| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Cell Autoimmunity by Plasmid DNA Vaccination1
*
Department of Microbiology and Immunology, University of North Carolina, Chapel Hill, NC 27599;
Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892; and
The Jackson Laboratory, Bar Harbor, ME 04609
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
cell-specific Th2 regulatory cell function for the purpose
of preventing IDDM even at a late stage of disease
development. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
cells found in
the islets of Langerhans. The disease process is characterized by a
progressive infiltration of lymphocytes and monocytes into the islets
(insulitis), culminating in massive destruction of the cells
(1, 2, 3). Studies in the nonobese diabetic (NOD) mouse, a
spontaneous murine model for IDDM, have demonstrated that
CD4+ and CD8+ T cells are
the primary mediators of cell destruction (for review, see Ref.
4). Furthermore, temporal analyses indicate that only a
few cell autoantigens such as glutamic acid decarboxylase 65
(GAD65) and insulin are targeted in the early stages of disease
development by CD4+ T cells (5, 6).
However, as progression to IDDM occurs, several other cell proteins
are recognized. Nevertheless, T cell recognition of GAD65 and insulin
is believed to be important in the progression of both human and NOD
IDDM (7, 8, 9, 10, 11).
Diabetogenic CD4+ T cells typically exhibit a Th1
cell phenotype which is characterized by the secretion of large amounts
of IFN-
and IL-2 (12). Accordingly, it has been
suggested that cell-specific Th2 cells may have a regulatory role
in IDDM (12). It is well established that Th2 cells
suppress Th1 effector cell differentiation through secretion of IL-4
and IL-10 (13, 14). Furthermore, various studies have
provided evidence, albeit indirect, that Th2 cells may regulate the
diabetogenic response. For example, recent onset diabetics have been
reported to exhibit reduced IL-4 expression in peripheral T cells
(15), and an inverse correlation between cell-specific
T cell and Ab reactivity has been detected in these individuals
(16). Finally, diabetes can be prevented in NOD mice by a
number of conditions which are reported to promote Th2 effector cell
function such as systemic administration of IL-4 (17, 18)
or immunizing young animals with GAD65 or insulin (5, 6, 19).
Exploiting the regulatory function of cell-specific Th2 cells
may therefore provide an effective means to selectively prevent IDDM in
a clinical setting (20). This approach is advantageous
since regulatory T cells can be induced in an Ag-specific manner, which
in turn suppress the development of other cell-specific Th1
effector cells through a cytokine-mediated bystander mechanism. Indeed,
progression to overt IDDM can be suppressed in NOD mice at late
preclinical stages of disease by i.v. or i.p. injection of soluble
GAD65 or GAD65-specific peptides prepared in the appropriate adjuvant,
respectively (21, 22, 23). However, multiple immunizations
with relatively high doses of Ag or peptide are necessary to
effectively induce regulatory Th2 cells (22, 23).
Extrapolating a similar set of conditions to suppress established
cell autoimmunity in patients may prove to be highly problematic.
Recently, the application of plasmid DNA (pDNA) for the purpose of
vaccination has generated a great deal of interest. Immunization with
pDNA encoding an immunogen and/or cytokine has proven to be an
effective approach to elicit long-term T cell and Ab immunity in
infectious disease and cancer models (for review, see Ref.
24). A number of properties including 1) in vivo
persistence (25), 2) versatility in the choice of
the route of administration, 3) an intrinsic adjuvant effect (26, 27), and 4) the relative ease to construct and produce large
amounts of recombinants make the use of pDNAs an appealing strategy for
immunotherapy of autoimmune diseases. Indeed, initial reports have
demonstrated that induction of experimental autoimmune
encephalomyelitis can be prevented by immunizing rodents with pDNAs
encoding a variable -chain segment of an encephalogenic TCR
(28) or with epitopes derived from autoantigens used to
induce the disease process (29, 30). However, the efficacy
of pDNA immunization to suppress established autoimmunity was not
examined in these studies.
In the current study, we have assessed the efficacy of pDNA
immunization to promote and maintain cell-specific Th2 regulatory
cell function for the purpose of inhibiting IDDM. Here, we show that
administration of pDNA vaccines encoding a secreted form of GAD65 and
IL-4 can prevent and, more importantly, suppress established cell
autoimmunity in NOD mice. Long-term protection was associated with the
induction of GAD65-specific Th2 regulatory cells and was dependent on
both exogenous and endogenous IL-4.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The Jw4303 vector employed for this study contains a transcriptional unit composed of a CMV promoter/enhancer element and polyadenylation and transcriptional termination sequences derived from the bovine growth hormone gene (31). To facilitate expression of two cDNA inserts, the Jw4303 vector was modified to contain two individual transcriptional units. cDNA encoding full-length murine IL-4 was cloned from a CD4+ Th2 clone via RT-PCR and the nucleotide sequence confirmed. IgGFc fusion proteins were engineered using the signal pIg vector (R&D Systems, Minneapolis,MN) which contains a human CD33 signal sequence and genomic DNA consisting of the hinge, CH2, and CH3 exons derived from human IgG4. cDNA encoding murine GAD65 or hen egg lysozyme (HEL) spanning nt 656-1070 and 175–270, respectively, were PCR amplified with Pfu DNA polymerase (Strategene, La Jolla, CA). Oligonucleotide primers were used which contained the appropriate flanking restriction enzymes to subclone into the signal pIg vector and a splice donor sequence at the 3' end of the amplicons to facilitate splicing with IgGFc RNA. The resulting DNA constructs were then subcloned into the wild-type or modified Jw4303 vectors. To test expression and secretion of the GAD65-IgGFc and HEL-IgGFc fusion proteins, COS-7 cells were transfected with the respective pDNAs prepared in Lipofectamine (Life Technologies, Rockville, MD) in accordance with the manufacturer’s directions. Culture supernatants were harvested 2 days after transfection. The IgGFc fusion proteins were immunoprecipitated via protein G-Sepharose (Pharmacia, Piscataway, NJ), resolved on SDS-PAGE, and analyzed by Western blot using a mouse anti-human IgG-HRP conjugate (Jackson ImmunoResearch, West Grove, PA). Levels of IL-4 secretion in COS-7 culture supernatants were determined by an IL-4-specific capture ELISA.
Mice
NOD/Lt mice were housed and bred under specific
pathogen-free conditions and allowed access to National Institutes of
Health diet 31A (Purina, St. Louis, MO). Currently in our colony
maintained at the University of North Carolina, IDDM develops in
80% of NOD/Lt female mice by one year of age. Establishment and
screening of NOD mice homozygous for an inactivated IL-4 gene
(NOD.IL4null) have previously been described
(23).
Assessment of diabetes and insulitis
Mice were monitored weekly for the development of glycosuria with Ames Diastix (Fisher, Pittsburgh, PA). Glycosuric values of >3 for two successive measurements were considered diagnostic of diabetes onset. Insulitis was assessed by histology. Pancreata were prepared for histology by fixing in neutral-buffered Formalin and then embedding in paraffin. The fixed blocks were sectioned and stained with hematoxylin and eosin. A minimum of five sections, each differing by 90 µm, was cut for each block, and slides were viewed by light microscopy. A minimum of 30 individual islets was scored for each animal. The severity of insulitis was scored as either peri-insulitis (islets surrounded by a few lymphocytes) or intrainsulitis (lymphocytic infiltration into the interior of the islets).
Immunizations
pDNA was prepared from DH5
Escherichia coli using
a Qiagen endotoxin-free kit (Qiagen, Chatsworth, CA) and resuspended at
1.0 mg/ml in PBS. NOD or NOD.IL4null female mice
4 wk of age received three i.m. injections of 50 µl (50 µg) of pDNA
in each quadricep over 21 days. NOD female mice 12 wk of age were
similarly treated with the exception of receiving four i.m. injections
over a period of 28 days.
RT-PCR
Total cellular RNA was prepared from muscle tissue of individual
mice using TRIzol (Life Technologies), and treated with RNase-free
DNase. First-strand cDNA was synthesized using the SuperScript
preamplification system (Life Technologies) and oligo(dT) primers
according to the manufacturer’s instructions. First-strand cDNA
encoding either HEL-IgGFc or GAD65-IgGFc was subsequently
amplified by PCR using Taq DNA polymerase and
oligonucleotide primers specific for the 5' end of CD33
(CGGAATTCATGCCGCTGCTGCTACTGCTG) and the 3' end of IgG4
(CGGAATTCTCATTTACCCGGAGACAGGGAGAGGCTCTTCTGCGT). PCR cycling
conditions consisted of denaturation at 94°C for 1 min, annealing at
60°C for 1 min, and extension at 72°C for 2 min for 30 cycles, and
a final extension cycle at 72°C for 10 min. Using similar cycling
conditions, transcripts encoding IL-4 (forward primer,
TCGGCATTTTGAACGAGGTC; reverse primer, GAAAAGCCCGAAAGAGTCTC) and
-actin (forward primer, GCATTGTTACCAACTGGG; reverse primer,
GTCAGGATCTTCATGAGG) were also amplified. The PCR products were
resolved on a 1.5% agarose gel and detected by ethidium bromide
staining.
Ags
The cloning and preparation of murine cell autoantigens
GAD65, carboxypeptidase H (CPH), and heat shock protein (HSP) 60 have
been previously described (5). Briefly, the cDNAs were
engineered to encode six histidine residues at the COOH terminus of
each protein. Recombinant GAD65 and CPH were expressed in a baculovirus
expression system and purified using a
Ni2+-conjugated resin (Qiagen). HSP60 was
produced in an E. coli expression system and similarly
purified. Each recombinant protein was further purified by preparative
SDS-PAGE, electroeluted, and dialyzed extensively against PBS.
In vitro cytokine assay
Lymphocyte cytokine secretion in response to the panel of
cell autoantigens was determined as previously described
(23). Briefly, a spleen cell suspension was prepared from
individual mice in ice-cold PBS. The spleen cell suspension was
immediately centrifuged at 400 x g for 5 min at 4°C,
and resuspended at 2.5 x 106 cells/ml in
culture medium consisting of RPMI 1640 supplemented with 2%
Nutridoma-SP (Boehringer Mannheim, Indianapolis, IN), 5 x
10-5 M 2-ME, 1x nonessential amino acids, 1 mM
sodium pyruvate, and 100 U/ml penicillin. Spleen cells (0.2 ml/well)
were incubated in a 96-well flat-bottom microtiter plate in the
presence of 20 µg/ml cell autoantigen. Six wells were used for
each cell autoantigen. Culture supernatants were harvested and
pooled for each Ag treatment after 48 h, and a capture ELISA was
used to measure IFN-, IL-4, and IL-5 in 0.1 ml of culture
supernatant in duplicate. Abs were obtained from PharMingen (San Diego,
CA) and the ELISA was conducted as recommended by the manufacturer.
Standard curves were established to quantitate the amount of the
respective cytokines in the culture supernatants. The lower limit of
detection for IFN-, IL-4, and IL-5 was 50, 25, and 35 pg/ml,
respectively.
Enzyme-linked immunospot (ELISPOT)
ImmunoSpot M200 plates (Cellular Technology, Cleveland, OH) were
coated overnight at 4°C with either 2 µg/ml anti-IFN- Ab
(R4-6A2; PharMingen) or 4 µg/ml anti-IL-4 Ab (11B11; PharMingen)
prepared in PBS. Plates were blocked with 1% BSA/PBS for a minimum of
2 h at room temperature and then washed four times with PBS.
Spleen cells were prepared from individual mice as above with the
exception of being resuspended in HL-1 medium (BioWhittaker,
Walkersville, MD). Splenocytes were then plated at 5 x
105/well (0.2 ml/well). Pancreatic lymph nodes
were pooled within a given treatment group and the resulting suspension
was prepared in HL-1 medium and plated at 2.5 x
105/well with 5 x
105/well irradiated (3000 rad) splenocytes
harvested from NOD.IL4null mice. Ag was added to
triplicate wells at a final concentration of 20 µg/ml. The plates
were incubated for either 24 h (IFN-) or 48 h (IL-4) at 37°C,
in 5.5% CO2, and then washed three times with
PBS followed by an additional three washes with 0.025% Tween 20/PBS.
Biotinylated anti-IFN- (XMG1.2; PharMingen) or anti-IL-4
(BVD6-24G2; PharMingen) was added at 2 and 4 µg/ml, respectively, in
1% BSA/PBS plus 0.025% Tween 20 (0.1 ml/well). After overnight
incubation at 4°C, plates were washed three times with 0.025% Tween
20/PBS, and streptavidin-HRP (PharMingen) was added at 1/2000 dilution
for 2 h at room temperature. This was followed by three washes
with 0.025% Tween 20/PBS and three washes with PBS only. The solution
to develop the plates consisted of 0.8 ml of 3-amino-9-carbazole
(Sigma, St. Louis, MO; 20 mg dissolved in 2.0 ml of dimethyl formamide)
added to 24 ml 0.1 M sodium acetate (pH 5.0) plus 0.12 ml of 3.0%
hydrogen peroxide; 0.2 ml of the developing solution was added per
well.
Adoptive transfer of diabetes to neonatal NOD mice
Neonatal NOD mice 24–48 h of age received a single i.p. injection of 5 x 106 spleen cells from diabetic donors (32) mixed with or without 106 CD4+ T cells purified from nondiabetic NOD mice treated with pDNA or left untreated. CD4+ T cells were purified from splenocytes by magnetic separation using anti-CD4 Ab conjugated to magnetic beads (Miltenyi Biotec, Auburn, CA). T cells were eluted by flushing the magnetic column with PBS containing 0.5% FCS as recommended by the manufacturer. Typically, the purity of the CD4+ T cells was >95%. Recipient mice were monitored for diabetes up to 10 wk of age.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To investigate the immunotherapeutic efficacy of pDNA vaccination to prevent IDDM in an Ag-specific manner, a pDNA recombinant was established encoding a fusion protein consisting of a portion of murine GAD65 and IgGFc (JwGAD65). The GAD65 fragment contains a minimum of three peptide epitopes which consist of amino acid residues 206–220, 217–236, and 290–309, which are recognized by CD4+ T cell clones derived from unimmunized or GAD65-immunized NOD mice (23, 33, 34). Furthermore, we have recently demonstrated that overt diabetes is prevented in NOD mice coimmunized with the 217–236 and 290–309 peptides prepared in IFA at 4 or 12 wk of age (23). In an attempt to efficiently stimulate CD4+ T cells, the GAD65-specific sequence was fused to a human IgG4Fc molecule. In this way, the fusion protein is secreted, and GAD65-specific epitopes should be preferentially processed and presented via the MHC class II pathway. Additional pDNA recombinants encoding murine IL-4 (JwIL-4) or both IL-4 and GAD65-IgGFc (JwGAD65 + IL4) were established for the purpose of enhancing Th2 effector cell differentiation. Finally, two pDNAs encoding a HEL-IgGFc fusion protein either alone (JwHEL) or in combination with IL-4 (JwHEL + IL-4) were established to serve as controls.
The panel of pDNAs was shown to be functional based on detection of
protein secreted by COS-7 cells transfected with the corresponding
recombinants (Fig. 1
A). In
addition, RNA transcripts encoding HEL-IgGFc, GAD65-IgGFc, or IL-4 were
detected via RT-PCR in muscle tissue prepared from NOD mice lacking a
functional IL-4 gene (NOD.IL4null) 4 wk after the
final of three injections with the corresponding pDNAs (Fig. 1B).
|
A). Notably, the
majority of NOD mice receiving JwGAD65 continued to develop diabetes
(71%) (Fig. 2A). Only in NOD mice coimmunized with JwGAD65
and JwIL-4 was there a significant reduction in the frequency of
diabetes (29%, p = 0.04 vs unimmunized,
p = 0.02 vs JwHEL and JwIL-4,
2 test) (Fig. 2A). Furthermore, the
majority of islets found in these animals were free of insulitis
(Table I). In contrast, a high frequency
of intrainsulitis was detected in the pancreata of diabetes-free NOD
mice which were left untreated, coimmunized with JwHEL and JwIL-4, or
immunized with JwGAD65 only (Table I).
|
|
, NOD mice treated at 4 wk of
age with JwGAD651550–1856 and JwIL-4 or JwHEL
and JwIL-4, but not JwGAD65 and JwIL-4, continued to develop overt
diabetes. These results suggest that protection is dependent on the
fragment of GAD65 encoded by pDNA.
|
cell autoimmunity.
Groups of 12-wk-old NOD female mice, which are euglycemic yet exhibit
maximal anti- cell-specific T cell and Ab reactivity and
significant insulitis (5), received four i.m.
injections of 50 µg ofJwGAD65 + IL-4, JwGAD65, or JwHEL + IL-4 in
each quadricep over 28 days. After monitoring animals up to 58 wk of
age, the majority of unimmunized NOD mice (70%) or animals immunized
with JwHEL + IL-4 (75%) or JwGAD65 (83%) had developed diabetes (Fig. 2
B). In contrast, only 17% of NOD mice immunized with
JwGAD65 + IL-4 developed diabetes (p = 0.03 vs
unimmunized, p = 0.01 vs JwHEL + IL-4,
2 test) (Fig. 2B). Similar results
were obtained when 12-wk-old NOD female mice were coimmunized with
JwGAD65 and JwIL-4 (data not shown). Histological analysis of
pancreata from nondiabetic NOD mice demonstrated that a significant
percentage of islets found in JwGAD65 + IL-4-immunized mice
remained free of insulitis relative to unimmunized mice or animals
immunized with JwHEL + IL-4 or JwGAD65 (Table III). The extent of insulitis observed in
the nondiabetic animals treated with JwGAD65 + IL-4 is typical of that
detected in untreated 12-wk-old NOD mice (23).
|
Since prevention of diabetes in NOD mice treated at both 4
and 12 wk of age with JwGAD65 was dependent on coadministration of
pDNA-encoding IL-4, this suggested that protection was mediated by
GAD65-specific Th2 cells. To test this notion, splenocyte
cultures were prepared from nondiabetic or diabetic NOD mice immunized
at either 4 and 12 wk of age, and cytokine levels were measured in
response to GAD65 and two other candidate cell autoantigens
HSP60 and CPH (Figs. 3 and 4). Cultures established from NOD mice
coimmunized with JwHEL and JwIL-4 at 4 wk of age or left untreated
contained similar levels of IFN- and no detectable IL-4 and IL-5
above background in response to the panel of cell autoantigens
(Fig. 3). Analogous results were obtained with cultures established
from NOD mice that were immunized at 12 wk of age with JwHEL + IL-4 or
left untreated (Fig. 4). Using RT-PCR, expression of IL-4 but not
TGF- mRNA was detected in anti-CD3 and anti-CD28
Ab-stimulated CD4+ T cells purified from the
spleen or pancreatic lymph nodes of NOD female mice coimmunized at 4 wk
of age with JwGAD65 and JwIL-4 (data not shown).
|
|
and concomitant
increased levels of IL-4 and IL-5 in response to GAD65 (Figs. 3 and 4).
A similar cytokine profile was also detected in response to HSP60 and
CPH, suggesting that intermolecular determinant spreading of the Th2
cell response had occurred (Figs. 3 and 4). In contrast, a Th1 cell
cytokine profile in response to the panel of cell autoantigens was
detected in cultures established from the few mice that did develop
IDDM following immunization with either JwGAD65 and JwIL-4 (Fig. 3, D–F) or JwGAD65 + IL-4 (Fig. 4, D–F). This
indicates that pDNA immunization was ineffective in these animals and
may explain why cell autoimmunity progressed to overt diabetes. Of
note, cultures established from nondiabetic or diabetic NOD mice
immunized with JwGAD65 only at either 4 or 12 wk of age contained no
detectable IL-4 or IL-5 above background, but contained significantly
elevated levels of IFN- in response to GAD65 relative to untreated
mice (Figs. 3 and 4).
To directly determine whether regulatory CD4+ Th2
cells mediated protection, mixtures of diabetogenic spleen cells and
CD4+ T cells purified from nondiabetic mice
immunized with pDNA at 4 or 12 wk of age were adoptively transferred
into NOD neonate recipients. As demonstrated in Table IV, CD4+ T cells
prepared from GAD65-IgGFc- and IL-4-vaccinated NOD mice effectively
suppressed the adoptive transfer of diabetes to recipients. However,
mice receiving cell suspensions containing CD4+ T
cells prepared from donor animals left untreated or immunized with
HEL-IgGFc and IL-4 or GAD65-IgGFc only developed overt diabetes
(Table IV).
|
Recent studies have demonstrated that pancreatic lymph nodes are
key sites for activation of cell-specific Th cells (35, 36). With this in mind, Th cell reactivity was assessed via
ELISPOT in both the spleen and pancreatic lymph nodes of 12-wk-old NOD
mice that had been immunized with the panel of pDNAs at 4 wk of age.
The frequency of IFN-- and IL-4-secreting Th cells detected in
splenocyte cultures (Fig. 5, A
and C) reflected well the general cytokine profile
determined above by ELISA in response to the panel of cell
autoantigens for the respective treatment groups (Figs. 3 and 4).
Importantly, an increase and concomitant decrease of IL-4- and
IFN--secreting Th cells, respectively, were detected in response to
GAD65 in the pancreatic lymph nodes of NOD mice immunized with JwGAD65
and JwIL-4 relative to untreated or JwHEL- and JwIL-4-treated mice
(Fig. 5D). Furthermore, the frequency of IFN--secreting
Th1 cells was increased in the pancreatic lymph nodes of NOD mice
receiving JwGAD65 only when compared with untreated animals (Fig. 5B).
|
Next, we examined whether exogenous IL-4 encoded by pDNA was
sufficient to elicit GAD65-specific Th2 cell reactivity and mediate
protection or whether endogenous IL-4 was also necessary. For this
purpose, female NOD.IL4null mice were used which
do not express endogenous IL-4 and consequently lack typical Th2
effector cells (23, 37, 38). Groups of 4-wk-old
NOD.IL4null female mice were coimmunized with
JwGAD65 and JwIL-4, or JwHEL and JwIL-4, and then monitored for overt
diabetes up to 48 wk of age. As demonstrated in Fig. 6, the majority of
NOD.IL4null mice coimmunized with either JwGAD65
and JwIL-4 (58%) or JwHEL and JwIL-4 (75%) or unimmunized animals
(67%) developed overt diabetes. On the other hand, only 25% of
wild-type NOD mice coimmunized with JwGAD65 and JwIL-4 developed
diabetes (Fig. 6), and these nondiabetic animals exhibited a
predominant Th2 cytokine profile in response to the panel of cell
autoantigens in vitro (Fig. 7, A–C). The lack of protection observed in the
NOD.IL4null mice coimmunized with JwGAD65 and
JwIL-4 correlated with a modest increase in IFN- relative to
untreated or JwHEL- and JwIL-4-coimmunized mice and no detectable IL-4
above background in response to GAD65 (Fig. 7, A and
B). Furthermore, a small but significant increase in IL-5
secretion in response to GAD65 was observed in these mice (Fig. 7C). Unlike wild-type NOD mice, however, no obvious effect
on HSP60- and CPH-specific Th1 cell reactivity was observed in cultures
prepared from NOD.IL4null mice coimmunized with
JwGAD65 and JwIL-4 (Fig. 7A). A similar cytokine profile was
detected in cultures prepared from NOD.IL4null
mice 2 wk after the final injection of JwGAD65 and JwIL-4 (Fig. 7, D–F). Interestingly, the level of IL-4 and IL-5 secretion
in response to the panel of cell autoantigens was significantly
increased (p < 0.001) in cultures prepared
from wild-type NOD mice shortly after the final pDNA immunization vs
wild-type NOD mice that had been followed long term (Fig. 7).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
cell-specific autoimmunity.
Immunization withpDNAs encoding GAD65-IgGFc- and IL-4-induced
protection in NOD mice at early and late preclinical stages of disease
(Fig. 2). This protection correlated with 1) suppression of insulitis
(Tables I and III), 2) Th2 cell cytokine secretion in response to the
panel of cell autoantigens in both the spleen and pancreatic lymph
nodes (
Figs. 3–5 and 7), and 3) induction of
CD4+ T cells which inhibited the adoptive
transfer of diabetes by diabetogenic spleen cells (Table IV).
Importantly, disease suppression was GAD65 specific, since NOD mice
immunized with HEL-IgGFc- and IL-4-encoding pDNAs continued to develop
diabetes (Fig. 1) and exhibited unaltered cell-specific T cell
reactivity (Figs. 2 and 3). Furthermore, effective immunoregulation of
IDDM was dependent on the fragment of GAD65 coupled to IgGFc. Whereas
protection was observed in young and older NOD mice immunized with pDNA
encoding a fragment of GAD65 spanning nt 656-1070 (Fig. 2), animals
continued to develop diabetes following immunization with
JwGAD651550–1856 which encodes the carboxyl
terminus of GAD65 (Table II). One possible explanation for the lack of
immunotherapeutic efficacy of the
JwGAD651550–1856 is that the p509–528 and
p524–543 epitopes found in this region of the molecule are
inefficiently processed and presented, thereby limiting induction of
regulatory Th effector cells.
We and others have previously shown that established cell
autoimmunity can be suppressed by immunizing NOD mice with intact GAD65
or GAD65-specific peptides (21, 22, 23). However, to
successfully induce GAD65-specific Th2 cells and inhibit disease
progression, multiple injections with high doses of protein or peptide
prepared in the appropriate adjuvant was required (22, 23). In marked contrast, long-term protection was achieved in
this study by immunizing NOD mice over a short period of time with
relatively low doses of pDNA prepared in saline. A number of factors
may contribute to the immunotherapeutic efficacy we observed with pDNA
vaccination. Intramuscular injection of pDNA has been shown to
transfect not only APCs and myocytes at the site of injection, but also
a variety of cell types and tissues due to the rapid release of free
pDNA from the muscle into blood and lymph (39, 40).
Consequently, systemic expression of GAD65 may contribute to T cell
activation and subsequent Th2 cell differentiation at key peripheral
sites. Indeed, GAD65-specific Th2 cell reactivity was detected in the
pancreatic lymph nodes of NOD mice immunized with JwGAD65 and JwIL-4
(Fig. 5). Recently, the pancreatic lymph nodes have been shown to be
sites of Ag-specific activation and proliferation for diabetogenic T
cells (35, 36). Conversely, it is likely that the
pancreatic lymph nodes also provide key sites for immunoregulation of
the disease process. Experiments are underway to identify additional
tissues in which T cells are activated and differentiate into
regulatory effector cells following pDNA vaccination. Expression of a
secreted GAD65 fusion protein (Fig. 1B) would also be
expected to readily promote CD4+ T cell
reactivity. Typically, secreted proteins are processed and presented
via the MHC class II pathway. Accordingly, we have found that
immunizing 4-wk-old NOD mice with JwIL-4 and a pDNA encoding
full-length intracellular GAD65 had only a minimal effect on
spontaneous GAD65-specific CD4+ T cell reactivity
and disease progression (data not shown). Currently, it is not certain
whether the IgGFc portion directly contributes to the immunogenicity of
the GAD65 fragment in addition to facilitating secretion of the fusion
protein. However, it is clear that the IgGFc does not induce
nonspecific protection since NOD mice immunized with pDNA encoding
HEL-IgGFc continue to develop diabetes at the same time of onset and
frequency as untreated NOD mice. Finally, continuous pDNA expression of
GAD65 in vivo may effectively maintain protection once it has been
established. Various studies for example have reported in vivo
persistence of pDNA up to several months postimmunization
(25). It is apparent, however, that once established
GAD65- and cell-specific Th2 cell reactivity does diminish with
time. Typically, levels of IL-4 and IL-5 secretion in response to the
panel of cell autoantigens is 2- to 3-fold greater in cultures
established shortly after pDNA vaccination vs cultures established from
nondiabetic NOD mice followed up for several months posttreatment (Fig. 7). Nevertheless, the Th2 cell reactivity which exists in these older
animals was still sufficient to limit progression of insulitis (Table I) and to regulate cell-specific Th1 cell responses (Fig. 3, A–C).
An important issue associated with Ag-based immunotherapies is the
possibility of exacerbating autoimmunity following treatment. Indeed,
we found that immunizing 4- or 12-wk-old NOD mice with JwGAD65 alone
enhanced GAD65-specific Th1 cell reactivity (Figs. 3, A and
D, and 4, A and D). Of importance is
that spontaneous GAD65-specific Th1 cell reactivity is first detected
in 4-wk-old NOD mice and reaches maximal levels in animals 12 wk of age
(5, 6). Two recent experimental autoimmune
encephalomyelitis studies have demonstrated that T cells are tolerized
via anergy/deletion mechanisms, and autoimmunity is prevented by
immunizing rodents with pDNAs encoding peptides derived from the
autoantigens used to induce disease (29, 30). In these
studies, however, the animals lacked primed autoantigen-specific T
cells at the time of pDNA immunization. Our results indicate that once
Th1 effector cells have been established, pDNAs encoding both
autoantigen and IL-4 are required to 1) minimize expansion of those Th1
effector cells and 2) to promote Th2 cell differentiation (
Figs. 3–5
and 7). Indeed, both unmethylated CpG motifs found in pDNA (26, 27) and saline pDNA immunization tend to preferentially promote
Th1 cell differentiation (41). Our results are also
consistent with a growing notion that the efficacy at which Th2 cell
differentiation can be induced in an Ag-specific manner is dependent on
the frequency of established Th1 effector cells and uncommitted T cell
precursors. For example, Coon et al. (42) showed that
immunization with pDNA-encoding porcine insulin B chain elicited Th2
cell reactivity and prevented diabetes induced by lymphocytic
choriomeningitis virus (LCMV) infection in BALB/c mice expressing LCMV
nucleoprotein in cells (42). In contrast, when
established T cell effectors already existed, i.m. immunization of
pDNA-encoding LCMV nucleoprotein was ineffective. Whether LCMV
nucleoprotein-specific Th2 cells could be induced by coimmunizing with
pDNA-encoding IL-4 was not examined. Interestingly, we have preliminary
data indicating that the majority NOD mice immunized at 4 wk of age
with pDNA encoding a murine insulin B chain-IgGFc fusion protein
continue to develop overt diabetes (R. Tisch, unpublished data).
Coadministration of pDNAs encoding IL-4 was necessary but not
sufficient to effectively induce GAD65-specific Th2 cells and prevent
diabetes. Therefore, an endogenous source of IL-4 is also required to
mediate protection. This was clearly evident in
NOD.IL4null mice, which after coimmunization with
JwGAD65 and JwIL4, continued to develop diabetes (Fig. 6). However, a
modest yet significant increase in IL-5 secretion was detected in
response to GAD65 in cultures prepared from
NOD.IL4null mice immunized with JwGAD65 and
JwIL-4 (Fig. 7, C and F), suggesting that
Th2-like cell differentiation had occurred. Interestingly, continuous
i.v. administration of IL-4 has been reported to potentiate Th2 cell
development and prevent IDDM in NOD mice (17, 18). In our
study, the three or four injections of pDNA may not have been
sufficient to achieve systemic levels of IL-4 required to mediate a
general suppressive effect. A recent study, for example, demonstrated
that diabetes could be prevented in NOD mice by weekly i.m. injections
of a pDNA encoding TGF- (43). Presumably, continuous
administration of the pDNA was necessary to achieve and maintain
appropriate levels of systemic TGF- to prevent disease. Based on our
findings, we speculate that pDNA-encoded IL-4 is required to initiate
GAD65-specific Th2 cell differentiation in the presence of GAD65-IgGFc.
Once the appropriate extracellular cytokine milieu has been established
locally, other cell-specific Th2 cells develop which sustain and
amplify the regulatory effect via bystander suppression of the
GAD65-specific Th2 cells. Persistent expression of GAD65-IgGFc and IL-4
may further maintain GAD65-specific Th2 cell reactivity. The markedly
reduced frequency of insulitis in diabetes-free NOD mice treated at
either 4 or 12 wk of age suggests that protection is mediated
predominantly in the periphery. Interestingly, the frequency of
insulitis detected in nondiabetic 58-wk-old NOD mice treated at 12 wk
of age is similar to that typically seen in unmanipulated 12-wk-old NOD
mice (23), suggesting that at the time of treatment those
islets free of insulitis were protected from subsequent infiltration.
Furthermore, this protection is Ag specific since immunization with
pDNAs encoding HEL-IgGFc and IL-4 had no significant effect on
cell-specific T cell reactivity or disease progression.
Finally, our results suggest that under the appropriate conditions,
vaccination with pDNAs encoding IL-4 and GAD65 may prove to be an
effective and readily applicable approach to inhibit progression to
overt IDDM in individuals at the late preclinical stages of disease
development. Employing pDNAs encoding other cytokines such as IL-10 and
IL-13 known to promote Th2 cell differentiation or additional cell
autoantigens may further enhance the immunotherapeutic potential of
this strategy in a clinical setting.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Roland Tisch, Department of Microbiology and Immunology, Mary Ellen Jones Building, Room 804, Campus Box 7290, University of North Carolina, Chapel Hill, NC 27599-7290.
3 Abbreviations used in this paper: IDDM, insulin dependent diabetes mellitus; NOD, nonobese diabetic; CPH, carboxypeptidase H; ELISPOT, enzyme-linked immunospot; GAD65, glutamic acid decarboxylase 65; HSP60, heat shock protein 60; HEL, hen egg lysozyme; pDNA, plasmid DNA; LCMV, lymphocytic choriomeningitis virus.
Received for publication April 25, 2000. Accepted for publication November 2, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
transcription. J. Clin. Invest. 95:628.
1 somatic gene therapy prevents autoimmune disease in nonobese diabetic mice. J. Immunol. 161:3950.This article has been cited by other articles:
|
|
 |
|
  N. Solvason, Y.-P. Lou, W. Peters, E. Evans, J. Martinez, U. Ramirez, A. Ocampo, R. Yun, S. Ahmad, E. Liu, et al. Improved Efficacy of a Tolerizing DNA Vaccine for Reversal of Hyperglycemia through Enhancement of Gene Expression and Localization to Intracellular Sites J. Immunol., December 15, 2008; 181(12): 8298 - 8307. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. B. Silver, R. K. Agarwal, S.-B. Su, I. Suffia, R. S. Grajewski, D. Luger, C.-C. Chan, R. M. Mahdi, J. M. Nickerson, and R. R. Caspi Hydrodynamic Vaccination with DNA Encoding an Immunologically Privileged Retinal Antigen Protects from Autoimmunity through Induction of Regulatory T Cells J. Immunol., October 15, 2007; 179(8): 5146 - 5158. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Pop, C. P. Wong, Q. He, Y. Wang, M. A. Wallet, K. S. Goudy, and R. Tisch The Type and Frequency of Immunoregulatory CD4+ T-Cells Govern the Efficacy of Antigen-Specific Immunotherapy in Nonobese Diabetic Mice Diabetes, May 1, 2007; 56(5): 1395 - 1402. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. J. Hill, A. B. Stotland, and N. E. Sarvetnick Distinct regulation of autoreactive CD4 T cell expansion by interleukin-4 under conditions of lymphopenia J. Leukoc. Biol., March 1, 2007; 81(3): 757 - 765. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Neumann, T. Tschernig, D. Popa, A. Schmiedl, G. P. de Lema, K. Resch, and M. U. Martin Injection of IL-12- and IL-18-encoding plasmids ameliorates the autoimmune pathology of MRL/Mp-Tnfrsf6lpr mice: synergistic effect on autoimmune symptoms Int. Immunol., December 1, 2006; 18(12): 1779 - 1787. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Every, D. R. Kramer, S. I. Mannering, A. M. Lew, and L. C. Harrison Intranasal Vaccination with Proinsulin DNA Induces Regulatory CD4+ T Cells That Prevent Experimental Autoimmune Diabetes. J. Immunol., April 15, 2006; 176(8): 4608 - 4615. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Han, Y. Li, J. Wang, R. Wang, G. Chen, L. Song, R. Xu, M. Yu, X. Wu, J. Qian, et al. Active Tolerance Induction and Prevention of Autoimmune Diabetes by Immunogene Therapy Using Recombinant Adenoassociated Virus Expressing Glutamic Acid Decarboxylase 65 Peptide GAD500-585 J. Immunol., April 15, 2005; 174(8): 4516 - 4524. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ma, Y. Huang, Z. Yin, R. Menassa, J. E. Brandle, and A. M. Jevnikar Induction of oral tolerance to prevent diabetes with transgenic plants requires glutamic acid decarboxylase (GAD) and IL-4 PNAS, April 13, 2004; 101(15): 5680 - 5685. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Seifarth, S. Pop, B. Liu, C. P. Wong, and R. Tisch More Stringent Conditions of Plasmid DNA Vaccination Are Required to Protect Grafted Versus Endogenous Islets in Nonobese Diabetic Mice J. Immunol., July 1, 2003; 171(1): 469 - 476. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. V. Tarbell, M. Lee, E. Ranheim, C. C. Chao, M. Sanna, S.-K. Kim, P. Dickie, L. Teyton, M. Davis, and H. McDevitt CD4+ T Cells from Glutamic Acid Decarboxylase (GAD)65-specific T Cell Receptor Transgenic Mice Are Not Diabetogenic and Can Delay Diabetes Transfer J. Exp. Med., August 19, 2002; 196(4): 481 - 492. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bot, D. Smith, S. Bot, A. Hughes, T. Wolfe, L. Wang, C. Woods, and M. v. Herrath Plasmid Vaccination with Insulin B Chain Prevents Autoimmune Diabetes in Nonobese Diabetic Mice J. Immunol., September 1, 2001; 167(5): 2950 - 2955. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Weaver Jr., B. Liu, and R. Tisch Plasmid DNAs Encoding Insulin and Glutamic Acid Decarboxylase 65 Have Distinct Effects on the Progression of Autoimmune Diabetes in Nonobese Diabetic Mice J. Immunol., July 1, 2001; 167(1): 586 - 592. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Tisch, B. Wang, M. A. Atkinson, D. V. Serreze, and R. Friedline A Glutamic Acid Decarboxylase 65-Specific Th2 Cell Clone Immunoregulates Autoimmune Diabetes in Nonobese Diabetic Mice J. Immunol., June 1, 2001; 166(11): 6925 - 6936. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
