|
|
||||||||
Gene Expression Through an NF-
B Site

*
Metabolism Branch, Division of Clinical Sciences, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; and
Graduate Genetics Program, Institute of Biomedical Sciences, George Washington University, Washington, DC 20052
| Abstract |
|---|
|
|
|---|
, the IL-15-specific binding receptor, mRNA and protein levels
were also elevated in HTLV-I-infected cells. We showed that transient
HTLV-I Tax expression lead to increased IL-15R
mRNA levels. In
addition, by using a reporter construct that bears the human IL-15R
promoter, we demonstrated that Tax expression increased promoter
activity by at least 4-fold. Furthermore, using promoter deletion
constructs and gel shift analysis, we defined a functional
NF-
B-binding motif in the human IL-15R
promoter, suggesting that
Tax activation of IL-15R
is due, in part, to the induction of
NF-
B. These data indicate that IL-15R
is transcriptionally
regulated by the HTLV-I Tax protein through the action of NF-
B.
These findings suggest a role for IL-15R
in aberrant T cell
proliferation observed in HTLV-I-associated
diseases. | Introduction |
|---|
|
|
|---|
and the common
receptor subunits (1, 2, 3, 4, 5, 6, 7, 8).
However, each cytokine has its own private receptor, namely, IL-2R
(9) and IL-15R
(10), respectively. The
- and common
-chains contribute to signal transduction cascades
initiated by the binding of IL-2 or IL-15. Despite their receptor sharing and similar biological functions, there are functional differences between IL-2 and IL-15. Although IL-2 and IL-15 are T cell growth factors, they have profoundly different effects on activation-induced cell death. IL-2 plays a role in peripheral tolerance by causing self-reactive T cell suicide (11, 12, 13). IL-2 is also important in activation-induced cell death (14, 15, 16) and the inhibition of CD8+ memory T cell maintenance (17). In contrast, IL-15 has been shown to have an antiapoptotic effect (18) and is critical for the survival of CD8+ memory cells (17, 19). IL-15, unlike IL-2, also stimulates mast cell proliferation and may enhance the actions of IL-3 and stem cell factor in the differentiation of mast cells (5, 20, 21).
Functional differences between IL-2 and IL-15 can be explained by their
expression patterns. IL-2 mRNA is largely restricted to lymphoid
tissues, yet IL-15 has a wide mRNA expression in many cells and
tissues. The broad effects of IL-15 can be explained, in part, by its
wide mRNA expression, but also, in part, by the expression of its
private receptor IL-15R
. IL-15R
is a 58- to 60-kDa type I
transmembrane protein that does not belong to the cytokine receptor
family (22). IL-15R
mRNA is expressed in various
tissues and cells including T cells, B cells, macrophages, thymic and
bone marrow cells, liver, heart, spleen, lung, skeletal muscle, and
activated endothelial cells (10, 22). Therefore, the
widespread distribution of IL-15 R
contributes to the pleiotropy of
IL-15 action.
Functions of IL-15R
have been demonstrated in IL-15R
null
(IL-15R
-/-) mice (23). These
knockout mice exhibit marked lymphopenia due to decreased homing of
lymphocytes to peripheral lymph nodes. They are also deficient in NK
cells, NK-T cells, CD8+ lymphocytes, and
TCR
intraepithelial lymphocytes. These findings suggest that both
IL-15 and its binding receptor are necessary for the development of NK
and certain subsets of T cells.
IL-15 is associated with a number of abnormalities including rheumatoid arthritis and inflammatory bowel disease (5). IL-15 is also thought to play a role in the pathological conditions caused by human lymphotropic virus type I (HTLV-I)2 infection including adult T cell leukemia (ATL) and HTLV-I- associated myelopathy/tropical spastic paraparesis (HAM/TSP). ATL is a CD4+ T cell leukemia that is characterized by the presence of lobulated nuclei (24, 25, 26). Patients with ATL have increased abnormal lymphocyte numbers and suffer from opportunistic infections as a result of compromised immune function. HAM/TSP is characterized by a slowly progressive paraparesis that is associated with spasticity (27, 28, 29).
Increased IL-15 levels in the T cells of both ATL and HAM/TSP patients
is due to the HTLV-I-encoded Tax protein (30, 31). Tax is
expressed from the pX sequence within the HTLV-I proviral genome
(32) and has been shown to induce a number of genes such
as those of IL-2 and IL-2R
(33, 34, 35). Activation of
cellular genes by HTLV-I Tax is mediated by a number of
cis-acting DNA elements including cAMP-responsive element
(32), serum-responsive elements, and NF-
B (36, 37). Azimi et al. (30) demonstrated that IL-15 mRNA
is induced by Tax through the action of NF-
B. NF-
B is a family of
proteins that dimerize to induce transcription of responsive genes.
Members of the NF-
B/Rel family include p50, p52, p65 (RelA), c-Rel,
and RelB (38, 39). The p50/p65 heterodimer is the
predominant complex. This complex is sequestered in the cytoplasm by
I
B proteins. Upon stimulation with mitogens, cytokines, or the
HTLV-I Tax protein, I
B-
is rapidly degraded and the NF-
B
subunits are translocated to the cell nucleus. Once inside the nucleus,
they function as transcription factors and cause the trans
activation of cellular genes (37, 40).
Although HTLV-I infection has been closely associated with both ATL and
HAM/TSP diseases, the molecular mechanisms of disease progression have
not been well defined. In the early phases of ATL and in HAM/TSP, there
is an abnormal proliferation of T cells. In ex vivo cultures, T cells
of HAM/TSP patients undergo spontaneous proliferation in the absence of
exogenous cytokine or growth factors (41, 42). The
spontaneous proliferation of these T cells has been attributed to the
Tax-induced overexpression of IL-2 and IL-2R
which results in the
establishment of autocrine and paracrine loops (35, 43, 44). However, recent data suggest that IL-15 can also contribute
to the spontaneous proliferation of these T cells (31). We
undertook this study to examine the status of IL-15R
in
HTLV-I-infected T cells.
In this study, we demonstrated the impact of HTLV-I infection on
IL-15R
trans activation and expression. We showed that
HTLV-I-infected T cells expressed higher levels of IL-15R
mRNA when
compared with uninfected T cells. In addition, we demonstrated that the
IL-15R
promoter was activated by Tax expression in Jurkat cells. We
also showed that Tax transcriptionally regulated IL-15R
expression,
in part, through the action of NF-
B. Furthermore, we demonstrated
the expression of IL-15R
on the surface of HTLV-I-infected cells.
These findings demonstrated the presence of IL-15R
in
HTLV-I-infected T cells and suggested a role for this receptor in the
abnormal proliferation of T cells in HTLV-I-associated diseases.
| Materials and Methods |
|---|
|
|
|---|
Cells were cultured in RPMI 1640 medium (Life Technologies, Gaithersburg, MD) containing 10% FCS, 2 mM L-glutamine, 0.2 M HEPES, and 100 U/ml penicillin/streptomycin antibiotic. Cultures were incubated at 37°C in 5%CO2/95%air.
Isolation of peripheral T cells
Peripheral blood mononuclear cells were purified from patient blood samples using Ficoll gradient centrifugation. Approximately 108 PBMC were used to isolate T cells. Abs conjugated to magnetic beads were used to negatively select a purified T cell population using a MACS T cell isolation protocol (Miltenyl Biotech, Auburn, CA). The resulting T cell populations were >95% pure as determined by flow cytometry analysis.
IL-15R
mRNA expression by RNase protection assay (RPA)
RPA was performed on HTLV-1-infected and -uninfected cell lines,
unstimulated normal donor and ATL patient T cells, and Jurkat cells
transfected with a Tax expression plasmid. For RPA, 10 µg of the
total RNA was used in each assay (PharMingen, San Diego, CA) along with
probes for human IL-15R
, IL-2R
, and GAPDH (PharMingen). To
calculate the fold induction of IL-15R
in ATL patient T cells, we
used a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). A box was
placed around each GAPDH and IL-15R
band and the PhosphorImager
recorded a density reading used in the following calculations. A box
containing no band was used as blank and the density from this box was
subtracted from all other samples. An average of the densities of GAPDH
bands of the normal donor samples was calculated. This average density
was then divided by individual GAPDH densities of ATL patient T cells.
This calculation yielded the GAPDH ratio for each patient sample.
Density readings from the ATL patient IL-15R
levels were multiplied
by the GAPDH ratio for each sample to yield a normalized IL-15R
level. Normalized IL-15R
levels were then divided by the average
density of the normal donor IL-15R
levels to calculate the fold
induction of IL-15R
expression. The IL-15R
level in the
Tax-transfected Jurkat cells was calculated in a similar manner. A
GAPDH ratio was calculated for the Tax-transfected cells by dividing
the density of the mock-transfected GAPDH by the GAPDH level of the
Tax-transfected sample. This ratio was then multiplied by the IL-15R
density of the Tax-transfected sample to yield a normalized IL-15R
level. This normalized IL-15R
level was divided by the
mock-transfected IL-15R
level to yield the fold induction of
IL-15R
expression.
RT-PCR
cDNA was obtained from RNA isolated from mock-transfected or
Tax-transfected Jurkat cells using the cDNA cycle kit (Invitrogen,
Carlsbad, CA). PCR for Tax was performed using the following primers:
5'-ATCCCGTGGAGACTCCTCAA-3' (sense) and 5'-CGTGCCATCGGTAAATGTCC-3'
(antisense). PCR conditions were as follows: 95°C for 5 min, 95°C
for 1 min
53°C for 1 min
72°C for 2 min (35 cycles), and
72°C for 5 min.
Cloning of the IL-15R
promoter
The Genome Walker (Clontech, Palo Alto, CA) library was used to
clone the 5' regulatory region of human IL-15R
. Two antisense
primers, 5'-GCGAGCGCTGCCCAGGC-3' and 5'-CCCAGGCCGGGGGGAG-3', were used
in a nested PCR protocol to amplify the region of DNA located 5' to
IL-15R
exon 1 (see Fig. 3
). These sequence data have been submitted
to the GenBank database under accession number AF283296. The resulting
1513-bp fragment was subsequently TA cloned into the pCR2.1 plasmid
(Invitrogen) and then into the pGL3 basic luciferase vector (Promega,
Madison, WI) at the KpnI/XhoI restriction enzyme
sites (hIL-15R
pro/pGL3). Reporter activity was determined in Jurkat
cells. In transfection studies using this full-length promoter, 5 µg
of the reporter constructs was transfected into 4 x
106 cells by electroporation at 280 V and 975
µF. Cells were plated in six-well dishes and maintained at 37°C for
24 h. Luciferase activity was determined using a luciferase
reporter assay (Promega). Data were normalized for transfection
efficiency using a
-galactosidase reporter assay (Promega). Data are
represented as the fold induction over the pGL3 basic reporter
construct. Assays were performed in triplicate and error bars represent
the SD of fold induction of samples.
|
transcription initiation site by 5' rapid
amplification of cDNA ends (RACE)
To interpret the IL-15R
promoter sequence, it was essential
to determine the precise transcription initiation site for the
IL-15R
gene. The rapid RACE (5' RACE; Life Technologies) assay was
used to detect the transcription initiation site in the IL-15R
5'
upstream region using mRNA isolated from T Ag Jurkat cells
(45). Gene-specific antisense primers used in this
analysis were: 5'-CCCAGGCCGGGGGGAG-3' (GSP 1) and 5'-GGTGGCGAGCGCTGC-3'
(GSP 2). All procedures were conducted according to the manufacturers
directions.
Construction and evaluation of human IL-15R
promoter deletions
Serial deletions of human IL-15R
promoter were prepared using
the Exo Mung Bean deletion kit (Stratagene, La Jolla, CA). The
luciferase construct containing the 1513-bp promoter fragment was
digested with KpnI and MluI to produce 3' and 5'
overhangs. Linearized plasmids were treated with 20 U of exonuclease
III at 23°C and aliquots were removed at various time points.
Digested plasmids were then treated with 15 U/µl mung bean nuclease
and incubated at 30°C for 30 min. Plasmids were religated and used to
transform One Shot competent cells (Invitrogen). Deletion constructs
were sequenced and evaluated for luciferase. Full-length or random
deletion constructs (5 µg) were cotransfected into Jurkat cells in
the presence or absence of a Tax expression plasmid (Tax/pMT2T at 5
µg) (46) to analyze whether the promoter was activated
by Tax and to delineate the regions of the promoter that were
responsive to it. All transfections and luciferase assays were
performed as described above.
Analysis of the Tax-responsive element within the IL-15R
promoter
The first 196 bp (bases encompassing -1061 to -865) of the
IL-15R
promoter were PCR amplified using the following primers:
5'-GCGACGCGTGTGGGATTTCCCCAGTTG-3' (sense) and
5'-GCGGAGCTCTGGGCAACACAGCCAG-3'(antisense). The resulting fragment
was TA cloned into pCR2.1 (Invitrogen) and subsequently cloned into the
pGL3 promoter vector (Promega) at the XhoI and
KpnI sites (Del.1/pGL3pro). In Fig. 4
C, 1, 2, and
5 µg of the Tax expression plasmid were used to perform a
dose-response curve using the Del.1/pGL3pro plasmid. Cotransfections
were also performed using the Del.1/pGL3pro (0.5 µg), Tax/pMT2T (5
µg), and SD I
B
/pCDNA3 (5 µg) expression plasmids (Fig. 4
D). All data are represented as the fold induction over the
pGL3 promoter construct alone. Assays were performed in triplicate and
error bars represent the SD of fold induction of samples.
|
B motif (-989 to -979) in the Del.1/pGL3 pro and the
hIL-15R
pro/pGL3 constructs were mutated using Quick Change
site-directed mutagenesis (Stratagene) with the following primers:
5'-AATTGAATAATGT(G
T)(G
A)GATTTC(C
A)(C
T)CAGTTGGAGTAAG-3' (sense) and 5'-CTTACTCCAACTG(C
A)(C
T)GAAATC(G
T) (G
A)ACATTATTCAATT-3' (antisense) to
generate Del.1 MT NF-
B/pGL3pro and hIL-15R
pro MT NF-
B/pGL3,
respectively. Cotransfection studies were performed in Jurkat cells
using 0.5 µg of the Del.1 MT NF-
B/pGL3pro reporter construct (Fig. 4
pro MT NF-
B/pGL3 reporter
construct (Fig. 4Expression plasmids
The Tax/pMT2T, p50/pMT2T, and p65/pMT2T plasmids were previously
described (37, 47, 48) and were a kind gift from U.
Siebenlist (National Institute of Allergy and Infectious Diseases
(NIAID), National Institutes of Health (NIH), Bethesda, MD). The SD
I
B
/pCDNA3 plasmid was kindly provided by C. Duckett (National
Cancer Institute, NIH, Bethesda, MD).
Analysis of transcription factor consensus sequences using EMSA
We performed electrophoretic mobility shift assay (EMSA) using
nuclear extracts from unactivated Jurkat cells, HuT102 cells, and COS
cells transfected with NF-
B p50/pMT2T and p65/pMT2T expression
plasmids. The probes used in this assay were double-stranded
32P-labeled oligonucleotides encompassing the
IL-15R
NF-
B (IL-15R
NF-
B) motif
ATGTGGGATTTCCCCAG or the Ig
B motif as a consensus
NF-
B motif (cNF-
B) AGTTGAGGGGACTTTCCCAGGC, where the
underlined sequences are the NF-
B binding sites. Abs to p50 and p65
subunits were added to the cell extracts for 30 min on ice for gel
shift analysis. Abs were a generous gift from U. Seinbelist (NIAID,
NIH). Extracts were then mixed with radiolabeled probes, poly(dI-dC),
and BSA at room temperature for 30 min. Samples were loaded onto an
acrylamide (30%)/bis-acrylamide (0.8%) gel and subjected to
electrophoresis at 120 V for the initial 10 min, followed by 150 V for
the remainder of the run. Gels were dried and exposed to Kodak MS film
(Kodak, Rochester, NY).
Generation of IL-15R
polyclonal Abs
The extracellular domain of IL-15R
was PCR amplified using
the following primers: 5'-GAGCTGCCGCCATGGCC-3' (sense) and
5'-CCGTCGTTACTGTGGAGG-3' (antisense). Amplified product was TA cloned
into pCR 2.1 (Invitrogen) and transformed into One Shot cells
(Invitrogen). Colonies containing the insert were subcloned into the
GST vector pGEX-2T (Pharmacia, New Brunswick, NJ) at the
BamHI/EcoRI sites or the His vector pET 30A
(Novagen, Madison, WI) at the BamHI/HindIII
sites. Transformed colonies were selected and grown in large cultures.
Cultures were induced to produce fusion proteins by the addition of 0.5
M isopropyl-1-thio-
-D-galactosidase. For
GST-IL-15R
protein isolation, cells were resuspended in 10 ml of PBS
containing 10% glycerol and 2 mM EDTA and treated with 100 mg/ml
lysozyme for 15 min at 30°C. Lysates were sonicated, centrifuged, and
added to glutathione beads at room temperature for 30 min. Samples were
washed three times in PBS containing glycerol and proteinase inhibitor.
GST fusion proteins were eluted by incubation in 50 mM Tris containing
10 mM glutathione. His fusion proteins were isolated by resuspending
cell pellets in lysis buffer containing 50 mM
NaH2PO4, 10 mM Tris, 8 M
urea, and 100 mM NaCl for 1 h at room temperature. Lysates were
then sonicated, centrifuged, and incubated in Talon resin beads
(Clontech) for 30 min at room temperature. Protein was eluted from the
resin using 50 mM NaH2PO4,
8 M urea, 10 mM Tris (pH 8.0), 100 mM NaCl, 100 mM EDTA, and protease
inhibitors. Both the GST and His IL-15R
fusion proteins were
dialyzed overnight in PBS and subsequently concentrated by
centrifugation.
Proteins were sent to Cocalico (Reamstown, PA) for polyclonal Ab
production. Rabbits were immunized with 100 µg of GST-IL-15R
and
boosted three times with 50 µg of fusion protein. All injections were
administered i.p. IgG from the serum of immunized rabbits was affinity
purified using His-tagged IL-15R
fusion protein and subsequently
monitored for specificity using Western blot and FACS analysis (data
not shown).
IL-15R
protein expression on HTLV-I-infected cells
HTLV-I-infected cell lines were analyzed for IL-15R
expression using flow cytometry. One million cells were washed in PBS
containing 3% FCS and 0.05% sodium azide. Cells were blocked with
human
-globulin for 15 min. Ten micrograms of IL-15R
or isotype
control Ab was then added to the cells and incubated on ice for 30 min.
Cells were washed twice in FACS buffer and resuspended in 10 µg of
goat anti-rabbit FITC-labeled Ab (Caltag, Burlingame, CA). Cells
were incubated on ice for 30 min and washed twice. Cells were
resuspended in ice-cold PBS and analyzed by flow cytometry using
CellQuest software (Becton Dickinson, San Jose, CA).
| Results |
|---|
|
|
|---|
levels in HTLV-I-infected and -uninfected T
cell lines
HTLV-I infection naturally occurs in patient T cells. To determine
whether HTLV-I infection impacted the expression of IL-15R
, we
compared IL-15R
mRNA levels in HTLV-I-infected T cell lines with
uninfected T cell lines. We performed an RPA on RNA extracted from a
number of HTLV-I-infected T cell lines including HuT102, C81, MJ, MT-1,
and MT-2 compared with HTLV-I-uninfected T cell lines such as CEM,
SupT1, A301, Jurkat, and HuT78. As shown in Fig. 1
A, HTLV-I-infected cell lines
expressed detectable levels of IL-15R
mRNA when compared with those
of uninfected cells, with the exception of HuT78 (see
Discussion). In addition, as previously shown, IL-2R
mRNA
levels were also higher in HTLV-I-infected T cells (49).
Furthermore, we examined IL-15R
mRNA levels in T cells from normal
donors vs T cells from patients with ATL (Fig. 1
B).
Following normalization for loading based on GAPDH levels (see
Materials and Methods), ATL patient samples showed a 1.1- to
13.1-fold increase in IL-15R
levels (lanes 511)
when compared with that of normal donors (lanes
14). Taken together, these findings suggested that IL-15R
expression was elevated in HTLV-I-infected cells.
|
mRNA levels
Since there was an increase in IL-15R
levels in HTLV-I-infected
cell lines, we hypothesized that IL-15R
levels were increased
through the action of the HTLV-I-encoded protein Tax. Tax is a viral
protein that activates the expression of an array of host cell genes
including those of IL-2, IL-2R
, and IL-15 (30, 35, 43, 44). To examine the role of Tax on IL-15R
expression, we
transfected a Tax expression plasmid (Tax/pMT2T) into Jurkat cells.
After 24 h, RNA was isolated and RPA was performed using probes
for human IL-15R
and GAPDH. IL-15R
mRNA levels were increased to
detectable levels and maintained an 18-fold induction when compared
with that of the mock-transfected cells (Fig. 2
A). RT-PCR analysis was
performed as a transfection efficiency control to demonstrate the
expression of Tax in Tax/pMT2T-transfected cells and not in
vector-alone-transfected Jurkat cells (Fig. 2
B). These data
suggested that the HTLV-I-encoded Tax protein increased the mRNA
expression level of IL-15R
in the Jurkat T cells.
|
promoter activity
To dissect the transcriptional regulation of IL-15R
in the
context of HTLV-I infection, we cloned the IL-15R
promoter, a
1513-bp fragment of DNA that lies directly 5' to the IL-15R
gene
start site. The sequence of this fragment is shown in Fig. 3
. The transcriptional initiation site
was determined by 5' RACE analysis on RNA obtained from Jurkat T Ag
cells. Sequence analysis suggested that there was no conventional TATA
box upstream of the transcription initiation site.
The IL-15R
promoter was subsequently cloned into the pGL3 luciferase
reporter construct (hIL-15R
pro/pGL3) for use in promoter activity
studies (Fig. 4
A). As shown in
Fig. 4
B, cotransfection of a Tax expression plasmid
(Tax/pMT2T) with the IL-15R
promoter increased basal promoter
activity by at least 4-fold. This suggested that the HTLV-I Tax protein
activated the IL-15R
promoter and thus might play an important role
in the trans activation of the IL-15R
gene.
NF-
B is involved in the regulation of IL-15R
transcription
Additional studies were performed to identify the region of the
IL-15R
promoter that was responsive to Tax expression. 5' serial
deletions of the IL-15R
promoter were transfected into Jurkat cells
in the presence or absence of Tax/pMT2T to localize the Tax-responsive
region of the IL-15R
promoter (Fig. 4
, A and
B). Deletion of the first 196-bp of the promoter by exo-mung
bean treatment completely inhibited Tax-induced promoter activation.
This suggested that DNA elements located within the first 196 bp of the
promoter (bases encompassing -1061 to -865) were responsible for the
Tax-induced activation.
Due to its highly active enhancer activity, this 196-bp region of the
IL-15R
promoter was then cloned into the pGL3 promoter vector which
contains an SV40 heterologous promoter and ana-lyzed for reporter
activity (Del.1/pGL3pro). As shown in Fig. 4
C, this fragment
was activated by Tax in a dose-dependent manner. These data again
implied that DNA elements located within this 196-bp region were
responsible for Tax-induced transcription of IL-15R
. Following
analysis of the IL-15R
promoter sequence, a putative NF-
B-binding
motif was identified at position -989 to -979 (Fig. 4
A).
We performed several experiments to examine the functionality of this
binding motif.
We first analyzed the effect of superdominant I
B
expression on
the Tax-induced activity of this region (Del.1/pGL3pro). I
B
regulates NF-
B function by binding to NF-
B subunits in the
cytoplasm (38). Upon phosphorylation and proteosomal
degradation of I
B, NF-
B is released and is free to enter the
nucleus to function as an active transcription factor. Over expression
of a superdominant I
B
plasmid (SD I
B
/pCDNA3) sequesters
NF-
B in the cytoplasm and hence blocks NF-
B activity
(50). We cotransfected the Del.1/pGL3pro with Tax/pMT2T
and SD I
B
/pCDNA3 expression plasmids to examine any effect on
Tax-induced activity. As shown in Fig. 4
D, transient
expression of a superdominant I
B
expression plasmid almost
completely inhibited the Tax-induced activity of the IL-15R
promoter. These data suggested that the NF-
B motif in this region of
the promoter was important for Tax activation. Since the Tax activation
was not completely inhibited by superdominant I
B
, these data also
implied that other factors in this region of the promoter were
important for promoter activity. Further analysis of this promoter
region is necessary to determine what additional factors are involved
in the Tax-induced activation of human IL-15R
transcription.
In addition, the NF-
B motifs in both the full-length (IL-15R
pro
MT NF-
B/pGL3) and the 196-bp region (Del.1 MT NF-
B/pGL3pro) were
mutated using site-directed mutagenesis. As shown in Fig. 4
, B and D, reporter constructs carrying the NF-
B
mutations were not induced by Tax in similar cotransfection studies.
This strongly suggested that the NF-
B motif located within the
IL-15R
promoter was essential to Tax-induced activation of the
promoter.
NF-
B binds specifically to its motif in the IL-15R
promoter
We next analyzed the ability of the NF-
B proteins to bind the
NF-
B motif within the IL-15R
promoter using EMSA. Extracts from
COS cells transfected with plasmids expressing the p50 and p65 NF-
B
subunits were subjected to EMSA analysis using the cNF-
B from the Ig
light chain promoter or the putative NF-
B motif within the
IL-15R
promoter. As shown in Fig. 5
A, the IL-15R
NF-
B site
bound a protein complex that comigrated with the p50/p50 homodimer
observed in the cNF-
B samples. This complex was supershifted upon
the addition of an anti-p50 Ab. A small portion of the binding to
the IL-15R
site could also be attributed to a complex formed with
the p50/p65 heterodimer. This complex was also supershifted upon the
addition of p65 Ab. This indicated that the p50 and p65 protein
subunits were capable of recognizing the NF-
B site within the
IL-15R
promoter. We also examined promoter binding in the context of
HTLV-I infection using extracts from the HTLV-I-uninfected Jurkat and
HTLV-I-infected HuT102 T cell lines. HTLV-I-infected HuT102 cells
exhibited a higher level of NF-
B binding using either the IL-15R
or the cNF-
B probes when compared with the uninfected Jurkat cell
line (Fig. 5
, B and C). The increase in NF-
B
binding between Jurkat and HuT102 cells was anticipated since
HTLV-I-infected cell lines such as HuT102 maintain constitutively
active NF-
B, yet unactivated Jurkat cells serve as an inadequate
source of NF-
B binding. The predominant band using either probe in
the HuT102 lysates consisted of a p50/p50 homodimer. These data
indicated that the putative NF-
B-binding sequence within the
IL-15R
promoter was recognized by NF-
B proteins. In addition,
increased binding of NF-
B subunits from HuT102 cells to the
IL-15R
promoter suggested that the constitutive NF-
B activation
of HTLV-I-infected cells may be responsible for the activity of NF-
B
motif-bearing promoters including IL-15R
.
|
protein expression correlates with receptor RNA levels
Data described above demonstrated an increase in IL-15R
mRNA
levels in HTLV-I-infected cells. To examine IL-15R
surface
expression, we produced a rabbit polyclonal Ab (See Materials and
Methods) for use in flow cytometry analysis. Using this polyclonal
Ab, we demonstrated higher levels of IL-15R
on the surface of
HTLV-I-infected cell lines than uninfected cell lines (Fig. 6
) with the exception of HuT78 (see
Discussion). These data suggested that IL-15R
was present
in measurable quantities on the surface of HTLV-I-infected cells.
|
| Discussion |
|---|
|
|
|---|
mRNA levels were
elevated in HTLV-I-infected T cell lines and in T cells from ATL
patients. In addition, we showed that IL-15R
was transcriptionally
regulated by the HTLV-I-encoded Tax protein, in part, through the
action of NF-
B. Furthermore, using a newly developed polyclonal Ab,
we demonstrated that IL-15R
protein expression was higher on the
surface of HTLV-I-infected T cell lines than uninfected T cell lines.
These findings suggested a possible role for IL-15R
in
HTLV-I-associated diseases such as ATL or HAM/TSP.
The levels of IL-15R
mRNA and protein in HTLV-I-infected T cell
lines were higher than those of uninfected T cell lines with the
exception of HuT78. HuT78 is a T lymphoma cell line that carries a
rearranged NF-
B2 gene which codes for abnormal NF-
B2 proteins
(p100/p52) (19). These proteins have no transcriptional
repressor functions and their function may contribute to the higher
levels of IL-15R
in these cells. In fact, we tested IL-15R
promoter activity in the presence or absence of superdominant I
B
in HuT78 cells. This NF-
B inhibitor did not reduce IL-15R
intrinsic promoter activity, again suggesting that NF-
B is
constitutively active in these cells (data not shown).
Constitutive NF-
B expression is important in HTLV-I-associated
diseases such as ATL. This is interesting because we provided evidence
that Tax, through the action of NF-
B, is important in the regulation
of both IL-15 and IL-15R
transcription. Kitajima et al.
(51) demonstrated that in a mouse model of late-stage ATL,
Tax antisense therapy had no effect on cell proliferation, yet NF-
B
antisense therapy inhibited cell growth. This suggested that NF-
B
was necessary for the maintenance of the ATL phenotype in late stages
of disease. In this stage of disease, Tax expression is undetectable by
RT-PCR; therefore, the activation of NF-
B pathway may explain the
persistent expression of genes that were initially activated by Tax
such as IL-15 and IL-15R
.
As shown in Fig. 1
A, IL-15R
mRNA levels were increased in
HTLV-I-infected T cell lines when compared with uninfected T cell
lines; however, levels of IL-15R
were not as abundant as those of
IL-2R
. We also showed that HTLV-I-infected cells expressed IL-15R
on their surface (Fig. 6
), yet this expression was limited. Previous
studies have shown that T cells from patients with ATL have >20,000
IL-2R
on their surface (52); therefore, there appears
to be a difference in the levels of expression of IL-2R
and
IL-15R
on HTLV-I-infected T cell lines. Differences in the surface
expression of IL-15R
and IL-2R
can be explained by their binding
affinities. IL-15R
binds IL-15 with a
Ka of 1011/M,
which is 1000-fold higher than that of IL-2R
for IL-2
(21). Due to this high-affinity interaction, vast
quantities of IL-15R
on the cell surface may not be necessary to
mediate IL-15 action. As cytokine is secreted from HTLV-I-infected
cells, IL-15R
could bind IL-15 in an autocrine or paracrine fashion,
contributing to the spontaneous proliferation of T cells. Because of
the high-affinity binding of IL-15 to its receptor, few receptors would
be necessary to promote proliferation in this fashion.
The increase in IL-15R
mRNA and protein expression levels in
HTLV-I-infected cells raises a potential role for this receptor in
HTLV-I-associated diseases. ATL is a leukemia that manifests a
partially IL-2-dependent polyclonal proliferation of T cells in the
early stages of disease. In the late phases of ATL, IL-2 is no longer
synthesized, but IL-15 and its receptor are expressed. HAM/TSP T cells
manifest ex vivo spontaneous proliferation in the absence of exogenous
cytokine or growth factor stimulation (41, 42). The
Tax-induced trans activation of IL-2 and IL-2R
is thought
to cause an autocrine and paracrine loop of cytokine-dependent T cell
proliferation. Tendler et al. (35) demonstrated that Abs
directed against both IL-2 and IL-2R
partially inhibited the
spontaneous proliferation of HAM/TSP T cells, yet proliferation was not
completely blocked. These data suggested that other growth factors or
cytokines might be involved in this phenomenon. Recently, Azimi et al.
(31) showed that Abs to IL-15 also inhibited the
spontaneous proliferation of these cells. In the same assay, MiK
1,
an Ab directed against the
-chain receptor shared by IL-2 and IL-15
that specifically inhibits the action of IL-15, also decreased the
spontaneous proliferation of HAM/TSP T cells. Combinations of Abs
directed to IL-2 and IL-15 or to IL-2R
and IL-2/15R
almost
completely inhibited the proliferation of these cells. These data
suggested that autocrine and paracrine loops involving both IL-2 and
IL-15 were involved in the spontaneous proliferation of these
cells.
Patients with HAM/TSP also possess a high number of HTLV-I Tax-specific
CD8+ cells that might contribute to disease
pathogenesis (41, 53). IL-15 is important in the survival
of CD8+ memory cells (54);
therefore, it is possible that IL-15 released from HTLV-I-infected
cells acts in a paracrine fashion on neighboring
CD8+ HTLV-I-specific cells. Levels of IL-15R
on these Tax-specific CD8+ cells have yet to be
determined. In addition, IL-15 is also known to be a potent inhibitor
of apoptosis (18, 55). This antiapoptotic mechanism may
support the long-term survival of CD8+ cells
present in HAM/TSP patients. Further examination of these mechanisms of
action of IL-15 and IL-15R
on CD8+ cells in
HAM/TSP is necessary to understand the paracrine loop of proliferation
envisioned.
Here, we showed that IL-15R
was expressed at higher levels in
HTLV-I-infected T cells when compared with most uninfected T cells. We
also demonstrated that this elevated expression was caused, in part, by
the activation of the IL-15R
promoter by the HTLV-I-encoded protein
Tax through the action of NF-
B. Based on these data, it is possible
that both IL-15 and IL-15R
participate in an autocrine/paracrine
loop of proliferation in HAM/TSP T cell cultures much like that
demonstrated previously for IL-2 and IL-2R
. Therefore, we propose a
model in which IL-2, IL-15, and their binding receptors are
transcriptionally regulated by Tax (Fig. 7
). Upon HTLV-I infection, Tax induces
the transcription of these cytokine systems. Production of both
cytokines and their receptors could lead to an autocrine/paracrine loop
of spontaneous proliferation of T cells. Understanding the mechanisms
behind the regulation of these cytokine systems could lead to
combinatorial therapies directed against both IL-2 and IL-15 or their
receptors in HTLV-I-associated diseases.
|
| Acknowledgments |
|---|
B
/pCDNA3 expression plasmid was a kind gift from C. Duckett
(National Cancer Institute, NIH). We thank Yutaka Tagaya for
discussions and critical review of the manuscript. | Footnotes |
|---|
2 Abbreviations used in this paper: HTLV-I, human T cell lymphotropic virus type I; ATL, adult T cell leukemia; HAM/TSP, HTLV-I-associated myopathy/tropical spastic paraparesis; RACE, rapid amplification of cDNA ends; RPA, RNase protection assay; cNF-
B, consensus NF-
B. ![]()
Received for publication July 6, 2000. Accepted for publication November 30, 2000.
| References |
|---|
|
|
|---|
chain of the interleukin-2 receptor. Science 264:965.
chain is shared by IL-2 and a cytokine, provisionally designated IL-T, that stimulates T-cell proliferation and the induction of lymphokine-activated killer cells. Proc. Natl. Acad. Sci. USA 91:4940.
and
chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 13:2822.[Medline]
chain of the IL-2 receptor. EMBO J. 14:3654.[Medline]
. Science 268:1472.
T lymphocytes for apoptosis. Nature 353:858.[Medline]
)-deficient T cells expressing a transgenic antigen receptor. J. Immunol. 158:3738.[Abstract]
chain and close linkage of IL-15RA and IL-2RA genes. J. Biol. Chem. 270:29862.
B site. Proc. Natl. Acad. Sci. USA 95:2452.
B. Mol. Cell. Biol. 14:6443.
B. Annu. Rev. Cell. Biol. 10:405.
B: structure function relationship of its protein subunits. Biochem. J. 290:297.
B and Rel: participants in a multiform transcriptional regulatory system. Int. Rev. Cytol. 143:1.[Medline]
B via stimulation of signaling pathways. J. Biol. Chem. 270:11745.
B and its inhibitor, I
B-
. Proc. Natl. Acad. Sci. USA 90:2532.
B-
proteolysis by site-specific, signal-induced phosphorylation. Science 267:1485.
B. Science 258:1792.This article has been cited by other articles:
![]() |
M. Mizuguchi, H. Asao, T. Hara, M. Higuchi, M. Fujii, and M. Nakamura Transcriptional Activation of the Interleukin-21 Gene and Its Receptor Gene by Human T-cell Leukemia Virus Type 1 Tax in Human T-cells J. Biol. Chem., September 18, 2009; 284(38): 25501 - 25511. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Giron-Michel, F. Menard, S. Negrini, A. Devocelle, B. Azzarone, and C. Besson EBV-associated mononucleosis does not induce long-term global deficit in T-cell responsiveness to IL-15 Blood, May 7, 2009; 113(19): 4541 - 4547. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Enose-Akahata, U. Oh, C. Grant, and S. Jacobson Retrovirally induced CTL degranulation mediated by IL-15 expression and infection of mononuclear phagocytes in patients with HTLV-I-associated neurologic disease Blood, September 15, 2008; 112(6): 2400 - 2410. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, M. Petrus, B. R. Bryant, V. Phuc Nguyen, M. Stamer, C. K. Goldman, R. Bamford, J. C. Morris, J. E. Janik, and T. A. Waldmann Induction of the IL-9 gene by HTLV-I Tax stimulates the spontaneous proliferation of primary adult T-cell leukemia cells by a paracrine mechanism Blood, May 15, 2008; 111(10): 5163 - 5172. [Abstract] [Full Text] [PDF] |
||||
![]() |
G P Taylor Molecular aspects of HTLV-I infection and adult T-cell leukaemia/lymphoma J. Clin. Pathol., December 1, 2007; 60(12): 1392 - 1396. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Twizere, J.-Y. Springael, M. Boxus, A. Burny, F. Dequiedt, J.-F. Dewulf, J. Duchateau, D. Portetelle, P. Urbain, C. V. Lint, et al. Human T-cell leukemia virus type-1 Tax oncoprotein regulates G-protein signaling Blood, February 1, 2007; 109(3): 1051 - 1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Dubois, T. A. Waldmann, and J. R. Muller Survival adjustment of mature dendritic cells by IL-15 PNAS, June 14, 2005; 102(24): 8662 - 8667. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nishimura, A. Fujimoto, N. Tamura, T. Yajima, W. Wajjwalku, and Y. Yoshikai A novel autoregulatory mechanism for transcriptional activation of the IL-15 gene by a nonsecretable isoform of IL-15 generated by alternative splicing FASEB J, January 1, 2005; 19(1): 19 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mori, T. Matsuda, M. Tadano, T. Kinjo, Y. Yamada, K. Tsukasaki, S. Ikeda, Y. Yamasaki, Y. Tanaka, T. Ohta, et al. Apoptosis Induced by the Histone Deacetylase Inhibitor FR901228 in Human T-Cell Leukemia Virus Type 1-Infected T-Cell Lines and Primary Adult T-Cell Leukemia Cells J. Virol., May 1, 2004; 78(9): 4582 - 4590. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hinz, P. Lemke, I. Anagnostopoulos, C. Hacker, D. Krappmann, S. Mathas, B. Dorken, M. Zenke, H. Stein, and C. Scheidereit Nuclear Factor {kappa}B-dependent Gene Expression Profiling of Hodgkin's Disease Tumor Cells, Pathogenetic Significance, and Link to Constitutive Signal Transducer and Activator of Transcription 5a Activity J. Exp. Med., September 2, 2002; 196(5): 605 - 617. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mori, Y. Yamada, S. Ikeda, Y. Yamasaki, K. Tsukasaki, Y. Tanaka, M. Tomonaga, N. Yamamoto, and M. Fujii Bay 11-7082 inhibits transcription factor NF-kappa B and induces apoptosis of HTLV-I-infected T-cell lines and primary adult T-cell leukemia cells Blood, August 13, 2002; 100(5): 1828 - 1834. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lu, C. A. Pise-Masison, T. M. Fletcher, R. L. Schiltz, A. K. Nagaich, M. Radonovich, G. Hager, P. A. Cole, and J. N. Brady Acetylation of Nucleosomal Histones by p300 Facilitates Transcription from Tax-Responsive Human T-Cell Leukemia Virus Type 1 Chromatin Template Mol. Cell. Biol., July 1, 2002; 22(13): 4450 - 4462. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Pise-Masison, M. Radonovich, R. Mahieux, P. Chatterjee, C. Whiteford, J. Duvall, C. Guillerm, A. Gessain, and J. N. Brady Transcription Profile of Cells Infected with Human T-cell Leukemia Virus Type I Compared with Activated Lymphocytes Cancer Res., June 1, 2002; 62(12): 3562 - 3571. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Mariner, Y. Mamane, J. Hiscott, T. A. Waldmann, and N. Azimi IFN Regulatory Factor 4 Participates in the Human T Cell Lymphotropic Virus Type I-Mediated Activation of the IL-15 Receptor {alpha} Promoter J. Immunol., June 1, 2002; 168(11): 5667 - 5674. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zucker-Franklin ; and U. Dobbeling The role of interleukin-7 and interleukin-15 in cutaneous T-cell lymphoma Blood, May 1, 2002; 99(9): 3488 - 3489. [Full Text] [PDF] |
||||
![]() |
N. Azimi, M. Nagai, S. Jacobson, and T. A. Waldmann IL-15 plays a major role in the persistence of Tax-specific CD8 cells in HAM/TSP patients PNAS, December 4, 2001; 98(25): 14559 - 14564. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |