| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Laboratory of Experimental Immunology, Université Libre de Bruxelles, Brussels, Belgium
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
to LPS-stimulated newborn DC restored their expression of
IL-12(p35) and their synthesis of IL-12 (p70) up to adult levels.
Moreover, we observed that neonatal DC are less efficient than adult DC
to induce IFN- production by allogenic adult CD4+ T
cells. This defect was corrected by the addition of rIL-12. We conclude
that neonatal DC are characterized by a severe defect in
IL-12(p35) gene expression which is responsible for an
impaired ability to elicit IFN- production by T
cells. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
whereas
their synthesis of Th2-type cytokines can vary, depending on the
species and the Ag considered (2, 3, 4). Indeed, vaccinal
responses of newborn mice are clearly Th2 skewed under conditions
inducing Th1-type responses in adult animals (5). Although
human newborns also display Th2-type responses upon in utero contact
with environmental allergens (6), a recent study showed
the induction of IFN--secreting cells in children vaccinated at
birth with the Mycobacterium bovis bacillus
Calmette-Guérin vaccine (7).
Inherent T cell defects certainly contribute to the immunological
immaturity of the newborn as indicated by impaired tyrosine
phosphorylation (8) and hypermethylation of specific sites
in the promoter region of the IFN- gene (9).
Because myeloid dendritic cells
(DC)3 are essential
for the priming of naive T cells as well as for their differentiation
into Th1 cells through the synthesis of IL-12 (10), we
hypothesized that a DC defect could contribute to the impaired immune
responses of the human newborn. Herein, we approached this question by
analyzing DC generated from adherent cord blood mononuclear cells
(CBMC) cultured in the presence of GM-CSF and IL-4. Our finding that
newborn DC are profoundly deficient in the synthesis of the bioactive
dimeric form of IL-12(p70) led us to analyze their expression of
IL-12(p40) and IL-12(p35) at the gene level and to determine its
relevance to the observed defect.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Culture medium consisted of RPMI 1640 (BioWhittaker
Europe, Verviers, Belgium) supplemented with 2 mM
L-glutamine (Life Technologies, Paisly, U.K.),
gentamicin (20 µg/ml), 50 µM 2-ME, 1% nonessential amino acids
(Life Technologies), and 10% FBS (BioWhittaker). Recombinant IL-4
(24 x 106 IU/mg) and recombinant GM-CSF
(Leucomax, 16 x 103 IU/mg) were kindly
provided by Schering-Plough (Kenilworth, NJ). LPS from
Escherichia coli (0128:B12) was purchased from Sigma
(Bornem, Belgium). Recombinant human IL-12 and recombinant human
IFN- were purchased from R&D Systems (Abingdon, U.K.) and BioSource
Europe (Nivelles, Belgium), respectively. Poly(I:C) was purchased from
Sigma.
Cells
Human cord blood was obtained from the placentas of normal full-term deliveries at the obstetric department of the Erasme Hospital, Brussels. Adult PBMC were isolated from buffy coats obtained from local routine blood donations. Mononuclear cells were obtained from all samples by centrifugation over Ficoll-Hypaque gradients (Nycomed, Oslo, Norway).
Generation of DC from peripheral blood
DC were generated from PBMC or from CBMC, as described by Romani et al. (11). Briefly, PBMC and CBMC were resuspended in culture medium and allowed to adhere onto six-well plates or large Falcon flasks for larger number of cells. After 2 h at 37°C, nonadherent cells were removed and adherent cells were cultured in 3 ml or 20 ml of medium containing GM-CSF (800 U/ml) and IL-4 (500 U/ml). Every 2 days, 800 U GM-CSF and 500 U IL-4 were added. After 6 days of culture, nonadherent cells corresponding to the DC-enriched fraction were harvested, washed, and used for subsequent experiments. As previously reported (12), the DC-enriched fraction obtained according to this protocol routinely contains >90% of DC as assessed by morphology and FACS analysis.
Flow cytometric analysis
For immunophenotyping, cells were washed in PBS supplemented with 0.5% BSA and 10 mM NaN3 and incubated for 30 min at 4°C with one of the following murine mAbs: PE-conjugated anti-HLA-DR IgG2b mAb, PE-conjugated anti-CD40 IgG1 mAb (BioSource International, Camarillo, CA), PE-conjugated anti-CD86 (B7-2) IgG2b mAb (PharMingen, San Diego), PE-conjugated anti-CD80 (B7-1) IgG1 mAb, PE-conjugated anti-CD14 IgG2b mAb, PE-conjugated anti-CD54 IgG2b mAb, PE-conjugated anti-CD4 IgG1 mAb, PE-conjugated anti-CD11c IgG1 mAb (Becton Dickinson, Mountain View, CA), PE-conjugated anti-CD1a IgG2a mAb (Dako, Prosan, Belgium), and PE-conjugated anti-CD83 IgG2b mAb (Immunotech, Marseille, France). As controls, cells were stained with corresponding isotype-matched control mAbs. Analysis was done using a FACScalibur flow cytometer (Becton Dickinson).
Cytokine determination
ELISA kits were purchased from BioSource Europe for
quantification of TNF-
, IL-6, and IL-8. The detection limit for
these three assays was 20 pg/ml. IL-12(p70) production was measured by
ELISA kits provided by Endogen (Woburn, MA; detection limit 2 pg/ml).
IFN-, IL-5, and IL-12(p40) concentrations were measured by two-site
sandwich ELISA systems using Abs from BioSource Europe (Cytoscreen;
detection limit for these three assays was 10 pg/ml). IL-10 and IL-2
were detected by sandwich ELISA systems using Abs from PharMingen and
R&D Systems, respectively (detection limit for these assays was 10
pg/ml). For determination of IL-2 levels, anti-IL-2 receptor mAb
(used as 1:200 dilution of ascitic fluid) was added in cultures
(13).
Cell stimulations
DC generated from adherent PBMC or CBMC were cultured at a final concentration of 4 x 105 cells/ml with or without LPS (1 µg/ml) in 24-well plates. After 24 h of culture, supernatants were recovered for determination of cytokine levels.
For the CD40-mediated activation, 3T6 cells transfected with the gene encoding the CD40 ligand (3T6-CD40 ligand transfectants) were used to induce CD40 triggering on DC. Untransfected 3T6 cells were used for control cultures (data not shown). 3T6 cells (5 x 104) were cocultured with 2 x 105 DC/well (24-well culture plate) in 1 ml of culture medium. Poly(I:C) was used at a final concentration of 20 µg/ml. After 3 days of incubation, supernatants were collected for determination of cytokine levels. For RT-PCR experiments, cells were incubated for a period of 8 h.
Quantification of IL-12 p35, IL-12 p40, and 
-actin mRNA levels
by real-time PCR
At the end of cell culture, total cellular RNA was extracted by
using the Tripure reagent (Roche Diagnostics, Brussels, Belgium)
according to the manufacturer’s instructions. Reverse transcription
was then conducted as follows: 8 µl of water containing 500 ng of
total RNA was added to 2 µl of oligo(dT) primer (0.5 µg/µl) and
incubated at 65°C for 10 min. Samples were chilled on ice and 10 µl
of RT mix containing the following components were added: 1) 4 µl of
5x RT buffer (250 mM Tris-HCl (pH 8.3), 375 mM KCl, and 15 mM
MgCl2); 2) 2 µl of deoxynucleotide triphosphate
mix (10 mM each); 3) 0.2 µl of BSA (1 mg/ml); 4) 0.5 µl (25 U) of
human placental ribonuclease inhibitor (RNAguard; Amersham Pharmacia
Biotech Benelux, Roosendaal, The Netherlands); 5) 1 µl (200 U) of
Moloney murine leukemia virus reverse transcriptase (Life
Technologies); and 6) 0.3 µl of H2O. The
samples were then incubated at 37°C for 60 min. The real-time PCR was
conducted on a Lightcycler apparatus (Roche Diagnostics) with a
dual-labeled fluorogenic probe in a 20-µl final volume containing: 1)
1 µl of cDNA, 2) 2 µl of sense and 3 µl of antisense primer (6
pmol/µl each), 3) 2 µl of master hybridization probes reagent
(Roche Diagnostics), 4) 5 µl of 25 mM MgCl2, 5)
1 µl of bifluorescent probe (4 pmol/µl), 6) 0.32 µl of TaqStart
Ab (Clontech, Palo Alto, Ca), and 7) H2O up to 20
µl. After an initial denaturation step at 95°C for 30 s,
temperature cycling was initiated. Each cycle consisted in 95°C for
0 s and 60°C for 20 s, the fluorescence being read at the
end of this second step (F1/F2 channels). A total of 45 cycles was
performed. The oligonucleotide sequences were used for IL-12 p35 and
p40, respectively: sense primers, 5'-CTCCTGGACCACCTCAGTTTG-3' and
5'-CGGTCATCTGCCGCAAA-3'; antisense primers, 5'-
GGTGAAGGCATGGGAACATT -3' and 5'-TGCCCATTCGCTCCAAGA-3'; probes were
5'-(6-Fam) CCAGAAACCTCCCCGTGGCCA(Tamra)(phosphate)-3', and
5'-(6-Fam) CGGGCCCAGGACCGCTACTATAGCT(Tamra)(phosphate)-3'. The
real-time PCR for -actin was performed in the same way, except for
the following reagents: 2 µl of cDNA, 4 µl of 25 mM
MgCl2, and a 1-µl -actin kit containing
primers and probe (Applied Biosystems; PE, Norwalk, CT).
IL-12 mRNA (p35 or p40) levels were expressed as the absolute number of
copies normalized against -actin mRNA. This was achieved by
generating standard curves from serial dilutions of standards. These
standards consisted in PCR products that included the IL-12 p35 or p40
amplicon and that were purified following standard procedures. Primer
sequences for IL-12 p35 and p40 standard were, respectively: sense,
5'-AGCCTCCTCCTTGTGGCTA-3' and 5'-GCTGGGAGTACCCTGACAC-3'; antisense,
5'-TGTGCTGGTTTTATCTTTTGTG-3' and 5'-TTGGGTCTATTCCGTTGTGT-3'. For
-actin, the serial dilutions were made from a purified plasmid (ATCC
clone 77644).
Threshold cycle values (calculated using the Lightcycler software in "arithmetic fit-point analysis") were converted to a number of mRNA copies by comparison to the respective standard curve.
DC-T cell cocultures
Responder cells were CD4+ T lymphocytes purified from PBMC of healthy adult donors by a negative selection using a mixture of hapten-conjugated Abs (including anti-CD8, anti-CD11b, anti-CD16, anti-CD19, anti-CD39, and anti-CD56 Abs), MACS microbeads coupled to anti-hapten mAbs, and a MACS column (Miltenyi Biotec, Palo Alto, CA). Purity of CD4+ T cells was >90% as assessed by FACS analysis. Stimulator cells were allogenic DC generated from adherent PBMC or CBMC, washed, and irradiated (3000 rad). Purified CD4+ T cells were then cocultured with DC at a ratio of 10:1. When mentioned, rIL-12 (10 ng/ml) was added at the beginning of the cultures. After 5 days at 37°C, cell proliferation was assessed by uptake of [3H]thymidine and culture supernatants were collected for determination of cytokine levels.
Statistical analysis
Data were compared using unpaired (Mann-Whitney U) or paired (Wilcoxon) nonparametric tests.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In preliminary experiments, we characterized the starting
population of plastic-adherent CBMC by flow cytometry. In a typical
experiment, these cells consisted of 68% monocytes as indicated by
CD14 and CD33 expression, 12% CD3+ T cells, 5%
CD19+ B cells, and <1%
CD56+ NK cells and CD34+
cells. This composition was similar to that observed with adherent
adult PBMC. Plastic-adherent monocytes from adult PBMC cultured for 6
days in GM-CSF and IL-4 have been characterized as immature DC
(11). We found out that cells generated in the same
conditions from adherent CBMC also expressed surface markers of
immature myeloid DC such as CD11c, CD1a, HLA-DR, CD40, CD80, CD86, CD4,
and CD54 molecules as determined by flow cytometry (Fig. 1
). CD14 and CD83 expression was low or
absent on both adult and newborn DC. When compared with adult
PBMC-derived DC, the only significant differences were reduced surface
expression of HLA-DR, CD80, and CD40 (Table I). The phenotype of DC generated from
highly purified cord blood monocytes was similar to that of DC
generated from adherent CBMC (data not shown), indicating that the
neonatal DC used in ensuing experiments are of monocyte origin as in
the case of adult DC derived from PBMC.
|
|
In the absence of stimulus, spontaneous production of IL-12(p70),
TNF-, IL-10, and IL-6 was below detection levels both in adult and
neonatal DC, whereas their synthesis of IL-8 did not significantly
vary. In contrast, spontaneous production of IL-12(p40) was
significantly lower in neonatal DC (Table II). In accordance with previous reports,
LPS and CD40 ligation strongly stimulate the production of cytokines by
DC (14, 15). As shown in Table II, newborn and adult DC
produced comparable levels of IL-6, IL-8, TNF-, and IL-10 in
either condition. As far as IL-12(p40) is concerned, levels secreted by
neonatal DC were significantly lower upon LPS activation but not upon
CD40 ligation (Table II). The most dramatic difference was observed for
IL-12(p70) which was produced at much lower levels by neonatal DC than
by adult DC under both conditions of stimulation. In an additional
experiment using poly(I:C) as DC stimulus, we confirmed that neonatal
DC are deficient in the synthesis of IL-12(p70) whereas their
production of IL-12 (p40) was similar to that of adult DC in that
scheme (Table II).
|
To evaluate the consequences of the reduced capacity to produce
IL-12, we prepared MLC with DC as stimulators and purified adult
CD4+ T cells as responders. First we observed in
three independent experiments that neonatal DC were as efficient as
adult DC in inducing T cell proliferation (data not shown). However,
the profile of cytokines that they elicited was different. As shown in
Table III, neonatal DC induced
significantly lower levels of IFN- and higher IL-10 levels than
adult DC. There was a trend toward the induction of lower IL-2 levels
by neonatal DC, although the difference vs adult DC did not reach
statistical significance. IL-5 production induced in MLC by neonatal
and adult DC was similar.
|
(10), we tested the effects of the addition of rIL-12 in
MLC. As shown in Table III
, rIL-12 strongly up-regulated the production
of IFN- in MLC both in adult and neonatal DC. Indeed, the capacity
of neonatal DC to induce IFN- production was similar to that of
adult DC under this condition, indicating that the impaired synthesis
of IL-12 by neonatal DC is involved in their reduced ability to elicit
IFN- production by T cells. The addition of IL-12 also resulted in
increased production of IL-2 and IL-10 in MLC. The trend toward
decreased induction of IL-2 and increased induction of IL-10 by
neonatal DC was still observed, although it did not reach statistical
significance under this condition.
rIFN- stimulates IL-12(p70) synthesis by neonatal DC
It has been shown that the synthesis of IL-12 by adult
monocyte-derived DC can be primed by IFN- (16). As
shown in Fig. 2, addition of exogenous
rIFN-, even at low concentrations, strongly up-regulated LPS-induced
IL-12(p70) production by both adult and newborn DC. Indeed, under the
LPS + IFN- condition, IL-12(p70) production by neonatal DC reached
levels similar to that secreted by adult DC. In control experiments, we
found out that IFN- alone did not induce IL-12(p70) synthesis either
in neonatal or in adult DC.
|
To further consider the molecular basis of the deficient
IL-12(p70) synthesis by neonatal DC, RT-PCR analysis was performed to
measure IL-12(p40) and IL-12(p35) mRNA levels. As shown in Fig. 3, IL-12(p40) mRNA levels were strongly
up-regulated by LPS in adult and newborn DC. In marked contrast,
IL-12(p35) mRNA was not up-regulated upon LPS stimulation in neonatal
DC so that IL-12 (p35) mRNA levels were significantly lower in
LPS-stimulated neonatal DC as compared with adult cells. Similar
observations were made when DC were stimulated by poly(I:C). Indeed,
under this condition, tested on six different donors in each group,
median (25–75th quantiles) IL-12(p35) mRNA levels were 73,493
581–121(64,581–121,113) and 14,695 451–20(5,451–20,188)
copies/106 copies of -actin for adult and
neonatal DC, respectively (p < 0.01),
whereas median (25–75th quantiles) IL-12(p40) mRNA levels were
130,552 437–166(72,437–166,207) and 227,780 993–276(141,993–276,834)
copies/106 copies of -actin for adult and
neonatal DC, respectively. Interestingly, the addition of rIFN-
completely restored IL-12(p35) gene expression in
LPS-stimulated neonatal DC. These results indicate that the impaired
IL-12(p70) synthesis by neonatal DC is directly related to a repressed
IL-12(p35) gene expression which can be overcome by
IFN--induced signals.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Bioactive IL-12 is a heterodimeric cytokine composed of two subunits, p35 and p40, encoded by different genes. Both subunits must be expressed in the same cell to generate the bioactive form of the cytokine. Until recently, IL-12 synthesis in monocytic cells was thought to be mainly regulated at the level of p40 gene expression (19). However, the expression of both subunits was shown to be tightly controlled in human monocytes, the induction of the p35 chain being required for their production of bioactive IL-12(p70) (20, 21). Posttranscriptional events appear critical for the control of the IL-12(p40) chain. Indeed, the impaired IL-12(p40) chain synthesis by LPS-stimulated CBMC was previously shown to be related to decreased p40 mRNA stability (22). We also observed a defect of IL-12(p40) synthesis in neonatal DC at least at the basal state and upon LPS stimulation. Our finding of a normal IL-12(p40) gene expression under these conditions is consistent with a predominantly posttranscriptional control.
The defect in IL-12(p70) synthesis by neonatal DC was much more pronounced than that of IL-12(p40). This was observed for the three conditions of DC stimulation that we tested. In the case of poly(I:C), the average levels of IL-12(p40) secreted by neonatal DC were even higher, although not significantly, than those produced by adult DC, indicating that impaired synthesis of the p40 chain is unlikely to be the main mechanism responsible for their deficient IL-12(p70) synthesis.
Indeed, using a real-time PCR technique, we showed a major defect in
the expression of the IL-12(p35) gene in neonatal DC whereas
the expression of the IL-12(p40) gene was similar to that of
adult DC. Regulation of human IL-12(p35) gene expression is
poorly characterized but it has been reported that
IL-12(p35) transcription can be initiated from different
sites (23, 24). A constitutively active CpG-rich promoter
region was identified 5' of the TATA box in EBV-transformed
lymphoblastoid cells (24). In human monocytes, priming of
IL-12(p35) synthesis by IFN- was shown to rely on an alternative
TATA-dependent promoter. Our observation that rIFN- restored the
ability of neonatal DC to express IL-12(p35) suggests that this pathway
is operative in those cells. There is compelling evidence that DNA
methylation has a repressive action on gene expression (reviewed in
Ref. 25). As far as the immune system is concerned, the
low capacity of thymocytes, cord blood, and naive adult T cells to
produce IFN- has been correlated with hypermethylation of CpG sites
of the IFN- gene (9). We plan to explore in the near
future the methylation status of CpG sites upstream of the coding
sequence of the p35 gene to determine whether a similar phenomenon
could be involved, at least partly, in the deficient IL-12 synthesis by
neonatal DC.
The results of our MLC experiments strongly suggest that the impaired
IL-12 production by neonatal DC could contribute to the deficient
production of IFN- observed during most T cell responses induced in
newborns. Other DC defects, including the decreased HLA-DR, CD80, and
CD40 expression observed in the present study, could be involved in the
immunological immaturity of neonates. Along this line, Hunt et al.
(26) previously demonstrated that unseparated low-density
cord blood cells enriched in DC have a decreased capacity to elicit T
cell proliferation. Indeed, we are currently extending the analysis of
IL-12 synthesis to freshly isolated cord blood DC.
Our observations might be relevant to the increased susceptibility of
newborns to intracellular pathogens but also have important
implications for the development of new strategies in early life
immunization. Indeed, the demonstration that IFN- restores the
capacity of neonatal DC to produce bioactive IL-12 suggests that either
rIFN- or adjuvants inducing IFN- in an IL-12-independent manner
might overcome the inability of the human newborn to develop efficient
Th1-type responses.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Michel Goldman, Department of Immunology, Hôpital Erasme, 808, route de Lennik, B-1070 Brussels, Belgium.
3 Abbreviations used in this paper: DC, dendritic cell; CBMC, cord blood mononuclear cells.
Received for publication July 31, 2000. Accepted for publication November 9, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
gene correlates with its expression by primary T-lineage cells. Eur. J. Immunol. 25:426.[Medline]
-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J. Exp. Med. 178:1041. of lipopolysaccharide-inducible p35 and p40 genes. Blood 86:646., natural killer, and lymphokine-activated killer activity by IL-12 in cord blood mononuclear cells. Blood 88:945.-dependent inducible expression of the human interleukin-12 p35 gene in monocytes initiates from a TATA-containing promoter distinct from the CpG-rich promoter active in Epstein-Barr virus-transformed lymphoblastoid cells. Blood 91:4645.This article has been cited by other articles:
|
|
 |
|
  T. R. Kollmann, J. Crabtree, A. Rein-Weston, D. Blimkie, F. Thommai, X. Y. Wang, P. M. Lavoie, J. Furlong, E. S. Fortuno III, A. M. Hajjar, et al. Neonatal Innate TLR-Mediated Responses Are Distinct from Those of Adults J. Immunol., December 1, 2009; 183(11): 7150 - 7160. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M'Rabet, A. P. Vos, G. Boehm, and J. Garssen Breast-Feeding and Its Role in Early Development of the Immune System in Infants: Consequences for Health Later in Life J. Nutr., September 1, 2008; 138(9): 1782S - 1790S. [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Goldberg, O. Nadiv, N. Luknar-Gabor, G. Zadik-Mnuhin, J. Tovbin, and Y. Katz Correlation of Th1-Type Cytokine Expression and Induced Proliferation to Lipopolysaccharide Am. J. Respir. Cell Mol. Biol., June 1, 2008; 38(6): 733 - 737. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Hartigan-O'Connor, K. Abel, and J. M. McCune Suppression of SIV-specific CD4+ T cells by infant but not adult macaque regulatory T cells: implications for SIV disease progression J. Exp. Med., October 29, 2007; 204(11): 2679 - 2692. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. H. M. L. P. Navarathna, K. W. Nickerson, G. E. Duhamel, T. R. Jerrels, and T. M. Petro Exogenous Farnesol Interferes with the Normal Progression of Cytokine Expression during Candidiasis in a Mouse Model Infect. Immun., August 1, 2007; 75(8): 4006 - 4011. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. C. Miles, M. van der Sande, D. Jeffries, S. Kaye, J. Ismaili, O. Ojuola, M. Sanneh, E. S. Touray, P. Waight, S. Rowland-Jones, et al. Cytomegalovirus Infection in Gambian Infants Leads to Profound CD8 T-Cell Differentiation J. Virol., June 1, 2007; 81(11): 5766 - 5776. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. C. Matthews, U. F. Power, and D. J. Reen Neonatal human autologous dendritic cells pulsed with recombinant protein antigen prime the generation of non-polarized CD4 T-cell effectors Int. Immunol., June 1, 2007; 19(6): 703 - 712. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Johnson, V. Albarani, M. Nguyen, M. Goldman, F. Willems, and E. Aksoy Protein Kinase C{alpha} Is Involved in Interferon Regulatory Factor 3 Activation and Type I Interferon-beta Synthesis J. Biol. Chem., May 18, 2007; 282(20): 15022 - 15032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhang, E. Deriaud, X. Jiao, D. Braun, C. Leclerc, and R. Lo-Man Type I interferons protect neonates from acute inflammation through interleukin 10-producing B cells J. Exp. Med., May 14, 2007; 204(5): 1107 - 1118. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Aksoy, V. Albarani, M. Nguyen, J.-F. Laes, J.-L. Ruelle, D. De Wit, F. Willems, M. Goldman, and S. Goriely Interferon regulatory factor 3-dependent responses to lipopolysaccharide are selectively blunted in cord blood cells Blood, April 1, 2007; 109(7): 2887 - 2893. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Bonhoeffer, C-A Siegrist, and P T Heath Immunisation of premature infants Arch. Dis. Child., November 1, 2006; 91(11): 929 - 935. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. P. Breitling, R. Fendel, B. Mordmueller, A. A. Adegnika, P. G. Kremsner, and A. J. F. Luty Cord Blood Dendritic Cell Subsets in African Newborns Exposed to Plasmodium falciparum In Utero. Infect. Immun., October 1, 2006; 74(10): 5725 - 5729. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-D. Park, L. Marti, J. Kurtzberg, and P. Szabolcs In vitro priming and expansion of cytomegalovirus-specific Th1 and Tc1 T cells from naive cord blood lymphocytes Blood, September 1, 2006; 108(5): 1770 - 1773. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Vakkila, R. Jaffe, M. Michelow, and M. T. Lotze Pediatric cancers are infiltrated predominantly by macrophages and contain a paucity of dendritic cells: a major nosologic difference with adult tumors. Clin. Cancer Res., April 1, 2006; 12(7): 2049 - 2054. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. W. Upham, A. Rate, J. Rowe, M. Kusel, P. D. Sly, and P. G. Holt Dendritic Cell Immaturity during Infancy Restricts the Capacity To Express Vaccine-Specific T-Cell Memory Infect. Immun., February 1, 2006; 74(2): 1106 - 1112. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Goriely, C. Molle, M. Nguyen, V. Albarani, N. O. Haddou, R. Lin, D. De Wit, V. Flamand, F. Willems, and M. Goldman Interferon regulatory factor 3 is involved in Toll-like receptor 4 (TLR4)- and TLR3-induced IL-12p35 gene activation Blood, February 1, 2006; 107(3): 1078 - 1084. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Caprio-Young, J. J. Bell, H.-H. Lee, J. Ellis, D. Nast, G. Sayler, B. Min, and H. Zaghouani Neonatally Primed Lymph Node, but Not Splenic T Cells, Display a Gly-Gly Motif within the TCR {beta}-Chain Complementarity-Determining Region 3 That Controls Affinity and May Affect Lymphoid Organ Retention J. Immunol., January 1, 2006; 176(1): 357 - 364. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. G. Holt Developmental factors as determinants of risk for infections and atopy in childhood Eur. Respir. Rev., December 1, 2005; 14(95): 69 - 73. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. M. Openshaw and J. S. Tregoning Immune Responses and Disease Enhancement during Respiratory Syncytial Virus Infection Clin. Microbiol. Rev., July 1, 2005; 18(3): 541 - 555. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Malhotra, P. Mungai, E. Muchiri, J. Ouma, S. Sharma, J. W. Kazura, and C. L. King Distinct Th1- and Th2-Type Prenatal Cytokine Responses to Plasmodium falciparum Erythrocyte Invasion Ligands Infect. Immun., June 1, 2005; 73(6): 3462 - 3470. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Li, Y.-J. Kim, and H. E. Broxmeyer Macrophage Colony-Stimulating Factor Drives Cord Blood Monocyte Differentiation into IL-10highIL-12absent Dendritic Cells with Tolerogenic Potential J. Immunol., April 15, 2005; 174(8): 4706 - 4717. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Brustoski, U. Moller, M. Kramer, A. Petelski, S. Brenner, D. R. Palmer, M. Bongartz, P. G. Kremsner, A. J. F. Luty, and U. Krzych IFN-{gamma} and IL-10 Mediate Parasite-Specific Immune Responses of Cord Blood Cells Induced by Pregnancy-Associated Plasmodium falciparum Malaria J. Immunol., February 1, 2005; 174(3): 1738 - 1745. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. J. Nonnecke, W. R. Waters, M. R. Foote, M. V. Palmer, B. L. Miller, T. E. Johnson, H. B. Perry, and M. A. Fowler Development of an Adult-Like Cell-Mediated Immune Response in Calves After Early Vaccination with Mycobacterium bovis bacillus Calmette-Guerin J Dairy Sci, January 1, 2005; 88(1): 195 - 210. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Kampmann, G. N. Tena, S. Mzazi, B. Eley, D. B. Young, and M. Levin Novel Human In Vitro System for Evaluating Antimycobacterial Vaccines Infect. Immun., November 1, 2004; 72(11): 6401 - 6407. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Chang-Rodriguez, R. Ecker, G. Stingl, and A. Elbe-Burger Autocrine IL-10 partially prevents differentiation of neonatal dendritic epidermal leukocytes into Langerhans cells J. Leukoc. Biol., September 1, 2004; 76(3): 657 - 666. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Regner, X. Martinez, E. Belnoue, C.-M. Sun, F. Boisgerault, P.-H. Lambert, C. Leclerc, and C.-A. Siegrist Partial Activation of Neonatal CD11c+ Dendritic Cells and Induction of Adult-Like CD8+ Cytotoxic T Cell Responses by Synthetic Microspheres J. Immunol., August 15, 2004; 173(4): 2669 - 2674. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. L. Young, M. A. Simon, M. A. Baird, G. W. Tannock, R. Bibiloni, K. Spencely, J. M. Lane, P. Fitzharris, J. Crane, I. Town, et al. Bifidobacterial Species Differentially Affect Expression of Cell Surface Markers and Cytokines of Dendritic Cells Harvested from Cord Blood Clin. Vaccine Immunol., July 1, 2004; 11(4): 686 - 690. [Abstract] [Full Text]
|
|
|
|
|
|
R. L. Chelvarajan, S. M. Collins, I. E. Doubinskaia, S. Goes, J. Van Willigen, D. Flanagan, W. J. S. de Villiers, J. S. Bryson, and S. Bondada Defective macrophage function in neonates and its impact on unresponsiveness of neonates to polysaccharide antigens J. Leukoc. Biol., June 1, 2004; 75(6): 982 - 994. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Goriely, C. Van Lint, R. Dadkhah, M. Libin, D. De Wit, D. Demonte, F. Willems, and M. Goldman A Defect in Nucleosome Remodeling Prevents IL-12(p35) Gene Transcription in Neonatal Dendritic Cells J. Exp. Med., April 5, 2004; 199(7): 1011 - 1016. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. De Wit, V. Olislagers, S. Goriely, F. Vermeulen, H. Wagner, M. Goldman, and F. Willems Blood plasmacytoid dendritic cell responses to CpG oligodeoxynucleotides are impaired in human newborns Blood, February 1, 2004; 103(3): 1030 - 1032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Dakic, Q.-x. Shao, A. D'Amico, M. O'Keeffe, W.-f. Chen, K. Shortman, and L. Wu Development of the Dendritic Cell System during Mouse Ontogeny J. Immunol., January 15, 2004; 172(2): 1018 - 1027. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Jullien, R. Q. Cron, K. Dabbagh, A. Cleary, L. Chen, P. Tran, P. Stepick-Biek, and D. B. Lewis Decreased CD154 expression by neonatal CD4+ T cells is due to limitations in both proximal and distal events of T cell activation Int. Immunol., December 1, 2003; 15(12): 1461 - 1472. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. M. Buddle, D. N. Wedlock, N. A. Parlane, L. A. L. Corner, G. W. de Lisle, and M. A. Skinner Revaccination of Neonatal Calves with Mycobacterium bovis BCG Reduces the Level of Protection against Bovine Tuberculosis Induced by a Single Vaccination Infect. Immun., November 1, 2003; 71(11): 6411 - 6419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Salio, N. Dulphy, J. Renneson, M. Herbert, A. McMichael, A. Marchant, and V. Cerundolo Efficient priming of antigen-specific cytotoxic T lymphocytes by human cord blood dendritic cells Int. Immunol., October 1, 2003; 15(10): 1265 - 1273. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Bell, B. Min, R. K. Gregg, H.-H. Lee, and H. Zaghouani Break of Neonatal Th1 Tolerance and Exacerbation of Experimental Allergic Encephalomyelitis by Interference with B7 Costimulation J. Immunol., August 15, 2003; 171(4): 1801 - 1808. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-M. Sun, L. Fiette, M. Tanguy, C. Leclerc, and R. Lo-Man Ontogeny and innate properties of neonatal dendritic cells Blood, July 15, 2003; 102(2): 585 - 591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Goriely, D. Demonte, S. Nizet, D. De Wit, F. Willems, M. Goldman, and C. Van Lint Human IL-12(p35) gene activation involves selective remodeling of a single nucleosome within a region of the promoter containing critical Sp1-binding sites Blood, June 15, 2003; 101(12): 4894 - 4902. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Adkins, T. Williamson, P. Guevara, and Y. Bu Murine Neonatal Lymphocytes Show Rapid Early Cell Cycle Entry and Cell Division J. Immunol., May 1, 2003; 170(9): 4548 - 4556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Vollstedt, M. Franchini, H. P. Hefti, B. Odermatt, M. O'Keeffe, G. Alber, B. Glanzmann, M. Riesen, M. Ackermann, and M. Suter Flt3 Ligand-treated Neonatal Mice Have Increased Innate Immunity Against Intracellular Pathogens and Efficiently Control Virus Infections J. Exp. Med., March 3, 2003; 197(5): 575 - 584. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Mascart, V. Verscheure, A. Malfroot, M. Hainaut, D. Pierard, S. Temerman, A. Peltier, A.-S. Debrie, J. Levy, G. Del Giudice, et al. Bordetella pertussis Infection in 2-Month-Old Infants Promotes Type 1 T Cell Responses J. Immunol., February 1, 2003; 170(3): 1504 - 1509. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. W. Upham, P. T. Lee, B. J. Holt, T. Heaton, S. L. Prescott, M. J. Sharp, P. D. Sly, and P. G. Holt Development of Interleukin-12-Producing Capacity throughout Childhood Infect. Immun., December 1, 2002; 70(12): 6583 - 6588. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Karlsson, C. Hessle, and A. Rudin Innate Immune Responses of Human Neonatal Cells to Bacteria from the Normal Gastrointestinal Flora Infect. Immun., December 1, 2002; 70(12): 6688 - 6696. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P.G. Holt and P. D. Sly Interactions between RSV Infection, Asthma, and Atopy: Unraveling the Complexities J. Exp. Med., November 18, 2002; 196(10): 1271 - 1275. [Full Text] [PDF]
|
|
|
|
|
|
F. J. Culley, J. Pollott, and P. J.M. Openshaw Age at First Viral Infection Determines the Pattern of T Cell-mediated Disease during Reinfection in Adulthood J. Exp. Med., November 18, 2002; 196(10): 1381 - 1386. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Adkins, Y. Bu, and P. Guevara Murine Neonatal CD4+ Lymph Node Cells Are Highly Deficient in the Development of Antigen-Specific Th1 Function in Adoptive Adult Hosts J. Immunol., November 1, 2002; 169(9): 4998 - 5004. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wysocka, M. H. Zaki, L. E. French, J. Chehimi, M. Shapiro, S. E. Everetts, K. S. McGinnis, L. Montaner, and A. H. Rook Sezary syndrome patients demonstrate a defect in dendritic cell populations: effects of CD40 ligand and treatment with GM-CSF on dendritic cell numbers and the production of cytokines Blood, October 16, 2002; 100(9): 3287 - 3294. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. McDowell, M. Marovich, R. Lira, M. Braun, and D. Sacks Leishmania Priming of Human Dendritic Cells for CD40 Ligand-Induced Interleukin-12p70 Secretion Is Strain and Species Dependent Infect. Immun., August 1, 2002; 70(8): 3994 - 4001. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Jakobsen, S. Bjarnarson, G. Del Giudice, M. Moreau, C.-A. Siegrist, and I. Jonsdottir Intranasal Immunization with Pneumococcal Conjugate Vaccines with LT-K63, a Nontoxic Mutant of Heat-Labile Enterotoxin, as Adjuvant Rapidly Induces Protective Immunity against Lethal Pneumococcal Infections in Neonatal Mice Infect. Immun., March 1, 2002; 70(3): 1443 - 1452. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. H. Smits, E. C. de Jong, J. H. N. Schuitemaker, T. B. H. Geijtenbeek, Y. van Kooyk, M. L. Kapsenberg, and E. A. Wierenga Intercellular Adhesion Molecule-1/LFA-1 Ligation Favors Human Th1 Development J. Immunol., February 15, 2002; 168(4): 1710 - 1716. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. O. C. Ota, J. Vekemans, S. E. Schlegel-Haueter, K. Fielding, M. Sanneh, M. Kidd, M. J. Newport, P. Aaby, H. Whittle, P.-H. Lambert, et al. Influence of Mycobacteriumbovis Bacillus Calmette-Guerin on Antibody and Cytokine Responses to Human Neonatal Vaccination J. Immunol., January 15, 2002; 168(2): 919 - 925. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
