|
|
||||||||
Department of Immunobiology, DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA 94304
| Abstract |
|---|
|
|
|---|
. In contrast, a synthetic dsRNA, polyinosinic
polycytidylic-acid, induced CD11c+ DC, but not pre-DC2 or
monocytes, to produce IFN-
. These data indicate that CpG DNA and
polyinosinic-polycytidylic acid stimulate different types of cells to
produce type I IFN and that it is important to select
oligodeoxynucleotides containing particular CpG motifs to induce
pre-DC2 to produce type I IFN, which may play a key role in the strong
adjuvant effects of CpG DNA. | Introduction |
|---|
|
|
|---|
Two classes of nucleic acids, namely 1) bacterial CpG DNA that contains immunostimulatory unmethylated CpG dinucleotides within specific flanking bases (referred to as CpG motifs) (4) and 2) dsRNA synthesized by various types of viruses (5), represent important members of the microbial components that enhance immune responses. Recent studies have shown that oligodeoxynucleotides (ODNs) containing CpG motifs (6, 7) and synthetic dsRNA, e.g., polyinosinic-polycytidylic acid (poly(I:C)) (8, 9), are capable of inducing DC to produce proinflammatory cytokines and to express high levels of costimulatory molecules.
A series of studies by Tokunaga and Yamamoto et al. has shown that
bacterial DNA or synthetic ODNs containing unique palindromic CpG
motifs induce human PBMC (10) and mouse spleen cells
(11) to produce type I IFN (IFN-
) (reviewed in Ref.
12). Poly(I:C) was originally synthesized as a potent
inducer of type I IFN (13, 14). Type I IFN plays an
essential role in antiviral innate immunity and is widely used to treat
viral hepatitis and various types of cancers (15). These
effects appear to be due to direct inhibition of viral replication in
infected cells and to the pleiotropic immunomodulating activity of type
I IFN (15), such as 1) enhancing the cytotoxicity of NK
cells and macrophages (15), 2) inducing T cell activation
(16), 3) maintaining the survival of activated T cells
(17), 4) stimulating human CD4+ T
cells to produce a Th1 cytokine IFN-
(18), and 5)
inducing the expression of TNF-related apoptosis-inducing ligand on T
cells and thereby enhancing T cell cytotoxicity (19).
Thus, CpG DNA and poly(I:C) are believed to be promising adjuvants for
vaccination against infections and cancers due to their DC-stimulating
and type I IFN-inducing capacity.
To understand the mechanisms underlying the induction of type I
IFN by CpG DNA and poly(I:C) and to increase their efficacy as
immunological adjuvants, it is important to determine which cells
produce type I IFN in response to CpG DNA and poly(I:C). Two groups
have recently shown that the main producers of type I IFN in human
blood, designated natural IFN-
-producing cells (IPC), are
identical with
CD4+IL-3R
highCD3-CD11c-
type 2 dendritic cell precursors (pre-DC2) (20, 21), which
differentiate into DC in response to IL-3 (22) or viruses
(23). Pre-DC2 IPC produce 1000 times more type I IFN than
do CD11c+ blood immature DC, monocytes, and
monocyte-derived DC in response to viral stimulation (20).
In this study we asked whether pre-DC2 will produce type I IFN in
response to CpG DNA and poly(I:C). We show that 1) pre-DC2, but not
CD11c+ DC or monocytes, produce type I IFN in
response to CpG ODNs containing particular palindromic sequences,
and that 2) CD11c+ DC, but not pre-DC2 or
monocytes, produce type I IFN in response to poly(I:C).
| Materials and Methods |
|---|
|
|
|---|
The following ODNs were purchased from Research Genetics (Huntsville, AL): 1668, TCCATGACGTTCCTGATGCT (6); 2117, T*CGT*CGTTTTGT*CGTTTTGT*CGTT (*C, methylated cytosine) (24); 2006, TCGTCGTTTTGTCGTTTTGTCGT (24); ACC-30, ACCGATACCGGTGCCGGTGACGGCACCACG (10); AAC-30, ACCGATAACGTTGCCGGTGACGGCACCACG (10); and GAC-30, ACCGATGACGTCGCCGGTGACGGCACCACG (10) (underlines indicate palindromic sequences). ODNs 1668, 2117, and 2006 are phosphorothioate forms, and ACC-30, AAC-30, and GAC-30 are phosphodiester forms. The phosphorothioate ODNs were added at 0 h at 0.1 µM (0.6 µg/ml) or 1 µM (6 µg/ml), and the phosphodiester ODNs were added at 0, 4, and 16 h, 5 µM (46 µg/ml) at each time point, to compensate for their degradation by DNase activity in medium.
Isolation and culture of cells
Monocytes, CD11c+ DC, and pre-DC2 were isolated from human peripheral blood as previously described (22, 23). The cells were cultured for 24 h in RPMI 1640 containing 10% FCS at 2 x 104/200 µl in round-bottom 96-well culture plates in the presence of ODNs or 50 µg/ml poly(I:C) (Sigma, St. Louis, MO). Adult dermal fibroblasts (Clonetics, Walkersville, MD) were maintained as recommended by the company and were stimulated with 50 µg/ml poly(I:C) for 24 h at 7.5 x 104/ml in 12-well culture plates.
Analysis of viability of pre-DC2 stimulated with ODNs or poly(I:C)
Pre-DC2 cultured for 24 h without stimulation or with ODNs or poly(I:C) were stained with propidium iodide and analyzed with a FACScan flow cytometer (Becton Dickinson, San Jose, CA). After cell debris was excluded by an appropriate forward scatter threshold, the percentages of propidium iodide-negative cells were calculated.
Flow cytometric analysis of the expression of CD80 and CD86
Freshly isolated pre-DC2 and pre-DC2 stimulated with ODNs for 24 h were stained with PE-conjugated anti-CD80 (L307.4; Becton Dickinson), PE-conjugated anti-CD86 (2331; PharMingen, San Diego, CA), or an isotype control Ab. CD11c+ DC cultured for 24 h without stimulation or with poly(I:C) were stained with FITC-conjugated anti-CD80 (L307.4), FITC-conjugated anti-CD86 (2331), or an isotype control Ab. The cells were analyzed with a FACScan flow cytometer. Dead cells were excluded by staining with propidium iodide.
Quantitation of cytokines by ELISA
An IFN-
ELISA kit, an IL-12 ELISA kit (BioSource
International, Camarillo, CA), and an IFN-
ELISA kit (FUJIREBIO,
Tokyo, Japan) were used to analyze cytokine production.
| Results |
|---|
|
|
|---|
Without any stimuli, the majority of pre-DC2 rapidly die within
24 h (22, 23) (Fig. 1
A). We first examined whether
different CpG ODNs and poly(I:C) prevent pre-DC2 from dying. We used
three types of CpG ODNs: 1) 2006, which up-regulates the expression of
costimulatory molecules on human blood DC (7) and B cells
(24); 2) AAC-30 and GAC-30, which have palindromic CpG
motifs and stimulate human PBMC (10) and mouse spleen
cells (11) to produce type I IFN; and 3) 1668, which
stimulates mouse DC to express high levels of costimulatory molecules
and to produce proinflammatory cytokines TNF-
, IL-6, and IL-12
(6).
|
The up-regulation of CD80 and CD86 expression on pre-DC2 is a hallmark
of their differentiation into DC (22, 23). Unmethylated
CpG ODN 2006 and methylated CpG ODN 2117 (1 µM) strongly up-regulated
the expression of CD80 and CD86 (Fig. 1
B). AAC-30 and GAC-30
also up-regulated CD80 and CD86, albeit to a lesser extent than 2006
and 2117 (Fig. 1
B).
Taken together, these data indicate that CpG ODNs containing appropriate sequences efficiently maintain the survival of pre-DC2 and induce them to differentiate into DC. In marked contrast, poly(I:C) does not stimulate pre-DC2 to survive and differentiate into DC.
Distinct CpG ODNs, but not poly(I:C), induce pre-DC2 to produce
IFN-
Next we examined whether CpG ODNs and poly(I:C) induce pre-DC2 to
produce IFN-
. Although 2006 strikingly up-regulated CD80 and CD86
(Fig. 1
B), this CpG ODN as well as 2117 and 1668 did not
induce pre-DC2 to produce detectable levels of IFN-
(Fig. 2
). In contrast, AAC-30 and GAC-30
induced pre-DC2 to produce large amounts of IFN-
(AAC-30 5081806
pg/ml; GAC-30 9311362 pg/ml; n = 3; Fig. 2
). ACC-30
induced pre-DC2 to produce much smaller amounts of IFN-
(18161
pg/ml; n = 3; Fig. 2
). None of the CpG ODNs used here
induced CD11c+ DC and monocytes to produce
detectable levels of IFN-
(data not shown). In line with the finding
that poly(I:C) did not maintain the survival of pre-DC2 (Fig. 1
A), this reagent did not induce pre-DC2 to produce a
detectable level of IFN-
(Table I
).
These data indicate that ODNs containing particular CpG motifs, but not
poly(I:C), induce pre-DC2 to produce IFN-
.
|
|

and IL-12 and to undergo maturation
Although poly(I:C) did not induce pre-DC2 to survive (Fig. 1
A) or to produce IFN-
(Table I
), this reagent has been
shown to induce human monocyte-derived DC to mature and to produce
IL-12 (8, 9). Thus, we asked whether poly(I:C) stimulates
CD11c+ myeloid DC (26) to produce
type I IFN and IL-12 and to undergo maturation. As shown in Table I
,
poly(I:C) induced CD11c+ DC, but not pre-DC2 or
monocytes, to produce small, but significant, amounts of IFN-
(24.197.9 pg/ml; n = 3), IFN-
(33.6166.5 pg/ml;
n = 3), and IL-12 (17.7137.7 pg/ml; n
= 4). Poly(I:C)-stimulated fibroblasts produced similar amounts of
IFN-
(28.648.5 pg/ml; n = 2; Table I
). Poly(I:C)
strongly up-regulated the expression of CD80 and CD86 on
CD11c+ DC during 24-h culture (Fig. 3
). Thus, poly(I:C) stimulates
CD11c+ myeloid DC, but not pre-DC2, to produce
type I IFN and IL-12 and to become mature DC.
|
| Discussion |
|---|
|
|
|---|
Hartmann et al. screened an extensive series of CpG ODNs to find those
with the highest immunostimulatory activity for human cells (24, 27). They and others found that CpG ODN 2006 most potently
activates human B cells (24), monocytes (25),
and DC (7). In line with these findings, 2006 induced
marked up-regulation of CD80 and CD86 on pre-DC2. However, this CpG ODN
did not induce pre-DC2 to produce detectable levels of IFN-
. In
contrast, another class of CpG ODNs, AAC-30 and GAC-30, which have been
shown to induce human PBMC (10) and mouse spleen cells
(11) to produce type I IFN, induced pre-DC2 to produce
IFN-
. On the other hand, monocytes or CD11c+
DC did not produce detectable levels of IFN-
in response to 2006,
AAC-30, or GAC-30. These data suggest that 1) pre-DC2 is the cell type
that produces IFN-
in response to CpG DNAs; and that 2) it is
important to select CpG DNAs containing particular sequences to induce
pre-DC2 to produce IFN-
. In addition, the finding that 2006 induced
pre-DC2 to up-regulate CD80 and CD86, but not to produce IFN-
,
suggests that CpG DNA may induce pre-DC2 to differentiate into DC and
to produce IFN-
through distinct signaling pathways.
Previous studies showed that methylation of cytosines in the CpG motifs abrogates the activity of CpG DNA to induce B cell proliferation (28) and NK cell activation (29). In this study, however, ODN 2117 containing methylated cytosines up-regulated CD80 and CD86 as strongly as ODN 2006 containing unmethylated CpG motifs, although 2117 did not support the survival of pre-DC2 as well as 2006 did. These data indicate that the methylation of cytosines abrogates the activity of CpG ODN 2006 only partially. It has been shown that ODNs with methylated CpG have a diminished, but significant, level of IFN-inducing capacity when encapsulated in liposomes (30). In addition, inverting CpG to GpC reduces, but does not totally abrogate, the activity of ODNs (including 1668 and 2006) to induce B cell proliferation and the up-regulation of costimulatory molecules (25). These findings suggest that although the presence of unmethylated CpG is most important for the optimal activity of immunostimulatory ODNs, those having appropriate flanking sequences can retain residual activity even without unmethylated CpG.
Our data suggest that CD11c+ DC is the only blood
cell type that produces a significant amount of type I IFN in response
to poly(I:C). CD11c+ DC and fibroblasts produced
similar levels of IFN-
per cell. Since the number of fibroblasts in
tissues is probably greater than that of CD11c+
DC, the main producers of type I IFN in response to poly(I:C) and dsRNA
may be fibroblasts, not blood cells, as has been shown (13, 14). It has recently been shown that poly(I:C) induces the
maturation of monocyte-derived immature DC (8, 9). Whereas
CD11c+ DC appear to be myeloid-derived DC because
they express myeloid markers (26), pre-DC2-derived DC may
be lymphoid-derived DC because pre-DC2 lack myeloid markers
(26) and express mRNA of pre-T receptor
-chain
(31). Thus, poly(I:C) may stimulate myeloid-derived, but
not lymphoid-derived, DC.
CpG DNA has pleiotropic effects on the immune system through activating
APC, i.e., B cells, macrophages, and DC (4). In
particular, a strong Th1-inducing effect of CpG DNA makes it a
promising immunological adjuvant to treat infectious diseases
(32), cancers (33), and allergic diseases
(34). It is conceivable that type I IFN induced by CpG DNA
contributes to the immunostimulatory effects of CpG DNA through various
mechanisms, such as enhancing NK cell activity (11),
inducing T cell activation (16), and enhancing IFN-
production by T cells (18). Therefore, CpG ODNs that
induce pre-DC2 to produce type I IFN may be suitable reagents for
clinical application. DNase-resistant phosphorothioate forms of AAC-30
and GAC-30 do not have a type I IFN-inducing effect on pre-DC2 (N.
Kadowaki, unpublished observations). Designing phosphorothioate forms
of CpG ODNs having such an effect may be an important future direction
for CpG immunology.
The molecular mechanisms by which the innate immune system recognizes
microbial components are a major topic of current immunology
(35). Although both CpG DNA (36, 37) and
dsRNA (38) activate NF-
B and Jun
NH2-terminal kinase, upstream signaling pathways
were shown to be different; CpG DNA, but not dsRNA, triggers a myeloid
differentiation marker-88- and TNF receptor-associated
factor-6-dependent pathway (39). The system we have
developed here provides an opportunity to identify the different
receptors involved in the recognition of CpG DNA vs dsRNA, which are
possibly members of the Toll-like receptor family
(40).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Norimitsu Kadowaki, Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin Kawara-cho, Sakyo-ku, Kyoto 606-8507, Japan. ![]()
3 Abbreviations used in this paper: DC, dendritic cells; ODN, oligodeoxynucleotide; poly(I:C), polyinosinic-polycytidylic acid; IPC, natural IFN-
-producing cells; pre-DC2, type 2 dendritic cell precursors. ![]()
Received for publication August 24, 2000. Accepted for publication November 27, 2000.
| References |
|---|
|
|
|---|
-interferons: 40th anniversary of the discovery of interferons. Cancer Res. 58:2489.
/
-producing cells link innate and adaptive immunity. J. Exp. Med. 192:219.
mRNA in a committed dendritic cell precursor in the human thymus. Blood 94:2647.
are required for activating the innate response to viral infection. Immunity 11:721.[Medline]
This article has been cited by other articles:
![]() |
S. L. Fanning, T. C. George, D. Feng, S. B. Feldman, N. J. Megjugorac, A. G. Izaguirre, and P. Fitzgerald-Bocarsly Receptor Cross-Linking on Human Plasmacytoid Dendritic Cells Leads to the Regulation of IFN-{alpha} Production J. Immunol., November 1, 2006; 177(9): 5829 - 5839. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M KLINMAN, H. XIE, and B. E IVINS CpG Oligonucleotides Improve the Protective Immune Response Induced by the Licensed Anthrax Vaccine Ann. N.Y. Acad. Sci., October 1, 2006; 1082(1): 137 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Teige, Y. Liu, and S. Issazadeh-Navikas IFN-beta Inhibits T Cell Activation Capacity of Central Nervous System APCs J. Immunol., September 15, 2006; 177(6): 3542 - 3553. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Benitez-Ribas, G. J. Adema, G. Winkels, I. S. Klasen, C. J.A. Punt, C. G. Figdor, and I. J. M. de Vries Plasmacytoid dendritic cells of melanoma patients present exogenous proteins to CD4+ T cells after Fc{gamma}RII-mediated uptake J. Exp. Med., July 10, 2006; 203(7): 1629 - 1635. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Gorski, E. L. Waller, J. Bjornton-Severson, J. A. Hanten, C. L. Riter, W. C. Kieper, K. B. Gorden, J. S. Miller, J. P. Vasilakos, M. A. Tomai, et al. Distinct indirect pathways govern human NK-cell activation by TLR-7 and TLR-8 agonists Int. Immunol., July 1, 2006; 18(7): 1115 - 1126. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. O. Kvale, J. Dalgaard, F. Lund-Johansen, H. Rollag, L. Farkas, K. Midtvedt, F. L. Jahnsen, J. E. Brinchmann, and J. Olweus CD11c+ dendritic cells and plasmacytoid DCs are activated by human cytomegalovirus and retain efficient T cell-stimulatory capability upon infection Blood, March 1, 2006; 107(5): 2022 - 2029. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Teleshova, J. Kenney, V. Williams, G. Van Nest, J. Marshall, J. D. Lifson, I. Sivin, J. Dufour, R. Bohm, A. Gettie, et al. CpG-C ISS-ODN activation of blood-derived B cells from healthy and chronic immunodeficiency virus-infected macaques J. Leukoc. Biol., February 1, 2006; 79(2): 257 - 267. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Guriec, C. Daniel, K. Le Ster, E. Hardy, and C. Berthou Cytokine-regulated expression and inhibitory function of Fc{gamma}RIIB1 and -B2 receptors in human dendritic cells J. Leukoc. Biol., January 1, 2006; 79(1): 59 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Schroeder, A. P. Bieneman, H. Xiao, K. L. Chichester, K. Vasagar, S. Saini, and M. C. Liu TLR9- and Fc{epsilon}RI-Mediated Responses Oppose One Another in Plasmacytoid Dendritic Cells by Down-Regulating Receptor Expression J. Immunol., November 1, 2005; 175(9): 5724 - 5731. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Wille-Reece, B. J. Flynn, K. Lore, R. A. Koup, R. M. Kedl, J. J. Mattapallil, W. R. Weiss, M. Roederer, and R. A. Seder HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates PNAS, October 18, 2005; 102(42): 15190 - 15194. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Asselin-Paturel, G. Brizard, K. Chemin, A. Boonstra, A. O'Garra, A. Vicari, and G. Trinchieri Type I interferon dependence of plasmacytoid dendritic cell activation and migration J. Exp. Med., April 4, 2005; 201(7): 1157 - 1167. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Chung, S. B. Amrute, K. Abel, G. Gupta, Y. Wang, C. J. Miller, and P. Fitzgerald-Bocarsly Characterization of Virus-Responsive Plasmacytoid Dendritic Cells in the Rhesus Macaque Clin. Vaccine Immunol., March 1, 2005; 12(3): 426 - 435. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vuckovic, D. Khalil, N. Angel, F. Jahnsen, I. Hamilton, A. Boyce, B. Hock, and D. N. J. Hart The CMRF58 antibody recognizes a subset of CD123hi dendritic cells in allergen-challenged mucosa J. Leukoc. Biol., March 1, 2005; 77(3): 344 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. De Creus, M. Abe, A. H. Lau, H. Hackstein, G. Raimondi, and A. W. Thomson Low TLR4 Expression by Liver Dendritic Cells Correlates with Reduced Capacity to Activate Allogeneic T Cells in Response to Endotoxin J. Immunol., February 15, 2005; 174(4): 2037 - 2045. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sugiyama, M. Gursel, F. Takeshita, C. Coban, J. Conover, T. Kaisho, S. Akira, D. M. Klinman, and K. J. Ishii CpG RNA: Identification of Novel Single-Stranded RNA That Stimulates Human CD14+CD11c+ Monocytes J. Immunol., February 15, 2005; 174(4): 2273 - 2279. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Gerosa, A. Gobbi, P. Zorzi, S. Burg, F. Briere, G. Carra, and G. Trinchieri The Reciprocal Interaction of NK Cells with Plasmacytoid or Myeloid Dendritic Cells Profoundly Affects Innate Resistance Functions J. Immunol., January 15, 2005; 174(2): 727 - 734. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Kamath, C. E. Sheasby, and D. F. Tough Dendritic Cells and NK Cells Stimulate Bystander T Cell Activation in Response to TLR Agonists through Secretion of IFN-{alpha}{beta} and IFN-{gamma} J. Immunol., January 15, 2005; 174(2): 767 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. McKenna, A.-S. Beignon, and N. Bhardwaj Plasmacytoid Dendritic Cells: Linking Innate and Adaptive Immunity J. Virol., January 1, 2005; 79(1): 17 - 27. [Full Text] [PDF] |
||||
![]() |
N. Dikopoulos, A. Bertoletti, A. Kroger, H. Hauser, R. Schirmbeck, and J. Reimann Type I IFN Negatively Regulates CD8+ T Cell Responses through IL-10-Producing CD4+ T Regulatory 1 Cells J. Immunol., January 1, 2005; 174(1): 99 - 109. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Hornung, J. Schlender, M. Guenthner-Biller, S. Rothenfusser, S. Endres, K.-K. Conzelmann, and G. Hartmann Replication-Dependent Potent IFN-{alpha} Induction in Human Plasmacytoid Dendritic Cells by a Single-Stranded RNA Virus J. Immunol., November 15, 2004; 173(10): 5935 - 5943. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Pannetier, C. Faure, M.-C. Georges-Courbot, V. Deubel, and S. Baize Human Macrophages, but Not Dendritic Cells, Are Activated and Produce Alpha/Beta Interferons in Response to Mopeia Virus Infection J. Virol., October 1, 2004; 78(19): 10516 - 10524. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Moseman, X. Liang, A. J. Dawson, A. Panoskaltsis-Mortari, A. M. Krieg, Y.-J. Liu, B. R. Blazar, and W. Chen Human Plasmacytoid Dendritic Cells Activated by CpG Oligodeoxynucleotides Induce the Generation of CD4+CD25+ Regulatory T Cells J. Immunol., October 1, 2004; 173(7): 4433 - 4442. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fallarino, C. Asselin-Paturel, C. Vacca, R. Bianchi, S. Gizzi, M. C. Fioretti, G. Trinchieri, U. Grohmann, and P. Puccetti Murine Plasmacytoid Dendritic Cells Initiate the Immunosuppressive Pathway of Tryptophan Catabolism in Response to CD200 Receptor Engagement J. Immunol., September 15, 2004; 173(6): 3748 - 3754. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dai, N. J. Megjugorac, S. B. Amrute, and P. Fitzgerald-Bocarsly Regulation of IFN Regulatory Factor-7 and IFN-{alpha} Production by Enveloped Virus and Lipopolysaccharide in Human Plasmacytoid Dendritic Cells J. Immunol., August 1, 2004; 173(3): 1535 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Teleshova, J. Jones, J. Kenney, J. Purcell, R. Bohm, A. Gettie, and M. Pope Short-term Flt3L treatment effectively mobilizes functional macaque dendritic cells J. Leukoc. Biol., June 1, 2004; 75(6): 1102 - 1110. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Anthony, N. L. Yonkers, A. B. Post, R. Asaad, F. P. Heinzel, M. M. Lederman, P. V. Lehmann, and H. Valdez Selective Impairments in Dendritic Cell-Associated Function Distinguish Hepatitis C Virus and HIV Infection J. Immunol., April 15, 2004; 172(8): 4907 - 4916. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pichyangkul, K. Yongvanitchit, U. Kum-arb, H. Hemmi, S. Akira, A. M. Krieg, D. G. Heppner, V. A. Stewart, H. Hasegawa, S. Looareesuwan, et al. Malaria Blood Stage Parasites Activate Human Plasmacytoid Dendritic Cells and Murine Dendritic Cells through a Toll-Like Receptor 9-Dependent Pathway J. Immunol., April 15, 2004; 172(8): 4926 - 4933. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Chaput, N. E. C. Schartz, F. Andre, J. Taieb, S. Novault, P. Bonnaventure, N. Aubert, J. Bernard, F. Lemonnier, M. Merad, et al. Exosomes as Potent Cell-Free Peptide-Based Vaccine. II. Exosomes in CpG Adjuvants Efficiently Prime Naive Tc1 Lymphocytes Leading to Tumor Rejection J. Immunol., February 15, 2004; 172(4): 2137 - 2146. [Abstract] [Full Text] [PDF] |
||||
|
|