The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vely, F.
Right arrow Articles by Bonneville, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vely, F.
Right arrow Articles by Bonneville, M.
The Journal of Immunology, 2001, 166: 2487-2494.
Copyright © 2001 by The American Association of Immunologists

Regulation of Inhibitory and Activating Killer-Cell Ig-Like Receptor Expression Occurs in T Cells After Termination of TCR Rearrangements1

Frédéric Vely2,{dagger}, Marie-Alix Peyrat2,*, Christelle Couedel2,*, Jean-François Morcet*, Franck Halary*, François Davodeau*, François Romagne§, Emmanuel Scotet*, Xavier Saulquin*, Elisabeth Houssaint*, Nicolas Schleinitz{dagger}, Alessandro Moretta, Eric Vivier{dagger},{ddagger} and Marc Bonneville3,*

* Institut National de la Santé et de la Recherche Médicale, Unité 463, Institut de Biologie, Nantes, France; {dagger} Centre d’Immunologie, Institut National de la Santé et de la Recherche Médicale/Centre National de la Recherche Scientifique de Marseille Luminy, Marseille, France; {ddagger} Institut Universitaire de France, Paris, France; § Immunotech SA, Marseille, France; and Istituto di Istologia, Universita di Genoa, Genoa, Italy


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A small fraction of T cells expresses killer-cell Ig-like receptors (KIR), a family of MHC class I-specific receptors that can modulate TCR-dependent activation of effector functions. Although KIR+ cells are enriched within Ag-experienced T cell subsets, the precise relationships between KIR+ and KIR- T cells and the stage of KIR induction on these lymphocytes remain unclear. In this study, we compared KIR- and KIR+ {alpha}{beta} T cell clones, sorted by means of the CD158b (KIR2DL2/KIR2DL3/KIR2DS2) specific mAb GL183. We isolated several pairs of CD158b+ and CD158b- {alpha}{beta} T cell clones sharing identical productive and nonproductive TCR transcripts. We showed that expression of functional KIR on T cells is regulated after termination of TCR rearrangements. Transcriptional regulation of KIR genes was documented in multiple T cell clones generated from the same donor, and the presence of KIR transcripts was also detected in KIR- T cells. These results document a complex regulation of KIR expression in T cells at both pre and posttranscriptional levels, under the control of yet undefined signals provided in vivo.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Natural killer and T cells play central and complementary functions in immunity against transformed or virus-infected cells. Although T cell-mediated elimination of target cells is achieved through recognition of Ags bound to MHC molecules, NK cell activation is in most cases negatively affected by the presence of MHC class I products on target cells (1, 2, 3). The molecular basis of these opposite behaviors of T and NK cells was elucidated with the identification of several NKR able to deliver inhibitory signals to effector cells upon recognition of MHC class Ia or Ib molecules (4, 5, 6, 7). In humans, these inhibitory MHC receptors fall into two major groups showing homology to either C-type lectins or Ig. Among members of the first group were identified several HLA-E-reactive heterodimeric receptors comprising an invariant CD94 subunit paired to NKG2 polypeptides (8, 9). Inhibitory NKR belonging to the Ig superfamily (also referred to as killer-cell Ig-like receptors (KIR)4) are either monomeric (KIR2DL1/KIR2DL2/KIR2DL3/KIR2DL4/KIR3DL1) or homodimeric (KIR3DL2) (5, 6). Although KIR2DL1 and KIR2DL2/2DL3 receptors recognize products of particular HLA-Cw alleles (e.g., Cw2/4/5/6/15/1602/1701 for the former, and Cw1/3/7/8/12/13/14/1601/1603 for the latter), KIR3DL1 receptors interact with multiple HLA-B molecules (Bw*04), KIR3DL2 receptors may recognize particular HLA-A (e.g., A*03 and A*011) alleles and KIR2DL4 receptor recognizes the nonclassical HLA-G molecule (11, 12, 13, 14, 15, 16, 17). A novel family of broadly distributed leukocyte Ig-like receptors (LIRs)/Ig-like transcripts (ILTs) has been more recently discovered (18, 19, 20). On lymphocytes, ILT-2 (LIR-1) has been shown to interact with a broad spectrum of HLA-A and HLA-B alleles as well as with HLA-G (18, 21).

Inhibitory NKR (KIR-long (KIR-L) molecules, LIR-1/ILT-2, NKG2A) harbor an intracytoplasmic immunoreceptor tyrosine-based inhibition motif, which is responsible for the inhibitory function of the receptor (5, 7). Activating NKR have also been described. Activating NKR (KIR-short (KIR-S) molecules, LIR-7/ILT-1) have no intracytoplasmic immunoreceptor tyrosine-based inhibition motif, but are associated with immunoreceptor tyrosine-based activation molecule-bearing transduction polypeptides such as killer cell-activating receptor-associated protein/DAP12 (KIR-S molecules, NKG2C) or FcR{gamma} (LIR-7/ILT-1) (7).

NKRs are not specific NK cell markers. Their distribution includes subsets of {alpha}{beta} and {gamma}{delta} T lymphocytes (14, 22, 23, 24, 25). NKR+ {alpha}{beta} T cells are preferentially found within Ag-experienced subsets (26), thus suggesting selective NKR induction or expansion of NKR+ T cells during in vivo T cell responses. In this regard, cytokines such as IL-15 and TGF-{beta} have been implicated in the induction of CD94/NKG2A dimers observed on some CD8+ T cells following their in vitro activation (27, 28). Whether a similar mechanism applies for KIR is yet unclear; in particular, direct evidence for in vitro or in vivo induction of KIR on mature lymphoid cells is still lacking.

Here, we have studied the Ag specificity and TCR features of KIR+ and KIR- {alpha}{beta} T lymphocytes derived from cells involved in a chronic in vivo response against EBV. We characterized several pairs of KIR+ and KIR- T cell clones expressing identical TCR transcripts, indicating that regulation of KIR expression occurs after termination of TCR rearrangements.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abs and reagents

The following mAb have been described earlier (4) and were used for flow cytometry analyses, immunomagnetic sorting, as well as for functional assays: EB6 (CD158a, anti-KIR2DL1 (p58.1) and KIR2DS1 (p50.1)); GL183 (CD158b, anti-KIR2DL2/2DL3 (p58.2) and KIR2DS2 (p50.2)); Z276 (anti-KIR3DL1 (p70)); Q66 (anti-KIR3DL2 (p140)); and FS172 (anti-KIR2DS4 (p50.3)). Synthetic peptides corresponding to previously defined EBV epitopes (BMLF1/HLA-A2, GLCTLVAML; BZLF1/HLA-B4002, SENDRLRLL; and BZLF1/HLA-B35, PCVLWPVLPEPLPQGQLTAYHVS) (29) were obtained from Chiron Mimotopes (Victoria, Australia).

Cells

B lymphoblastoid cells (BLC) were grown in RPMI 1640 medium with 2 mM L-glutamine and 8% pooled human serum (culture medium). Synovial T cell lines were isolated, cultured, sorted, and cloned as described (29, 30). The HLA haplotypes of donors A and B were as follows: HLA-A2, -B27, -B61, -Cw1, and Cw15 for donor A, HLA-A24, -A31, -B35, -B60, -Cw3, and -Cw7 for donor B. For immunomagnetic sorting, T cells were incubated with anti-KIR mAb for 45 min, washed once, and rotated for 4 h at 4°C with magnetic beads coated with sheep anti-mouse IgG (Dynal, Oslo, Norway). After eight washes, bead-adherent cells were either seeded at 0.3 cells/well (for direct cloning) or expanded in bulk cultures in culture medium supplemented with rIL-2 (150 IU/ml; Chiron Mimotopes) and restimulated at 3-wk intervals with purified lectin (leukoagglutinin, 0.5 µg/ml; Sigma, Les Ulis, France) in the presence of irradiated allogeneic PBMC and BLC (25, 31).

Flow cytometry analysis

Cells were phenotyped by indirect immunofluorescence as described (25, 31). In brief, cells were incubated first with unconjugated mAb for 30 min at room temperature, washed, and incubated with FITC-conjugated rabbit anti-mouse Ig antiserum (BioAtlantic, Nantes, France) for 30 min on ice. After washing, cells were analyzed by flow cytometry on a FACScan apparatus (Becton Dickinson, Mountain View, CA) using the LYSYS II software package on a FACStation. For intracellular staining, cells were permeabilized in saponin buffer (PBS plus 0.1% BSA plus 0.1% saponin (Sigma) previous staining and flow cytometry was performed as described above using reagents reconstituted in saponin buffer. All washes were performed in saponin buffer.

Analysis of TCR transcripts

For TCR{alpha} transcripts, RNA from 5 x 106 T cells was extracted using TRIzol reagent (Life Technologies, Rockville, MD) according to the supplier’s instructions, and was dissolved in 40 µl water. Reverse transcription (RT) was performed on 2.5 µl of the RNA solution in a final volume of 12.5 µl for 30 min at 45°C in a mix containing 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 10 U rRNasin (Promega, Madison, WI), 1 µM of each dNTP, 100 U Moloney murine leukemia virus reverse transcriptase (Life Technologies) and 25 pM of the C{alpha}-specific primer 5'-TGAAGTCCATAGACCTCATGTC. For each clone, five PCR were performed using sets of degenerate V{alpha} primers described elsewhere (32). Each PCR was completed to 50 µl with a 1x mix of Taq DNA polymerase (Pharmacia, Piscataway, NJ), 1.25 U of Taq DNA polymerase, 25 pM of mixed V{alpha} primers. Amplification was performed as described (31, 33). Amplified products were directly sequenced (without previous plasmid cloning) as described (31, 32, 33) using Sequenase (Amersham, Arlington Heights, IL) and the C{alpha} sequencing primer, 5'-CTTTGTGACACATTTGTTTGAG.

For TCR{beta} transcripts, RT was performed using a C{beta}I reverse primer (5'-GCAGACAGGACCCCTTGCTGG) as described above. Amplification was performed using the following degenerate V{beta} primers: 5'-CAYNRVDMYRTBTMYTGGTA and 5'-CMYRMHMMYMTKTWYTGGTA (Y = C+T, N = A+C+G+T, R = A+G, V = G+A+C, D = G+A+T, M = A+C, B = G+T+C, H = A+T+C, K = G+T, W = A+T). A second PCR was then performed using a nested C{beta} primer (5'-GTGGCCAGGCACACCAGTGTG) as described (31, 32, 33). Bands of interest were purified and sequenced as described above.

Functional assays

COS cell transfection assay was performed by the DEAE-dextran chloroquine method (34). In brief, 1.5 x 104 COS cells were cotransfected with 100 ng of an expression vector coding for an EBV protein and 100 ng of an expression vector coding for an HLA allele. Transfected COS cells were tested 48 h after transfection for their ability to trigger TNF secretion by 105 responding T cells after a 6-h incubation at 37°C. TNF released in culture supernatants was quantitated by a bioassay using Wehi 164 cells (35).

For the peptide-induced "fratricide" assay, CTL were incubated for 2 h with 10 µM peptide and washed once, and cell lysis was estimated by flow cytometry on the basis of forward/side scatter patterns and propidium iodide exclusion (29).

For 51Cr-release assays, cytotoxic activity of CTL clones was also estimated by a regular 51Cr-release assay against 51Cr-labeled BLC loaded with antigenic peptide at a 10/1 E:T ratio, and the percent of specific target lysis calculated as previously described (31). Peptide loading of BLC was performed as described in Ref. 29 . In brief, 51Cr-labeled BLC were incubated with 10 µM of synthetic antigenic peptide for 1 h in 200 µl of RPMI 1640 plus 8% FCS, then washed three times in RPMI 1640/FCS previous to use in CTL assays. In some instances, the CTL assay was performed in the presence of GL183 mAb; in this case, effector cells were preincubated for 15 min with GL183 mAb (1/4 final hybridoma supernatant) and then added to peptide-loaded target cells expressing the relevant HLA restricting element (e.g., HLA-B35 in the experiment shown in Fig. 2Go) with or without the relevant KIR ligand.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 2. KIR-mediated inhibition of clone BGL19 cytotoxic activity. A, CTL activity of B2.5 and BGL19 clones was estimated at a 10/1 E:T ratio against BZLF1/B35 peptide-loaded HLA-B35+ BLC carrying or not p58.2 KIR ligands ({circ}, B BLC (Cw3/7); •, BM9 BLC (Cw4/4)). B, Restoration of CTL activity of BGL19 T cell clone against KIR-L+ targets following masking of KIRs on effector cells. CTL activity of clones B2.5 and BGL19 was estimated at a 10/1 E:T ratio against B BLC (Cw3/7) or BM9 BLC (Cw4/4) loaded with 10 µM of BZLF1/B35 peptide, in the absence ({square}) or presence ({blacksquare}) of GL183 mAb (1/4 final hybridoma supernatant).

 
KIR repertoire analysis

DNA and total RNA were prepared from 5 x 106 T cell clones using the TRIzol reagent (Life Technologies) according to the manufacturer’s instructions. Total RNA (5 µg) was used for cDNA conversion in a total volume of 30 µl using a first-strand cDNA synthesis kit (Life Technologies). Determination of the KIR repertoire was performed by PCR using for each amplification either 200 ng of genomic DNA for genomic typing, or 2 µl of cDNA synthesis reaction for transcripts detection. Specific oligonucleotides for genomic and cDNA sequences, and PCR conditions were described previously (36, 37). To verify the specificity of the primers designed to detect KIR sequences, vectors containing a single KIR cDNA sequence (KIR2DS1, KIR2DL1, KIR2DL3, or KIR2DS2) or a bacterial artificial chromosome (BAC) containing KIR2DL1, KIR3DL1, KIR3DL2, and KIR2DS4 genes (kindly provided by Dr. N. Wagtmann), were used as matrices in the PCR-based assay. At a concentration of 0.1 pg of plasmid or 200 ng of BAC, only specific amplifications of the KIR cDNA or genomic sequences by appropriate primer pairs were detected.

Semiquantitative PCR analysis and sequencing

To compare the amount of KIR2DL3 or KIR2DS2 transcripts in T cell clones, 5 µl of diluted (10-1 to 10-3) or not (100) cDNA were used in a PCR assay to coamplify human {beta}-actin and KIR2DL3 or KIR2DS2. The matrix concentration of the various T cell clones that led to a similar human {beta}-actin amplification was determined and the amplification levels of KIR2DL3 or KIR2DS2 at these concentrations were compared.

Full-length cDNAs of KIR2DL3 were obtained from T cell clones RNA by RT-PCR using oligo(dT) RT and PCR amplification using 5'-KIR2DL3/2DS2 primer (TCGCTCATGGTCGTCAGCATGGTGTGT) and 3'-KIR2DL3/2DS2 primer (AGGGCTCAGCATTTGGAAGTTCCGT). Amplified products were cloned in pGEM-T-easy vector and sequenced using M13 reverse and T7 primers (ABI Prism 3; Perkin-Elmer, Norwalk, CT).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of CD158+ and CD158- {alpha}{beta} T cells sharing identical in-frame and out-of-frame TCR transcripts

Several indirect observations, such as the preferential KIR expression on T cells with memory features (26), suggest that surface KIR are induced at late stages of T cell differentiation, after termination of TCR rearrangements. However, this hypothesis remains to be formally proven. Indeed despite numerous attempts, it has not been possible to induce or modulate surface KIRs on established T cell clones in vitro, even in the presence of cytokines (e.g., IL-15, IL-4, IL-12, IFN-{gamma}, and TGF{beta}) known to affect surface expression of lectin-like NKRs, such as CD94-NKG2 heterodimers (27, 38). A way to demonstrate this would be to isolate pairs of clones differing by their KIR phenotype but expressing identical TCRs. To this end, we attempted to isolate KIR+ and KIR- {alpha}{beta} T cell clones showing the same antigenic specificity. CD158b+ (GL183+) KIR+ T cell lines were generated from two synovial T cell lines derived from rheumatoid arthritis patients, which were previously shown to be selected in vivo by a restricted set of well-defined EBV-derived Ags (29, 39). The specificity of unsorted (predominantly CD158b-) and CD158b+ T cells derived from these patients was then determined by testing their reactivity to COS cells cotransfected with cDNAs coding for various EBV/HLA combinations (29, 34). The CD158b+ cell lines derived from both patients reacted to few dominant EBV/HLA combinations also recognized by unsorted autologous T cell lines (data not shown). T cell clones were then generated from CD158b+ and unsorted T cell lines, checked for CD158b expression, and screened for their reactivity against the aforementioned dominant viral Ag in a peptide-induced fratricide assay. Several CD158b- and CD158b+ clones recognizing the same EBV epitope (BMLF1/A2) were isolated from one patient (A). Similarly, we obtained from the other patient (B), CD158b- and CD158b+ T cell clones reacting against another EBV Ag (BZLF1/HLA-B35 epitope). Representative CD158b- (A4.5, B2.5) and CD158b+ (AGL10, BGL19) T cell clones derived from patients A (A4.5, AGL10) and B (B2.5, BGL19) are shown in Fig. 1Go. TCR{alpha} and {beta} transcripts derived from these clones were then amplified by RT-PCR and the corresponding V(D)J junctional regions sequenced. TCR{alpha}- and {beta}-chains with identical junctional sequences were identified in the two pairs of KIR+ and KIR- T cell clones reacting against the above Ags (Table IGo). Of note, KIR+ and KIR- T cell clones shared not only in-frame but also out-of-frame TCR transcripts (Table IGo), thus proving that they were the progeny of the same mature T cell clone. Taken together, these data formally demonstrated that the regulation of KIR cell surface expression occurs after termination of TCR gene rearrangements.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 1. Identification of pairs of KIR+ and KIR- T cell clones reacting against identical MHC/EBV peptide complexes. A, Flow cytometry analysis of T cell clones derived from patients A and B using KIR-specific mAb. Shown are the fluorescence histograms (in log scale) obtained by staining T cell clones with GL183 mAb (open histogram) or an irrelevant isotype-matched mAb (filled histogram). Background staining was obtained with all the other NKR-specific mAb tested (i.e., EB6, ZIN276, DEC66, and FSTR172). B, Identification of EBV Ags recognized by KIR+ and KIR- T cell clones. T cell clone reactivity was evaluated against EBV peptides corresponding to the major EBV epitopes identified at the polyclonal level (see text). Because EBV Ags were recognized in the context of autologous HLA alleles, T cell specificity could be determined by an effector fratricide assay after a 2-h incubation with peptide as described (29 ). {square}, BMLF1/A2 peptide (upper panel), BZFL1/B35 peptide (lower panel); {blacksquare}, BZLF1/B40 peptide (upper and lower panels).

 

View this table:
[in this window]
[in a new window]
 
Table I. TCR junctional sequences derived from CD158b+ and CD158b {alpha}{beta} T cell clones1

 
Functional analysis of KIR+ and KIR- {alpha}{beta} T cell clones

The functionality of KIRs on the aforementioned T cell clones was studied by analyzing the effect of KIR engagement on T cell clone cytolytic activity. Cross-linking of CD158b using mAb GL183 induced partial inhibition of anti-CD3 redirected lysis of murine FcR+ P815 cells by the CD158b+ clone BGL19, when compared with its CD158b- counterpart (clone B2.5) (data not shown). Similar results were obtained when KIR were cross-linked by their physiological ligands (i.e., using HLA-Cw3+ or Cw7+ targets) and the T cell clone activated by its nominal peptidic Ag. Indeed, EBV peptide-loaded BLC lacking CD158b ligands (e.g., HLA-Cw4+ targets) were more efficiently lysed by the CD158b+ clone BGL19 than those expressing CD158b ligands (e.g., HLA-Cw3/7+ targets) (Fig. 2GoA, right). By contrast, Cw4+ and Cw3/7+ BLC loaded with the HLA-B35-restricted BZLF1 peptidic Ag were lysed to a similar extent by the KIR- clone B2.5 (Fig. 2GoA, left). This difference was exclusively accounted for by KIR engagement because efficient cytolysis of Cw3/7+ target cells by clone BGL19 was fully restored when masking KIR during the CTL assay (Fig. 2GoB). Taken together, these results indicated that the CD158b molecules on clone BGL19 were functional as inhibitory receptors for HLA-Cw3/Cw7.

Transcriptional and posttranscriptional control of KIR expression in {alpha}{beta} T cells

A PCR-based analysis of the KIR repertoire was performed on KIR+ and KIR- T cell clone DNA and RNA. Genotype of T cell clones derived from donor B (B2.5, BGL19) is 2DL1+, 2DL2-, 2DL3+, 3DL1+, 3DL2+, 2DS1-, 2DS2-, 2DS3-, 2DS4+, 2DS5-, and 3DS1- (Table IIGo and Fig. 3Go). Genotype of cells from donor A origin (AGL10 and A4.5) is 2DL1+, 2DL2+, 2DL3+, 3DL1+, 3DL2+, 2DS1+, 2DS2+, 2DS3-, 2DS4+, 2DS5-, and 3DS1- (Table IIGo and Fig. 3Go). Evidence for a transcriptional regulation of KIR genes was obtained by comparing the transcripts and the genes detected in a given cell (Table IIGo and Fig. 3Go). In AGL10 cells, neither 2DS1 nor 2DS4 transcripts were detected, while 2DS1 and 2DS4 genes were present. Similarly, in A4.5 cells, no transcripts for 2DL1, 2DL2, 3DL1, 3DL2, 2DS1, or 2DS4 were detected despite the presence of the corresponding genes.


View this table:
[in this window]
[in a new window]
 
Table II. KIR genotype and phenotype of CD158b+ and CD158b {alpha}{beta} T cell clones1

 


View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 3. KIR gene transcription patterns of T cell clones. The detection of transcripts and genes for each KIR was performed by RT-PCR and genomic PCR as described previously (36 ). The same panels of KIR amplification were obtained in three independent experiments.

 
The comparison of KIR transcription patterns in KIR+ vs KIR- T cell clones isolated from the same individuals prompted us to investigate whether an additional regulation pathway of KIR expression occurred in T cells, at posttranscriptional levels. B2.5 and BGL19 cells transcribed all their KIR genes, although the former did not express any surface KIR and the latter expressed exclusively KIR2DL3 protein at the cell surface (Table IIGo and data not shown). A4.5 T cells transcribed two KIRs, 2DL3 and 2DS2, but did not express the corresponding protein at the cell surface. Similarly, out of the seven transcripts detected in AGL10 T cell clone, only CD158b is expressed at the surface (KIR2DL2 and/or KIR2DL3 and/or KIR2DS2) (Fig. 3Go). The "missing" KIR proteins were also absent in intact or permeabilized cells, as indicated by flow cytometry analysis using a large panel of KIR-specific mAb (see Table IIIGo). Similar complex control of KIR gene expression was documented in 14 additional T cell clones derived from donor A and 2 additional clones from donor B (Table IIIGo). Several explanations, such as low levels of KIR gene transcription and/or lack of reactivity of mAb to the corresponding KIR protein (e.g., due to KIR polymorphism), could account for the presence of KIR transcripts in the absence of the corresponding protein. To exclude that polymorphism of KIR2DL3 was responsible for the absence of staining using CD158b mAb, we cloned and sequenced the full-length KIR2DL3 cDNA obtained from B2.5 and BGL18 T cell clones. Both sequences were totally identical with KIR2DL3 clone 6 sequence (GenBank accession number U24074; data not shown). We then attempted to amplify full-length KIR2DL3 cDNA from A18.1 and AGL16 T cell clones using 5'-KIR2DL3 primer and 3'-KIR2DL3 primer. In these experiments, only KIR2DS2 clone 49 (GenBank accession number U24079) was cloned and sequenced (data not shown). Therefore, B2.5 T cells and A18.1 T cells express bona fide KIR2DL3 and KIR2DS2 transcripts, although no cell surface expression of the corresponding protein could be detected. We then performed a semiquantitative PCR analysis of KIR2DS2 and KIR2DL3 transcripts in AGL16 and A18.1, as well as in BGL18 and B2.5 T cell clones, respectively. A lower KIR2DL3 transcription level was observed in B2.5, as compared with BGL18 T cells (Fig. 4GoA). Similarly, a lower KIR2DS2 transcription level was observed in A18.1 as compared with AGL16 T cells (Fig. 4GoB). These data thus indicate that quantitative differences in KIR transcripts are likely responsible for the distinct KIR surface phenotypes observed in A18.1 and AGL16, as well as in B2.5 and BGL18 T cell clones.


View this table:
[in this window]
[in a new window]
 
Table III. KIR transcript patterns of KIR+ and KIR T cell clones derived from donors A and B1

 


View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. Semiquantitative PCR analysis of KIR transcripts in CD158b+ and CD158b- T cell clones and NK cell lines. Coamplification of either KIR2DL3 (A and C) or KIR2DS2 (B) and actin transcripts were performed using 5 µl of undiluted (10-0 and C, upper panel) or diluted cDNAs (10-1, 10-2, and 10-3). A, Comparison of KIR2DL3 transcripts from CD158b+ (BGL18) or CD158b- (B2.5) T cell clones. B, Comparison of KIR2DS2 transcripts from CD158b+ (AGL16) or CD158b- (A18.1) T cell clones. C (upper panel), Detection of KIR2DL3 transcripts from CD158b+ (NK3.3) or CD158b- (NK92 and NKL) NK cell lines. C (lower panel), Comparison of KIR2DL3 transcripts from CD158b+ (NK3.3) or CD158b- (NK92) NK cell lines.

 
Further analysis of the pathways that regulate KIR expression was performed in clonal NK cell lines. NK92, NK3.3, and NKL human NK cell lines were cell surface phenotyped using CD158b mAb. As described earlier, NK3.3 is CD158b+ whereas both NK92 and NKL are CD158b- (data not shown). Despite the lack of detectable KIR molecules at the cell surface, KIR2DL3 transcripts were detected in NK92 cells. The specificity of KIR2DL3 RT-PCR detection was assessed by the lack of KIR2DL3 transcripts in NKL (Fig. 4GoC, upper panel). Consistent with the results obtained in T cells, the level of KIR2DL3 transcripts is much higher in the CD158b+ NK3.3 cells, than in the CD158- NK92 cells (Fig. 4GoC, lower panel).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Two groups of cell surface receptors have been identified in NK and T cell subsets, which define a repertoire of MHC class I recognition. Ig-like molecules include KIR and LIR/ILT molecules, whereas C-type lectins include CD94/NKG2 heterodimers in humans as well as CD94/NKG2 heterodimers and Ly-49 homodimers in the mouse (5, 6). The shaping of this MHC class I repertoire appears to differ between lectin-like and Ig-like molecules. Indeed the cell surface expression of murine Ly-49 is influenced by the level of expression of cognate MHC class I molecules (40, 41), whereas KIR cell surface expression does not seem to be directly affected by the nature or expression levels of HLA class I molecules (14, 42). Besides, activation of CD94/NKG2 gene transcription and/or cell surface export of intracytoplasmic CD94/NKG2 heterodimers can be induced on developing and mature lymphoid cells after short-term in vitro culture in the presence of IL-15 (27). By contrast, all attempts to induce KIR in vitro on mature T or NK cells have failed so far. These results, which confirm that expression of KIRs and NKR homologous to C-type lectin is regulated through distinct pathways (43), have left open the issues as to when and how KIR are induced. The absence of both KIR transcripts (data not shown) and proteins (44) in thymocytes, and by contrast their selective expression on fully differentiated NK cells (45) and Ag-experienced T cells (26), suggests late KIR induction during lymphoid cell development. Along this line the existence of KIR+ and KIR- T cell clones sharing identical productive and nonproductive TCR transcripts formally proves that induction/modulation of KIR expression occurs after termination of TCR rearrangements. In line with previous studies (25, 27, 28), the KIR phenotype of our T cell clones was highly stable (i.e., they remained KIR+ or KIR- irrespective of their activation status (data not shown)), thus strongly suggesting that KIR induction occurred in vivo and not during the process of synovial T cell line generation. Cytokines are probably involved in KIR cell surface expression, as suggested by the in vitro induction of KIR on developing CD34+ hematopoietic progenitor cells upon treatment with Flt-3 ligand and IL-15 (46). However, whether the same factors will be required to induce KIR on precursor and mature lymphoid cells remains open. In this regard, preliminary experiments failed to demonstrate any effect on KIR expression by T cell clones of exogenously added IL-15, either alone or in combination with IL-2 (M.-A.P. and M.B., unpublished observations).

KIR expression on T cells has been mainly described on CD8+ memory T cells (26). KIR engagement by autologous MHC class I molecules can regulate in vitro CD3/TCR-mediated cytotoxicity and cytokine production suggesting a role of KIR in the control of T cell activation (22, 23, 25, 27, 43, 47, 48, 49). In a previous study, activation of KIR+ CTL clones following recognition of tumor Ags was shown to be abrogated by KIR (50). Interestingly, in our study, the inhibitory effect of KIR on TCR-mediated activation of {alpha}{beta} T cell clones was partial. The efficiency of KIR-mediated inhibition is likely affected by numerous parameters such as the avidity of TCR/ligand interactions and more generally the global avidity of the interactions between effector and target cells. Such factors may easily explain the differences observed between the two situations and are in line with recent data revealing unexpected complexity in the biological function of KIR on T cells (51, 52).

KIR belong to a multigenic and multiallelic family, and the polymorphism of KIR genes is still incompletely documented (37, 53). KIR genes are currently subdivided into inhibitory KIR (KIR2DL1, KIR2DL2, KIR2DL3, KIR2DL4, KIR3DL1, and KIR3DL2) and activating isoforms (KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, and KIR3DS). Eighteen distinct KIR genotypes have been previously documented (36). T cell clones derived from donor B shared the most common genotype corresponding to group 1 individuals described earlier (36), while cells from donor A harbored a newly described genotype (Table IIGo). Given the limited number of individuals analyzed thus far (36), these numbers are certainly underestimated and, therefore, it is not surprising to detect here new KIR genotypes such as the one displayed by cells from donor A.

A variable KIR transcription pattern from one NK clone to another, but a good matching between the presence of a given KIR transcript and its corresponding protein within a given clone, has been previously reported (36). These data suggested that the regulation of KIR expression only operated at a transcriptional, but not at a posttranscriptional, level. We confirm here the transcriptional regulation of the genes encoding for KIR-L and KIR-S proteins in both T and NK cells. But, in addition, we found that KIR-L and KIR-S transcripts were frequently detected in T cell clones and in one NK cell line in the absence of the corresponding protein, revealing that RT-PCR data that document KIR transcription pattern should be interpreted with caution. This discrepancy between KIR-L/KIR-S gene transcription and protein expression could be explained by transient KIR modulation (e.g., following receptor cross-linking). However, we failed to detect any intracellular KIR within permeabilized cells, in addition to those already detected on the surface (Table IIIGo). Furthermore, kinetic analysis of KIR surface phenotype and transcripts in T cell clones at various time points after antigenic activation demonstrated stable transcription and surface expression of KIR, irrespective of the T cell clone activation status (data not shown). In addition, we have shown that the level of KIR-L and KIR-S transcripts are positively correlated to the cell surface expression of the corresponding KIR protein.

Thus, although the factors that induce KIR gene transcription are still unknown, our data show that the regulation of KIR expression occurs in T cells after termination of TCR rearrangements, that a threshold of KIR-L and KIR-S transcripts must be reached to achieve efficient T and NK cell surface expression of the KIR proteins at the cell surface, and that the transcriptional and posttranscriptional pathways that regulates KIR genes expression in T and NK cells are at least in part shared between KIR-L and KIR-S.


    Acknowledgments
 
We thank Dr. Miguel Lopez-Botet (Hospital de la Princesa, Madrid, Spain) and Dr. Nicolaï Wagtmann (Novo, Nordisk, Denmark) for providing Abs and BAC, respectively.


    Footnotes
 
1 This work was supported in part by the Association pour la Recherche sur le Cancer by institutional grants from Institut National de la Santé et de la Recherche Médicale and by ZENECA (to F.V.). Back

2 F.V., M.-A.P., and C.C. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Marc Bonneville, Institut National de la Santé et de la Recherche Médicale, Unité 463, Institut de Biologie, 9 quai Moncousu, 44035 Nantes Cedex 01, France. Back

4 Abbreviations used in this paper: KIR, killer-cell Ig-like receptor; BLC, B lymphoblastoid cell; RT, reverse transcription; LIR, leukocyte Ig-like receptor; ILT, Ig-like transcript; KIR-L, KIR-long; KIR-S, KIR-short. Back

Received for publication November 23, 1999. Accepted for publication December 1, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Raulet, D. H., W. Held. 1995. Natural killer cell receptors: the offs and ons of NK cell recognition. Cell 82:697.[Medline]
  2. Yokoyama, W. M.. 1998. Natural killer cell receptors. Curr. Opin. Immunol. 10:298.[Medline]
  3. Kärre, K., H. G. Ljunggren, G. Piontek, R. Kiessling. 1986. Selective rejection of H-2-deficient lymphoma variants suggests alternative immune defense strategy. Nature 319:675.[Medline]
  4. Moretta, A., C. Bottino, M. Vitale, D. Pende, R. Biassoni, M. C. Mingari, L. Moretta. 1996. Receptors for HLA-class-I molecules in human natural killer cells. Annu. Rev. Immunol. 14:619.[Medline]
  5. Lanier, L. L.. 1998. NK cell receptors. Annu. Rev. Immunol. 16:359.[Medline]
  6. Long, E. O.. 1999. Regulation of immune responses through inhibitory receptors. Annu. Rev. Immunol. 17:875.[Medline]
  7. Tomasello, E., M. Bléry, E. Vély, E. Vivier. 2000. Signaling pathways engaged by NK cell receptors: double concerto for activating receptors, inhibitory receptors and NK cells. Semin. Immunol. 12:139.[Medline]
  8. Braud, V. M., D. S. Allan, C. A. O’Callaghan, K. Soderstrom, A. D’Andrea, G. Ogg, S. Lazetic, N. T. Young, J. I. Bell, J. H. Phillips, et al 1998. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391:795.[Medline]
  9. Lee, N., M. Llano, M. Carretero, A. Ishitani, F. Navarro, M. Lopez-Botet, D. E. Geraghty. 1998. HLA-E is a major ligand for the natural killer inhibitory receptor CD94/NKG2A. Proc. Natl. Acad. Sci. USA 95:5199.[Abstract/Free Full Text]
  10. Bauer, S., V. Groh, J. Wu, A. Steinle, J. H. Phillips, L. L. Lanier, T. Spies. 1999. Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science 285:727.[Abstract/Free Full Text]
  11. Wagtmann, N., S. Rajogopalan, C. C. Winter, M. Peruzzi, E. O. Long. 1995. Killer cell inhibitory receptors specific for HLA-C and HLA-B identified by direct binding and by functional transfer. Immunity 3:801.[Medline]
  12. Litwin, V., J. Gumperz, P. Parham, J. H. Philips, L. L. Lanier. 1994. NKB1: an NK cell receptor involved in the recognition of HLA-B. J. Exp. Med. 180:537.[Abstract/Free Full Text]
  13. Gumperz, J. E., V. Litwin, J. H. Phillips, L. L. Lanier, P. Parham. 1995. The Bw4 public epitope of HLA-B molecules confers reactivity with natural killer cell clones that express NKB-1, a putative HLA receptor. J. Exp. Med. 181:1133.[Abstract/Free Full Text]
  14. Gumperz, J. E., N. M. Valiante, P. Parham, L. L. Lanier, D. Tyan. 1996. Heterogeneous phenotypes of expression of the NKB1 natural killer cell class I receptor among individuals of different human histocompatibility leukocyte antigens types appear genetically regulated, but not linked to major histocompatibility complex haplotype. J. Exp. Med. 183:1817.[Abstract/Free Full Text]
  15. Lanier, L. L., J. E. Gumperz, P. Parham, I. Melero, M. Lopez-Botet, J. H. Phillips. 1995. The NKB1 and HP-3E4 NK cell receptors are structurally distinct glycoproteins and independently recognize polymorphic HLA-B and HLA-C molecules. J. Immunol. 154:3320.[Abstract]
  16. Döhring, C., D. Scheidegger, J. Samaridis, M. Cella, M. Colonna. 1996. A human killer inhibitory receptor specific for HLA-A. J. Immunol. 156:3098.[Abstract]
  17. Pende, D., R. Biassoni, C. Cantoni, S. Verdiani, M. Falco, C. Di Donato, L. Accame, C. Bottino, A. Morreta, L. Moretta. 1996. The natural killer cell receptor specific for HLA-A allotypes: a novel member of the p58/p70 family of inhibitory receptors which is characterized by three Ig-like domains and is expressed as a 140kD disulphide-linked dimer. J. Exp. Med. 184:505.[Abstract/Free Full Text]
  18. Colonna, M., F. Navarro, T. Bellon, M. Liano, P. Garcia, J. Samaridis, L. Angman, M. Cella, M. Lopez-Botet. 1997. A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J. Exp. Med. 186:1809.[Abstract/Free Full Text]
  19. Cosman, D., N. Fanger, L. Borges, M. Kubin, W. Chin, L. Peterson, M.-L. Hsu. 1997. A novel immunoglobulin superfamily receptor for cellular and viral MHC class I molecule. Immunity 7:273.[Medline]
  20. Wagtmann, N., S. Rojo, E. Eichler, H. Mohrenweiser, E. O. Long. 1997. A new human gene complex encoding the killer cell inhibitory receptors and related monocyte/macrophage receptors. Curr. Biol. 7:615.[Medline]
  21. Navarro, F., M. Llano, T. Bellon, M. Colonna, D. E. Geraghty, M. Lopez-Botet. 1999. The ILT2(LIR1) and CD94/NKG2A NK cell receptors respectively recognize HLA-G1 and HLA-E molecules co-expressed on target cells. Eur. J. Immunol. 29:277.[Medline]
  22. Mingari, M. C., C. Vitale, A. Cambiaggi, F. Schiavetti, G. Melioli, S. Ferrini, A. Poggi. 1995. Cytolytic T lymphocytes displaying natural killer (NK)-like activity: expression of NK-related functional receptors for HLA class I molecules (p58 and CD94) and inhibitory effect on the TCR-mediated target cell lysis or lymphokine production. Int. Immunol. 7:697.[Abstract/Free Full Text]
  23. Phillips, J. H., J. E. Gumperz, P. Parham, L. L. Lanier. 1995. Superantigen-dependant, cell-mediated cytotoxicity inhibited by MHC class I receptors on T lymphocytes. Science 268:403.[Abstract/Free Full Text]
  24. Aramburu, J., M. A. Balboa, A. Ramìrez, A. Silva, F. Acevedo, F. Sanchez-Madrid, M. O. De Landàzuri, M. Lòpez-Botet. 1990. A novel functional cell surface dimer (Kp43) expressed by natural killer cells and T cell receptor-{gamma}/{delta}+ lymphocytes. I. Inhibition of the IL-2 dependent proliferation by anti-Kp43 monoclonal antibody. J. Immunol. 144:3228.[Abstract]
  25. Halary, F., M.-A. Peyrat, E. Champagne, M. Lopez-Botet, A. Moretta, L. Moretta, H. Vié, J.-J. Fournié, M. Bonneville. 1997. Control of self-reactive cytotoxic T lymphocytes expressing {gamma}{delta} T cell receptors by natural killer inhibitory receptors. Eur. J. Immunol. 27:2812.[Medline]
  26. Mingari, M. C., F. Schiavetti, M. Ponte, C. Vitale, E. Maggi, S. Romagnani, J. Demarest, G. Pantaleo, A. S. Fauci, L. Moretta. 1996. Human CD8+ T lymphocyte subsets that express HLA class I-specific inhibitory receptors represent oligoclonally or monoclonally expanded cell populations. Proc. Natl. Acad. Sci. USA 93:12433.[Abstract/Free Full Text]
  27. Mingari, M. C., M. Ponte, S. Bertone, F. Schiavetti, C. Vitale, R. Bellomo, A. Moretta, L. Moretta. 1998. HLA class I-specific inhibitory receptors in human T lymphocytes: interleukin 15-induced expression of CD94/NKG2A in superantigen- or alloantigen-activated CD8+ T cells. Proc. Natl. Acad. Sci. USA 95:1172.[Abstract/Free Full Text]
  28. Bertone, S., F. Schiavetti, R. Bellomo, C. Vitale, M. Ponte, L. Moretta, M. C. Mingari. 1999. Transforming growth factor-{beta}-induced expression of CD94/NKG2A inhibitory receptors in human T lymphocytes. Eur. J. Immunol. 29:23.[Medline]
  29. Scotet, E., M. A. Peyrat, A. X. Saulquin, C. Retiere, C. Couedel, F. Davodeau, N. Dulphy, A. Toubert, J. D. Bignon, A. Lim, et al 1999. Frequent enrichment for CD8 T cells reactive against common herpes viruses in chronic inflammatory lesions: towards a reassessment of the physiopathological significance of T cell clonal expansions found in autoimmune inflammatory processes. Eur. J. Immunol. 29:973.[Medline]
  30. David-Ameline, J., A. Lim, F. Davodeau, M. A. Peyrat, J. M. Berthelot, G. Semana, C. Pannetier, J. Gaschet, H. Vie, J. Even, M. Bonneville. 1996. Selection of T cells reactive against autologous B lymphoblastoid cells during chronic rheumatoid arthritis. J. Immunol. 157:4697.[Abstract]
  31. Davodeau, F., M. A. Peyrat, M. M. Hallet, J. Gaschet, I. Houde, R. Vivien, H. Vie, M. Bonneville. 1993. Close correlation between Daudi and mycobacterial antigen recognition by human {gamma}{delta} T cells and expression of V9JPC1 {gamma}/V2DJC {delta}-encoded T cell receptors. J. Immunol. 151:1214.[Abstract]
  32. Couedel, C., M. Bodinier, M. A. Peyrat, M. Bonneville, F. Davodeau, F. Lang. 1999. Selection and long-term persistence of reactive CTL clones during an EBV chronic response are determined by avidity, CD8 variable contribution compensating for differences in TCR affinities. J. Immunol. 162:6351.[Abstract/Free Full Text]
  33. Davodeau, F., M. A. Peyrat, F. Romagne, A. Necker, M. M. Hallet, H. Vie, M. Bonneville. 1995. Dual T cell receptor {beta} chain expression on human T lymphocytes. J. Exp. Med. 181:1391.[Abstract/Free Full Text]
  34. Brichard, V., A. Van Pel, T. Wolfel, C. Wolfel, E. De Plaen, B. Lethe, P. Coulie, T. Boon. 1993. The tyrosinase gene codes for an antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J. Exp. Med. 178:489.[Abstract/Free Full Text]
  35. Espevik, T., J. Nissen-Meyer. 1986. A highly sensitive cell line, WEHI 164 clone 13, for measuring cytotoxic factor/tumor necrosis factor from human monocytes. J. Immunol. Methods 95:99.[Medline]
  36. Uhrberg, M., N. M. Valiante, B. P. Shum, H. G. Shilling, K. Lienert-Weidenbach, B. Corliss, D. Tyan, L. L. Lanier, P. Parham. 1997. Human diversity in killer cell inhibitory receptor genes. Immunity 7:753.[Medline]
  37. Valiante, N. M., M. Uhrberg, H. G. Shilling, K. Lienert-Weidenbach, K. L. Arnett, A. D’Andrea, J. H. Phillips, L. L. Lanier, P. Parham. 1997. Functionally and structurally distinct NK cell receptor repertories in the peripheral blood of two human donors. Immunity 7:739.[Medline]
  38. Mingari, M. C., A. Moretta, L. Moretta. 1998. Regulation of KIR expression in human T cells: a safety mechanism that may impair protective T-cell responses. Immunol. Today 19:153.[Medline]
  39. Scotet, E., J. David-Ameline, M. A. Peyrat, A. Moreau-Aubry, D. Pinczon, A. Lim, J. Even, G. Semana, J. M. Berthelot, R. Breathnach, et al 1996. T cell response to Epstein-Barr virus transactivators in chronic rheumatoid arthritis. J. Exp. Med. 184:1791.[Abstract/Free Full Text]
  40. Raulet, D. H., W. Held, I. Correa, J. R. Dorfman, M. F. Wu, L. Corral. 1997. Specificity, tolerance and developmental regulation of natural killer cells defined by expression of class I-specific Ly49 receptors. Immunol. Rev. 155:41.[Medline]
  41. Höglund, P., J. Sundback, M. Y. Olsson-Alheim, M. Johansson, M. Salcedo, H.-G. C. Öhlen, C. L. Sentman Ljunggren, K. Kärre. 1997. Host MHC class I gene control of NK-cell specificity on the mouse. Immunol. Rev. 155:11.[Medline]
  42. Cambiaggi, A., C. Verthuy, P. Naquet, F. Romagne, P. Ferrier, R. Biassoni, A. Moretta, L. Moretta, E. Vivier. 1997. Natural killer cell acceptance of H-2 mismatch bone marrow grafts in transgenic mice expressing HLA-Cw3 specific killer cell inhibitory receptor. Proc. Natl. Acad. Sci. USA 94:8088.[Abstract/Free Full Text]
  43. Andre, P., C. Brunet, S. Guia, H. Gallais, J. Sampol, E. Vivier, F. Dignat-George. 1999. Differential regulation of killer cell Ig-like receptors and CD94 lectin-like dimers on NK and T lymphocytes from HIV-1-infected individuals. Eur. J. Immunol. 29:1076.[Medline]
  44. Mingari, M. C., M. Ponte, C. Cantoni, C. Vitale, F. Schiavetti, S. Bertone, R. Bellomo, A. Tradori Cappai, R. Biassoni. 1997. HLA-class I-specific inhibitory receptors in human cytolytic T lymphocytes: molecular characterization, distribution in lymphoid tissues and co-expression by individual T cells. Int. Immunol. 9:485.[Abstract/Free Full Text]
  45. Andre, P., O. Spertini, S. Guia, P. Rihet, F. Dignat-George, H. Brailly, J. Sampol, P. J. Anderson, E. Vivier. 2000. Modification of P-selectin glycoprotein ligand-1 with a natural killer cell-restricted sulfated lactosamine creates an alternate ligand for L-selectin. Proc. Natl. Acad. Sci. USA 97:3400.[Abstract/Free Full Text]
  46. Yu, H., T. A. Fehniger, P. Fuchshuber, K. S. Thiel, E. Vivier, W. E. Carson, M. A. Caligiuri. 1998. Flt3 ligand promotes the generation of a distinct CD3+ human natural killer cell progenitor that responds to interleukin-15. Blood. 92:3647.[Abstract/Free Full Text]
  47. Ferrini, S., A. Cambiaggi, R. Meazza, S. Sforzini, S. Marciano, M. C. Mingari, L. Moretta. 1994. T cell clones expressing the natural killer cell-related p58 receptor molecule display heterogeneity in phenotypic properties and p58 function. Eur. J. Immunol. 24:2294.[Medline]
  48. Battistini, L., G. Borsellino, G. Sawicki, F. Poccia, M. Salvetti, G. Ristori, C. F. Brosnan. 1997. Phenotypic and cytokine analysis of human peripheral blood {gamma}{delta} T cells expressing NK cell receptors. J. Immunol. 159:3723.[Abstract]
  49. Bakker, A. B., J. H. Phillips, C. G. Figdor, L. L. Lanier. 1998. Killer cell inhibitory receptors for MHC class I molecules regulate lysis of melanoma cells mediated by NK cells, {gamma}{delta} T cells, and antigen-specific CTL. J. Immunol. 160:5239.[Abstract/Free Full Text]
  50. Ikeda, H., B. Lethé, F. Lehmann, N. Van Baren, J.-F. Baurain, C. De Smet, H. Chambost, M. Vitale, A. Moretta, T. Boon, P. G. Coulie. 1997. Characterization of an antigen that is recognized on a melanoma showing partial HLA loss by CTL expressing an NK inhibitory receptor. Immunity 6:199.[Medline]
  51. Cambiaggi, A., S. Darche, S. Guia, P. Kourilsky, J.-P. Abastado, E. Vivier. 1999. Modulation of T-cell functions in KIR2DL3 (CD158b) transgenic mice. Blood 94:2396.[Abstract/Free Full Text]
  52. Ugolini, S., E. Vivier. 2000. Regulation of T cell function by NK cell receptors for classical MHC class I molecules. Curr. Opin. Immunol. 12:295.[Medline]
  53. Wilson, M. J., M. Torkar, A. Haude, S. Milne, T. Jones, D. Sheer, S. Beck, J. Trowsdale. 2000. Plasticity in the organization and sequences of human KIR/ILT gene families. Proc. Natl. Acad. Sci. USA 97:4778.[Abstract/Free Full Text]
  54. WHO-IUIS nomenclature sub-committee on TCR designation. 1995. Nomenclature for T-cell receptor (TCR) gene segments of the immune system. Immunogenetics. 42:451.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
L. T. van der Veken, M. Diez Campelo, M. A. W. G. van der Hoorn, R. S. Hagedoorn, H. M. E. van Egmond, J. van Bergen, R. Willemze, J. H. F. Falkenburg, and M. H. M. Heemskerk
Functional Analysis of Killer Ig-Like Receptor-Expressing Cytomegalovirus-Specific CD8+ T Cells
J. Immunol., January 1, 2009; 182(1): 92 - 101.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S. V. Goverdhan, S. I. Khakoo, H. Gaston, X. Chen, and A. J. Lotery
Age-Related Macular Degeneration Is Associated with the HLA-Cw*0701 Genotype and the Natural Killer Cell Receptor AA Haplotype
Invest. Ophthalmol. Vis. Sci., November 1, 2008; 49(11): 5077 - 5082.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. Li, C. M. Weyand, and J. J. Goronzy
Epigenetic mechanisms of age-dependent KIR2DL4 expression in T cells
J. Leukoc. Biol., September 1, 2008; 84(3): 824 - 834.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Patterson, A. Chaidos, D. C. A. Neville, A. Poggi, T. D. Butters, I. A. G. Roberts, and A. Karadimitris
Human Invariant NKT Cells Display Alloreactivity Instructed by Invariant TCR-CD1d Interaction and Killer Ig Receptors
J. Immunol., September 1, 2008; 181(5): 3268 - 3276.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Pascal, E. Yamada, M. P. Martin, G. Alter, M. Altfeld, J. A. Metcalf, M. W. Baseler, J. W. Adelsberger, M. Carrington, S. K. Anderson, et al.
Detection of KIR3DS1 on the Cell Surface of Peripheral Blood NK Cells Facilitates Identification of a Novel Null Allele and Assessment of KIR3DS1 Expression during HIV-1 Infection
J. Immunol., August 1, 2007; 179(3): 1625 - 1633.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. S. Warren, P. M. Rana, D. T. Rieger, K. A. Hewitt, J. E. Dahlstrom, and A. L. Kent
CD8 T cells expressing killer Ig-like receptors and NKG2A are present in cord blood and express a more naive phenotype than their counterparts in adult blood
J. Leukoc. Biol., June 1, 2006; 79(6): 1252 - 1259.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Ortonne, D. Huet, C. Gaudez, A. Marie-Cardine, V. Schiavon, M. Bagot, P. Musette, and A. Bensussan
Significance of circulating T-cell clones in Sezary syndrome
Blood, May 15, 2006; 107(10): 4030 - 4038.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Xu, A. N. Vallejo, Y. Jiang, C. M. Weyand, and J. J. Goronzy
Distinct Transcriptional Control Mechanisms of Killer Immunoglobulin-like Receptors in Natural Killer (NK) and in T Cells
J. Biol. Chem., June 24, 2005; 280(25): 24277 - 24285.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Anfossi, J.-M. Doisne, M.-A. Peyrat, S. Ugolini, O. Bonnaud, D. Bossy, V. Pitard, P. Merville, J.-F. Moreau, J.-F. Delfraissy, et al.
Coordinated Expression of Ig-Like Inhibitory MHC Class I Receptors and Acquisition of Cytotoxic Function in Human CD8+ T Cells
J. Immunol., December 15, 2004; 173(12): 7223 - 7229.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. van Bergen, A. Thompson, A. van der Slik, T. H. M. Ottenhoff, J. Gussekloo, and F. Koning
Phenotypic and Functional Characterization of CD4 T Cells Expressing Killer Ig-Like Receptors
J. Immunol., December 1, 2004; 173(11): 6719 - 6726.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. R. Snyder, T. Nakajima, P. J. Leibson, C. M. Weyand, and J. J. Goronzy
Stimulatory Killer Ig-Like Receptors Modulate T Cell Activation through DAP12-Dependent and DAP12-Independent Mechanisms
J. Immunol., September 15, 2004; 173(6): 3725 - 3731.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. D. Peacock and R. M. Welsh
Origin and Fate of Lymphocytic Choriomeningitis Virus-Specific CD8+ T Cells Coexpressing the Inhibitory NK Cell Receptor Ly49G2
J. Immunol., July 1, 2004; 173(1): 478 - 484.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. K. Epling-Burnette, J. S. Painter, P. Chaurasia, F. Bai, S. Wei, J. Y. Djeu, and T. P. Loughran Jr
Dysregulated NK receptor expression in patients with lymphoproliferative disease of granular lymphocytes
Blood, May 1, 2004; 103(9): 3431 - 3439.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. A. Stewart, J. van Bergen, and J. Trowsdale
Different and Divergent Regulation of the KIR2DL4 and KIR3DL1 Promoters
J. Immunol., June 15, 2003; 170(12): 6073 - 6081.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. R. Snyder, M. Lucas, E. Vivier, C. M. Weyand, and J. J. Goronzy
Selective Activation of the c-Jun NH2-terminal Protein Kinase Signaling Pathway by Stimulatory KIR in the Absence of KARAP/DAP12 in CD4+ T Cells
J. Exp. Med., February 17, 2003; 197(4): 437 - 449.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Hummel, D. Wilms, M. Vitacolonna, and M. Zoller
Donor T cell and host NK depletion improve the therapeutic efficacy of allogeneic bone marrow cell reconstitution in the nonmyeloablatively conditioned tumor-bearing host
J. Leukoc. Biol., November 1, 2002; 72(5): 898 - 912.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. C. Hsu, X.-R. Liu, A. Selvakumar, E. Mickelson, R. J. O'Reilly, and B. Dupont
Killer Ig-Like Receptor Haplotype Analysis by Gene Content: Evidence for Genomic Diversity with a Minimum of Six Basic Framework Haplotypes, Each with Multiple Subsets
J. Immunol., November 1, 2002; 169(9): 5118 - 5129.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Romagnani, G. Pietra, M. Falco, E. Millo, P. Mazzarino, R. Biassoni, A. Moretta, L. Moretta, and M. C. Mingari
Identification of HLA-E-specific alloreactive T lymphocytes: A cell subset that undergoes preferential expansion in mixed lymphocyte culture and displays a broad cytolytic activity against allogeneic cells
PNAS, August 20, 2002; 99(17): 11328 - 11333.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
N. Dulphy, C. Rabian, C. Douay, O. Flinois, S. Laoussadi, J. Kuipers, R. Tamouza, D. Charron, and A. Toubert
Functional modulation of expanded CD8+ synovial fluid T cells by NK cell receptor expression in HLA-B27-associated reactive arthritis
Int. Immunol., May 1, 2002; 14(5): 471 - 479.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. R. Snyder, L.-O. Muegge, C. Offord, W. M. O'Fallon, Z. Bajzer, C. M. Weyand, and J. J. Goronzy
Formation of the Killer Ig-Like Receptor Repertoire on CD4+CD28null T Cells
J. Immunol., April 15, 2002; 168(8): 3839 - 3846.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. G. Shilling, L. A. Guethlein, N. W. Cheng, C. M. Gardiner, R. Rodriguez, D. Tyan, and P. Parham
Allelic Polymorphism Synergizes with Variable Gene Content to Individualize Human KIR Genotype
J. Immunol., March 1, 2002; 168(5): 2307 - 2315.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vely, F.
Right arrow Articles by Bonneville, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vely, F.
Right arrow Articles by Bonneville, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS