HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kadowaki, N. Articles by Liu, Y.-J. Search for Related Content PubMed PubMed Citation Articles by Kadowaki, N. Articles by Liu, Y.-J.

Distinct CpG DNA and Polyinosinic-Polycytidylic Acid Double-Stranded RNA, Respectively, Stimulate CD11c^- Type 2 Dendritic Cell Precursors and CD11c⁺ Dendritic Cells to Produce Type I IFN¹

Department of Immunobiology, DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA 94304

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Two classes of nucleic acids, bacterial DNA containing unmethylated CpG motifs and dsRNA in viruses, induce the production of type I IFN that contributes to the immunostimulatory effects of these microbial molecules. Thus, it is important to determine which cells produce type I IFN in response to CpG DNA and dsRNA. CD4⁺CD11c^- type 2 dendritic cell precursors (pre-DC2) were identified as the main producers of type I IFN in human blood in response to viruses. Here we asked whether pre-DC2 also produce type I IFN in response to CpG DNA and dsRNA. Oligodeoxynucleotides containing particular palindromic CpG motifs induced pre-DC2, but not CD11c⁺ blood DC or monocytes, to produce IFN-. In contrast, a synthetic dsRNA, polyinosinic polycytidylic-acid, induced CD11c⁺ DC, but not pre-DC2 or monocytes, to produce IFN-. These data indicate that CpG DNA and polyinosinic-polycytidylic acid stimulate different types of cells to produce type I IFN and that it is important to select oligodeoxynucleotides containing particular CpG motifs to induce pre-DC2 to produce type I IFN, which may play a key role in the strong adjuvant effects of CpG DNA.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The innate immune system has the capacity to recognize invariant molecular patterns shared by microbial pathogens (1). Recent studies have revealed that this recognition is a crucial step in inducing effective immune responses (1). The main mechanism by which microbial components augment immune responses is to stimulate APC, especially dendritic cells (DC),³ to produce proinflammatory cytokines and to express high levels of costimulatory molecules for T cells (1, 2). These activated DC subsequently initiate primary T cell responses and dictate the type of T cell-mediated effector function (3).

Two classes of nucleic acids, namely 1) bacterial CpG DNA that contains immunostimulatory unmethylated CpG dinucleotides within specific flanking bases (referred to as CpG motifs) (4) and 2) dsRNA synthesized by various types of viruses (5), represent important members of the microbial components that enhance immune responses. Recent studies have shown that oligodeoxynucleotides (ODNs) containing CpG motifs (6, 7) and synthetic dsRNA, e.g., polyinosinic-polycytidylic acid (poly(I:C)) (8, 9), are capable of inducing DC to produce proinflammatory cytokines and to express high levels of costimulatory molecules.

A series of studies by Tokunaga and Yamamoto et al. has shown that bacterial DNA or synthetic ODNs containing unique palindromic CpG motifs induce human PBMC (10) and mouse spleen cells (11) to produce type I IFN (IFN-) (reviewed in Ref. 12). Poly(I:C) was originally synthesized as a potent inducer of type I IFN (13, 14). Type I IFN plays an essential role in antiviral innate immunity and is widely used to treat viral hepatitis and various types of cancers (15). These effects appear to be due to direct inhibition of viral replication in infected cells and to the pleiotropic immunomodulating activity of type I IFN (15), such as 1) enhancing the cytotoxicity of NK cells and macrophages (15), 2) inducing T cell activation (16), 3) maintaining the survival of activated T cells (17), 4) stimulating human CD4⁺ T cells to produce a Th1 cytokine IFN- (18), and 5) inducing the expression of TNF-related apoptosis-inducing ligand on T cells and thereby enhancing T cell cytotoxicity (19). Thus, CpG DNA and poly(I:C) are believed to be promising adjuvants for vaccination against infections and cancers due to their DC-stimulating and type I IFN-inducing capacity.

To understand the mechanisms underlying the induction of type I IFN by CpG DNA and poly(I:C) and to increase their efficacy as immunological adjuvants, it is important to determine which cells produce type I IFN in response to CpG DNA and poly(I:C). Two groups have recently shown that the main producers of type I IFN in human blood, designated natural IFN--producing cells (IPC), are identical with CD4⁺IL-3R^highCD3^-CD11c^- type 2 dendritic cell precursors (pre-DC2) (20, 21), which differentiate into DC in response to IL-3 (22) or viruses (23). Pre-DC2 IPC produce 1000 times more type I IFN than do CD11c⁺ blood immature DC, monocytes, and monocyte-derived DC in response to viral stimulation (20). In this study we asked whether pre-DC2 will produce type I IFN in response to CpG DNA and poly(I:C). We show that 1) pre-DC2, but not CD11c⁺ DC or monocytes, produce type I IFN in response to CpG ODNs containing particular palindromic sequences, and that 2) CD11c⁺ DC, but not pre-DC2 or monocytes, produce type I IFN in response to poly(I:C).

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Oligodeoxynucleotides

The following ODNs were purchased from Research Genetics (Huntsville, AL): 1668, TCCATGACGTTCCTGATGCT (6); 2117, T*CGT*CGTTTTGT*CGTTTTGT*CGTT (*C, methylated cytosine) (24); 2006, TCGTCGTTTTGTCGTTTTGTCGT (24); ACC-30, ACCGATACCGGTGCCGGTGACGGCACCACG (10); AAC-30, ACCGATAACGTTGCCGGTGACGGCACCACG (10); and GAC-30, ACCGATGACGTCGCCGGTGACGGCACCACG (10) (underlines indicate palindromic sequences). ODNs 1668, 2117, and 2006 are phosphorothioate forms, and ACC-30, AAC-30, and GAC-30 are phosphodiester forms. The phosphorothioate ODNs were added at 0 h at 0.1 µM (0.6 µg/ml) or 1 µM (6 µg/ml), and the phosphodiester ODNs were added at 0, 4, and 16 h, 5 µM (46 µg/ml) at each time point, to compensate for their degradation by DNase activity in medium.

Isolation and culture of cells

Monocytes, CD11c⁺ DC, and pre-DC2 were isolated from human peripheral blood as previously described (22, 23). The cells were cultured for 24 h in RPMI 1640 containing 10% FCS at 2 x 10⁴/200 µl in round-bottom 96-well culture plates in the presence of ODNs or 50 µg/ml poly(I:C) (Sigma, St. Louis, MO). Adult dermal fibroblasts (Clonetics, Walkersville, MD) were maintained as recommended by the company and were stimulated with 50 µg/ml poly(I:C) for 24 h at 7.5 x 10⁴/ml in 12-well culture plates.

Analysis of viability of pre-DC2 stimulated with ODNs or poly(I:C)

Pre-DC2 cultured for 24 h without stimulation or with ODNs or poly(I:C) were stained with propidium iodide and analyzed with a FACScan flow cytometer (Becton Dickinson, San Jose, CA). After cell debris was excluded by an appropriate forward scatter threshold, the percentages of propidium iodide-negative cells were calculated.

Flow cytometric analysis of the expression of CD80 and CD86

Freshly isolated pre-DC2 and pre-DC2 stimulated with ODNs for 24 h were stained with PE-conjugated anti-CD80 (L307.4; Becton Dickinson), PE-conjugated anti-CD86 (2331; PharMingen, San Diego, CA), or an isotype control Ab. CD11c⁺ DC cultured for 24 h without stimulation or with poly(I:C) were stained with FITC-conjugated anti-CD80 (L307.4), FITC-conjugated anti-CD86 (2331), or an isotype control Ab. The cells were analyzed with a FACScan flow cytometer. Dead cells were excluded by staining with propidium iodide.

Quantitation of cytokines by ELISA

An IFN- ELISA kit, an IL-12 ELISA kit (BioSource International, Camarillo, CA), and an IFN- ELISA kit (FUJIREBIO, Tokyo, Japan) were used to analyze cytokine production.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
CpG ODNs, but not poly(I:C), maintain the survival of pre-DC2 and induce them to differentiate into DC

Without any stimuli, the majority of pre-DC2 rapidly die within 24 h (22, 23) (Fig. 1A). We first examined whether different CpG ODNs and poly(I:C) prevent pre-DC2 from dying. We used three types of CpG ODNs: 1) 2006, which up-regulates the expression of costimulatory molecules on human blood DC (7) and B cells (24); 2) AAC-30 and GAC-30, which have palindromic CpG motifs and stimulate human PBMC (10) and mouse spleen cells (11) to produce type I IFN; and 3) 1668, which stimulates mouse DC to express high levels of costimulatory molecules and to produce proinflammatory cytokines TNF-, IL-6, and IL-12 (6).

View larger version (19K): [in this window] [in a new window]   FIGURE 1. CpG ODNs, but not poly(I:C), maintain the survival of pre-DC2 and up-regulate the expression of CD80 and CD86. Pre-DC2 were cultured for 24 h without stimulation, with the indicated ODNs, or with 50 µg/ml poly(I:C). ODNs ACC-30, AAC-30, and GAC-30 were added at 5 µM (46 µg/ml). A, Viability. ODNs 2117 and 2006 were added at 0.1 µM (0.6 µg/ml) or 1 µM (6 µg/ml). After cell debris was excluded by an appropriate forward scatter threshold, the percentages of propidium iodide-negative cells were measured by flow cytometry. Data are representative of three experiments. B, The expression of CD80 and CD86. Freshly isolated pre-DC2 and pre-DC2 cultured with the indicated CpG ODNs for 24 h were stained with PE-conjugated anti-CD80 or anti-CD86 mAbs. ODNs 2117 and 2006 were added at 1 µM (6 µg/ml). Data are representative of three experiments.

The up-regulation of CD80 and CD86 expression on pre-DC2 is a hallmark of their differentiation into DC (22, 23). Unmethylated CpG ODN 2006 and methylated CpG ODN 2117 (1 µM) strongly up-regulated the expression of CD80 and CD86 (Fig. 1B). AAC-30 and GAC-30 also up-regulated CD80 and CD86, albeit to a lesser extent than 2006 and 2117 (Fig. 1B).

Taken together, these data indicate that CpG ODNs containing appropriate sequences efficiently maintain the survival of pre-DC2 and induce them to differentiate into DC. In marked contrast, poly(I:C) does not stimulate pre-DC2 to survive and differentiate into DC.

Distinct CpG ODNs, but not poly(I:C), induce pre-DC2 to produce IFN-

Next we examined whether CpG ODNs and poly(I:C) induce pre-DC2 to produce IFN-. Although 2006 strikingly up-regulated CD80 and CD86 (Fig. 1B), this CpG ODN as well as 2117 and 1668 did not induce pre-DC2 to produce detectable levels of IFN- (Fig. 2). In contrast, AAC-30 and GAC-30 induced pre-DC2 to produce large amounts of IFN- (AAC-30 508–1806 pg/ml; GAC-30 931–1362 pg/ml; n = 3; Fig. 2). ACC-30 induced pre-DC2 to produce much smaller amounts of IFN- (18–161 pg/ml; n = 3; Fig. 2). None of the CpG ODNs used here induced CD11c⁺ DC and monocytes to produce detectable levels of IFN- (data not shown). In line with the finding that poly(I:C) did not maintain the survival of pre-DC2 (Fig. 1A), this reagent did not induce pre-DC2 to produce a detectable level of IFN- (Table I). These data indicate that ODNs containing particular CpG motifs, but not poly(I:C), induce pre-DC2 to produce IFN-.

View larger version (26K): [in this window] [in a new window]   FIGURE 2. ODNs containing particular palindromic CpG motifs induce pre-DC2 to produce IFN-. Cells were stimulated with the indicated CpG ODNs (2117, 2006, and 1668, 1 µM (6 µg/ml); ACC-30, AAC-30, and GAC-30, 5 µM (46 µg/ml)) for 24 h, and the concentrations of IFN- in the supernatants were measured by ELISA. Data are representative of three experiments.

View this table: [in this window] [in a new window]   Table I. Poly(I:C) induces CD11c+ DC, but not pre-DC2, to produce IFN- and IL-121

Poly(I:C) stimulates CD11c⁺ myeloid DC to produce IFN- and IL-12 and to undergo maturation

Although poly(I:C) did not induce pre-DC2 to survive (Fig. 1A) or to produce IFN- (Table I), this reagent has been shown to induce human monocyte-derived DC to mature and to produce IL-12 (8, 9). Thus, we asked whether poly(I:C) stimulates CD11c⁺ myeloid DC (26) to produce type I IFN and IL-12 and to undergo maturation. As shown in Table I, poly(I:C) induced CD11c⁺ DC, but not pre-DC2 or monocytes, to produce small, but significant, amounts of IFN- (24.1–97.9 pg/ml; n = 3), IFN- (33.6–166.5 pg/ml; n = 3), and IL-12 (17.7–137.7 pg/ml; n = 4). Poly(I:C)-stimulated fibroblasts produced similar amounts of IFN- (28.6–48.5 pg/ml; n = 2; Table I). Poly(I:C) strongly up-regulated the expression of CD80 and CD86 on CD11c⁺ DC during 24-h culture (Fig. 3). Thus, poly(I:C) stimulates CD11c⁺ myeloid DC, but not pre-DC2, to produce type I IFN and IL-12 and to become mature DC.

View larger version (34K): [in this window] [in a new window]   FIGURE 3. Poly(I:C) strongly up-regulates the expression of CD80 and CD86 on CD11c+ DC. CD11c+ DC cultured for 24 h without stimulation or with 50 µg/ml poly(I:C) were stained with FITC-conjugated anti-CD80 or anti-CD86 mAbs. Data are representative of three experiments.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Hartmann et al. screened an extensive series of CpG ODNs to find those with the highest immunostimulatory activity for human cells (24, 27). They and others found that CpG ODN 2006 most potently activates human B cells (24), monocytes (25), and DC (7). In line with these findings, 2006 induced marked up-regulation of CD80 and CD86 on pre-DC2. However, this CpG ODN did not induce pre-DC2 to produce detectable levels of IFN-. In contrast, another class of CpG ODNs, AAC-30 and GAC-30, which have been shown to induce human PBMC (10) and mouse spleen cells (11) to produce type I IFN, induced pre-DC2 to produce IFN-. On the other hand, monocytes or CD11c⁺ DC did not produce detectable levels of IFN- in response to 2006, AAC-30, or GAC-30. These data suggest that 1) pre-DC2 is the cell type that produces IFN- in response to CpG DNAs; and that 2) it is important to select CpG DNAs containing particular sequences to induce pre-DC2 to produce IFN-. In addition, the finding that 2006 induced pre-DC2 to up-regulate CD80 and CD86, but not to produce IFN-, suggests that CpG DNA may induce pre-DC2 to differentiate into DC and to produce IFN- through distinct signaling pathways.

Previous studies showed that methylation of cytosines in the CpG motifs abrogates the activity of CpG DNA to induce B cell proliferation (28) and NK cell activation (29). In this study, however, ODN 2117 containing methylated cytosines up-regulated CD80 and CD86 as strongly as ODN 2006 containing unmethylated CpG motifs, although 2117 did not support the survival of pre-DC2 as well as 2006 did. These data indicate that the methylation of cytosines abrogates the activity of CpG ODN 2006 only partially. It has been shown that ODNs with methylated CpG have a diminished, but significant, level of IFN-inducing capacity when encapsulated in liposomes (30). In addition, inverting CpG to GpC reduces, but does not totally abrogate, the activity of ODNs (including 1668 and 2006) to induce B cell proliferation and the up-regulation of costimulatory molecules (25). These findings suggest that although the presence of unmethylated CpG is most important for the optimal activity of immunostimulatory ODNs, those having appropriate flanking sequences can retain residual activity even without unmethylated CpG.

Our data suggest that CD11c⁺ DC is the only blood cell type that produces a significant amount of type I IFN in response to poly(I:C). CD11c⁺ DC and fibroblasts produced similar levels of IFN- per cell. Since the number of fibroblasts in tissues is probably greater than that of CD11c⁺ DC, the main producers of type I IFN in response to poly(I:C) and dsRNA may be fibroblasts, not blood cells, as has been shown (13, 14). It has recently been shown that poly(I:C) induces the maturation of monocyte-derived immature DC (8, 9). Whereas CD11c⁺ DC appear to be myeloid-derived DC because they express myeloid markers (26), pre-DC2-derived DC may be lymphoid-derived DC because pre-DC2 lack myeloid markers (26) and express mRNA of pre-T receptor -chain (31). Thus, poly(I:C) may stimulate myeloid-derived, but not lymphoid-derived, DC.

CpG DNA has pleiotropic effects on the immune system through activating APC, i.e., B cells, macrophages, and DC (4). In particular, a strong Th1-inducing effect of CpG DNA makes it a promising immunological adjuvant to treat infectious diseases (32), cancers (33), and allergic diseases (34). It is conceivable that type I IFN induced by CpG DNA contributes to the immunostimulatory effects of CpG DNA through various mechanisms, such as enhancing NK cell activity (11), inducing T cell activation (16), and enhancing IFN- production by T cells (18). Therefore, CpG ODNs that induce pre-DC2 to produce type I IFN may be suitable reagents for clinical application. DNase-resistant phosphorothioate forms of AAC-30 and GAC-30 do not have a type I IFN-inducing effect on pre-DC2 (N. Kadowaki, unpublished observations). Designing phosphorothioate forms of CpG ODNs having such an effect may be an important future direction for CpG immunology.

The molecular mechanisms by which the innate immune system recognizes microbial components are a major topic of current immunology (35). Although both CpG DNA (36, 37) and dsRNA (38) activate NF-B and Jun NH₂-terminal kinase, upstream signaling pathways were shown to be different; CpG DNA, but not dsRNA, triggers a myeloid differentiation marker-88- and TNF receptor-associated factor-6-dependent pathway (39). The system we have developed here provides an opportunity to identify the different receptors involved in the recognition of CpG DNA vs dsRNA, which are possibly members of the Toll-like receptor family (40).

	Acknowledgments

 
We thank J. Cupp for cell sorting and D. Wylie for critical reading of the manuscript.

	Footnotes

 
¹ DNAX Research Institute of Molecular and Cellular Biology is supported by Schering-Plough Corp.

² Address correspondence and reprint requests to Dr. Norimitsu Kadowaki, Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin Kawara-cho, Sakyo-ku, Kyoto 606-8507, Japan.

³ Abbreviations used in this paper: DC, dendritic cells; ODN, oligodeoxynucleotide; poly(I:C), polyinosinic-polycytidylic acid; IPC, natural IFN--producing cells; pre-DC2, type 2 dendritic cell precursors.

Received for publication August 24, 2000. Accepted for publication November 27, 2000.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Medzhitov, R., Jr C. A. Janeway. 1997. Innate immunity: impact on the adaptive immune response. Curr. Opin. Immunol. 9:4.[Medline]
2. Reis e Sousa, C., A. Sher, P. Kaye. 1999. The role of dendritic cells in the induction and regulation of immunity to microbial infection. Curr. Opin. Immunol. 11:392.[Medline]
3. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
4. Krieg, A. M.. 2000. The role of CpG motifs in innate immunity. Curr. Opin. Immunol. 12:35.[Medline]
5. Jacobs, B. L., J. O. Langland. 1996. When two strands are better than one: the mediators and modulators of the cellular responses to double-stranded RNA. Virology 219:339.[Medline]
6. Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28:2045.[Medline]
7. Hartmann, G., G. J. Weiner, A. M. Krieg. 1999. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc. Natl. Acad. Sci. USA 96:9305.[Abstract/Free Full Text]
8. Cella, M., M. Salio, Y. Sakakibara, H. Langen, I. Julkunen, A. Lanzavecchia. 1999. Maturation, activation, and protection of dendritic cells induced by double-stranded RNA. J. Exp. Med. 189:821.[Abstract/Free Full Text]
9. Verdijk, R. M., T. Mutis, B. Esendam, J. Kamp, C. J. Melief, A. Brand, E. Goulmy. 1999. Polyriboinosinic polyribocytidylic acid (poly(I:C)) induces stable maturation of functionally active human dendritic cells. J. Immunol. 163:57.[Abstract/Free Full Text]
10. Yamamoto, T., S. Yamamoto, T. Kataoka, K. Komuro, M. Kohase, T. Tokunaga. 1994. Synthetic oligonucleotides with certain palindromes stimulate interferon production of human peripheral blood lymphocytes in vitro. Jpn. J. Cancer Res. 85:775.[Medline]
11. Yamamoto, S., T. Yamamoto, T. Kataoka, E. Kuramoto, O. Yano, T. Tokunaga. 1992. Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN [correction of INF] and augment IFN-mediated [correction of INF] natural killer activity. J. Immunol. 148:4072.[Abstract]
12. Yamamoto, S., T. Yamamoto, T. Tokunaga. 2000. Oligodeoxyribonucleotides with 5'-ACGT-3' or 5'-TCGA-3' sequence induce production of interferons. Curr. Top. Microbiol. Immunol. 247:23.[Medline]
13. De Clercq, E.. 1981. Interferon induction by polynucleotides, modified polynucleotides, and polycarboxylates. Methods Enzymol. 78:227.[Medline]
14. Levy, H. B.. 1981. Induction of interferon in vivo and in vitro by polynucleotides and derivatives, and preparation of derivatives. Methods Enzymol. 78:242.[Medline]
15. Pfeffer, L. M., C. A. Dinarello, R. B. Herberman, B. R. Williams, E. C. Borden, R. Bordens, M. R. Walter, T. L. Nagabhushan, P. P. Trotta, S. Pestka. 1998. Biological properties of recombinant -interferons: 40th anniversary of the discovery of interferons. Cancer Res. 58:2489.[Abstract/Free Full Text]
16. Sun, S., X. Zhang, D. F. Tough, J. Sprent. 1998. Type I interferon-mediated stimulation of T cells by CpG DNA. J. Exp. Med. 188:2335.[Abstract/Free Full Text]
17. Marrack, P., J. Kappler, T. Mitchell. 1999. Type I interferons keep activated T cells alive. J. Exp. Med. 189:521.[Abstract/Free Full Text]
18. Demeure, C. E., C. Y. Wu, U. Shu, P. V. Schneider, C. Heusser, H. Yssel, G. Delespesse. 1994. In vitro maturation of human neonatal CD4 T lymphocytes. II. Cytokines present at priming modulate the development of lymphokine production. J. Immunol. 152:4775.[Abstract]
19. Kayagaki, N., N. Yamaguchi, M. Nakayama, H. Eto, K. Okumura, H. Yagita. 1999. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression on human T cells: a novel mechanism for the antitumor effects of type I IFNs. J. Exp. Med. 189:1451.[Abstract/Free Full Text]
20. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah, S. Ho, S. Antonenko, Y. J. Liu. 1999. The nature of the principal type 1 interferon-producing cells in human blood. Science 284:1835.[Abstract/Free Full Text]
21. Cella, M., D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakajima, A. Lanzavecchia, M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat. Med. 5:919.[Medline]
22. Grouard, G., M. C. Rissoan, L. Filgueira, I. Durand, J. Banchereau, Y. J. Liu. 1997. The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand. J. Exp. Med. 185:1101.[Abstract/Free Full Text]
23. Kadowaki, N., S. Antonenko, J. Y. Lau, Y. J. Liu. 2000. Natural interferon /-producing cells link innate and adaptive immunity. J. Exp. Med. 192:219.[Abstract/Free Full Text]
24. Hartmann, G., A. M. Krieg. 2000. Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J. Immunol. 164:944.[Abstract/Free Full Text]
25. Bauer, M., K. Heeg, H. Wagner, G. B. Lipford. 1999. DNA activates human immune cells through a CpG sequence-dependent manner. Immunology 97:699.[Medline]
26. O’Doherty, U., M. Peng, S. Gezelter, W. J. Swiggard, M. Betjes, N. Bhardwaj, R. M. Steinman. 1994. Human blood contains two subsets of dendritic cells, one immunologically mature and the other immature. Immunology 82:487.[Medline]
27. Hartmann, G., R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto, W. L. Rasmussen, M. Waldschmidt, D. Sajuthi, R. H. Purcell, et al 2000. Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo. J. Immunol. 164:1617.[Abstract/Free Full Text]
28. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
29. Ballas, Z. K., W. L. Rasmussen, A. M. Krieg. 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157:1840.[Abstract]
30. Sonehara, K., H. Saito, E. Kuramoto, S. Yamamoto, T. Yamamoto, T. Tokunaga. 1996. Hexamer palindromic oligonucleotides with 5'-CG-3' motif(s) induce production of interferon. J. Interferon Cytokine Res. 16:799.[Medline]
31. Res, P. C., F. Couwenberg, F. A. Vyth-Dreese, H. Spits. 1999. Expression of pT mRNA in a committed dendritic cell precursor in the human thymus. Blood 94:2647.[Abstract/Free Full Text]
32. Klinman, D. M., D. Verthelyi, F. Takeshita, K. J. Ishii. 1999. Immune recognition of foreign DNA: a cure for bioterrorism?. Immunity 11:123.[Medline]
33. Weiner, G. J.. 2000. CpG DNA in cancer immunotherapy. Curr. Top. Microbiol. Immunol. 247:157.[Medline]
34. Kline, J. N.. 2000. Effects of CpG DNA on Th1/Th2 balance in asthma. Curr. Top. Microbiol. Immunol. 247:211.[Medline]
35. Medzhitov, R., Jr C. A. Janeway. 1997. Innate immunity: the virtues of a nonclonal system of recognition. Cell 91:295.[Medline]
36. Stacey, K. J., M. J. Sweet, D. A. Hume. 1996. Macrophages ingest and are activated by bacterial DNA. J. Immunol. 157:2116.[Abstract]
37. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, K. Heeg, G. B. Lipford, H. Wagner. 1998. CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO J. 17:6230.[Medline]
38. Chu, W. M., D. Ostertag, Z. W. Li, L. Chang, Y. Chen, Y. Hu, B. Williams, J. Perrault, M. Karin. 1999. JNK2 and IKK are required for activating the innate response to viral infection. Immunity 11:721.[Medline]
39. Hacker, H., R. M. Vabulas, O. Takeuchi, K. Hoshino, S. Akira, H. Wagner. 2000. Immune cell activation by bacterial CpG-DNA through myeloid differentiation marker 88 and tumor necrosis factor receptor-associated factor (TRAF)6. J. Exp. Med. 192:595.[Abstract/Free Full Text]
40. Aderem, A., R. J. Ulevitch. 2000. Toll-like receptors in the induction of the innate immune response. Nature 406:782.[Medline]

This article has been cited by other articles:

				S. L. Fanning, T. C. George, D. Feng, S. B. Feldman, N. J. Megjugorac, A. G. Izaguirre, and P. Fitzgerald-Bocarsly Receptor Cross-Linking on Human Plasmacytoid Dendritic Cells Leads to the Regulation of IFN-{alpha} Production J. Immunol., November 1, 2006; 177(9): 5829 - 5839. [Abstract] [Full Text] [PDF]

				D. M KLINMAN, H. XIE, and B. E IVINS CpG Oligonucleotides Improve the Protective Immune Response Induced by the Licensed Anthrax Vaccine Ann. N.Y. Acad. Sci., October 1, 2006; 1082(1): 137 - 150. [Abstract] [Full Text] [PDF]

				I. Teige, Y. Liu, and S. Issazadeh-Navikas IFN-beta Inhibits T Cell Activation Capacity of Central Nervous System APCs J. Immunol., September 15, 2006; 177(6): 3542 - 3553. [Abstract] [Full Text] [PDF]

				D. Benitez-Ribas, G. J. Adema, G. Winkels, I. S. Klasen, C. J.A. Punt, C. G. Figdor, and I. J. M. de Vries Plasmacytoid dendritic cells of melanoma patients present exogenous proteins to CD4+ T cells after Fc{gamma}RII-mediated uptake J. Exp. Med., July 10, 2006; 203(7): 1629 - 1635. [Abstract] [Full Text] [PDF]

				K. S. Gorski, E. L. Waller, J. Bjornton-Severson, J. A. Hanten, C. L. Riter, W. C. Kieper, K. B. Gorden, J. S. Miller, J. P. Vasilakos, M. A. Tomai, et al. Distinct indirect pathways govern human NK-cell activation by TLR-7 and TLR-8 agonists Int. Immunol., July 1, 2006; 18(7): 1115 - 1126. [Abstract] [Full Text] [PDF]

				E. O. Kvale, J. Dalgaard, F. Lund-Johansen, H. Rollag, L. Farkas, K. Midtvedt, F. L. Jahnsen, J. E. Brinchmann, and J. Olweus CD11c+ dendritic cells and plasmacytoid DCs are activated by human cytomegalovirus and retain efficient T cell-stimulatory capability upon infection Blood, March 1, 2006; 107(5): 2022 - 2029. [Abstract] [Full Text] [PDF]

				N. Teleshova, J. Kenney, V. Williams, G. Van Nest, J. Marshall, J. D. Lifson, I. Sivin, J. Dufour, R. Bohm, A. Gettie, et al. CpG-C ISS-ODN activation of blood-derived B cells from healthy and chronic immunodeficiency virus-infected macaques J. Leukoc. Biol., February 1, 2006; 79(2): 257 - 267. [Abstract] [Full Text] [PDF]

				N. Guriec, C. Daniel, K. Le Ster, E. Hardy, and C. Berthou Cytokine-regulated expression and inhibitory function of Fc{gamma}RIIB1 and -B2 receptors in human dendritic cells J. Leukoc. Biol., January 1, 2006; 79(1): 59 - 70. [Abstract] [Full Text] [PDF]

				J. T. Schroeder, A. P. Bieneman, H. Xiao, K. L. Chichester, K. Vasagar, S. Saini, and M. C. Liu TLR9- and Fc{epsilon}RI-Mediated Responses Oppose One Another in Plasmacytoid Dendritic Cells by Down-Regulating Receptor Expression J. Immunol., November 1, 2005; 175(9): 5724 - 5731. [Abstract] [Full Text] [PDF]

				U. Wille-Reece, B. J. Flynn, K. Lore, R. A. Koup, R. M. Kedl, J. J. Mattapallil, W. R. Weiss, M. Roederer, and R. A. Seder HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates PNAS, October 18, 2005; 102(42): 15190 - 15194. [Abstract] [Full Text] [PDF]

				C. Asselin-Paturel, G. Brizard, K. Chemin, A. Boonstra, A. O'Garra, A. Vicari, and G. Trinchieri Type I interferon dependence of plasmacytoid dendritic cell activation and migration J. Exp. Med., April 4, 2005; 201(7): 1157 - 1167. [Abstract] [Full Text] [PDF]

				E. Chung, S. B. Amrute, K. Abel, G. Gupta, Y. Wang, C. J. Miller, and P. Fitzgerald-Bocarsly Characterization of Virus-Responsive Plasmacytoid Dendritic Cells in the Rhesus Macaque Clin. Vaccine Immunol., March 1, 2005; 12(3): 426 - 435. [Abstract] [Full Text] [PDF]

				S. Vuckovic, D. Khalil, N. Angel, F. Jahnsen, I. Hamilton, A. Boyce, B. Hock, and D. N. J. Hart The CMRF58 antibody recognizes a subset of CD123hi dendritic cells in allergen-challenged mucosa J. Leukoc. Biol., March 1, 2005; 77(3): 344 - 351. [Abstract] [Full Text] [PDF]

				A. De Creus, M. Abe, A. H. Lau, H. Hackstein, G. Raimondi, and A. W. Thomson Low TLR4 Expression by Liver Dendritic Cells Correlates with Reduced Capacity to Activate Allogeneic T Cells in Response to Endotoxin J. Immunol., February 15, 2005; 174(4): 2037 - 2045. [Abstract] [Full Text] [PDF]

				T. Sugiyama, M. Gursel, F. Takeshita, C. Coban, J. Conover, T. Kaisho, S. Akira, D. M. Klinman, and K. J. Ishii CpG RNA: Identification of Novel Single-Stranded RNA That Stimulates Human CD14+CD11c+ Monocytes J. Immunol., February 15, 2005; 174(4): 2273 - 2279. [Abstract] [Full Text] [PDF]

				F. Gerosa, A. Gobbi, P. Zorzi, S. Burg, F. Briere, G. Carra, and G. Trinchieri The Reciprocal Interaction of NK Cells with Plasmacytoid or Myeloid Dendritic Cells Profoundly Affects Innate Resistance Functions J. Immunol., January 15, 2005; 174(2): 727 - 734. [Abstract] [Full Text] [PDF]

				A. T. Kamath, C. E. Sheasby, and D. F. Tough Dendritic Cells and NK Cells Stimulate Bystander T Cell Activation in Response to TLR Agonists through Secretion of IFN-{alpha}{beta} and IFN-{gamma} J. Immunol., January 15, 2005; 174(2): 767 - 776. [Abstract] [Full Text] [PDF]

				K. McKenna, A.-S. Beignon, and N. Bhardwaj Plasmacytoid Dendritic Cells: Linking Innate and Adaptive Immunity J. Virol., January 1, 2005; 79(1): 17 - 27. [Full Text] [PDF]

				N. Dikopoulos, A. Bertoletti, A. Kroger, H. Hauser, R. Schirmbeck, and J. Reimann Type I IFN Negatively Regulates CD8+ T Cell Responses through IL-10-Producing CD4+ T Regulatory 1 Cells J. Immunol., January 1, 2005; 174(1): 99 - 109. [Abstract] [Full Text] [PDF]

				V. Hornung, J. Schlender, M. Guenthner-Biller, S. Rothenfusser, S. Endres, K.-K. Conzelmann, and G. Hartmann Replication-Dependent Potent IFN-{alpha} Induction in Human Plasmacytoid Dendritic Cells by a Single-Stranded RNA Virus J. Immunol., November 15, 2004; 173(10): 5935 - 5943. [Abstract] [Full Text] [PDF]

				D. Pannetier, C. Faure, M.-C. Georges-Courbot, V. Deubel, and S. Baize Human Macrophages, but Not Dendritic Cells, Are Activated and Produce Alpha/Beta Interferons in Response to Mopeia Virus Infection J. Virol., October 1, 2004; 78(19): 10516 - 10524. [Abstract] [Full Text] [PDF]

				E. A. Moseman, X. Liang, A. J. Dawson, A. Panoskaltsis-Mortari, A. M. Krieg, Y.-J. Liu, B. R. Blazar, and W. Chen Human Plasmacytoid Dendritic Cells Activated by CpG Oligodeoxynucleotides Induce the Generation of CD4+CD25+ Regulatory T Cells J. Immunol., October 1, 2004; 173(7): 4433 - 4442. [Abstract] [Full Text] [PDF]

				F. Fallarino, C. Asselin-Paturel, C. Vacca, R. Bianchi, S. Gizzi, M. C. Fioretti, G. Trinchieri, U. Grohmann, and P. Puccetti Murine Plasmacytoid Dendritic Cells Initiate the Immunosuppressive Pathway of Tryptophan Catabolism in Response to CD200 Receptor Engagement J. Immunol., September 15, 2004; 173(6): 3748 - 3754. [Abstract] [Full Text] [PDF]

				J. Dai, N. J. Megjugorac, S. B. Amrute, and P. Fitzgerald-Bocarsly Regulation of IFN Regulatory Factor-7 and IFN-{alpha} Production by Enveloped Virus and Lipopolysaccharide in Human Plasmacytoid Dendritic Cells J. Immunol., August 1, 2004; 173(3): 1535 - 1548. [Abstract] [Full Text] [PDF]

				N. Teleshova, J. Jones, J. Kenney, J. Purcell, R. Bohm, A. Gettie, and M. Pope Short-term Flt3L treatment effectively mobilizes functional macaque dendritic cells J. Leukoc. Biol., June 1, 2004; 75(6): 1102 - 1110. [Abstract] [Full Text] [PDF]

				D. D. Anthony, N. L. Yonkers, A. B. Post, R. Asaad, F. P. Heinzel, M. M. Lederman, P. V. Lehmann, and H. Valdez Selective Impairments in Dendritic Cell-Associated Function Distinguish Hepatitis C Virus and HIV Infection J. Immunol., April 15, 2004; 172(8): 4907 - 4916. [Abstract] [Full Text] [PDF]

				S. Pichyangkul, K. Yongvanitchit, U. Kum-arb, H. Hemmi, S. Akira, A. M. Krieg, D. G. Heppner, V. A. Stewart, H. Hasegawa, S. Looareesuwan, et al. Malaria Blood Stage Parasites Activate Human Plasmacytoid Dendritic Cells and Murine Dendritic Cells through a Toll-Like Receptor 9-Dependent Pathway J. Immunol., April 15, 2004; 172(8): 4926 - 4933. [Abstract] [Full Text] [PDF]

				N. Chaput, N. E. C. Schartz, F. Andre, J. Taieb, S. Novault, P. Bonnaventure, N. Aubert, J. Bernard, F. Lemonnier, M. Merad, et al. Exosomes as Potent Cell-Free Peptide-Based Vaccine. II. Exosomes in CpG Adjuvants Efficiently Prime Naive Tc1 Lymphocytes Leading to Tumor Rejection J. Immunol., February 15, 2004; 172(4): 2137 - 2146. [Abstract] [Full Text] [PDF]