The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mariner, J. M.
Right arrow Articles by Azimi, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mariner, J. M.
Right arrow Articles by Azimi, N.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2001, 166: 2602-2609.
Copyright © 2001 by The American Association of Immunologists

Human T Cell Lymphotropic Virus Type I Tax Activates IL-15R{alpha} Gene Expression Through an NF-{kappa}B Site

Jennifer M. Mariner1,*,{dagger}, Valerie Lantz*, Thomas A. Waldmann* and Nazli Azimi*

* Metabolism Branch, Division of Clinical Sciences, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; and {dagger} Graduate Genetics Program, Institute of Biomedical Sciences, George Washington University, Washington, DC 20052


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-15 mRNA levels are increased in diseases caused by human T cell lymphotropic virus type I (HTLV-I). In this study, we demonstrated that IL-15R{alpha}, the IL-15-specific binding receptor, mRNA and protein levels were also elevated in HTLV-I-infected cells. We showed that transient HTLV-I Tax expression lead to increased IL-15R{alpha} mRNA levels. In addition, by using a reporter construct that bears the human IL-15R{alpha} promoter, we demonstrated that Tax expression increased promoter activity by at least 4-fold. Furthermore, using promoter deletion constructs and gel shift analysis, we defined a functional NF-{kappa}B-binding motif in the human IL-15R{alpha} promoter, suggesting that Tax activation of IL-15R{alpha} is due, in part, to the induction of NF-{kappa}B. These data indicate that IL-15R{alpha} is transcriptionally regulated by the HTLV-I Tax protein through the action of NF-{kappa}B. These findings suggest a role for IL-15R{alpha} in aberrant T cell proliferation observed in HTLV-I-associated diseases.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin 15 is a cytokine that shares biological functions with IL-2. The functional similarities between these two cytokines can be explained, in part, by the use of common receptors. Both IL-2 and IL-15 share the IL-2R{beta} and the common {gamma} receptor subunits (1, 2, 3, 4, 5, 6, 7, 8). However, each cytokine has its own private receptor, namely, IL-2R{alpha} (9) and IL-15R{alpha} (10), respectively. The {beta}- and common {gamma}-chains contribute to signal transduction cascades initiated by the binding of IL-2 or IL-15.

Despite their receptor sharing and similar biological functions, there are functional differences between IL-2 and IL-15. Although IL-2 and IL-15 are T cell growth factors, they have profoundly different effects on activation-induced cell death. IL-2 plays a role in peripheral tolerance by causing self-reactive T cell suicide (11, 12, 13). IL-2 is also important in activation-induced cell death (14, 15, 16) and the inhibition of CD8+ memory T cell maintenance (17). In contrast, IL-15 has been shown to have an antiapoptotic effect (18) and is critical for the survival of CD8+ memory cells (17, 19). IL-15, unlike IL-2, also stimulates mast cell proliferation and may enhance the actions of IL-3 and stem cell factor in the differentiation of mast cells (5, 20, 21).

Functional differences between IL-2 and IL-15 can be explained by their expression patterns. IL-2 mRNA is largely restricted to lymphoid tissues, yet IL-15 has a wide mRNA expression in many cells and tissues. The broad effects of IL-15 can be explained, in part, by its wide mRNA expression, but also, in part, by the expression of its private receptor IL-15R{alpha}. IL-15R{alpha} is a 58- to 60-kDa type I transmembrane protein that does not belong to the cytokine receptor family (22). IL-15R{alpha} mRNA is expressed in various tissues and cells including T cells, B cells, macrophages, thymic and bone marrow cells, liver, heart, spleen, lung, skeletal muscle, and activated endothelial cells (10, 22). Therefore, the widespread distribution of IL-15 R{alpha} contributes to the pleiotropy of IL-15 action.

Functions of IL-15R{alpha} have been demonstrated in IL-15R{alpha} null (IL-15R{alpha} -/-) mice (23). These knockout mice exhibit marked lymphopenia due to decreased homing of lymphocytes to peripheral lymph nodes. They are also deficient in NK cells, NK-T cells, CD8+ lymphocytes, and TCR{gamma}{delta} intraepithelial lymphocytes. These findings suggest that both IL-15 and its binding receptor are necessary for the development of NK and certain subsets of T cells.

IL-15 is associated with a number of abnormalities including rheumatoid arthritis and inflammatory bowel disease (5). IL-15 is also thought to play a role in the pathological conditions caused by human lymphotropic virus type I (HTLV-I)2 infection including adult T cell leukemia (ATL) and HTLV-I- associated myelopathy/tropical spastic paraparesis (HAM/TSP). ATL is a CD4+ T cell leukemia that is characterized by the presence of lobulated nuclei (24, 25, 26). Patients with ATL have increased abnormal lymphocyte numbers and suffer from opportunistic infections as a result of compromised immune function. HAM/TSP is characterized by a slowly progressive paraparesis that is associated with spasticity (27, 28, 29).

Increased IL-15 levels in the T cells of both ATL and HAM/TSP patients is due to the HTLV-I-encoded Tax protein (30, 31). Tax is expressed from the pX sequence within the HTLV-I proviral genome (32) and has been shown to induce a number of genes such as those of IL-2 and IL-2R{alpha} (33, 34, 35). Activation of cellular genes by HTLV-I Tax is mediated by a number of cis-acting DNA elements including cAMP-responsive element (32), serum-responsive elements, and NF-{kappa}B (36, 37). Azimi et al. (30) demonstrated that IL-15 mRNA is induced by Tax through the action of NF-{kappa}B. NF-{kappa}B is a family of proteins that dimerize to induce transcription of responsive genes. Members of the NF-{kappa}B/Rel family include p50, p52, p65 (RelA), c-Rel, and RelB (38, 39). The p50/p65 heterodimer is the predominant complex. This complex is sequestered in the cytoplasm by I{kappa}B proteins. Upon stimulation with mitogens, cytokines, or the HTLV-I Tax protein, I{kappa}B-{alpha} is rapidly degraded and the NF-{kappa}B subunits are translocated to the cell nucleus. Once inside the nucleus, they function as transcription factors and cause the trans activation of cellular genes (37, 40).

Although HTLV-I infection has been closely associated with both ATL and HAM/TSP diseases, the molecular mechanisms of disease progression have not been well defined. In the early phases of ATL and in HAM/TSP, there is an abnormal proliferation of T cells. In ex vivo cultures, T cells of HAM/TSP patients undergo spontaneous proliferation in the absence of exogenous cytokine or growth factors (41, 42). The spontaneous proliferation of these T cells has been attributed to the Tax-induced overexpression of IL-2 and IL-2R{alpha} which results in the establishment of autocrine and paracrine loops (35, 43, 44). However, recent data suggest that IL-15 can also contribute to the spontaneous proliferation of these T cells (31). We undertook this study to examine the status of IL-15R{alpha} in HTLV-I-infected T cells.

In this study, we demonstrated the impact of HTLV-I infection on IL-15R{alpha} trans activation and expression. We showed that HTLV-I-infected T cells expressed higher levels of IL-15R{alpha} mRNA when compared with uninfected T cells. In addition, we demonstrated that the IL-15R{alpha} promoter was activated by Tax expression in Jurkat cells. We also showed that Tax transcriptionally regulated IL-15R{alpha} expression, in part, through the action of NF-{kappa}B. Furthermore, we demonstrated the expression of IL-15R{alpha} on the surface of HTLV-I-infected cells. These findings demonstrated the presence of IL-15R{alpha} in HTLV-I-infected T cells and suggested a role for this receptor in the abnormal proliferation of T cells in HTLV-I-associated diseases.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture

Cells were cultured in RPMI 1640 medium (Life Technologies, Gaithersburg, MD) containing 10% FCS, 2 mM L-glutamine, 0.2 M HEPES, and 100 U/ml penicillin/streptomycin antibiotic. Cultures were incubated at 37°C in 5%CO2/95%air.

Isolation of peripheral T cells

Peripheral blood mononuclear cells were purified from patient blood samples using Ficoll gradient centrifugation. Approximately 108 PBMC were used to isolate T cells. Abs conjugated to magnetic beads were used to negatively select a purified T cell population using a MACS T cell isolation protocol (Miltenyl Biotech, Auburn, CA). The resulting T cell populations were >95% pure as determined by flow cytometry analysis.

IL-15R{alpha} mRNA expression by RNase protection assay (RPA)

RPA was performed on HTLV-1-infected and -uninfected cell lines, unstimulated normal donor and ATL patient T cells, and Jurkat cells transfected with a Tax expression plasmid. For RPA, 10 µg of the total RNA was used in each assay (PharMingen, San Diego, CA) along with probes for human IL-15R{alpha}, IL-2R{alpha}, and GAPDH (PharMingen). To calculate the fold induction of IL-15R{alpha} in ATL patient T cells, we used a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). A box was placed around each GAPDH and IL-15R{alpha} band and the PhosphorImager recorded a density reading used in the following calculations. A box containing no band was used as blank and the density from this box was subtracted from all other samples. An average of the densities of GAPDH bands of the normal donor samples was calculated. This average density was then divided by individual GAPDH densities of ATL patient T cells. This calculation yielded the GAPDH ratio for each patient sample. Density readings from the ATL patient IL-15R{alpha} levels were multiplied by the GAPDH ratio for each sample to yield a normalized IL-15R{alpha} level. Normalized IL-15R{alpha} levels were then divided by the average density of the normal donor IL-15R{alpha} levels to calculate the fold induction of IL-15R{alpha} expression. The IL-15R{alpha} level in the Tax-transfected Jurkat cells was calculated in a similar manner. A GAPDH ratio was calculated for the Tax-transfected cells by dividing the density of the mock-transfected GAPDH by the GAPDH level of the Tax-transfected sample. This ratio was then multiplied by the IL-15R{alpha} density of the Tax-transfected sample to yield a normalized IL-15R{alpha} level. This normalized IL-15R{alpha} level was divided by the mock-transfected IL-15R{alpha} level to yield the fold induction of IL-15R{alpha} expression.

RT-PCR

cDNA was obtained from RNA isolated from mock-transfected or Tax-transfected Jurkat cells using the cDNA cycle kit (Invitrogen, Carlsbad, CA). PCR for Tax was performed using the following primers: 5'-ATCCCGTGGAGACTCCTCAA-3' (sense) and 5'-CGTGCCATCGGTAAATGTCC-3' (antisense). PCR conditions were as follows: 95°C for 5 min, 95°C for 1 min -> 53°C for 1 min -> 72°C for 2 min (35 cycles), and 72°C for 5 min.

Cloning of the IL-15R{alpha} promoter

The Genome Walker (Clontech, Palo Alto, CA) library was used to clone the 5' regulatory region of human IL-15R{alpha}. Two antisense primers, 5'-GCGAGCGCTGCCCAGGC-3' and 5'-CCCAGGCCGGGGGGAG-3', were used in a nested PCR protocol to amplify the region of DNA located 5' to IL-15R{alpha} exon 1 (see Fig. 3Go). These sequence data have been submitted to the GenBank database under accession number AF283296. The resulting 1513-bp fragment was subsequently TA cloned into the pCR2.1 plasmid (Invitrogen) and then into the pGL3 basic luciferase vector (Promega, Madison, WI) at the KpnI/XhoI restriction enzyme sites (hIL-15R{alpha}pro/pGL3). Reporter activity was determined in Jurkat cells. In transfection studies using this full-length promoter, 5 µg of the reporter constructs was transfected into 4 x 106 cells by electroporation at 280 V and 975 µF. Cells were plated in six-well dishes and maintained at 37°C for 24 h. Luciferase activity was determined using a luciferase reporter assay (Promega). Data were normalized for transfection efficiency using a {beta}-galactosidase reporter assay (Promega). Data are represented as the fold induction over the pGL3 basic reporter construct. Assays were performed in triplicate and error bars represent the SD of fold induction of samples.



View larger version (82K):
[in this window]
[in a new window]
 
FIGURE 3. The human IL-15R{alpha} promoter sequence. The transcription initiation site and NF-{kappa}B motif are in boldface type and underlined. Part of IL-15R{alpha} exon 1 which was cloned into the hIL-15R{alpha} pro/pGL3 luciferase construct is also underlined.

 
Analysis of the IL-15R{alpha} transcription initiation site by 5' rapid amplification of cDNA ends (RACE)

To interpret the IL-15R{alpha} promoter sequence, it was essential to determine the precise transcription initiation site for the IL-15R{alpha} gene. The rapid RACE (5' RACE; Life Technologies) assay was used to detect the transcription initiation site in the IL-15R{alpha} 5' upstream region using mRNA isolated from T Ag Jurkat cells (45). Gene-specific antisense primers used in this analysis were: 5'-CCCAGGCCGGGGGGAG-3' (GSP 1) and 5'-GGTGGCGAGCGCTGC-3' (GSP 2). All procedures were conducted according to the manufacturer’s directions.

Construction and evaluation of human IL-15R{alpha} promoter deletions

Serial deletions of human IL-15R{alpha} promoter were prepared using the Exo Mung Bean deletion kit (Stratagene, La Jolla, CA). The luciferase construct containing the 1513-bp promoter fragment was digested with KpnI and MluI to produce 3' and 5' overhangs. Linearized plasmids were treated with 20 U of exonuclease III at 23°C and aliquots were removed at various time points. Digested plasmids were then treated with 15 U/µl mung bean nuclease and incubated at 30°C for 30 min. Plasmids were religated and used to transform One Shot competent cells (Invitrogen). Deletion constructs were sequenced and evaluated for luciferase. Full-length or random deletion constructs (5 µg) were cotransfected into Jurkat cells in the presence or absence of a Tax expression plasmid (Tax/pMT2T at 5 µg) (46) to analyze whether the promoter was activated by Tax and to delineate the regions of the promoter that were responsive to it. All transfections and luciferase assays were performed as described above.

Analysis of the Tax-responsive element within the IL-15R{alpha} promoter

The first 196 bp (bases encompassing -1061 to -865) of the IL-15R{alpha} promoter were PCR amplified using the following primers: 5'-GCGACGCGTGTGGGATTTCCCCAGTTG-3' (sense) and 5'-GCGGAGCTCTGGGCAACACAGCCAG-3'(antisense). The resulting fragment was TA cloned into pCR2.1 (Invitrogen) and subsequently cloned into the pGL3 promoter vector (Promega) at the XhoI and KpnI sites (Del.1/pGL3pro). In Fig. 4GoC, 1, 2, and 5 µg of the Tax expression plasmid were used to perform a dose-response curve using the Del.1/pGL3pro plasmid. Cotransfections were also performed using the Del.1/pGL3pro (0.5 µg), Tax/pMT2T (5 µg), and SD I{kappa}B{alpha}/pCDNA3 (5 µg) expression plasmids (Fig. 4GoD). All data are represented as the fold induction over the pGL3 promoter construct alone. Assays were performed in triplicate and error bars represent the SD of fold induction of samples.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 4. Reporter assays of the human IL-15R{alpha} promoter in Jurkat cells. A, Schematic representation of the deletion constructs of the hIL-15R{alpha}pro/pGL3 reporter. B, hIL-15R{alpha}pro/pGL3 or serial deletion constructs were cotransfected with Tax/pMT2T to delineate the region of the promoter responsive to Tax. A full-length IL-15 R{alpha} promoter construct mutant for NF-{kappa}B (hIL-15R{alpha}pro MT NF-{kappa}B/pGL3) was also cotransfected with Tax/pMT2T to determine its response to Tax. C, Del.1/pGL3pro was cotransfected with various concentrations of Tax/pMT2T to determine the dose response of Tax induction. D, Del.1/pGL3pro was cotransfected with Tax/pMT2T alone or with Tax/pMT2T and SD I{kappa}B{alpha}/pCDNA3 to determine the effect on reporter activity in the presence of an NF-{kappa}B inhibitor. A reporter construct bearing a mutated NF-{kappa}B motif (Del.1 MT NF-{kappa}B/pGL3pro) was also cotransfected with Tax/pMT2T to examine its response to Tax expression. In B–D, 2 µg of {beta}-galactosidase plasmid was also added to normalize the transfection efficiency. The bars in the graph represent the average fold induction of triplicate samples over the pGL3 or pGL3pro vectors alone.

 
The NF-{kappa}B motif (-989 to -979) in the Del.1/pGL3 pro and the hIL-15R{alpha}pro/pGL3 constructs were mutated using Quick Change site-directed mutagenesis (Stratagene) with the following primers: 5'-AATTGAATAATGT(G -> T)(G -> A)GATTTC(C -> A)(C -> T)CAGTTGGAGTAAG-3' (sense) and 5'-CTTACTCCAACTG(C -> A)(C -> T)GAAATC(G -> T) (G -> A)ACATTATTCAATT-3' (antisense) to generate Del.1 MT NF-{kappa}B/pGL3pro and hIL-15R{alpha}pro MT NF-{kappa}B/pGL3, respectively. Cotransfection studies were performed in Jurkat cells using 0.5 µg of the Del.1 MT NF-{kappa}B/pGL3pro reporter construct (Fig. 4GoD) or 5 µg of the hIL-15R{alpha}pro MT NF-{kappa}B/pGL3 reporter construct (Fig. 4GoA) and 5 µg of the Tax/pMT2T (Fig. 4GoD).

Expression plasmids

The Tax/pMT2T, p50/pMT2T, and p65/pMT2T plasmids were previously described (37, 47, 48) and were a kind gift from U. Siebenlist (National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health (NIH), Bethesda, MD). The SD I{kappa}B{alpha}/pCDNA3 plasmid was kindly provided by C. Duckett (National Cancer Institute, NIH, Bethesda, MD).

Analysis of transcription factor consensus sequences using EMSA

We performed electrophoretic mobility shift assay (EMSA) using nuclear extracts from unactivated Jurkat cells, HuT102 cells, and COS cells transfected with NF-{kappa}B p50/pMT2T and p65/pMT2T expression plasmids. The probes used in this assay were double-stranded 32P-labeled oligonucleotides encompassing the IL-15R{alpha} NF-{kappa}B (IL-15R{alpha}NF-{kappa}B) motif ATGTGGGATTTCCCCAG or the Ig {kappa}B motif as a consensus NF-{kappa}B motif (cNF-{kappa}B) AGTTGAGGGGACTTTCCCAGGC, where the underlined sequences are the NF-{kappa}B binding sites. Abs to p50 and p65 subunits were added to the cell extracts for 30 min on ice for gel shift analysis. Abs were a generous gift from U. Seinbelist (NIAID, NIH). Extracts were then mixed with radiolabeled probes, poly(dI-dC), and BSA at room temperature for 30 min. Samples were loaded onto an acrylamide (30%)/bis-acrylamide (0.8%) gel and subjected to electrophoresis at 120 V for the initial 10 min, followed by 150 V for the remainder of the run. Gels were dried and exposed to Kodak MS film (Kodak, Rochester, NY).

Generation of IL-15R{alpha} polyclonal Abs

The extracellular domain of IL-15R{alpha} was PCR amplified using the following primers: 5'-GAGCTGCCGCCATGGCC-3' (sense) and 5'-CCGTCGTTACTGTGGAGG-3' (antisense). Amplified product was TA cloned into pCR 2.1 (Invitrogen) and transformed into One Shot cells (Invitrogen). Colonies containing the insert were subcloned into the GST vector pGEX-2T (Pharmacia, New Brunswick, NJ) at the BamHI/EcoRI sites or the His vector pET 30A (Novagen, Madison, WI) at the BamHI/HindIII sites. Transformed colonies were selected and grown in large cultures. Cultures were induced to produce fusion proteins by the addition of 0.5 M isopropyl-1-thio-{beta}-D-galactosidase. For GST-IL-15R{alpha} protein isolation, cells were resuspended in 10 ml of PBS containing 10% glycerol and 2 mM EDTA and treated with 100 mg/ml lysozyme for 15 min at 30°C. Lysates were sonicated, centrifuged, and added to glutathione beads at room temperature for 30 min. Samples were washed three times in PBS containing glycerol and proteinase inhibitor. GST fusion proteins were eluted by incubation in 50 mM Tris containing 10 mM glutathione. His fusion proteins were isolated by resuspending cell pellets in lysis buffer containing 50 mM NaH2PO4, 10 mM Tris, 8 M urea, and 100 mM NaCl for 1 h at room temperature. Lysates were then sonicated, centrifuged, and incubated in Talon resin beads (Clontech) for 30 min at room temperature. Protein was eluted from the resin using 50 mM NaH2PO4, 8 M urea, 10 mM Tris (pH 8.0), 100 mM NaCl, 100 mM EDTA, and protease inhibitors. Both the GST and His IL-15R{alpha} fusion proteins were dialyzed overnight in PBS and subsequently concentrated by centrifugation.

Proteins were sent to Cocalico (Reamstown, PA) for polyclonal Ab production. Rabbits were immunized with 100 µg of GST-IL-15R{alpha} and boosted three times with 50 µg of fusion protein. All injections were administered i.p. IgG from the serum of immunized rabbits was affinity purified using His-tagged IL-15R{alpha} fusion protein and subsequently monitored for specificity using Western blot and FACS analysis (data not shown).

IL-15R{alpha} protein expression on HTLV-I-infected cells

HTLV-I-infected cell lines were analyzed for IL-15R{alpha} expression using flow cytometry. One million cells were washed in PBS containing 3% FCS and 0.05% sodium azide. Cells were blocked with human {gamma}-globulin for 15 min. Ten micrograms of IL-15R{alpha} or isotype control Ab was then added to the cells and incubated on ice for 30 min. Cells were washed twice in FACS buffer and resuspended in 10 µg of goat anti-rabbit FITC-labeled Ab (Caltag, Burlingame, CA). Cells were incubated on ice for 30 min and washed twice. Cells were resuspended in ice-cold PBS and analyzed by flow cytometry using CellQuest software (Becton Dickinson, San Jose, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Detection of IL-15R{alpha} levels in HTLV-I-infected and -uninfected T cell lines

HTLV-I infection naturally occurs in patient T cells. To determine whether HTLV-I infection impacted the expression of IL-15R{alpha}, we compared IL-15R{alpha} mRNA levels in HTLV-I-infected T cell lines with uninfected T cell lines. We performed an RPA on RNA extracted from a number of HTLV-I-infected T cell lines including HuT102, C81, MJ, MT-1, and MT-2 compared with HTLV-I-uninfected T cell lines such as CEM, SupT1, A301, Jurkat, and HuT78. As shown in Fig. 1GoA, HTLV-I-infected cell lines expressed detectable levels of IL-15R{alpha} mRNA when compared with those of uninfected cells, with the exception of HuT78 (see Discussion). In addition, as previously shown, IL-2R{alpha} mRNA levels were also higher in HTLV-I-infected T cells (49). Furthermore, we examined IL-15R{alpha} mRNA levels in T cells from normal donors vs T cells from patients with ATL (Fig. 1GoB). Following normalization for loading based on GAPDH levels (see Materials and Methods), ATL patient samples showed a 1.1- to 13.1-fold increase in IL-15R{alpha} levels (lanes 5–11) when compared with that of normal donors (lanes 1–4). Taken together, these findings suggested that IL-15R{alpha} expression was elevated in HTLV-I-infected cells.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 1. IL-15R{alpha} mRNA expression in HTLV-I-infected vs -uninfected T cell lines and ATL patient samples as examined by RPA. A, Various T cell lines were examined for human IL-15R{alpha}, IL-2R{alpha}, and GAPDH mRNA expression. HTLV-I (-) lanes contain the uninfected resting T cell lines in the following order: A301, SupT1, Jurkat, CEM, and HuT78. HTLV-I (+) lanes contain HTLV-I-infected cell lines HuT102, C81, MJ, MT-1, and MT-2, respectively. B, IL-15R{alpha} mRNA levels were compared by RPA in unactivated normal donor T cells and ATL patient T cells. Lanes 1–4 contain four normal donor samples while lanes 5–11 contain seven ATL patient samples.

 
Effect of HTLV-I Tax expression on IL-15R{alpha} mRNA levels

Since there was an increase in IL-15R{alpha} levels in HTLV-I-infected cell lines, we hypothesized that IL-15R{alpha} levels were increased through the action of the HTLV-I-encoded protein Tax. Tax is a viral protein that activates the expression of an array of host cell genes including those of IL-2, IL-2R{alpha}, and IL-15 (30, 35, 43, 44). To examine the role of Tax on IL-15R{alpha} expression, we transfected a Tax expression plasmid (Tax/pMT2T) into Jurkat cells. After 24 h, RNA was isolated and RPA was performed using probes for human IL-15R{alpha} and GAPDH. IL-15R{alpha} mRNA levels were increased to detectable levels and maintained an 18-fold induction when compared with that of the mock-transfected cells (Fig. 2GoA). RT-PCR analysis was performed as a transfection efficiency control to demonstrate the expression of Tax in Tax/pMT2T-transfected cells and not in vector-alone-transfected Jurkat cells (Fig. 2GoB). These data suggested that the HTLV-I-encoded Tax protein increased the mRNA expression level of IL-15R{alpha} in the Jurkat T cells.



View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 2. The effect of HTLV-I Tax expression on IL-15R{alpha} mRNA levels. A, Total RNA samples from Jurkat cells that were transfected with Tax/pMT2T or empty vector and analyzed by RPA for IL-15R{alpha} and GAPDH levels. Lane 1 contains RNA from the mock-transfected control cells and lane 2 contains RNA from the Tax/pMT2T-expressing cells. B, RT-PCR was performed as a control for Tax transfection efficiency. Lane 3 contains the mock (pMT2T empty vector)-transfected cells while lane 4 contains the Tax/pMT2T-transfected cells.

 
IL-15R{alpha} promoter activity

To dissect the transcriptional regulation of IL-15R{alpha} in the context of HTLV-I infection, we cloned the IL-15R{alpha} promoter, a 1513-bp fragment of DNA that lies directly 5' to the IL-15R{alpha} gene start site. The sequence of this fragment is shown in Fig. 3Go. The transcriptional initiation site was determined by 5' RACE analysis on RNA obtained from Jurkat T Ag cells. Sequence analysis suggested that there was no conventional TATA box upstream of the transcription initiation site.

The IL-15R{alpha} promoter was subsequently cloned into the pGL3 luciferase reporter construct (hIL-15R{alpha}pro/pGL3) for use in promoter activity studies (Fig. 4GoA). As shown in Fig. 4GoB, cotransfection of a Tax expression plasmid (Tax/pMT2T) with the IL-15R{alpha} promoter increased basal promoter activity by at least 4-fold. This suggested that the HTLV-I Tax protein activated the IL-15R{alpha} promoter and thus might play an important role in the trans activation of the IL-15R{alpha} gene.

NF-{kappa}B is involved in the regulation of IL-15R{alpha} transcription

Additional studies were performed to identify the region of the IL-15R{alpha} promoter that was responsive to Tax expression. 5' serial deletions of the IL-15R{alpha} promoter were transfected into Jurkat cells in the presence or absence of Tax/pMT2T to localize the Tax-responsive region of the IL-15R{alpha} promoter (Fig. 4Go, A and B). Deletion of the first 196-bp of the promoter by exo-mung bean treatment completely inhibited Tax-induced promoter activation. This suggested that DNA elements located within the first 196 bp of the promoter (bases encompassing -1061 to -865) were responsible for the Tax-induced activation.

Due to its highly active enhancer activity, this 196-bp region of the IL-15R{alpha} promoter was then cloned into the pGL3 promoter vector which contains an SV40 heterologous promoter and ana-lyzed for reporter activity (Del.1/pGL3pro). As shown in Fig. 4GoC, this fragment was activated by Tax in a dose-dependent manner. These data again implied that DNA elements located within this 196-bp region were responsible for Tax-induced transcription of IL-15R{alpha}. Following analysis of the IL-15R{alpha} promoter sequence, a putative NF-{kappa}B-binding motif was identified at position -989 to -979 (Fig. 4GoA). We performed several experiments to examine the functionality of this binding motif.

We first analyzed the effect of superdominant I{kappa}B{alpha} expression on the Tax-induced activity of this region (Del.1/pGL3pro). I{kappa}B{alpha} regulates NF-{kappa}B function by binding to NF-{kappa}B subunits in the cytoplasm (38). Upon phosphorylation and proteosomal degradation of I{kappa}B, NF-{kappa}B is released and is free to enter the nucleus to function as an active transcription factor. Over expression of a superdominant I{kappa}B{alpha} plasmid (SD I{kappa}B{alpha}/pCDNA3) sequesters NF-{kappa}B in the cytoplasm and hence blocks NF-{kappa}B activity (50). We cotransfected the Del.1/pGL3pro with Tax/pMT2T and SD I{kappa}B{alpha}/pCDNA3 expression plasmids to examine any effect on Tax-induced activity. As shown in Fig. 4GoD, transient expression of a superdominant I{kappa}B{alpha} expression plasmid almost completely inhibited the Tax-induced activity of the IL-15R{alpha} promoter. These data suggested that the NF-{kappa}B motif in this region of the promoter was important for Tax activation. Since the Tax activation was not completely inhibited by superdominant I{kappa}B{alpha}, these data also implied that other factors in this region of the promoter were important for promoter activity. Further analysis of this promoter region is necessary to determine what additional factors are involved in the Tax-induced activation of human IL-15R{alpha} transcription.

In addition, the NF-{kappa}B motifs in both the full-length (IL-15R{alpha}pro MT NF-{kappa}B/pGL3) and the 196-bp region (Del.1 MT NF-{kappa}B/pGL3pro) were mutated using site-directed mutagenesis. As shown in Fig. 4Go, B and D, reporter constructs carrying the NF-{kappa}B mutations were not induced by Tax in similar cotransfection studies. This strongly suggested that the NF-{kappa}B motif located within the IL-15R{alpha} promoter was essential to Tax-induced activation of the promoter.

NF-{kappa}B binds specifically to its motif in the IL-15R{alpha} promoter

We next analyzed the ability of the NF-{kappa}B proteins to bind the NF-{kappa}B motif within the IL-15R{alpha} promoter using EMSA. Extracts from COS cells transfected with plasmids expressing the p50 and p65 NF-{kappa}B subunits were subjected to EMSA analysis using the cNF-{kappa}B from the Ig {kappa} light chain promoter or the putative NF-{kappa}B motif within the IL-15R{alpha} promoter. As shown in Fig. 5GoA, the IL-15R{alpha} NF-{kappa}B site bound a protein complex that comigrated with the p50/p50 homodimer observed in the cNF-{kappa}B samples. This complex was supershifted upon the addition of an anti-p50 Ab. A small portion of the binding to the IL-15R{alpha} site could also be attributed to a complex formed with the p50/p65 heterodimer. This complex was also supershifted upon the addition of p65 Ab. This indicated that the p50 and p65 protein subunits were capable of recognizing the NF-{kappa}B site within the IL-15R{alpha} promoter. We also examined promoter binding in the context of HTLV-I infection using extracts from the HTLV-I-uninfected Jurkat and HTLV-I-infected HuT102 T cell lines. HTLV-I-infected HuT102 cells exhibited a higher level of NF-{kappa}B binding using either the IL-15R{alpha} or the cNF-{kappa}B probes when compared with the uninfected Jurkat cell line (Fig. 5Go, B and C). The increase in NF-{kappa}B binding between Jurkat and HuT102 cells was anticipated since HTLV-I-infected cell lines such as HuT102 maintain constitutively active NF-{kappa}B, yet unactivated Jurkat cells serve as an inadequate source of NF-{kappa}B binding. The predominant band using either probe in the HuT102 lysates consisted of a p50/p50 homodimer. These data indicated that the putative NF-{kappa}B-binding sequence within the IL-15R{alpha} promoter was recognized by NF-{kappa}B proteins. In addition, increased binding of NF-{kappa}B subunits from HuT102 cells to the IL-15R{alpha} promoter suggested that the constitutive NF-{kappa}B activation of HTLV-I-infected cells may be responsible for the activity of NF-{kappa}B motif-bearing promoters including IL-15R{alpha}.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 5. EMSA using the IL-15R{alpha}NF-{kappa}B motif ATGTGGGATTTCCCCAG and the Ig {kappa}B NF-{kappa}B as cNF-{kappa}B motif AGTTGAGGGGACTTTCCCAGGC (where the underlined sequences are the NF-{kappa}B binding sites) in lysates from HTLV-I-infected and -uninfected T cell lines. A, Extracts were obtained from COS cells transfected with the p50 and p65 subunits of NF-{kappa}B and were incubated with the cNF-{kappa}B and IL-15R{alpha}NF-{kappa}B probes. Both the p50/p50 homodimer and p50/p65 heterodimer can be seen with the cNF-{kappa}B and the IL-15R{alpha}NF-{kappa}B probes. Super shift analysis using Abs to p50 or p65 confirm the presence of both p50 and p65 in the shifted bands. B, Nuclear extracts from the unactivated HTLV-I-negative Jurkat cell line were analyzed for their ability to bind both cNF-{kappa}B and IL-15R{alpha}NF-{kappa}B probes. Binding is greatly diminished when compared with either the COS or HuT102 cell shifts with either probe. C, Nuclear extracts from the HTLV-I-infected HuT102 T cell line extracts were analyzed for NF-{kappa}B protein binding to the cNF-{kappa}B and IL-15R{alpha}NF-{kappa}B probes. Lysates were able to bind both probes to form a predominant p50-p50 homodimer complex. Supershift analysis confirmed the presence of the NF-{kappa}B p50 protein in these complexes. Binding of the IL-15R{alpha}NF-{kappa}B motif in the HTLV-I-infected cell line was greatly enhanced when compared with the uninfected cell line (B).

 
IL-15R{alpha} protein expression correlates with receptor RNA levels

Data described above demonstrated an increase in IL-15R{alpha} mRNA levels in HTLV-I-infected cells. To examine IL-15R{alpha} surface expression, we produced a rabbit polyclonal Ab (See Materials and Methods) for use in flow cytometry analysis. Using this polyclonal Ab, we demonstrated higher levels of IL-15R{alpha} on the surface of HTLV-I-infected cell lines than uninfected cell lines (Fig. 6Go) with the exception of HuT78 (see Discussion). These data suggested that IL-15R{alpha} was present in measurable quantities on the surface of HTLV-I-infected cells.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 6. IL-15R{alpha} cell surface expression as analyzed by flow cytometry. A, Uninfected T cell lines were analyzed using a rabbit polyclonal Ab directed against the extracellular domain of IL-15R{alpha}. B, HTLV-I-infected T cell lines were examined by flow cytometry for the presence of cell surface IL-15R{alpha} using a polyclonal Ab. In A and B, dotted lines represent staining with a rabbit IgG control and solid lines represent staining with polyclonal IL-15R{alpha} Ab.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we demonstrated that IL-15R{alpha} mRNA levels were elevated in HTLV-I-infected T cell lines and in T cells from ATL patients. In addition, we showed that IL-15R{alpha} was transcriptionally regulated by the HTLV-I-encoded Tax protein, in part, through the action of NF-{kappa}B. Furthermore, using a newly developed polyclonal Ab, we demonstrated that IL-15R{alpha} protein expression was higher on the surface of HTLV-I-infected T cell lines than uninfected T cell lines. These findings suggested a possible role for IL-15R{alpha} in HTLV-I-associated diseases such as ATL or HAM/TSP.

The levels of IL-15R{alpha} mRNA and protein in HTLV-I-infected T cell lines were higher than those of uninfected T cell lines with the exception of HuT78. HuT78 is a T lymphoma cell line that carries a rearranged NF-{kappa}B2 gene which codes for abnormal NF-{kappa}B2 proteins (p100/p52) (19). These proteins have no transcriptional repressor functions and their function may contribute to the higher levels of IL-15R{alpha} in these cells. In fact, we tested IL-15R{alpha} promoter activity in the presence or absence of superdominant I{kappa}B{alpha} in HuT78 cells. This NF-{kappa}B inhibitor did not reduce IL-15R{alpha} intrinsic promoter activity, again suggesting that NF-{kappa}B is constitutively active in these cells (data not shown).

Constitutive NF-{kappa}B expression is important in HTLV-I-associated diseases such as ATL. This is interesting because we provided evidence that Tax, through the action of NF-{kappa}B, is important in the regulation of both IL-15 and IL-15R{alpha} transcription. Kitajima et al. (51) demonstrated that in a mouse model of late-stage ATL, Tax antisense therapy had no effect on cell proliferation, yet NF-{kappa}B antisense therapy inhibited cell growth. This suggested that NF-{kappa}B was necessary for the maintenance of the ATL phenotype in late stages of disease. In this stage of disease, Tax expression is undetectable by RT-PCR; therefore, the activation of NF-{kappa}B pathway may explain the persistent expression of genes that were initially activated by Tax such as IL-15 and IL-15R{alpha}.

As shown in Fig. 1GoA, IL-15R{alpha} mRNA levels were increased in HTLV-I-infected T cell lines when compared with uninfected T cell lines; however, levels of IL-15R{alpha} were not as abundant as those of IL-2R{alpha}. We also showed that HTLV-I-infected cells expressed IL-15R{alpha} on their surface (Fig. 6Go), yet this expression was limited. Previous studies have shown that T cells from patients with ATL have >20,000 IL-2R{alpha} on their surface (52); therefore, there appears to be a difference in the levels of expression of IL-2R{alpha} and IL-15R{alpha} on HTLV-I-infected T cell lines. Differences in the surface expression of IL-15R{alpha} and IL-2R{alpha} can be explained by their binding affinities. IL-15R{alpha} binds IL-15 with a Ka of 1011/M, which is 1000-fold higher than that of IL-2R{alpha} for IL-2 (21). Due to this high-affinity interaction, vast quantities of IL-15R{alpha} on the cell surface may not be necessary to mediate IL-15 action. As cytokine is secreted from HTLV-I-infected cells, IL-15R{alpha} could bind IL-15 in an autocrine or paracrine fashion, contributing to the spontaneous proliferation of T cells. Because of the high-affinity binding of IL-15 to its receptor, few receptors would be necessary to promote proliferation in this fashion.

The increase in IL-15R{alpha} mRNA and protein expression levels in HTLV-I-infected cells raises a potential role for this receptor in HTLV-I-associated diseases. ATL is a leukemia that manifests a partially IL-2-dependent polyclonal proliferation of T cells in the early stages of disease. In the late phases of ATL, IL-2 is no longer synthesized, but IL-15 and its receptor are expressed. HAM/TSP T cells manifest ex vivo spontaneous proliferation in the absence of exogenous cytokine or growth factor stimulation (41, 42). The Tax-induced trans activation of IL-2 and IL-2R{alpha} is thought to cause an autocrine and paracrine loop of cytokine-dependent T cell proliferation. Tendler et al. (35) demonstrated that Abs directed against both IL-2 and IL-2R{alpha} partially inhibited the spontaneous proliferation of HAM/TSP T cells, yet proliferation was not completely blocked. These data suggested that other growth factors or cytokines might be involved in this phenomenon. Recently, Azimi et al. (31) showed that Abs to IL-15 also inhibited the spontaneous proliferation of these cells. In the same assay, MiK{beta}1, an Ab directed against the {beta}-chain receptor shared by IL-2 and IL-15 that specifically inhibits the action of IL-15, also decreased the spontaneous proliferation of HAM/TSP T cells. Combinations of Abs directed to IL-2 and IL-15 or to IL-2R{alpha} and IL-2/15R{beta} almost completely inhibited the proliferation of these cells. These data suggested that autocrine and paracrine loops involving both IL-2 and IL-15 were involved in the spontaneous proliferation of these cells.

Patients with HAM/TSP also possess a high number of HTLV-I Tax-specific CD8+ cells that might contribute to disease pathogenesis (41, 53). IL-15 is important in the survival of CD8+ memory cells (54); therefore, it is possible that IL-15 released from HTLV-I-infected cells acts in a paracrine fashion on neighboring CD8+ HTLV-I-specific cells. Levels of IL-15R{alpha} on these Tax-specific CD8+ cells have yet to be determined. In addition, IL-15 is also known to be a potent inhibitor of apoptosis (18, 55). This antiapoptotic mechanism may support the long-term survival of CD8+ cells present in HAM/TSP patients. Further examination of these mechanisms of action of IL-15 and IL-15R{alpha} on CD8+ cells in HAM/TSP is necessary to understand the paracrine loop of proliferation envisioned.

Here, we showed that IL-15R{alpha} was expressed at higher levels in HTLV-I-infected T cells when compared with most uninfected T cells. We also demonstrated that this elevated expression was caused, in part, by the activation of the IL-15R{alpha} promoter by the HTLV-I-encoded protein Tax through the action of NF-{kappa}B. Based on these data, it is possible that both IL-15 and IL-15R{alpha} participate in an autocrine/paracrine loop of proliferation in HAM/TSP T cell cultures much like that demonstrated previously for IL-2 and IL-2R{alpha}. Therefore, we propose a model in which IL-2, IL-15, and their binding receptors are transcriptionally regulated by Tax (Fig. 7Go). Upon HTLV-I infection, Tax induces the transcription of these cytokine systems. Production of both cytokines and their receptors could lead to an autocrine/paracrine loop of spontaneous proliferation of T cells. Understanding the mechanisms behind the regulation of these cytokine systems could lead to combinatorial therapies directed against both IL-2 and IL-15 or their receptors in HTLV-I-associated diseases.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 7. Model of spontaneous T cell proliferation in HTLV-I-associated diseases. We hypothesize that Tax activates IL-2, IL-15, IL-2R{alpha}, and IL-15R{alpha}. These cytokine systems could drive the molecular mechanism behind the polyclonal expansion of ATL cells early in the course of disease as well as the spontaneous proliferation of HAM/TSP T cells that is observed ex vivo.

 


    Acknowledgments
 
The Tax/pMT2T expression plasmid and the anti-p50 and p65 Abs were kind gifts from U. Seibenlist (NIAID, NIH). The SD I{kappa}B{alpha}/pCDNA3 expression plasmid was a kind gift from C. Duckett (National Cancer Institute, NIH). We thank Yutaka Tagaya for discussions and critical review of the manuscript.


    Footnotes
 
1 Address correspondence and reprint requests to Jennifer M. Mariner, Building 10, Room 4N-102, National Cancer Institute, National Institutes of Health, 10 Center Drive MSC 1374, Bethesda, MD 20892-1374. Back

2 Abbreviations used in this paper: HTLV-I, human T cell lymphotropic virus type I; ATL, adult T cell leukemia; HAM/TSP, HTLV-I-associated myopathy/tropical spastic paraparesis; RACE, rapid amplification of cDNA ends; RPA, RNase protection assay; cNF-{kappa}B, consensus NF-{kappa}B. Back

Received for publication July 6, 2000. Accepted for publication November 30, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Burton, J. D., R. N. Bamford, C. Peters, A. J. Grant, G. Kurys, C. K. Goldman, J. Brennan, E. Roessler, T. A. Waldmann. 1994. A lymphokine, provisionally designated interleukin T and produced by a human adult T-cell leukemia line, stimulates T-cell proliferation and the induction of lymphokine-activated killer cells. Proc. Natl. Acad. Sci. USA 91:4935.[Abstract/Free Full Text]
  2. Grabstein, K. H., J. Eisenman, K. Shanebeck, C. Rauch, S. Srinivasan, V. Fung, C. Beers, J. Richardson, M. A. Schoenborn, M. Ahdieh, et al 1994. Cloning of a T cell growth factor that interacts with the {beta} chain of the interleukin-2 receptor. Science 264:965.[Abstract/Free Full Text]
  3. Bamford, R. N., A. J. Grant, J. D. Burton, C. Peters, G. Kurys, C. K. Goldman, J. Brennan, E. Roessler, T. A. Waldmann. 1994. The interleukin (IL) 2 receptor {beta} chain is shared by IL-2 and a cytokine, provisionally designated IL-T, that stimulates T-cell proliferation and the induction of lymphokine-activated killer cells. Proc. Natl. Acad. Sci. USA 91:4940.[Abstract/Free Full Text]
  4. Giri, J. G., M. Ahdieh, J. Eisenman, K. Shanebeck, K. Grabstein, S. Kumaki, A. Namen, L. S. Park, D. Cosman, D. Anderson. 1994. Utilization of the {beta} and {gamma} chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 13:2822.[Medline]
  5. Waldmann, T. A., Y. Tagaya, R. Bamford. 1998. Interleukin-2, interleukin-15, and their receptors. Int. Rev. Immunol. 16:205.[Medline]
  6. Tagaya, Y., R. N. Bamford, A. DeFilippis, T. A. Waldmann. 1996. IL-15: a pleiotropic cytokine with diverse receptor/signaling pathways whose expression is controlled at multiple levels. Immunity 4:329.[Medline]
  7. Kennedy, M. K., L. S. Park. 1996. Characterization of interleukin-15 (IL-15) and the IL- 15 receptor complex. J. Clin. Immunol. 16:134.[Medline]
  8. Bamford, R. N., Y. Tagaya, T. A. Waldmann. 1997. Interleukin 15: what it does and how it is controlled. Immunologist 5:52.
  9. Leonard, W., J. Depper, G. Crabtree, S. Rudikoff, J. Pumphrey, R. Robb, M. Kronke, P. Svetlik, N. Peffer, T. Waldmann. 1984. Molecular cloning and expression of cDNAs for the human interleukin-2 receptor. Nature 311:626.[Medline]
  10. Giri, J. G., S. Kumaki, M. Ahdieh, D. J. Friend, A. Loomis, S. Shanebeck, R. DuBose, D. Cosman, L. S. Park, D. M. Anderson. 1995. Identification and cloning of a novel IL-15 binding protein that is structurally related to the {alpha} chain of the IL-2 receptor. EMBO J. 14:3654.[Medline]
  11. Sadlack, B., H. Merz, H. Schorle, A. Schimpi, A. C. Feller, I. Horack. 1993. Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 75:253.[Medline]
  12. Suzuki, H., T. Kunding, C. Furlonger, A. Wakeman, E. Timms, T. Matsuyama, T. Schimtts, J. Simard, P. Ohashi, H. Greisser, et al 1995. Deregulated T cell activation and autoimmunity in mice lacking IL-2 receptor {beta}. Science 268:1472.[Abstract/Free Full Text]
  13. Willerford, D., J. Chen, J. Ferry, L. Davidson, A. Ma, F. Alt. 1995. Interleukin-2 receptor alpha chain regulates the size and content of the peripheral lymphoid compartment. Immunity 3:521.[Medline]
  14. Lenardo, M.. 1991. Interleukin-2 programs mouse {alpha}{beta} T lymphocytes for apoptosis. Nature 353:858.[Medline]
  15. Refaeli, Y., L. VanParijs, C. A. London, J. Tschopp, A. Abbas. 1998. Biochemical mechanisms of IL-2 regulated Fas-mediated T cell apoptosis. Immunity 8:615.[Medline]
  16. Van Parijs, L., A. Biuckians, A. Ibragimov, F. Alt, D. Willerford, A. Abbas. 1997. Functional responses and apoptosis of CD25 (IL-2R {alpha})-deficient T cells expressing a transgenic antigen receptor. J. Immunol. 158:3738.[Abstract]
  17. Ku, C., M. Murakami, A. Sakamoto, J. Kappler, P. Marrack. 2000. Control of homeostasis of CD8+ memory T cells by opposing cytokines. Science 288:675.[Abstract/Free Full Text]
  18. Bulfone-Paus, S., D. Ungureanu, T. Pohl, G. Lindner, T. Paus, R. Ruckert, H. Krause, U. Kunzendorf. 1997. Interleukin-15 protects from lethal apoptosis in vivo. Nat. Med. 3:1124.[Medline]
  19. Zhang, X., S. Sun, I. Hwang, D. Tough, J. Sprent. 1998. Potent and selective stimulation of memory-phenotype CD8+ T cells in vivo by IL-15. Immunity 8:591.[Medline]
  20. Tagaya, Y., J. D. Burton, Y. Miyamoto, T. A. Waldmann. 1996. Identification of a novel receptor/signal transduction pathway for IL-15/T in mast cells. EMBO J. 15:4928.[Medline]
  21. Waldmann, T., Y. Tagaya. 1999. The multifaceted regulation of interleukin-15 expression and the role of this cytokine in NK cell differentiation and host cell response to intracellular pathogens. Annu. Rev. Immunol. 17:19.[Medline]
  22. Anderson, D. M., S. Kumaki, M. Abdieh, J. Bertles, M. Tometsko, A. Loomis, J. Giri, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, et al 1995. Functional characterization of the human interleukin 15 receptor {alpha} chain and close linkage of IL-15RA and IL-2RA genes. J. Biol. Chem. 270:29862.[Abstract/Free Full Text]
  23. Lodolce, J. P., D. L. Boone, S. Chai, R. E. Swain, T. Dassopoulos, S. Trettin, A. Ma. 1998. IL-15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation. Immunity 9:669.[Medline]
  24. Yodoi, J., K. Takatsuki, T. Masuda. 1974. Two cases of T-cell chronic lymphocytic leukemia in Japan. N. Engl. J. Med. 290:572.
  25. Uchiyama, T., J. Yodoi, K. Sagawa, K. Takatsuki, H. Uchino. 1977. Adult T-cell leukemia: clinical and hematologic features of 16 cases. Blood 50:481.[Free Full Text]
  26. Takatsuki, K., K. Yamaguchi, M. Matsuoka. 1994. ATL and HTLV-I related diseases. K. Takatsuki, ed. Adult T-Cell Leukemia 1. Oxford Univ. Press, Oxford.
  27. Osame, M., M. Matsumoto, K. Usuku, S. Izumo, N. Ijichi, H. Amitani, M. Tara, A. Igata. 1987. Chronic progressive myelopathy associated with elevated antibodies to human T lymphotropic virus type I and adult T-cell leukemia-like cells. Ann. Neurol. 21:117.[Medline]
  28. Osame, M., A. Igata, M. Matsumoto, M. Kohka, K. Usuku, S. Izumo. 1990. HTLV-I associated myelopathy (HAM), treatment trails, retrospective survey, and clinical and laboratory findings. Hematol. Rev. 3:271.
  29. Osame, M., J. C. McArthur. 1990. Neurologic manifestations of infection with human T cell lymphotropic virus type I. A. K. Asbury, and G. M. McKhann, and W. I. McDonald, eds. Disease of the Nervous System Clinical Neurobiology 1331. Saunders,
  30. Azimi, N., K. Brown, R. N. Bamford, Y. Tagaya, U. Siebenlist, T. A. Waldmann. 1998. Human T cell lymphotropic virus type I Tax protein trans-activates interleukin 15 gene transcription through an NF-{kappa}B site. Proc. Natl. Acad. Sci. USA 95:2452.[Abstract/Free Full Text]
  31. Azimi, N., S. Jacobson, T. Leist, T. A. Waldmann. 1999. Involvement of IL-15 in the pathogenesis of human T lymphotropic virus type I-associated myelopathy/tropical spastic paraparesis: implications for therapy with a monoclonal antibody directed to the IL-2/15R receptor. J. Immunol. 163:4064.[Abstract/Free Full Text]
  32. Jeang, K. T., I. Boros, J. Brady, M. Radonovich, G. Khoury. 1988. Characterization of cellular factors that interact with the human T-cell leukemia virus type I p40x-responsive 21 base pair sequence. J. Virol. 62:4499.[Abstract/Free Full Text]
  33. Inoue, J., M. Seiki, T. Taniguchi, S. Tsuru, M. Yoshida. 1986. Induction of interleukin 2 receptor gene expression by p40x encoded by human T cell leukemia virus type 1. EMBO J. 5:2883.[Medline]
  34. Maruyama, M., H. Shibuya, H. Harada, M. Hatakayama, M. Seiki, T. Fujita, I. Inoue, M. Yoshida, T. Taniguchi. 1987. Evidence for aberrant activation of interleukin 2 autocrine loop by HTLV-I encoded p40x and T3/T1 complex triggering. Cell 48:343.[Medline]
  35. Tendler, C. L., S. J. Greenberg, W. A. Blattner, A. Manns, W. Murphy, T. Fleisher, B. Hanchard, O. Morgan, J. D. Burton, D. L. Nelson, T. A. Waldmann. 1990. Transactivation of interleukin 2 and its receptor induces immune activation in human T-cell lymphotropic virus type I-associated myelopathy: Pathogenic implications and a rationale for immunotherapy. Proc. Natl. Acad. Sci. USA 87:5218.[Abstract/Free Full Text]
  36. Fujii, M., P. Sassone-Corsi, I. Verma. 1988. c-fos promoter trans-activation by the tax1 protein of human T-cell leukemia virus type I. Proc. Natl. Acad. Sci. USA 85:8526.[Abstract/Free Full Text]
  37. Kanno, T., K. Brown, G. Franzoso, U. Siebenlist. 1994. Kinetic analysis of human T-cell leukemia virus type I Tax-mediated activation of NF-{kappa}B. Mol. Cell. Biol. 14:6443.[Abstract/Free Full Text]
  38. Siebenlist, U., G. Franzoso, K. Brown. 1994. Structure, regulation and function of NF- {kappa}B. Annu. Rev. Cell. Biol. 10:405.
  39. Grimm, S., P. Baeuerle. 1993. The inducible transcription factor NF-{kappa}B: structure function relationship of its protein subunits. Biochem. J. 290:297.
  40. Grilli, M., J. Chiu, M. Lenardo. 1993. NF-{kappa}B and Rel: participants in a multiform transcriptional regulatory system. Int. Rev. Cytol. 143:1.[Medline]
  41. Jacobson, S., V. Zaninovic, C. Mora, P. Rodgers-Johnson, W. A. Sheremata, C. J. Gibbs, C. Gajdusek, D. E. McFarlin. 1988. Immunological findings in neurological diseases associated with antibodies to HTLV-I: activated lymphocytes in tropical spastic parapaesis. Ann. Neurol. 23:S196.
  42. Itoyama, Y., S. Minato, J. Kira, I. Goto, H. Sato, K. Okochi, Y. Yamamoto. 1988. Spontaneous proliferation of peripheral blood lymphocytes increased in patients with HTLV-I associated myelopathy. Neurology 28:1302.[Abstract/Free Full Text]
  43. Maeda, M., N. Arima, Y. Daitoku, M. Kashihara, H. Okamoto, T. Uchiyama, K. Shirono, M. Matsuoka, T. Hattori, K. Takatsuki, et al 1987. Evidence for the interleukin-2 dependent expansion of leukemic cells in adult T cell leukemia. Blood 70:1407.[Abstract/Free Full Text]
  44. Tendler, C., S. Greenberg, J. Burton, D. Danielpour, S. Kim, W. Blattner, A. Manns, T. Waldmann. 1991. Cytokine induction in HTLV-I associated myelopathy and adult T-cell leukemia: alternate molecular mechanisms underlying retroviral pathogenesis. J. Cell. Biochem. 46:302.[Medline]
  45. Clipstone, N. A., G. Crabtree. 1992. Identification of calcineurin as a key signalling enzyme in T-lymphocyte activation. Nature 357:695.[Medline]
  46. Kanno, T., K. Brown, U. Sienbenlist. 1995. Evidence in support of a role for human T cell leukemia virus type I tax in activating NF-{kappa}B via stimulation of signaling pathways. J. Biol. Chem. 270:11745.[Abstract/Free Full Text]
  47. Brown, K., S. Park, T. Kanno, G. Franzoso, U. Sienbenlist. 1993. Mutual regulation of the transcriptional activator NF-{kappa}B and its inhibitor, I{kappa}B-{alpha}. Proc. Natl. Acad. Sci. USA 90:2532.[Abstract/Free Full Text]
  48. Brown, K., S. Gerstberger, L. Carlson, G. Franzoso, U. Siebenlist. 1995. Control of I{kappa}B-{alpha} proteolysis by site-specific, signal-induced phosphorylation. Science 267:1485.[Abstract/Free Full Text]
  49. Kelly, K., P. Davis, H. Mitsuya, S. Iving, J. Wright, R. Grassman, B. Fleckenstein, Y. Wano, W. Greene, U. Siebenlist. 1992. A high proportion of early response genes are constitutively activated in T cells by HTLV-I. Oncogene 7:1463.[Medline]
  50. Mir, S. S., B. W. M. Richter, C. S. Duckett. 2000. Differential effects of CD30 activation in anaplastic large cell lymphoma and Hodgkin disease cells. Blood 96:4307.[Abstract/Free Full Text]
  51. Kitajima, I., T. Shinohara, J. Bilakovics, D. A. Brown, X. Xu, M. Nerenberg. 1992. Ablation of transplanted HTLV-I Tax-transformed tumors in mice by antisense inhibition of NF-{kappa}B. Science 258:1792.[Abstract/Free Full Text]
  52. Waldmann, T.. 1989. Multichain interleukin-2 receptor: a target for immunotherapy in lymphoma. J. Natl. Cancer Inst. 81:914.[Abstract/Free Full Text]
  53. Jacobson, S., H. Shida, D. E. McFarlin, A. S. Fauci, S. Koenig. 1990. Circulating CD8+ cytotoxic T-lymphocytes specific for HTLV-I pX in patients with HTLV-I-associated neurological disease. Nature 348:245.[Medline]
  54. Zhang, J., C. Chang, L. Lombardi, R. Dalla-Favera. 1994. Rearranged NFKB2 gene in the HUT78 T-lymphoma cell line codes for a constitutively nuclear factor lacking transcriptional repressor functions. Oncogene 9:1931.[Medline]
  55. Marks-Konczalik, J., S. Dubois, J. M. Losi, H. Sabzevari, N. Yamada, L. Feigenbaum, T. A. Waldmann, Y. Tagaya. 2000. IL-2-induced activation-induced cell death is inhibited in IL-15 transgenic mice. Proc. Natl. Acad. Sci. USA 97:11445.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. Mizuguchi, H. Asao, T. Hara, M. Higuchi, M. Fujii, and M. Nakamura
Transcriptional Activation of the Interleukin-21 Gene and Its Receptor Gene by Human T-cell Leukemia Virus Type 1 Tax in Human T-cells
J. Biol. Chem., September 18, 2009; 284(38): 25501 - 25511.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Giron-Michel, F. Menard, S. Negrini, A. Devocelle, B. Azzarone, and C. Besson
EBV-associated mononucleosis does not induce long-term global deficit in T-cell responsiveness to IL-15
Blood, May 7, 2009; 113(19): 4541 - 4547.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Enose-Akahata, U. Oh, C. Grant, and S. Jacobson
Retrovirally induced CTL degranulation mediated by IL-15 expression and infection of mononuclear phagocytes in patients with HTLV-I-associated neurologic disease
Blood, September 15, 2008; 112(6): 2400 - 2410.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Chen, M. Petrus, B. R. Bryant, V. Phuc Nguyen, M. Stamer, C. K. Goldman, R. Bamford, J. C. Morris, J. E. Janik, and T. A. Waldmann
Induction of the IL-9 gene by HTLV-I Tax stimulates the spontaneous proliferation of primary adult T-cell leukemia cells by a paracrine mechanism
Blood, May 15, 2008; 111(10): 5163 - 5172.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
G P Taylor
Molecular aspects of HTLV-I infection and adult T-cell leukaemia/lymphoma
J. Clin. Pathol., December 1, 2007; 60(12): 1392 - 1396.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J.-C. Twizere, J.-Y. Springael, M. Boxus, A. Burny, F. Dequiedt, J.-F. Dewulf, J. Duchateau, D. Portetelle, P. Urbain, C. V. Lint, et al.
Human T-cell leukemia virus type-1 Tax oncoprotein regulates G-protein signaling
Blood, February 1, 2007; 109(3): 1051 - 1060.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. P. Dubois, T. A. Waldmann, and J. R. Muller
Survival adjustment of mature dendritic cells by IL-15
PNAS, June 14, 2005; 102(24): 8662 - 8667.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
H. Nishimura, A. Fujimoto, N. Tamura, T. Yajima, W. Wajjwalku, and Y. Yoshikai
A novel autoregulatory mechanism for transcriptional activation of the IL-15 gene by a nonsecretable isoform of IL-15 generated by alternative splicing
FASEB J, January 1, 2005; 19(1): 19 - 28.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
N. Mori, T. Matsuda, M. Tadano, T. Kinjo, Y. Yamada, K. Tsukasaki, S. Ikeda, Y. Yamasaki, Y. Tanaka, T. Ohta, et al.
Apoptosis Induced by the Histone Deacetylase Inhibitor FR901228 in Human T-Cell Leukemia Virus Type 1-Infected T-Cell Lines and Primary Adult T-Cell Leukemia Cells
J. Virol., May 1, 2004; 78(9): 4582 - 4590.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Hinz, P. Lemke, I. Anagnostopoulos, C. Hacker, D. Krappmann, S. Mathas, B. Dorken, M. Zenke, H. Stein, and C. Scheidereit
Nuclear Factor {kappa}B-dependent Gene Expression Profiling of Hodgkin's Disease Tumor Cells, Pathogenetic Significance, and Link to Constitutive Signal Transducer and Activator of Transcription 5a Activity
J. Exp. Med., September 2, 2002; 196(5): 605 - 617.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Mori, Y. Yamada, S. Ikeda, Y. Yamasaki, K. Tsukasaki, Y. Tanaka, M. Tomonaga, N. Yamamoto, and M. Fujii
Bay 11-7082 inhibits transcription factor NF-kappa B and induces apoptosis of HTLV-I-infected T-cell lines and primary adult T-cell leukemia cells
Blood, August 13, 2002; 100(5): 1828 - 1834.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Lu, C. A. Pise-Masison, T. M. Fletcher, R. L. Schiltz, A. K. Nagaich, M. Radonovich, G. Hager, P. A. Cole, and J. N. Brady
Acetylation of Nucleosomal Histones by p300 Facilitates Transcription from Tax-Responsive Human T-Cell Leukemia Virus Type 1 Chromatin Template
Mol. Cell. Biol., July 1, 2002; 22(13): 4450 - 4462.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. A. Pise-Masison, M. Radonovich, R. Mahieux, P. Chatterjee, C. Whiteford, J. Duvall, C. Guillerm, A. Gessain, and J. N. Brady
Transcription Profile of Cells Infected with Human T-cell Leukemia Virus Type I Compared with Activated Lymphocytes
Cancer Res., June 1, 2002; 62(12): 3562 - 3571.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Mariner, Y. Mamane, J. Hiscott, T. A. Waldmann, and N. Azimi
IFN Regulatory Factor 4 Participates in the Human T Cell Lymphotropic Virus Type I-Mediated Activation of the IL-15 Receptor {alpha} Promoter
J. Immunol., June 1, 2002; 168(11): 5667 - 5674.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Zucker-Franklin ; and U. Dobbeling
The role of interleukin-7 and interleukin-15 in cutaneous T-cell lymphoma
Blood, May 1, 2002; 99(9): 3488 - 3489.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Azimi, M. Nagai, S. Jacobson, and T. A. Waldmann
IL-15 plays a major role in the persistence of Tax-specific CD8 cells in HAM/TSP patients
PNAS, November 15, 2001; (2001) 251540598.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Azimi, M. Nagai, S. Jacobson, and T. A. Waldmann
IL-15 plays a major role in the persistence of Tax-specific CD8 cells in HAM/TSP patients
PNAS, December 4, 2001; 98(25): 14559 - 14564.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mariner, J. M.
Right arrow Articles by Azimi, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mariner, J. M.
Right arrow Articles by Azimi, N.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS