|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


*
Medical Policlinic, University of Munich, Munich, Germany; and
Institute for Animal Physiology, University of Munich, Munich, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
(1), macrophage-inflammatory protein 1
, and monocyte
chemotactic protein 2 (1, 2). Chemokines act in concert
with adhesion molecules to induce the extravasation of leukocytes and
to direct their migration to sites of tissue injury (3).
In a variety of chronic inflammatory diseases, an impressive
accumulation of CCR5-positive T cells and macrophages is found at the
site of inflammation. An accumulation of CCR5+
cells has been demonstrated in several types of arthritis (4, 5), inflammatory renal diseases including transplant rejection
(6, 7), multiple sclerosis (8, 9), and
inflammatory bowel diseases (10). In contrast, in the
peripheral blood of these patients only a minority of T cells and
monocytes express CCR5. Therefore, CCR5 appears to be an excellent
marker to identify leukocytes that are involved in chronic
inflammation. The occurrence of a 32-bp deletion in the CCR5 gene that
prevents expression of CCR5 (11) allows study of the
pathophysiological role of CCR5 in chronic inflammatory diseases. In
patients with rheumatoid arthritis, the frequency of CCR5-deficient
(CCR5-
32/
32)2
(5) individuals is significantly reduced
(12). Moreover, the mean survival of kidney transplants is
significantly longer in CCR5-
32/
32 patients (D.
Schlöndorff, personal communication). These results make CCR5
look like a promising target for therapeutic intervention. Furthermore,
the predominance of CCR5-positive leukocytes in the diseased tissue in
contrast to its rare expression on peripheral blood leukocytes suggests
that a specific elimination of CCR5-positive leukocytes may be
therapeutically useful by reducing the number of infiltrating cells in
chronic inflammation without significantly depleting peripheral blood
leukocytes. Eliminating CCR5-positive leukocytes from the inflammatory
infiltrate should be of greater therapeutic benefit than simply
blocking chemokine receptors of these cells, as they have already
infiltrated the tissue.
Besides its role in inflammation, CCR5 is the primary coreceptor for
M-tropic HIV-1 strains that predominate early in the course of an
infection (13, 14). Transmission of HIV-1 depends on the
presence of CCR5, as individuals with a homozygous
32 deletion of
the CCR5 allele are highly resistant against infection with HIV-1
(11). Although antiretroviral therapy can efficiently
suppress replication of HIV-1, complete eradication of HIV has not been
achieved to date. The main obstacle appears to be the inactivity of
antiretroviral therapy against latently infected cells that can survive
for several years and function as an endogenous source for HIV-1
(15). Many of these cells fail to express viral proteins
and can evade the immune response. However, the majority of latently
infected cells may still express CCR5, as this receptor was necessary
for their initial infection. We therefore propose that depletion of
CCR5-positive cells should significantly reduce the number of latently
infected cells in HIV-1 infection. Other strategies to eliminate
HIV-1-infected cells that depend on a specific recognition of viral
proteins, e.g., surface-expressed gp120 (16), would be
less effective against latently infected cells.
To test these possibilities, we designed two strategies to destroy
CCR5-positive cells. First, we constructed a bispecific single-chain Ab
that binds with one arm to CCR5 and with the other arm to CD3 expressed
on T lymphocytes. Thereby the bispecific Ab induces a close contact
between CCR5-positive target cells and CD3-positive T cells.
Cross-linkage of CD3 by the Ab triggers the cytotoxic activity of T
lymphocytes and leads to lysis of CCR5-positive cells (Fig. 1
). Bispecific Abs were originally
developed for oncological therapy to redirect cytotoxic T cells against
malignant cells (17). Various types of bispecific Abs have
been described so far. Although the chemical cross-linkage of two mAbs
and the hybrid-hybridoma technology (18) is hampered by
ill-defined protein aggregates and low yields, diabodies and bispecific
single-chain Abs have overcome these problems (19, 20, 21, 22, 23). In
1995, we described functional expression of bispecific single-chain Abs
in Chinese hamster ovary (CHO) (3) cells (20, 24). These Abs are composed of two single-chain Fv fragments
that are joined by a flexible linker consisting of glycine and serine
molecules. We now propose a new application for bispecific Abs, namely,
elimination of infiltrating leukocytes in chronic inflammation. The
CCR5-CD3-bispecific Ab would specifically deplete CCR5-positive cells
and reduce considerably the number of cells that infiltrate inflamed
tissue. T cells and monocytes that are not involved in the inflammation
would largely remain unaffected because they rarely express
CCR5.
|
2-macroglobulin receptor and is therefore
toxic to most eukaryotic cells (27). To overcome this
problem, the first domain of Pseudomonas exotoxin A can be
replaced by a specific sequence to alter the binding specificity of the
toxin (26). We investigated whether a chemokine can serve
as ligand sequence on the toxin, direct it to specific targets by
binding to the specific chemokine receptor, and induce uptake of the
toxin and lysis of chemokine receptor-positive cells. We considered
chemokines to efficiently mediate the uptake of the toxin as chemokine
receptors are rapidly internalized upon binding of chemokines
(28, 29). In this study, we show that in fact the
chemokine RANTES fused to PE38 binds to CCR5 and efficiently destroys
CCR5-positive target cells. Thus, both the bifunctional CD3-CCR5 Abs
and the RANTES-Pseudomonas A toxin constructs are promising
candidates as therapeutic agents. | Materials and Methods |
|---|
|
|
|---|
PBMC were isolated from buffy coats or full blood of healthy
donors by Ficoll density gradient centrifugation. Where indicated, PBMC
were used from donors with a homozygous 32-bp deletion in the CCR5
allele (CCR5-
32/
32) preventing surface expression of CCR5.
Synovial fluid of patients with arthritis was obtained from diagnostic
or therapeutic arthrocentesis and used for the experiments without
further preparation. Informed consent was obtained from all
patients.
CHO cells were stably transfected with CCR5 or CXC chemokine receptor (CXCR) 4 as described previously (28).
Construction and expression of the bispecific single-chain Ab anti-CCR5-anti-CD3
The light (VL) and heavy (VH) variable domains from the anti-CCR5 hybridoma MC-1 were cloned using PCR amplification (30). Reverse transcription was conducted with random hexamer nucleotides and SuperScript reverse transcriptase (Life Technologies, Grand Island, NY). The variable domains were amplified by PCR with Pfu-polymerase, subcloned into the vector PCR-script Amp SK+ (Stratagene, La Jolla, CA), and sequenced. As described previously, the light and heavy variable domains were joined to a single-chain fragment using a (Gly4Ser1)3 linker and expressed in the periplasmic space of Escherichia coli to test binding of the recombinant protein to CCR5. Subsequently, the DNA sequence of the anti-CCR5 single-chain fragment was subcloned with BsrG1 and BspE1 into an eukaryotic expression vector (pEF-DHFR) that contained a single-chain fragment directed against CD3 with a C-terminally attached tail of six histidine residues (20). The anti-CCR5 and anti-CD3 single-chain fragments were joined by a linker coding for Gly4Ser1. The bispecific Ab was expressed in DHFR-deficient CHO cells and purified from the culture supernatant by affinity chromatography on immobilized Ni2+ ions (Ni-NTA; Qiagen, Chatsworth, CA).
Construction and expression of RANTES-PE38
A PCR fragment of RANTES, generated with the primers P1 and P2, was subcloned with StuI and SalI into a vector for periplasmic expression in E. coli (20). The restriction site StuI had previously been introduced at the 3' terminus of the OmpA signal sequence. The DNA of a truncated version of Pseudomonas exotoxin A (PE38), kindly provided by I. Pastan (26), was amplified by PCR with Pfu-polymerase using the primers P3 and P4 and subcloned with BspE1 and HindIII into the vector that already contained the cDNA of RANTES. Primer P4 also added a tail of 6 histidine residues at the 3' terminus of PE38. During the periplasmic expression, the OmpA signal sequence is cleaved off such that the recombinant protein starts with the first amino acid of RANTES. The C-terminally attached tail of six histidine residues allowed purification by affinity chromatography on Ni-NTA (Qiagen). List of primers is as follows: P1, 5'-AAAGGCCTCCCCATATTCCTCGGA; P2, 5'- AAAGTCGACTCCGGACATCTCCAAAGAGTTGATGTAC; P3, 5'-AATCCGGAGGCGGCAGCCTGGCCGC; and P4, 5'-GGGAAGCTTAGTGATGGTGATGGTGATGCTTCAGGTCCTCGCGCGG.
FACS analysis and Western blot
Binding of the bispecific single-chain Ab to CHO cells or PBMC was determined by FACS analysis. The cells were incubated with the bispecific Ab for 60 min on ice followed by an Ab against 6xHis (Dianova, Hamburg, Germany) and a PE-conjugated polyclonal rabbit anti-mouse F(ab')2 fragment (R439; Dako, Hamburg, Germany).
Western blots to detect the bispecific Ab or RANTES-PE38 were stained with the mAb against 6xHis (Dako) and a peroxidase-labeled polyclonal rabbit anti-mouse Ab (P260; Dako). Western blots to detect CCR5 in the cell-free supernatant were performed as previously described (31).
Down-modulation of chemokine receptors
PBMC were incubated for 30 min at 37°C with various concentrations of RANTES or RANTES-PE38 diluted in RPMI 1640 with 10% FCS in a volume of 100 µl. Medium alone was used as control. The cells were then stained on ice for surface CCR5 expression using the mAb MC-1 or medium as negative control followed by the PE-conjugated anti-mouse Ab R439. As shown previously, the presence of RANTES bound to CCR5 does not block the binding of MC-1 to CCR5 (28). The same could be demonstrated for RANTES-PE38. The FACS analysis was performed on a FACSCalibur (Becton Dickinson, Mountain View, CA) and CellQuest software. Lymphocytes and monocytes were distinguished by their forward and sideward light scatter properties and expression of CD14, CD4, and CD8. Relative surface CCR5 expression was calculated as [mean channel fluorescence (experimental) - mean channel fluorescence (negative control)]/[mean channel fluorescence (medium) - mean channel fluorescence (negative control)].
Depletion of cells with the bispecific anti-CCR5-anti-CD3 Ab and RANTES-PE38
PBMC from CCR5 wild-type or CCR5-deficient (
32/
32) donors
were incubated overnight to induce expression of CCR5 on monocytes.
Cultured PBMC or freshly drawn synovial fluid of patients with
arthritis were incubated with different concentrations of purified
anti-CCR5-anti-CD3-bispecific Abs or medium as control for 20 h.
No preactivation of effector T cells was performed. Surviving cells
were analyzed on a FACSCalibur and counted.
CHO cells expressing CCR5 or CXCR4 were grown to subconfluence on 24-well culture plates and incubated with different concentrations of purified RANTES-PE38 or medium as control. After 40 h, the adherent and nonadherent cells were recovered and analyzed by FACS to measure the percentage of dead cells. We have previously established that dead (propidium iodide-positive) CHO cells can be identified by their light scatter properties.
| Results |
|---|
|
|
|---|
As described in Materials and Methods, we amplified the
DNA sequences coding for the variable domains of the light
(VL) and heavy chain (VH)
of the CCR5-specific hybridoma MC-1 by RT-PCR. Subsequently, we
constructed a single-chain fragment by joining the
VL and VH sequences with a
linker coding for
(Gly4Ser1)3
and expressed it in the periplasmic space of E. coli to test
the binding activity of the construct. To obtain the bispecific
single-chain Ab, we joined the DNA sequence of the CCR5 Ab fragment to
an Ab fragment directed against CD3 using a linker coding for
Gly4Ser1. The bispecific
single-chain Ab was expressed in CHO cells and purified via a
C-terminally attached histidine tail with an overall purification yield
of
900 µg/L culture supernatant. SDS-PAGE showed a single band of
60 kDa under reducing and nonreducing conditions without any
detectable proteolysis or degradation of the protein (Fig. 2
).
|
Binding of the bispecific Ab to CD3-positive T cells was
demonstrated by FACS analysis (Fig. 3
).
As the bispecific Ab would also bind to CCR5, we performed the analysis
with PBMC that lack expression of CCR5 due to a homozygous 32-bp
deletion in the CCR5 alleles. The Ab showed good binding to T cells as
identified by costaining with Abs against CD4 and CD8 (Fig. 3
). In
addition, the bispecific Ab competed with the monoclonal CD3 Ab OKT-3
for binding to T cells (data not shown).
|
32/
32 deletion. Overnight cultivation of
monocytes induces expression of CCR5 on wild-type monocytes, while
monocytes from donors with a homozygous CCR5-
32/
32 deletion fail
to express CCR5. Moreover, the CCR5 signal detectable with the
bispecific Ab on cultured monocytes could be reduced to values
below 15% by preincubation of monocytes for 30 min at 37°C with
AOP-RANTES, a CCR5 ligand that is known to efficiently induce
internalization of CCR5 (data not shown) (28).
Preabsorption of the bispecific Ab on CCR5+ CHO
cells prevented subsequent binding to CD3 and preabsorption on
CCR5-deficient T cells almost completely abolished subsequent binding
to CCR5 (data not shown). This further indicates that both
specificities of the bispecific Ab are contained in the same
molecule.
|
To test the ability of the anti-CCR5-anti-CD3-bispecific
single-chain Ab to deplete CCR5-positive primary cells, we incubated
human PBMC with the bispecific Ab (Fig. 5
). Before incubation the PBMC were
cultured overnight to up-regulate CCR5 expression on monocytes
(28, 32). By retargeting cytotoxic T cells, the bispecific
Ab depleted the majority of monocytes within 20 h in a
concentration-dependent manner (Fig. 5
). In contrast to the bispecific
Ab, the monovalent single-chain Fv fragments directed against CCR5 and
CD3 used either alone or in combination were not able to deplete
CCR5-positive monocytes (data not shown). To verify that the depletion
of monocytes with the bispecific Ab was due to their expression of
CCR5, we performed the same experiment with PBMC from a donor with a
homozygous 32-bp deletion in the CCR5 allele that prevents surface
expression of CCR5. No depletion of CCR5-deficient monocytes occurred
after 20 h, indicating that the depletion of cells with the
bispecific Ab is restricted to monocytes that express CCR5 (Fig. 5
A). As further control, we preincubated PBMC with an excess
of the parental mAb MC-1 or a control Ab and then added the bispecific
Ab. Preincubation with MC-1 considerably reduced the depletion of
monocytes while the control Ab had no effect (data not shown).
|
The bispecific single-chain Ab could potentially be applied to
deplete CCR5-positive T cells and monocytes from the inflamed joints of
patients with arthritis. We therefore determined the depletion of
CCR5-positive cells from the synovial fluid of patients with various
types of arthritis. Before each depletion experiment, we confirmed by
FACS analysis that the majority of lymphocytes and monocytes in the
synovial samples express CCR5, whereas no expression of CCR5 was
detectable on granulocytes (data not shown). The synovial fluid was
incubated ex vivo with different concentrations of the bispecific Ab
immediately after arthrocentesis without prior preparation or washing
steps. Using freshly drawn synovial fluid, we aimed at testing the
efficacy and stability of the bispecific Ab under conditions resembling
most closely the situation in vivo. Within 20 h, the bispecific Ab
induced depletion of the majority of lymphocytes and monocytes from the
synovial fluid, while granulocytes that do not express CCR5 remained
unaffected (Fig. 6
).
|
As described in Materials and Methods, the DNA sequence
of RANTES was fused with the sequence of a truncated version of the
Pseudomonas exotoxin A (PE38) kindly provided by I. Pastan
(26). In a first version of the construct, a Gly-Ser
linker was spaced between RANTES and PE38. However, this resulted in a
considerable proteolytic degradation of the fusion protein during
expression in E. coli (data not shown). To stabilize the
construct, we removed the linker and the first three amino acids of
PE38. The new fusion protein showed no proteolysis during expression in
the periplasmic space of E. coli as demonstrated by SDS-PAGE
and Western blot (Fig. 7
).
|
The fusion of RANTES to the N terminus of a truncated version of
the Pseudomonas exotoxin A is supposed to result in specific
binding of the construct to cells expressing RANTES receptors such as
CCR5, CCR1, and CCR3. Internalization of the chemokine receptors upon
binding of the modified toxin would enhance the cellular uptake and
cytotoxic activity of the construct. We therefore analyzed whether
RANTES-PE38 is able to internalize CCR5 from the surface of primary
monocytes and T cells (Fig. 8
).
Internalization of CCR5 would indicate that the construct is able to
bind to CCR5 and that RANTES remains functionally active after fusion
to PE38. As shown in Fig. 8
, the construct is able to internalize CCR5
from the surface of monocytes and lymphocytes. Compared with unmodified
RANTES, the chemokine toxin was somewhat less effective in
down-modulating CCR5. To exclude the possibility that RANTES-PE38
increases the shedding of CCR5 from the cell surface and thereby
reduces surface expression of CCR5, we quantified by Western blot the
amount of CCR5 in the cell-free supernatant after incubation of
CCR5-positive CHO cells for 30 min at 37°C with unmodified RANTES,
RANTES-PE38, or medium alone. Compared with the medium
control, no increased shedding of CCR5 was detectable with either
RANTES or RANTES-PE38, indicating that the reduced surface expression
is due to internalization of CCR5.
|
|
| Discussion |
|---|
|
|
|---|
We present two possibilities to deplete CCR5-positive cells. First, we
describe a bispecific single-chain Ab that simultaneously binds to CCR5
and CD3 and thereby redirects T effector cells against CCR5-positive
target cells (Fig. 1
). A precondition for the efficacy of this
bispecific Ab is the presence of T effector cells. In rheumatoid
arthritis, T cells are enriched in the synovial fluid and tissue and
their percentage further increases with disease duration. Since most of
these T cells are CCR5 positive, they would deplete each other as shown
for the synovial fluids of patients with arthritis (Fig. 6
). Many of
the infiltrating T cells potentially recognize autoantigens and
therefore perpetuate the disease process. In chronic
glomerulonephritis, interstitial nephritis, and transplant rejection,
CCR5-positive T cells are abundantly present in areas of interstitial
infiltration and their number correlates with the degree of renal
insufficiency (6). Apart from T cells, CCR5 is expressed
by the majority of monocytes/macrophages within the inflamed tissue.
Monocytes/macrophages are responsible for destruction of inflamed
tissue. The depletion of infiltrating monocytes/macrophages may
therefore considerably reduce the tissue damage, e.g., joint
destruction in rheumatoid arthritis. Moreover, CCR5 is highly expressed
on dendritic cells (33) that are found in the synovial
fluid and synovial tissue in rheumatoid arthritis and are thought to
play a major role for initiation and perpetuation of the inflammatory
process (34).
A specific depletion of CCR5-positive cells appears to have several advantages over conventional immunosuppressive or immunomodulatory therapy: 1) Depletion of infiltrating cells would only take a couple of hours, while immunomodulatory agents usually need several weeks for their onset of action. 2) Conventional treatments only suppress the activity of infiltrating cells which leads to a rapid relapse after termination of the therapy. In contrast the bispecific Ab would eliminate the infiltrating cells and may therefore exert a prolonged benefit. 3) Elimination of CCR5-positive leukocytes is supposed to be well tolerated as CCR5-positive cells are enriched in the inflamed tissue and only rarely encountered in the peripheral blood. A local application of bispecific Abs, e.g., intra-articular injection in arthritis, would further reduce potential side effects.
Chemokine toxins significantly differ from bispecific Abs in their mechanism of depletion. Although bispecific Abs depend on T effector cells to deplete other cells, the mere binding and internalization of chemokine toxins is sufficient to induce cell death. Binding and internalization of chemokine toxins depends on the expression of appropriate chemokine receptors. In many cases, chemokines bind to more than one receptor, which would result in a more extensive destruction of cells. The chemokine toxin RANTES-PE38 binds to CCR5 and eliminates CCR5-positive CHO cells. However, we assume that the construct would also recognize and destroy CCR1- or CCR3-positive cells since RANTES also binds to these receptors (35). The main advantage of chemokine toxins is their ease of production, as the chemokine moiety can be rapidly exchanged by one cloning step. For most receptors, one would also be able to select a chemokine that only binds to one receptor. Chemokine toxins would therefore be an ideal tool to study depletion of selected subtypes of cells in various animal models of inflammation.
The expression of chemokine receptors on leukocytes is associated with certain types of an immune response. Recently, it was described that the receptors CCR5 and CXCR3 are primarily expressed on TH-1 cells, while CCR3, CCR4, and CCR8 are mainly found on TH-2 cells (36, 37, 38, 39). Depletion of chemokine receptor- positive cells may therefore induce an immune deviation from TH-2 to TH-1 or vice versa. Depletion of CCR3-positive cells may be of benefit in allergic diseases, as CCR3 is not only expressed on TH-2 cells but also on eosinophils and basophils (40, 41).
Apart from chronic inflammatory diseases, the depletion of CCR5-positive cells could also be useful for the treatment of HIV-1 infection to reduce the number of latently infected cells. Early in the course of an HIV infection, preferentially CCR5-positive cells are infected with HIV-1 (14). A small fraction of these cells, mainly CD4+ T cells, macrophages, and potentially dendritic cells, become latently infected and function as an endogenous source for HIV-1 (15). Latently infected cells can survive for several years and are thought to be responsible for the failure to completely eradicate HIV-1 despite prolonged highly active antiretroviral therapy. We therefore propose that depletion of CCR5+ cells would shorten the half-life of latently infected cells and could help to eradicate HIV-1 in combination with highly active antiretroviral therapy. Latently infected cells cannot be identified by surface expression of viral proteins, as little viral genes are expressed when the virus is dormant. CCR5 however would still be expressed on latently infected cells as it was necessary for initial infection.
Specific depletion of chemokine receptor-positive cells can be achieved with bispecific Abs and chemokine toxins and may represent a new strategy in the treatment of chronic inflammatory diseases and HIV-1.
| Footnotes |
|---|
2 Abbreviations used this paper: CCR5-
32/
32, homozygous 32-bp deletion in the CCR5 alleles; CHO, Chinese hamster ovary; PE38, truncated version of Pseudomonas exotoxin A; CXCR, CXC chemokine receptor. ![]()
Received for publication June 28, 2000. Accepted for publication December 5, 2000.
| References |
|---|
|
|
|---|
and IP-10 are expressed in demyelinating brain lesions. Proc. Natl. Acad. Sci. USA 96:6873.
2-macroglobulin receptor/low density lipoprotein receptor-related protein binds and internalizes Pseudomonas exotoxin A. J. Biol. Chem. 267:12420.This article has been cited by other articles:
![]() |
P. E. Kennedy, T. K. Bera, Q.-C. Wang, M. Gallo, W. Wagner, M. G. Lewis, E. A. Berger, and I. Pastan Anti-HIV-1 immunotoxin 3B3(Fv)-PE38: enhanced potency against clinical isolates in human PBMCs and macrophages, and negligible hepatotoxicity in macaques J. Leukoc. Biol., November 1, 2006; 80(5): 1175 - 1182. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dorr, M. Westby, S. Dobbs, P. Griffin, B. Irvine, M. Macartney, J. Mori, G. Rickett, C. Smith-Burchnell, C. Napier, et al. Maraviroc (UK-427,857), a Potent, Orally Bioavailable, and Selective Small-Molecule Inhibitor of Chemokine Receptor CCR5 with Broad-Spectrum Anti-Human Immunodeficiency Virus Type 1 Activity Antimicrob. Agents Chemother., November 1, 2005; 49(11): 4721 - 4732. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Stanford and T. B. Issekutz The relative activity of CXCR3 and CCR5 ligands in T lymphocyte migration: concordant and disparate activities in vitro and in vivo J. Leukoc. Biol., November 1, 2003; 74(5): 791 - 799. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |