|
|
||||||||


,
*
Institut National de la Santé et de la Recherche Médicale, Unité 463, Institut de Biologie, Nantes, France;
Centre dImmunologie, Institut National de la Santé et de la Recherche Médicale/Centre National de la Recherche Scientifique de Marseille Luminy, Marseille, France;
Institut Universitaire de France, Paris, France;
§
Immunotech SA, Marseille, France; and
¶
Istituto di Istologia, Universita di Genoa, Genoa, Italy
| Abstract |
|---|
|
|
|---|

T cell clones, sorted by
means of the CD158b (KIR2DL2/KIR2DL3/KIR2DS2) specific mAb GL183. We
isolated several pairs of CD158b+ and CD158b-

T cell clones sharing identical productive and nonproductive TCR
transcripts. We showed that expression of functional KIR on T cells is
regulated after termination of TCR rearrangements. Transcriptional
regulation of KIR genes was documented in multiple T
cell clones generated from the same donor, and the presence of KIR
transcripts was also detected in KIR- T cells. These
results document a complex regulation of KIR expression in T cells at
both pre and posttranscriptional levels, under the control of yet
undefined signals provided in vivo. | Introduction |
|---|
|
|
|---|
Inhibitory NKR (KIR-long (KIR-L) molecules, LIR-1/ILT-2, NKG2A) harbor
an intracytoplasmic immunoreceptor tyrosine-based inhibition motif,
which is responsible for the inhibitory function of the receptor
(5, 7). Activating NKR have also been described.
Activating NKR (KIR-short (KIR-S) molecules, LIR-7/ILT-1) have no
intracytoplasmic immunoreceptor tyrosine-based inhibition motif, but
are associated with immunoreceptor tyrosine-based activation
molecule-bearing transduction polypeptides such as killer
cell-activating receptor-associated protein/DAP12 (KIR-S molecules,
NKG2C) or FcR
(LIR-7/ILT-1) (7).
NKRs are not specific NK cell markers. Their distribution includes
subsets of 
and 
T lymphocytes (14, 22, 23, 24, 25).
NKR+ 
T cells are preferentially found
within Ag-experienced subsets (26), thus suggesting
selective NKR induction or expansion of NKR+ T
cells during in vivo T cell responses. In this regard, cytokines such
as IL-15 and TGF-
have been implicated in the induction of
CD94/NKG2A dimers observed on some CD8+ T cells
following their in vitro activation (27, 28). Whether a
similar mechanism applies for KIR is yet unclear; in particular, direct
evidence for in vitro or in vivo induction of KIR on mature lymphoid
cells is still lacking.
Here, we have studied the Ag specificity and TCR features of
KIR+ and KIR- 
T
lymphocytes derived from cells involved in a chronic in vivo response
against EBV. We characterized several pairs of
KIR+ and KIR- T cell
clones expressing identical TCR transcripts, indicating that regulation
of KIR expression occurs after termination of TCR rearrangements.
| Materials and Methods |
|---|
|
|
|---|
The following mAb have been described earlier (4) and were used for flow cytometry analyses, immunomagnetic sorting, as well as for functional assays: EB6 (CD158a, anti-KIR2DL1 (p58.1) and KIR2DS1 (p50.1)); GL183 (CD158b, anti-KIR2DL2/2DL3 (p58.2) and KIR2DS2 (p50.2)); Z276 (anti-KIR3DL1 (p70)); Q66 (anti-KIR3DL2 (p140)); and FS172 (anti-KIR2DS4 (p50.3)). Synthetic peptides corresponding to previously defined EBV epitopes (BMLF1/HLA-A2, GLCTLVAML; BZLF1/HLA-B4002, SENDRLRLL; and BZLF1/HLA-B35, PCVLWPVLPEPLPQGQLTAYHVS) (29) were obtained from Chiron Mimotopes (Victoria, Australia).
Cells
B lymphoblastoid cells (BLC) were grown in RPMI 1640 medium with 2 mM L-glutamine and 8% pooled human serum (culture medium). Synovial T cell lines were isolated, cultured, sorted, and cloned as described (29, 30). The HLA haplotypes of donors A and B were as follows: HLA-A2, -B27, -B61, -Cw1, and Cw15 for donor A, HLA-A24, -A31, -B35, -B60, -Cw3, and -Cw7 for donor B. For immunomagnetic sorting, T cells were incubated with anti-KIR mAb for 45 min, washed once, and rotated for 4 h at 4°C with magnetic beads coated with sheep anti-mouse IgG (Dynal, Oslo, Norway). After eight washes, bead-adherent cells were either seeded at 0.3 cells/well (for direct cloning) or expanded in bulk cultures in culture medium supplemented with rIL-2 (150 IU/ml; Chiron Mimotopes) and restimulated at 3-wk intervals with purified lectin (leukoagglutinin, 0.5 µg/ml; Sigma, Les Ulis, France) in the presence of irradiated allogeneic PBMC and BLC (25, 31).
Flow cytometry analysis
Cells were phenotyped by indirect immunofluorescence as described (25, 31). In brief, cells were incubated first with unconjugated mAb for 30 min at room temperature, washed, and incubated with FITC-conjugated rabbit anti-mouse Ig antiserum (BioAtlantic, Nantes, France) for 30 min on ice. After washing, cells were analyzed by flow cytometry on a FACScan apparatus (Becton Dickinson, Mountain View, CA) using the LYSYS II software package on a FACStation. For intracellular staining, cells were permeabilized in saponin buffer (PBS plus 0.1% BSA plus 0.1% saponin (Sigma) previous staining and flow cytometry was performed as described above using reagents reconstituted in saponin buffer. All washes were performed in saponin buffer.
Analysis of TCR transcripts
For TCR
transcripts, RNA from 5 x
106 T cells was extracted using TRIzol reagent
(Life Technologies, Rockville, MD) according to the suppliers
instructions, and was dissolved in 40 µl water. Reverse transcription
(RT) was performed on 2.5 µl of the RNA solution in a final volume of
12.5 µl for 30 min at 45°C in a mix containing 50 mM Tris-HCl (pH
8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 10 U
rRNasin (Promega, Madison, WI), 1 µM of each dNTP, 100 U Moloney
murine leukemia virus reverse transcriptase (Life Technologies) and 25
pM of the C
-specific primer 5'-TGAAGTCCATAGACCTCATGTC. For each
clone, five PCR were performed using sets of degenerate V
primers
described elsewhere (32). Each PCR was completed to 50
µl with a 1x mix of Taq DNA polymerase (Pharmacia,
Piscataway, NJ), 1.25 U of Taq DNA polymerase, 25 pM of
mixed V
primers. Amplification was performed as described (31, 33). Amplified products were directly sequenced (without
previous plasmid cloning) as described (31, 32, 33) using
Sequenase (Amersham, Arlington Heights, IL) and the C
sequencing
primer, 5'-CTTTGTGACACATTTGTTTGAG.
For TCR
transcripts, RT was performed using a C
I reverse primer
(5'-GCAGACAGGACCCCTTGCTGG) as described above. Amplification was
performed using the following degenerate V
primers:
5'-CAYNRVDMYRTBTMYTGGTA and 5'-CMYRMHMMYMTKTWYTGGTA (Y = C+T,
N = A+C+G+T, R = A+G, V = G+A+C, D = G+A+T, M
= A+C, B = G+T+C, H = A+T+C, K = G+T, W = A+T). A
second PCR was then performed using a nested C
primer
(5'-GTGGCCAGGCACACCAGTGTG) as described (31, 32, 33). Bands of
interest were purified and sequenced as described above.
Functional assays
COS cell transfection assay was performed by the DEAE-dextran chloroquine method (34). In brief, 1.5 x 104 COS cells were cotransfected with 100 ng of an expression vector coding for an EBV protein and 100 ng of an expression vector coding for an HLA allele. Transfected COS cells were tested 48 h after transfection for their ability to trigger TNF secretion by 105 responding T cells after a 6-h incubation at 37°C. TNF released in culture supernatants was quantitated by a bioassay using Wehi 164 cells (35).
For the peptide-induced "fratricide" assay, CTL were incubated for 2 h with 10 µM peptide and washed once, and cell lysis was estimated by flow cytometry on the basis of forward/side scatter patterns and propidium iodide exclusion (29).
For 51Cr-release assays, cytotoxic activity of
CTL clones was also estimated by a regular
51Cr-release assay against
51Cr-labeled BLC loaded with antigenic peptide at
a 10/1 E:T ratio, and the percent of specific target lysis calculated
as previously described (31). Peptide loading of BLC was
performed as described in Ref. 29 . In brief,
51Cr-labeled BLC were incubated with 10 µM of
synthetic antigenic peptide for 1 h in 200 µl of RPMI 1640 plus
8% FCS, then washed three times in RPMI 1640/FCS previous to use in
CTL assays. In some instances, the CTL assay was performed in the
presence of GL183 mAb; in this case, effector cells were preincubated
for 15 min with GL183 mAb (1/4 final hybridoma supernatant) and then
added to peptide-loaded target cells expressing the relevant HLA
restricting element (e.g., HLA-B35 in the experiment shown in Fig. 2
)
with or without the relevant KIR ligand.
|
DNA and total RNA were prepared from 5 x 106 T cell clones using the TRIzol reagent (Life Technologies) according to the manufacturers instructions. Total RNA (5 µg) was used for cDNA conversion in a total volume of 30 µl using a first-strand cDNA synthesis kit (Life Technologies). Determination of the KIR repertoire was performed by PCR using for each amplification either 200 ng of genomic DNA for genomic typing, or 2 µl of cDNA synthesis reaction for transcripts detection. Specific oligonucleotides for genomic and cDNA sequences, and PCR conditions were described previously (36, 37). To verify the specificity of the primers designed to detect KIR sequences, vectors containing a single KIR cDNA sequence (KIR2DS1, KIR2DL1, KIR2DL3, or KIR2DS2) or a bacterial artificial chromosome (BAC) containing KIR2DL1, KIR3DL1, KIR3DL2, and KIR2DS4 genes (kindly provided by Dr. N. Wagtmann), were used as matrices in the PCR-based assay. At a concentration of 0.1 pg of plasmid or 200 ng of BAC, only specific amplifications of the KIR cDNA or genomic sequences by appropriate primer pairs were detected.
Semiquantitative PCR analysis and sequencing
To compare the amount of KIR2DL3 or KIR2DS2 transcripts in T
cell clones, 5 µl of diluted (10-1 to
10-3) or not (100) cDNA
were used in a PCR assay to coamplify human
-actin and KIR2DL3 or
KIR2DS2. The matrix concentration of the various T cell clones that led
to a similar human
-actin amplification was determined and the
amplification levels of KIR2DL3 or KIR2DS2 at these concentrations were
compared.
Full-length cDNAs of KIR2DL3 were obtained from T cell clones RNA by RT-PCR using oligo(dT) RT and PCR amplification using 5'-KIR2DL3/2DS2 primer (TCGCTCATGGTCGTCAGCATGGTGTGT) and 3'-KIR2DL3/2DS2 primer (AGGGCTCAGCATTTGGAAGTTCCGT). Amplified products were cloned in pGEM-T-easy vector and sequenced using M13 reverse and T7 primers (ABI Prism 3; Perkin-Elmer, Norwalk, CT).
| Results |
|---|
|
|
|---|

T
cells sharing identical in-frame and out-of-frame TCR transcripts
Several indirect observations, such as the preferential KIR
expression on T cells with memory features (26), suggest
that surface KIR are induced at late stages of T cell differentiation,
after termination of TCR rearrangements. However, this hypothesis
remains to be formally proven. Indeed despite numerous attempts, it has
not been possible to induce or modulate surface KIRs on established T
cell clones in vitro, even in the presence of cytokines (e.g., IL-15,
IL-4, IL-12, IFN-
, and TGF
) known to affect surface expression of
lectin-like NKRs, such as CD94-NKG2 heterodimers (27, 38).
A way to demonstrate this would be to isolate pairs of clones differing
by their KIR phenotype but expressing identical TCRs. To this end, we
attempted to isolate KIR+ and
KIR- 
T cell clones showing the same
antigenic specificity. CD158b+
(GL183+) KIR+ T cell lines
were generated from two synovial T cell lines derived from rheumatoid
arthritis patients, which were previously shown to be selected in vivo
by a restricted set of well-defined EBV-derived Ags (29, 39). The specificity of unsorted (predominantly
CD158b-) and CD158b+ T
cells derived from these patients was then determined by testing their
reactivity to COS cells cotransfected with cDNAs coding for various
EBV/HLA combinations (29, 34). The
CD158b+ cell lines derived from both patients
reacted to few dominant EBV/HLA combinations also recognized by
unsorted autologous T cell lines (data not shown). T cell clones were
then generated from CD158b+ and unsorted T cell
lines, checked for CD158b expression, and screened for their reactivity
against the aforementioned dominant viral Ag in a peptide-induced
fratricide assay. Several CD158b- and
CD158b+ clones recognizing the same EBV epitope
(BMLF1/A2) were isolated from one patient (A). Similarly, we obtained
from the other patient (B), CD158b- and
CD158b+ T cell clones reacting against another
EBV Ag (BZLF1/HLA-B35 epitope). Representative
CD158b- (A4.5, B2.5) and
CD158b+ (AGL10, BGL19) T cell clones derived from
patients A (A4.5, AGL10) and B (B2.5, BGL19) are shown in Fig. 1
. TCR
and
transcripts derived
from these clones were then amplified by RT-PCR and the corresponding
V(D)J junctional regions sequenced. TCR
- and
-chains with
identical junctional sequences were identified in the two pairs of
KIR+ and KIR- T cell
clones reacting against the above Ags (Table I
). Of note, KIR+
and KIR- T cell clones shared not only in-frame
but also out-of-frame TCR transcripts (Table I
), thus proving that they
were the progeny of the same mature T cell clone. Taken together, these
data formally demonstrated that the regulation of KIR cell surface
expression occurs after termination of TCR gene rearrangements.
|
|

T cell clones
The functionality of KIRs on the aforementioned T cell clones was
studied by analyzing the effect of KIR engagement on T cell clone
cytolytic activity. Cross-linking of CD158b using mAb GL183 induced
partial inhibition of anti-CD3 redirected lysis of murine
FcR+ P815 cells by the
CD158b+ clone BGL19, when compared with its
CD158b- counterpart (clone B2.5) (data not
shown). Similar results were obtained when KIR were cross-linked by
their physiological ligands (i.e., using HLA-Cw3+
or Cw7+ targets) and the T cell clone activated
by its nominal peptidic Ag. Indeed, EBV peptide-loaded BLC lacking
CD158b ligands (e.g., HLA-Cw4+ targets) were more
efficiently lysed by the CD158b+ clone BGL19 than
those expressing CD158b ligands (e.g., HLA-Cw3/7+
targets) (Fig. 2
A,
right). By contrast, Cw4+ and
Cw3/7+ BLC loaded with the HLA-B35-restricted
BZLF1 peptidic Ag were lysed to a similar extent by the
KIR- clone B2.5 (Fig. 2
A,
left). This difference was exclusively accounted for by KIR
engagement because efficient cytolysis of Cw3/7+
target cells by clone BGL19 was fully restored when masking KIR during
the CTL assay (Fig. 2
B). Taken together, these results
indicated that the CD158b molecules on clone BGL19 were functional as
inhibitory receptors for HLA-Cw3/Cw7.
Transcriptional and posttranscriptional control of KIR expression
in 
T cells
A PCR-based analysis of the KIR repertoire was performed on
KIR+ and KIR- T cell clone
DNA and RNA. Genotype of T cell clones derived from donor B (B2.5,
BGL19) is 2DL1+,
2DL2-, 2DL3+,
3DL1+, 3DL2+,
2DS1-, 2DS2-,
2DS3-, 2DS4+,
2DS5-, and
3DS1- (Table II
and Fig. 3
). Genotype of cells from donor A origin
(AGL10 and A4.5) is 2DL1+,
2DL2+, 2DL3+,
3DL1+, 3DL2+,
2DS1+, 2DS2+,
2DS3-, 2DS4+,
2DS5-, and
3DS1- (Table II
and Fig. 3
). Evidence for
a transcriptional regulation of KIR genes was obtained by
comparing the transcripts and the genes detected in a given cell (Table II
and Fig. 3
). In AGL10 cells, neither 2DS1 nor 2DS4 transcripts were
detected, while 2DS1 and 2DS4 genes were present.
Similarly, in A4.5 cells, no transcripts for 2DL1, 2DL2, 3DL1, 3DL2,
2DS1, or 2DS4 were detected despite the presence of the corresponding
genes.
|
|
|
|
| Discussion |
|---|
|
|
|---|
KIR expression on T cells has been mainly described on
CD8+ memory T cells (26). KIR
engagement by autologous MHC class I molecules can regulate in vitro
CD3/TCR-mediated cytotoxicity and cytokine production suggesting a role
of KIR in the control of T cell activation (22, 23, 25, 27, 43, 47, 48, 49). In a previous study, activation of
KIR+ CTL clones following recognition of tumor
Ags was shown to be abrogated by KIR (50). Interestingly,
in our study, the inhibitory effect of KIR on TCR-mediated activation
of 
T cell clones was partial. The efficiency of KIR-mediated
inhibition is likely affected by numerous parameters such as
the avidity of TCR/ligand interactions and more generally the global
avidity of the interactions between effector and target cells. Such
factors may easily explain the differences observed between the two
situations and are in line with recent data revealing unexpected
complexity in the biological function of KIR on T cells (51, 52).
KIR belong to a multigenic and multiallelic family, and the
polymorphism of KIR genes is still incompletely documented
(37, 53). KIR genes are currently subdivided
into inhibitory KIR (KIR2DL1, KIR2DL2, KIR2DL3, KIR2DL4, KIR3DL1, and
KIR3DL2) and activating isoforms (KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4,
KIR2DS5, and KIR3DS). Eighteen distinct KIR genotypes have
been previously documented (36). T cell clones derived
from donor B shared the most common genotype corresponding to group 1
individuals described earlier (36), while cells from donor
A harbored a newly described genotype (Table II
). Given the limited
number of individuals analyzed thus far (36), these
numbers are certainly underestimated and, therefore, it is not
surprising to detect here new KIR genotypes such as the one
displayed by cells from donor A.
A variable KIR transcription pattern from one NK clone to another, but
a good matching between the presence of a given KIR transcript and its
corresponding protein within a given clone, has been previously
reported (36). These data suggested that the regulation of
KIR expression only operated at a transcriptional, but not at a
posttranscriptional, level. We confirm here the transcriptional
regulation of the genes encoding for KIR-L and KIR-S proteins in both T
and NK cells. But, in addition, we found that KIR-L and KIR-S
transcripts were frequently detected in T cell clones and in one NK
cell line in the absence of the corresponding protein, revealing that
RT-PCR data that document KIR transcription pattern should be
interpreted with caution. This discrepancy between
KIR-L/KIR-S gene transcription and protein expression could
be explained by transient KIR modulation (e.g., following receptor
cross-linking). However, we failed to detect any intracellular KIR
within permeabilized cells, in addition to those already detected on
the surface (Table III
). Furthermore, kinetic analysis of KIR surface
phenotype and transcripts in T cell clones at various time points after
antigenic activation demonstrated stable transcription and surface
expression of KIR, irrespective of the T cell clone activation status
(data not shown). In addition, we have shown that the level of KIR-L
and KIR-S transcripts are positively correlated to the cell surface
expression of the corresponding KIR protein.
Thus, although the factors that induce KIR gene transcription are still unknown, our data show that the regulation of KIR expression occurs in T cells after termination of TCR rearrangements, that a threshold of KIR-L and KIR-S transcripts must be reached to achieve efficient T and NK cell surface expression of the KIR proteins at the cell surface, and that the transcriptional and posttranscriptional pathways that regulates KIR genes expression in T and NK cells are at least in part shared between KIR-L and KIR-S.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 F.V., M.-A.P., and C.C. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Marc Bonneville, Institut National de la Santé et de la Recherche Médicale, Unité 463, Institut de Biologie, 9 quai Moncousu, 44035 Nantes Cedex 01, France. ![]()
4 Abbreviations used in this paper: KIR, killer-cell Ig-like receptor; BLC, B lymphoblastoid cell; RT, reverse transcription; LIR, leukocyte Ig-like receptor; ILT, Ig-like transcript; KIR-L, KIR-long; KIR-S, KIR-short. ![]()
Received for publication November 23, 1999. Accepted for publication December 1, 2000.
| References |
|---|
|
|
|---|
/
+ lymphocytes. I. Inhibition of the IL-2 dependent proliferation by anti-Kp43 monoclonal antibody. J. Immunol. 144:3228.[Abstract]

T cell receptors by natural killer inhibitory receptors. Eur. J. Immunol. 27:2812.[Medline]
-induced expression of CD94/NKG2A inhibitory receptors in human T lymphocytes. Eur. J. Immunol. 29:23.[Medline]

T cells and expression of V9JPC1
/V2DJC
-encoded T cell receptors. J. Immunol. 151:1214.[Abstract]
chain expression on human T lymphocytes. J. Exp. Med. 181:1391.
T cells expressing NK cell receptors. J. Immunol. 159:3723.[Abstract]

T cells, and antigen-specific CTL. J. Immunol. 160:5239.This article has been cited by other articles:
![]() |
G. Li, M. Yu, C. M. Weyand, and J. J. Goronzy Epigenetic regulation of killer immunoglobulin-like receptor expression in T cells Blood, October 15, 2009; 114(16): 3422 - 3430. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. T. van der Veken, M. Diez Campelo, M. A. W. G. van der Hoorn, R. S. Hagedoorn, H. M. E. van Egmond, J. van Bergen, R. Willemze, J. H. F. Falkenburg, and M. H. M. Heemskerk Functional Analysis of Killer Ig-Like Receptor-Expressing Cytomegalovirus-Specific CD8+ T Cells J. Immunol., January 1, 2009; 182(1): 92 - 101. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Goverdhan, S. I. Khakoo, H. Gaston, X. Chen, and A. J. Lotery Age-Related Macular Degeneration Is Associated with the HLA-Cw*0701 Genotype and the Natural Killer Cell Receptor AA Haplotype Invest. Ophthalmol. Vis. Sci., November 1, 2008; 49(11): 5077 - 5082. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Li, C. M. Weyand, and J. J. Goronzy Epigenetic mechanisms of age-dependent KIR2DL4 expression in T cells J. Leukoc. Biol., September 1, 2008; 84(3): 824 - 834. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Patterson, A. Chaidos, D. C. A. Neville, A. Poggi, T. D. Butters, I. A. G. Roberts, and A. Karadimitris Human Invariant NKT Cells Display Alloreactivity Instructed by Invariant TCR-CD1d Interaction and Killer Ig Receptors J. Immunol., September 1, 2008; 181(5): 3268 - 3276. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pascal, E. Yamada, M. P. Martin, G. Alter, M. Altfeld, J. A. Metcalf, M. W. Baseler, J. W. Adelsberger, M. Carrington, S. K. Anderson, et al. Detection of KIR3DS1 on the Cell Surface of Peripheral Blood NK Cells Facilitates Identification of a Novel Null Allele and Assessment of KIR3DS1 Expression during HIV-1 Infection J. Immunol., August 1, 2007; 179(3): 1625 - 1633. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Warren, P. M. Rana, D. T. Rieger, K. A. Hewitt, J. E. Dahlstrom, and A. L. Kent CD8 T cells expressing killer Ig-like receptors and NKG2A are present in cord blood and express a more naive phenotype than their counterparts in adult blood J. Leukoc. Biol., June 1, 2006; 79(6): 1252 - 1259. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ortonne, D. Huet, C. Gaudez, A. Marie-Cardine, V. Schiavon, M. Bagot, P. Musette, and A. Bensussan Significance of circulating T-cell clones in Sezary syndrome Blood, May 15, 2006; 107(10): 4030 - 4038. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu, A. N. Vallejo, Y. Jiang, C. M. Weyand, and J. J. Goronzy Distinct Transcriptional Control Mechanisms of Killer Immunoglobulin-like Receptors in Natural Killer (NK) and in T Cells J. Biol. Chem., June 24, 2005; 280(25): 24277 - 24285. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Anfossi, J.-M. Doisne, M.-A. Peyrat, S. Ugolini, O. Bonnaud, D. Bossy, V. Pitard, P. Merville, J.-F. Moreau, J.-F. Delfraissy, et al. Coordinated Expression of Ig-Like Inhibitory MHC Class I Receptors and Acquisition of Cytotoxic Function in Human CD8+ T Cells J. Immunol., December 15, 2004; 173(12): 7223 - 7229. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. van Bergen, A. Thompson, A. van der Slik, T. H. M. Ottenhoff, J. Gussekloo, and F. Koning Phenotypic and Functional Characterization of CD4 T Cells Expressing Killer Ig-Like Receptors J. Immunol., December 1, 2004; 173(11): 6719 - 6726. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Snyder, T. Nakajima, P. J. Leibson, C. M. Weyand, and J. J. Goronzy Stimulatory Killer Ig-Like Receptors Modulate T Cell Activation through DAP12-Dependent and DAP12-Independent Mechanisms J. Immunol., September 15, 2004; 173(6): 3725 - 3731. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Peacock and R. M. Welsh Origin and Fate of Lymphocytic Choriomeningitis Virus-Specific CD8+ T Cells Coexpressing the Inhibitory NK Cell Receptor Ly49G2 J. Immunol., July 1, 2004; 173(1): 478 - 484. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Epling-Burnette, J. S. Painter, P. Chaurasia, F. Bai, S. Wei, J. Y. Djeu, and T. P. Loughran Jr Dysregulated NK receptor expression in patients with lymphoproliferative disease of granular lymphocytes Blood, May 1, 2004; 103(9): 3431 - 3439. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Stewart, J. van Bergen, and J. Trowsdale Different and Divergent Regulation of the KIR2DL4 and KIR3DL1 Promoters J. Immunol., June 15, 2003; 170(12): 6073 - 6081. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Snyder, M. Lucas, E. Vivier, C. M. Weyand, and J. J. Goronzy Selective Activation of the c-Jun NH2-terminal Protein Kinase Signaling Pathway by Stimulatory KIR in the Absence of KARAP/DAP12 in CD4+ T Cells J. Exp. Med., February 17, 2003; 197(4): 437 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hummel, D. Wilms, M. Vitacolonna, and M. Zoller Donor T cell and host NK depletion improve the therapeutic efficacy of allogeneic bone marrow cell reconstitution in the nonmyeloablatively conditioned tumor-bearing host J. Leukoc. Biol., November 1, 2002; 72(5): 898 - 912. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Hsu, X.-R. Liu, A. Selvakumar, E. Mickelson, R. J. O'Reilly, and B. Dupont Killer Ig-Like Receptor Haplotype Analysis by Gene Content: Evidence for Genomic Diversity with a Minimum of Six Basic Framework Haplotypes, Each with Multiple Subsets J. Immunol., November 1, 2002; 169(9): 5118 - 5129. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Romagnani, G. Pietra, M. Falco, E. Millo, P. Mazzarino, R. Biassoni, A. Moretta, L. Moretta, and M. C. Mingari Identification of HLA-E-specific alloreactive T lymphocytes: A cell subset that undergoes preferential expansion in mixed lymphocyte culture and displays a broad cytolytic activity against allogeneic cells PNAS, August 20, 2002; 99(17): 11328 - 11333. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Dulphy, C. Rabian, C. Douay, O. Flinois, S. Laoussadi, J. Kuipers, R. Tamouza, D. Charron, and A. Toubert Functional modulation of expanded CD8+ synovial fluid T cells by NK cell receptor expression in HLA-B27-associated reactive arthritis Int. Immunol., May 1, 2002; 14(5): 471 - 479. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Snyder, L.-O. Muegge, C. Offord, W. M. O'Fallon, Z. Bajzer, C. M. Weyand, and J. J. Goronzy Formation of the Killer Ig-Like Receptor Repertoire on CD4+CD28null T Cells J. Immunol., April 15, 2002; 168(8): 3839 - 3846. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. G. Shilling, L. A. Guethlein, N. W. Cheng, C. M. Gardiner, R. Rodriguez, D. Tyan, and P. Parham Allelic Polymorphism Synergizes with Variable Gene Content to Individualize Human KIR Genotype J. Immunol., March 1, 2002; 168(5): 2307 - 2315. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |