunity: impact on the adaptive immune response. Curr. Opin. Immunol. 9:4.[Medline]
  3. Medzhitov, R., P. Preston-Hurburt, Jr C. A. Janeway. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388:394.[Medline]
  4. Rock, F. L., G. Hardiman, J. C. Timans, R. A. Kastelein, J. F. Bazan. 1998. A family of human receptors structurally related to Drosophila Toll. Proc. Natl. Acad. Sci. USA 95:588.[Abstract/Free Full Text]
  5. Chaudhary, P. M., C. Ferguson, V. Nguyen, O. Nguen. H. F. Massa, M. Eby, A. Jasmin, B. J. Trask, L. Hood, P. S. Nelson. 1998. Cloning and characterization of two Toll/interleukin-1 receptor-like genes TIL3 and TIL4: evidence for a multi-gene receptor family in humans. Blood 91:4020.[Abstract/Free Full Text]
  6. Takeuchi, O., T. Kawai, H. Sanjo, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, K. Takeda, S. Akira. 1999. TLR6: a novel member of an expanding Toll-like receptor family. Gene 231:59.[Medline]
  7. Yang, R.-B., M. R. Mark, A. Gray, A. Huang, M. H. Xie, M. Zhang, A. Goddard, W. I. Wood, A. L. Gurney, P. J. Godowski. 1998. Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signaling. Nature 395:284.[Medline]
  8. Kirschning, C. J., H. Wesche, T. M. Ayres, M. Rothe. 1998. Human Toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide. J. Exp. Med. 188:2091.[Abstract/Free Full Text]
  9. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. V. Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, et al 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice; mutation in Tlr4 gene. Science 282:2085.[Abstract/Free Full Text]
  10. Qureshi, S. T., L. Lariviere, G. Leveque, S. Clermont, K. J. Moore, P. Gros, D. Malo. 1999. Endotoxin-tolerant mice have mutation in Toll-like receptor 4 (Tlr4). J. Exp. Med. 189:615.[Abstract/Free Full Text]
  11. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, S. Akira. 1999. TLR4-deficient mice are hyporesponsive to LPS: evidence for TLR4 as the Lps gene product. J. Immunol. 162:3749.[Abstract/Free Full Text]
  12. Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, C. J. Kirschning. 1999. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by Toll-like receptor 2. J. Biol. Chem. 274:17406.[Abstract/Free Full Text]
  13. Takeuchi, O., K. Hoshino, T. Kawai, H. Sanko, H. Takada, T. Ogawa, K. Takeda, S. Akira. 1999. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity 11:443.[Medline]
  14. Shimazu, R., S. Akashi, H. Ogata, Y. Nagai, K. Fukudome, K. Miyake, M. Kimoto. 1999. MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4. J. Exp. Med. 189:1777.[Abstract/Free Full Text]
  15. Brightbill, H. D., D. H. Libraty, S. R. Krutzik, R.-B. Yang, J. T. Belisle, J. R. Bleharski, M. Maitland, M. V. Norgard, S. E. Plevy, S. T. Smale, et al 1999. Host defense mechanisms triggered by microbial lipoproteins through Toll-like receptors. Science 285:732.[Abstract/Free Full Text]
  16. Aliprantis, A. O., R.-B Yang, M. R. Mark, S. Suggett, B. Devaux, J. D. Radolf, G. R. Klimpel, P. Godowski, A. Zychlinsky. 1999. Cell activation and apoptosis by bacterial lipoproteins through Toll-like receptor-2. Science 285:736.[Abstract/Free Full Text]
  17. Hirschfeld, M., C. J. Kirschning, R. Schwandner, H. Wesche, J. H. Weis, R. M. Wooten, J. J. Weis. 1999. Inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by Toll-like receptor 2. J. Immunol. 163:2382.[Abstract/Free Full Text]
  18. Underhill, D. M., A. Ozinsky, A. M. Hajjar, A. Stevens, C. B. Wilson, M. Bassetti, A. Aderem. 1999. The Toll-like receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens. Nature 401:811.[Medline]
  19. Sankaran, K., H. C. Wu. 1994. Lipid modification of bacterial prolipoprotein. J. Biol. Chem. 269:19701.[Abstract/Free Full Text]
  20. O’ Neill, L. A. J., C. A. Dinarello. 2000. The IL-1 receptor/Toll-like receptor superfamily: crucial receptors for inflammation and host defense. Immunol. Today 239:206.
  21. Blanchard, A., L. Montagnier. 1994. AIDS-associated mycoplasmas. Annu. Rev. Microbiol. 48:687.[Medline]
  22. Lo, S.-C., S. Tsai, J. R. Benish, J. W-K. Shin, D. J. Wear, D. M. Wong. 1990. Enhancement of HIV-1 cytocidal effects in CD4+ lymphocytes by the AIDS-associated Mycoplasma. Science 251:1074.
  23. Kikkawa, S., M. Matsumoto, T. Sasaki, M. Nishiguchi, K. Tanaka, K. Toyoshima, T. Seya. 2000. Complement activation on Mycoplasma fermentans induced mycoplasma clearance from infected cells: probing the organism with mAbs against M161Ag. Infect. Immun. 68:1672.[Abstract/Free Full Text]
  24. Hawkins, R. E., L. S. Rickman, S. H. Vermund, M. Carl. 1992. Association of mycoplasma and human immunodeficiency virus infection: detection of amplified Mycoplasma fermentans DNA in blood. J. Infect. Dis. 165:581.[Medline]
  25. Katseni, V. L., C. B. Gilroy, B. K. Ryait, K. Ariyoshi, P. D. Bieniasz, J. N. Weber, D. Taylor-Robinson. 1993. Mycoplasma fermentans in individuals seropositive and seronegative for HIV-1. Lancet 341:271.[Medline]
  26. Feng, S. H., S. C. Lo. 1994. Induced mouse spleen B-cell proliferation and secretion of immunoglobulin by lipid-associated membrane proteins of Mycoplasma fermentans incognitus and Mycoplasma penetrans. Infect. Immun. 62:3916.[Abstract/Free Full Text]
  27. Kostyal, D. A., G. H. Butler, D. H. Beezhold. 1994. A 48-kilodalton Mycoplasma fermentans membrane protein induces cytokine secretion by human monocytes. Infect. Immun. 62:3793.[Abstract/Free Full Text]
  28. Rawadi, G., S. Roman-Roman, M. Castedo, V. Dutilleul, S. Susin, P. Marchetti, M. Geuskens, G. Kroemer. 1996. Effects of Mycoplasma fermentans on the myelomonocytic lineage: different molecular entities with cytokine-inducing and cytocidal potential. J. Immunol. 156:670.[Abstract]
  29. Mühlradt, P. F., M. Kieß, H. Meyer, R. Sußmuth, G. Jung. 1997. Isolation, structure elucidation, and synthesis of a macrophage stimulatory lipopeptide from Mycoplasma fermentans acting at picomolar concentration. J. Exp. Med. 185:1951.[Abstract/Free Full Text]
  30. Matsumoto, M., J. Takeda, N. Inoue, T. Hara, M. Hatanaka, K. Takahashi, S. Nagasawa, H. Akedo, T. Seya. 1997. A novel protein that participates in nonself discrimination of malignant cells by homologous complement. Nat. Med. 3:1266.[Medline]
  31. Matsumoto, M., M. Nishiguchi, S. Kikkawa, H. Nishimura, S. Nagasawa, T. Seya. 1998. Structural and functional properties of complement-activating protein M161Ag, a Mycoplasma fermentans gene product that induces cytokine production by human monocytes. J. Biol. Chem. 273:12407.[Abstract/Free Full Text]
  32. Matsumoto, M., T. Seya. 1999. M161Ag is a potent cytokine inducer with complement activating function. Int. J. Mol. Med. 3:291.[Medline]
  33. Yamano, F., A. Muto, Y. Kawauchi, M. Iwami, S. Iwagami, Y. Azumi, S. Osawa. 1985. UGA is read as tryptophan in Mycoplasma capricolum. Proc. Natl. Acad. Sci. USA 82:2306.[Abstract/Free Full Text]
  34. Calcutt, M., M. F. Kim, A. B. Karpas, P. F. Muhlradt, K. S. Wise. 1999. Differential posttranslational processing confers intraspecies variation of a major surface lipoprotein and a macrophage-activating lipopeptide of Mycoplasma fermentans. Infect. Immun. 67:760.[Abstract/Free Full Text]
  35. Lien, E., T. J. Sellti, A. Yoshimura, T. H. Flo, G. Rawadi, R. W. Finberg, J. D. Carroll, T. Espevik, R. R. Ingalls, J. D. Radolf, D. T. Golenbock. 1999. Toll-like receptor 2 functions as a pattern recognition receptor for diverse bacterial products. J. Biol. Chem. 274:33419.[Abstract/Free Full Text]
  36. Takeuchi, O., A. Kaufmann, K. Grote, T. Kawai, K. Hoshino, M. Morr, P. F. Muhlradt, S. Akira. 2000. Preferentially the R-stereoisomer of the mycoplasmal lipopeptide macrophage-activating lipopeptide-2 activates immune cells through Toll-like receptor 2- and MyD88-dependent signaling pathway. J. Immunol. 164:554.[Abstract/Free Full Text]
  37. Begum, N. A., S. Tsuji, M. Nomura, K. Shida, I. Azuma, A. Hayashi, M. Matsumoto, T. Seya, K. Toyoshima. 1999. Human MD-1 homologue is a BCG-regulated gene product in monocytes: its identification by differential display. Biochem. Biophys. Res. Commun. 256:325.[Medline]
  38. Tsuji, S., M. Matsumoto, O. Takeuchi, S. Akira, I. Azuma, A. Hayashi, K. Toyoshima, T. Seya. 2000. The maturation of human dendritic cells by cell-wall skeleton of Mycobacterium bovis bacillus Calmette-Guérin (BCG-CWS): involvement of Toll-like receptors. Infect. Immun. 68:6883.[Abstract/Free Full Text]
  39. Iida, K., K. Mitomo, T. Fujita, N. Tamura. 1987. Characterization of three monoclonal antibodies against C3 with selective specificities. Immunology 62:413.[Medline]
  40. Betancourt, L., T. Takao, L. Hernandez, G. Pardon, Y. Shimonishi. 1999. Structural characterization of Acetobacter diazotropicus levansucrase by matrix-assisted laser desorption/ionization mass spectrometry: identification of an N terminal blocking group and a free-thiol cysteine residue. J. Mass Spectrom. 34:169.[Medline]
  41. Tjalsma, H., V. P. Kontinen, Z. Pragai, H. Wu., R. Meima, G. Venema, S. Bron, M. Sarvas, J. M. van Dijl. 1999. The role of lipoprotein processing by signal peptidase II in the Gram-positive eubacterium Bacillus subtilis. J. Biol. Chem. 274:1698.[Abstract/Free Full Text]
  42. Matsumoto, M., F. Yamashita, K. Iida, M. Tomita, T. Seya. 1995. Purification and characterization of a human membrane protein that activates complement pathway and allows the deposition of homologous complement C3. J. Exp. Med. 181:115.[Abstract/Free Full Text]
  43. Hoshino, M., Y. Kawata, Y. Goto. 1996. Interaction of GroEL with conformational states of horse cytochrome c. J. Mol. Biol. 262:575.[Medline]
  44. Faurem, E., O. Equils, P. A. Sieling, L. Thomas, F. X. Zhang, C. J. Kirschning, N. Polentarutti, M. Muzio, M. Arditi. 2000. Bacterial lipopolysaccharide activates NF-{kappa}B through Toll-like receptor 4 (TLR4) in cultured human dermal endothelial cells. J. Biol. Chem. 275:11058.[Abstract/Free Full Text]
  45. Rescigno, M., F. Granucci, S. Citterio, M. Foti, P. Ricciardi-Castagnoli. 1999. Coordinated events during bacteria-induced DC maturation. Immunol. Today 20:200.[Medline]
  46. De Smedt, T., B. Pajak, E. Muraille, L. Lespagnard, E. Heinen, P. De Baetselier, J. Urbain, O. Leo, M. Moser. 1996. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo. J. Exp. Med. 184:1413.[Abstract/Free Full Text]
  47. Cella, M., A. Engering, V. Pinet, J. Pieters, A. Lanzavecchia. 1997. Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 388:782.[Medline]
  48. Garcia, J., B. Lemercier, S. Roman-Roman, G. Rawadi. 1998. A Mycoplasma fermentans-derived synthetic lipopeptide induces AP-1 and NF-{kappa}B activity and cytokine secretion in macrophages via the activation of mitogen-activated protein kinase pathways. J. Biol. Chem. 273:34391.[Abstract/Free Full Text]
  49. Medzhitov, R., Jr C. A. Janeway. 1997. Innate immunity: the virtues of a nonclonal system of recognition. Cell 91:295.[Medline]
  50. Poltorak, A., P. Ricciardi-Castagnoli, S. Citterio, B. Beutler. 2000. Physical contact between lipopolysaccharide and Toll-like receptor 4 revealed by genetic complementation. Proc. Natl. Acad. Sci. USA 97:2163.[Abstract/Free Full Text]
  51. Zhou, L., T. F. Tedder. 1996. CD14+ blood monocytes can differentiate into functionally mature CD83+ dendritic cells. Proc. Natl. Acad. Sci. USA 93:2588.[Abstract/Free Full Text]
  52. Mey, A., D. Ponard, M. Colomb, G. Normier, H. Binz, J. P. Revillard. 1994. Acylation of the lipid A region of a Klebsiella pneumoniae LPS controls the alternative pathway activation of human complement. Mol. Immunol. 31:1239.[Medline]
  53. Inai, S., K. Nagaki, S. Ebisu, K. Kato, S. Kotani, A. Misaki. 1976. Activation of the alternative complement pathway by water-insoluble glucans of streptococcus mutants: the relation between their chemical structures and activating potencies. J. Immunol. 117:1256.[Abstract/Free Full Text]
  54. Fujita, T., M. Takiuchi, M. Matsumoto, K. Nagaki, S. Inai. 1977. C3- and C5-cleaving properdin enzymes formed on zymosan incubated with human serum: the decay and the regeneration of the enzymes. Int. Arch. Allergy Appl. Immunol. 53:303.[Medline]
  55. Hayashi, A., O. Doi, I. Azuma, K. Toyoshima. 1998. Immuno-friendly use of BCG-cell wall skeleton remarkably improves the survival rate of various cancer patients. Proc. Jpn. Acad. 74:50.
  56. Seya, T., M. Matsumoto, S. Tsuji, N. A. Begum, M. Nomura, I. Azuma, A. Hayashi, and K. Toyoshima. 2000. Two receptor theory in innate immune activation: studies on the receptors for bacillus Calmette-Guérin-cell wall skeleton (BCG-CWS). Arch. Immunol. Ther. Exp. In press.
  57. Means, T. K., S. Wang, E. Lien, A. Yoshimura, D. T. Golenbock, M. J. Fenton. 1999. Human Toll-like receptors mediate cellular activation by Mycobacterium tuberculosis. J. Immunol. 163:3920.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. Liang, K. B. Hosur, S. Lu, H. F. Nawar, B. R. Weber, R. I. Tapping, T. D. Connell, and G. Hajishengallis
Mapping of a Microbial Protein Domain Involved in Binding and Activation of the TLR2/TLR1 Heterodimer
J. Immunol., March 1, 2009; 182(5): 2978 - 2985.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Shingai, M. Azuma, T. Ebihara, M. Sasai, K. Funami, M. Ayata, H. Ogura, H. Tsutsumi, M. Matsumoto, and T. Seya
Soluble G protein of respiratory syncytial virus inhibits Toll-like receptor 3/4-mediated IFN-beta induction
Int. Immunol., September 1, 2008; 20(9): 1169 - 1180.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Tsukamoto, K. Hazeki, M. Hoshi, K. Nigorikawa, N. Inoue, T. Sasaki, and O. Hazeki
Critical Roles of the p110{beta} Subtype of Phosphoinositide 3-Kinase in Lipopolysaccharide-Induced Akt Activation and Negative Regulation of Nitrite Production in RAW 264.7 Cells
J. Immunol., February 15, 2008; 180(4): 2054 - 2061.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. Shimizu, Y. Kida, and K. Kuwano
Mycoplasma pneumoniae-Derived Lipopeptides Induce Acute Inflammatory Responses in the Lungs of Mice
Infect. Immun., January 1, 2008; 76(1): 270 - 277.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Shingai, T. Ebihara, N. A. Begum, A. Kato, T. Honma, K. Matsumoto, H. Saito, H. Ogura, M. Matsumoto, and T. Seya
Differential Type I IFN-Inducing Abilities of Wild-Type versus Vaccine Strains of Measles Virus
J. Immunol., November 1, 2007; 179(9): 6123 - 6133.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
A. C. W. Kauf, R. F. Rosenbusch, M. J. Paape, and D. D. Bannerman
Innate Immune Response to Intramammary Mycoplasma bovis Infection
J Dairy Sci, July 1, 2007; 90(7): 3336 - 3348.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Liang, M. Wang, K. Triantafilou, M. Triantafilou, H. F. Nawar, M. W. Russell, T. D. Connell, and G. Hajishengallis
The A Subunit of Type IIb Enterotoxin (LT-IIb) Suppresses the Proinflammatory Potential of the B Subunit and Its Ability to Recruit and Interact with TLR2
J. Immunol., April 15, 2007; 178(8): 4811 - 4819.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
Y. Asai, Y. Makimura, and T. Ogawa
Toll-like receptor 2-mediated dendritic cell activation by a Porphyromonas gingivalis synthetic lipopeptide
J. Med. Microbiol., April 1, 2007; 56(4): 459 - 465.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Liang, M. Wang, R. I. Tapping, V. Stepensky, H. F. Nawar, M. Triantafilou, K. Triantafilou, T. D. Connell, and G. Hajishengallis
Ganglioside GD1a Is an Essential Coreceptor for Toll-like Receptor 2 Signaling in Response to the B subunit of Type IIb Enterotoxin
J. Biol. Chem., March 9, 2007; 282(10): 7532 - 7542.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Ishii, A. Matsuo, H. Sawa, T. Tsujita, K. Shida, M. Matsumoto, and T. Seya
Lamprey TLRs with Properties Distinct from Those of the Variable Lymphocyte Receptors
J. Immunol., January 1, 2007; 178(1): 397 - 406.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. P. Fabisiak, F. Gao, R. G. Thomson, R. M. Strieter, S. C. Watkins, and J. H. Dauber
Mycoplasma fermentans and TNF-beta interact to amplify immune-modulating cytokines in human lung fibroblasts
Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L781 - L793.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
K. Hazeki, S. Kinoshita, T. Matsumura, K. Nigorikawa, H. Kubo, and O. Hazeki
Opposite Effects of Wortmannin and 2-(4-Morpholinyl)-8-phenyl-1(4H)-benzopyran-4-one Hydrochloride on Toll-Like Receptor-Mediated Nitric Oxide Production: Negative Regulation of Nuclear Factor-{kappa}B by Phosphoinositide 3-Kinase
Mol. Pharmacol., May 1, 2006; 69(5): 1717 - 1724.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Hashimoto, K. Tawaratsumida, H. Kariya, K. Aoyama, T. Tamura, and Y. Suda
Lipoprotein is a predominant Toll-like receptor 2 ligand in Staphylococcus aureus cell wall components
Int. Immunol., February 1, 2006; 18(2): 355 - 362.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Shimizu, Y. Kida, and K. Kuwano
A Dipalmitoylated Lipoprotein from Mycoplasma pneumoniae Activates NF-{kappa}B through TLR1, TLR2, and TLR6
J. Immunol., October 1, 2005; 175(7): 4641 - 4646.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Shingai, N. Inoue, T. Okuno, M. Okabe, T. Akazawa, Y. Miyamoto, M. Ayata, K. Honda, M. Kurita-Taniguchi, M. Matsumoto, et al.
Wild-Type Measles Virus Infection in Human CD46/CD150-Transgenic Mice: CD11c-Positive Dendritic Cells Establish Systemic Viral Infection
J. Immunol., September 1, 2005; 175(5): 3252 - 3261.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
H. Weigt, C. Nassenstein, T. Tschernig, P. F. Muhlradt, N. Krug, and A. Braun
Efficacy of Macrophage-activating Lipopeptide-2 Combined with Interferon-{gamma} in a Murine Asthma Model
Am. J. Respir. Crit. Care Med., September 1, 2005; 172(5): 566 - 572.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Uehori, K. Fukase, T. Akazawa, S. Uematsu, S. Akira, K. Funami, M. Shingai, M. Matsumoto, I. Azuma, K. Toyoshima, et al.
Dendritic Cell Maturation Induced by Muramyl Dipeptide (MDP) Derivatives: Monoacylated MDP Confers TLR2/TLR4 Activation
J. Immunol., June 1, 2005; 174(11): 7096 - 7103.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Nakao, K. Funami, S. Kikkawa, M. Taniguchi, M. Nishiguchi, Y. Fukumori, T. Seya, and M. Matsumoto
Surface-Expressed TLR6 Participates in the Recognition of Diacylated Lipopeptide and Peptidoglycan in Human Cells
J. Immunol., February 1, 2005; 174(3): 1566 - 1573.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
F. Rharbaoui, A. Westendorf, C. Link, S. Felk, J. Buer, M. Gunzer, and C. A. Guzman
The Mycoplasma-Derived Macrophage-Activating 2-Kilodalton Lipopeptide Triggers Global Immune Activation on Nasal Mucosa-Associated Lymphoid Tissues
Infect. Immun., December 1, 2004; 72(12): 6978 - 6986.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Tsujita, H. Tsukada, M. Nakao, H. Oshiumi, M. Matsumoto, and T. Seya
Sensing Bacterial Flagellin by Membrane and Soluble Orthologs of Toll-like Receptor 5 in Rainbow Trout (Onchorhynchus mikiss)
J. Biol. Chem., November 19, 2004; 279(47): 48588 - 48597.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
P. A. Pioli, E. Amiel, T. M. Schaefer, J. E. Connolly, C. R. Wira, and P. M. Guyre
Differential Expression of Toll-Like Receptors 2 and 4 in Tissues of the Human Female Reproductive Tract
Infect. Immun., October 1, 2004; 72(10): 5799 - 5806.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
F. Gao, A. Barchowsky, A. A. Nemec, and J. P. Fabisiak
Microbial Stimulation by Mycoplasma fermentans Synergistically Amplifies IL-6 Release by Human Lung Fibroblasts in Response to Residual Oil Fly Ash (ROFA) and Nickel
Toxicol. Sci., October 1, 2004; 81(2): 467 - 479.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Epelman, D. Stack, C. Bell, E. Wong, G. G. Neely, S. Krutzik, K. Miyake, P. Kubes, L. D. Zbytnuik, L. L. Ma, et al.
Different Domains of Pseudomonas aeruginosa Exoenzyme S Activate Distinct TLRs
J. Immunol., August 1, 2004; 173(3): 2031 - 2040.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N. A. Begum, K. Ishii, M. Kurita-Taniguchi, M. Tanabe, M. Kobayashi, Y. Moriwaki, M. Matsumoto, Y. Fukumori, I. Azuma, K. Toyoshima, et al.
Mycobacterium bovis BCG Cell Wall-Specific Differentially Expressed Genes Identified by Differential Display and cDNA Subtraction in Human Macrophages
Infect. Immun., February 1, 2004; 72(2): 937 - 948.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Akazawa, H. Masuda, Y. Saeki, M. Matsumoto, K. Takeda, K. Tsujimura, K. Kuzushima, T. Takahashi, I. Azuma, S. Akira, et al.
Adjuvant-Mediated Tumor Regression and Tumor-Specific Cytotoxic Response Are Impaired in MyD88-Deficient Mice
Cancer Res., January 15, 2004; 64(2): 757 - 764.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Oshiumi, M. Sasai, K. Shida, T. Fujita, M. Matsumoto, and T. Seya
TIR-containing Adapter Molecule (TICAM)-2, a Bridging Adapter Recruiting to Toll-like Receptor 4 TICAM-1 That Induces Interferon-{beta}
J. Biol. Chem., December 12, 2003; 278(50): 49751 - 49762.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Saito, T. Yajima, H. Nishimura, K. Aiba, R. Ishimitsu, T. Matsuguchi, T. Fushimi, Y. Ohshima, Y. Tsukamoto, and Y. Yoshikai
Soluble Branched {beta}-(1,4)Glucans from Acetobacter Species Show Strong Activities to Induce Interleukin-12 in Vitro and Inhibit T-helper 2 Cellular Response with Immunoglobulin E Production in Vivo
J. Biol. Chem., October 3, 2003; 278(40): 38571 - 38578.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Fujita, T. Into, M. Yasuda, T. Okusawa, S. Hamahira, Y. Kuroki, A. Eto, T. Nisizawa, M. Morita, and K.-i. Shibata
Involvement of Leucine Residues at Positions 107, 112, and 115 in a Leucine-Rich Repeat Motif of Human Toll-Like Receptor 2 in the Recognition of Diacylated Lipoproteins and Lipopeptides and Staphylococcus aureus Peptidoglycans
J. Immunol., October 1, 2003; 171(7): 3675 - 3683.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Matsumoto, K. Funami, M. Tanabe, H. Oshiumi, M. Shingai, Y. Seto, A. Yamamoto, and T. Seya
Subcellular Localization of Toll-Like Receptor 3 in Human Dendritic Cells
J. Immunol., September 15, 2003; 171(6): 3154 - 3162.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Uehori, M. Matsumoto, S. Tsuji, T. Akazawa, O. Takeuchi, S. Akira, T. Kawata, I. Azuma, K. Toyoshima, and T. Seya
Simultaneous Blocking of Human Toll-Like Receptors 2 and 4 Suppresses Myeloid Dendritic Cell Activation Induced by Mycobacterium bovis Bacillus Calmette-Guerin Peptidoglycan
Infect. Immun., August 1, 2003; 71(8): 4238 - 4249.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Muroi, T. Ohnishi, S. Azumi-Mayuzumi, and K.-i. Tanamoto
Lipopolysaccharide-Mimetic Activities of a Toll-Like Receptor 2-Stimulatory Substance(s) in Enterobacterial Lipopolysaccharide Preparations
Infect. Immun., June 1, 2003; 71(6): 3221 - 3226.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. A. Kurt-Jones, L. Mandell, C. Whitney, A. Padgett, K. Gosselin, P. E. Newburger, and R. W. Finberg
Role of Toll-like receptor 2 (TLR2) in neutrophil activation: GM-CSF enhances TLR2 expression and TLR2-mediated interleukin 8 responses in neutrophils
Blood, August 13, 2002; 100(5): 1860 - 1868.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Luhrmann, U. Deiters, J. Skokowa, M. Hanke, J. E. Gessner, P. F. Muhlradt, R. Pabst, and T. Tschernig
In Vivo Effects of a Synthetic 2-Kilodalton Macrophage-Activating Lipopeptide of Mycoplasma fermentans after Pulmonary Application
Infect. Immun., July 1, 2002; 70(7): 3785 - 3792.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-K. Lee, J. Lee, and P. S. Tobias
Two Lipoproteins Extracted from Escherichia coli K-12 LCD25 Lipopolysaccharide Are the Major Components Responsible for Toll-Like Receptor 2-Mediated Signaling
J. Immunol., April 15, 2002; 168(8): 4012 - 4017.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. Vasselon and P. A. Detmers
Toll Receptors: a Central Element in Innate Immune Responses
Infect. Immun., March 1, 2002; 70(3): 1033 - 1041.
[Full Text] [PDF]


Home page
Infect. Immun.Home page
K. L. Davis and K. S. Wise
Site-Specific Proteolysis of the MALP-404 Lipoprotein Determines the Release of a Soluble Selective Lipoprotein-Associated Motif-Containing Fragment and Alteration of the Surface Phenotype of Mycoplasma fermentans
Infect. Immun., March 1, 2002; 70(3): 1129 - 1135.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Fukui, N. Inoue, M. Matsumoto, M. Nomura, K. Yamada, Y. Matsuda, K. Toyoshima, and T. Seya
Molecular Cloning and Functional Characterization of Chicken Toll-like Receptors. A SINGLE CHICKEN TOLL COVERS MULTIPLE MOLECULAR PATTERNS
J. Biol. Chem., December 7, 2001; 276(50): 47143 - 47149.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
I. C. Almeida and R. T. Gazzinelli
Proinflammatory activity of glycosylphosphatidylinositol anchors derived from Trypanosoma cruzi: structural and functional analyses
J. Leukoc. Biol., October 1, 2001; 70(4): 467 - 477.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
M. Narita, H. Tanaka, S. Yamada, S. Abe, T. Ariga, and Y. Sakiyama
Significant Role of Interleukin-8 in Pathogenesis of Pulmonary Disease Due to Mycoplasma pneumoniae Infection
Clin. Vaccine Immunol., September 1, 2001; 8(5): 1028 - 1030.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Mitsuzawa, I. Wada, H. Sano, D. Iwaki, S. Murakami, T. Himi, N. Matsushima, and Y. Kuroki
Extracellular Toll-Like Receptor 2 Region Containing Ser40-Ile64 but Not Cys30-Ser39 Is Critical for the Recognition of Staphylococcus aureus Peptidoglycan
J. Biol. Chem., October 26, 2001; 276(44): 41350 - 41356.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishiguchi, M.
Right arrow Articles by Seya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishiguchi, M.
Right arrow Articles by Seya, T.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS