|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




*
Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892;
Laboratory of Diagnostic Radiology Research and
Neuroimmunology Branch, National Institute of Neurological Diseases and Stroke, National Institutes of Health, Bethesda, MD 20892;
Department of Neurology, University of California, San Francisco, CA 94143; and
¶ Alexion Pharmaceuticals, Inc., New Haven, CT 06511
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Encephalitogenic CD4+ T cells are believed to initiate and perpetuate EAE and MS and thus constitute a therapeutic target (1, 2, 3, 4, 5, 6, 7, 8). Abundant myelin protein Ags, including myelin basic protein (MBP) and proteolipid protein (PLP) as well as the less abundant Ags, myelin oligodendrocyte glycoprotein (MOG) and myelin-associated glycoprotein (MAG), are recognized by T cells in MS patients (9, 10, 11). T cell responses against MBP and PLP may occur at an increased frequency in MS patients compared with controls (1, 2, 11, 12). Ag-specific immunotherapies directed at T cells could avoid the harmful side effects of general immunosuppressive treatments. We have investigated a potential immunotherapy for MS based on our observation that T cells undergo apoptosis both in vitro and in vivo when exposed to high or repeated doses of their cognate Ag (13, 14). Antigenic restimulation of T cells cycling in IL-2 up-regulates CD95 (Fas/Apo-1), TNF receptor and their respective ligands causing apoptosis (15, 16, 17). MBP administration to mice with EAE can ameliorate disease by deleting specifically reactive T cells (14, 18, 19).
To present a broad array of potential epitopes to reactive T cells, we constructed MP4, a protein chimera of the 21.5-kDa isoform of human MBP, and a modified form of human PLP, termed PLP4, that lacks the hydrophobic domains of the protein but includes all of the known T cell epitopes (19, 20, 21). MP4 is processed into multiple determinants and can eliminate rodent EAE by promoting tolerance to different epitopes (19, 20). This is important in view of epitope or determinant "spreading" in MS and EAE (19, 20, 22, 23, 24, 25, 26, 27, 28). We previously documented epitope spreading in EAE in marmosets (29). Epitope spreading poses a challenge for Ag-specific therapies, but even single epitopes can be effective in treating disease in some circumstances (27, 28). For example, severe EAE induced in (PL/J x SJL)F1 mice by immunization with MOG4160 and MBP Ac111 peptides can be treated effectively by the MBP peptide alone (28).
In a few instances, EAE and Ag treatments have been studied in nonhuman primates. EAE was originally induced in rhesus macaques using CNS homogenates or purified MBP (3, 4, 30, 31, 32). It was also found that repeated injections of MBP could arrest EAE in the macaque model (31, 32). However, EAE in macaques involves hemorrhagic lesions with neutrophil infiltrates that are not characteristic of MS (7, 30, 31, 32). A new nonhuman primate model of EAE in Callithrix jacchus jacchus (common marmoset) has been developed that has clinical and pathological features closely resembling those of MS (7, 8). Disease in marmosets involves predominantly perivascular lymphocytic infiltrates and demyelination. The marmoset model has advantages over rodent EAE models in that a rigorous neurological examination and the evaluation of lesions by high resolution magnetic resonance imaging (MRI) are possible (8, 29, 33). Only a single study of Ag treatment of EAE, which used the low abundance MOG protein, has been conducted in marmosets, with the ominous finding that acute disease was suppressed but severe fatal disease rebounded after treatment cessation (34). However, the previous study did not resolve the important question that remains, whether a defined protein representing the abundant myelin epitopes could have a significant and durable therapeutic effect in primates. Here we show that Ag treatment of marmoset EAE achieves a clinical benefit without severe late toxicity.
| Materials and Methods |
|---|
|
|
|---|
Nine C. jacchus jacchus marmosets were obtained from
a colony maintained by the National Institute for Child Health and
Human Development at the National Institutes of Health Primate Unit
(Poolesville, MD). The animals, all males, ranged in age from
1
year, 8 mo to 2 years, 2 mo of age and were cared for under an approved
protocol in accordance with the guidelines established by the National
Institutes of Health Animal Care and Use Committee.
Antigens
MP4 was prepared by metal affinity chromatography and reversed phase HPLC as previously described (20). The recombinant extracellular domain of rat MOG (rMOG), was prepared as described (35).
Induction of EAE
MP4 was emulsified 1:2 in TiterMax adjuvant (Vaxcel, Norcross, GA). Animals received 100 µl intradermal injections containing a total of 1 mg MP4 at four sites on the back. On the day of immunization and again 2 days later, all immunized animals were given an i.v. injection of 5 ml sterile normal saline containing 1010 killed Bordetella pertussis organisms. The B. pertussis was kindly provided by Dr. Pat Van Zandt (Wyeth-Lederle Vaccines, Madison, NJ).
Ab responses
Serum Ab titers were tested in duplicate by ELISA (36). ELISA plates (Pierce, Rockford, IL) were coated overnight with 1 µg/well rMOG or MBP in 0.25 M carbonate buffer (pH 8.6), washed with PBS containing 0.05% Tween 20, and blocked with 1% BSA in the same buffer. After washing, 100 µl of a 1:200 or appropriate dilution of immune sera were incubated in the wells for 2 h at 37°C, followed by immunoperoxidase-conjugated anti-monkey IgG (Sigma, St. Louis, MO; 1:6,000) for 1 h at 37°C. Plates were developed with o-phenylenediamine dihydrochloride in 0.05 M phosphate-citrate buffer (pH 5.0; Sigma) for 30 min and read at 490 nm in a Vmax ELISA reader (Molecular Devices, Sunnyvale, CA).
T cell proliferation assays
PBL were separated using Lymphocyte Separation Medium (Organon Teknika, Durham, NC) density gradients according to the manufacturers instructions and plated in U-bottom 96-well microtiter plates (Becton Dickinson, Lincoln Park, NJ) at 1 x 105 cells/well in a total volume of 0.2 ml of AIM V serum-free medium (Life Technologies, Gaithersburg, MD). Test wells were prepared in triplicate with medium only, 50 or 100 µg/ml MP4, or 1 µg/well Con A (Boehringer Mannheim, Indianapolis, IN) and pulsed with 1 µCi [methyl-3H]thymidine (Amersham, Arlington Heights, IL). After 3 days of incubation, plates were harvested on a Tomtec MachII96 (Wallac, Gaithersburg, MD), and analyzed using a Betaplate 1205 scintillation counter (Wallac).
Cytokine RT-PCR
PCR were conducted as previously described (34) for
primers (5' to 3' sequences): HPRT 5', TGACCAGTCAACAGGGGAC; HPRT 3',
GCTCTACTAAGCAGATGGC. IFN-
5', CTGTTACTGCCAGGACCCAT;
IFN-
3', CGTCTGACTCCTTCTTCGCTT. IL-10 5',
GGTTACCTGGGTTGCCAAGCCT; IL-10 3' (37),
CTTCTATGTAGTTGATGAAGATGTC. TGF-
5', GCCCTGGACACCAACTACTGC;
TGF
3', GTCGCATTTGCAGGAGCGCAC. IL-4 5', TGTCCACGGACACAAGTGCGA;
IL-4 3', CATGATCGTCTTTAGCCTTTCC.
Clinical and pathological evaluation of EAE
Marmosets were observed daily, and clinical symptoms were scored
as previously described (Table I
)
(7). At 105 days after immunization, animals were
euthanized, and the brain and spinal cord were removed and fixed in
Formal-Fixx (Shandon, Pittsburgh, PA). Sections of 3 mm were prepared
in coronal, transverse, or longitudinal orientations using tissue
fragments embedded in paraffin. The sections were stained using
hematoxylin and eosin, Luxol fast blue, or Bodians silver stain
techniques (American Histolabs, Gaithersburg, MD). Histopathological
sections of CNS were scored in a blinded manner as previously described
(7) with minor changes as described in Table I
. Typically,
seven to nine coronal and transverse 3-mm sections of the entire spinal
cord were evaluated. Photomicrographs were taken on a Axiophot
microscope (Carl Zeiss, Thornwood, NY).
|
Scans were performed in the coronal plane with 2-mm interleaved slices on a Signa 1.5 T unit (General Electric, Milwaukee, WI) and included a T2-weighted spin echo pulse sequence SE 2000/20/80 and T1-weighted sequences SE 450/13 with and without a magnetization transfer (MT) pulse, using a 3-inch surface coil (29, 33). T1-weighted and MT images were performed before and after i.v. administration of the contrast agent gadopentetate dimeglumine 0.3 mmol/kg (Magnevist; Berlex Laboratories, Cedar Knolls, NJ). Scans were interpreted in a blinded manner.
| Results |
|---|
|
|
|---|
Nine male marmosets were randomly assigned to three treatment
groups. Siblings (two sets) were placed in different groups. The groups
received 1 ml 5% dextrose in sterile water containing 6 mg MP4 (high
dose), 0.6 mg MP4 (low dose), or 0 mg MP4 (sham). The 6-mg high
treatment dose was based on a body weight scale-up from a dose that
eliminated disease in rodents (14, 18, 19, 20, 21). The treatments
were administered through an indwelling venous catheter in the tail
twice daily at
10 a.m. and 6 p.m., on days 5, 7, and 9 after
immunization. Neurological evaluation, weight, and temperature
measurements were performed daily for 105 days by observers unaware of
the treatment groups. All animals in the sham group showed moderate
clinical symptoms of EAE including weight loss, ataxia, incontinence,
and mono- or paraparesis with onset ranging from 7 to 29 days (Fig. 1
, Table I
). By contrast, no clinical
symptoms were observed in the high dose group. In the low dose group,
moderate clinical disease was observed in two of three animals with
onset delayed to day 24 for one animal and day 42 for the other animal.
No symptoms were seen in 10 unimmunized control marmosets. Single
episodes of seizures were observed in a pair of siblings, one in the
high dose group and one in the sham group. Idiopathic sporadic seizures
have been described in unmanipulated marmosets and are not
characteristic of marmoset EAE (35, 40). In one
unimmunized animal given the 6-mg dose of MP4 i.v., a solitary cerebral
inflammatory lesion was observed, however, this animal did not manifest
any other CNS changes and had no T cell or Ab responses to MP4 (data
not shown). In further control experiments, 12 unimmunized marmosets
received daily doses of MP4 for one month and no CNS disease was
observed (data not shown).
|
We used serial MRIs performed throughout the 105-day observation
period to evaluate white matter disease in real time. MRI changes
occurred in all animals with clear differences between the treatment
groups (Fig. 2
, Table II
). First, the onset of MRI changes for
the sham-treated animals was at least 2 wk earlier than that of the
treatment groups. White matter disease on MRI correlated well with
clinical symptoms for the sham and low dose groups. Second, despite the
lack of clinical symptoms, animals in the high dose group exhibited MRI
changes indicating that the disease process was not completely
abolished. Third, severe white matter disease (score, 3) was reached by
two of three sham-treated animals, by one of the low dose animals, and
in none of the high dose animals. Moreover, only one of three animals
in the high dose group reached a score of 2, and the mean MRI score for
the high dose group was reduced at all time points relative to the
sham-treated animals. Thus, serial MRI imaging demonstrated
ameliorative effects of both doses of MP4 treatment in live
animals.
|
|
After 105 days, we evaluated pathology in coronal brain and spinal
cord sections (Table I
). Significant inflammatory infiltrates were
found in all animals in both the sham and low dose groups, but only one
animal in the high dose group showed perivascular infiltrates in the
CNS. Relatively little demyelination was observed in any of the
animals, possibly because of the large time interval between the early
occurrence of severe clinical/MRI findings and the time of the
pathological analyses. Remyelination obscures evidence of early
demyelinating disease (1, 2, 3, 4, 5).
Decreased proliferation responses and antimyelin Ab production
PBL proliferative responses to the MP4 Ag were also evaluated
(Table III
). At 18 days postimmunization
(9 days post treatment), proliferative responses were seen in all
groups, but the mean stimulation index for the sham-treated animals was
21.0 as compared with a mean of 8.3 for the high dose group. Control
proliferative responses to Con A did not differ between groups (data
not shown). At later time points, significant differences in
MP4-specific responses between treated and untreated animals were not
observed (data not shown), but were similar to levels shown at 18 days
postimmunization.
|
|
Previously, MOG treatment of marmoset EAE was suggested to deviate
T cells from a Th1 to a Th2 response (34). Cytokine mRNA
production was therefore evaluated by semiquantitative RT-PCR using
mRNA samples obtained at day 16 (1 wk after the final treatment) from
either the sham-treated or the high dose MP4-treated animals (34, 38). Relative mRNA amounts of the Th1 cytokine, IFN-
, the Th2
cytokines, IL-4 and IL-10, and TGF-
are shown in Fig. 4
as a fraction of HPRT control mRNA.
Only IFN-
was modestly induced after a 4-h incubation with 25
µg/ml MP4. No differences were found between sham and high dose
animals, and the mRNA levels of the Th2 cytokines IL-4 and IL-10 were
lower than the levels of IFN-
or TGF-
. Thus, immune deviation did
not occur as a result of MP4 treatment and could not account for
disease amelioration.
|
| Discussion |
|---|
|
|
|---|
First and foremost, it was clear that high dose Ag treatment decreased disease as judged by clinical and MRI evaluation. Histopathology also showed that Ag treatment was associated with less lymphocyte infiltration. We also found decreased T cell proliferative responses and Ab production in Ag-treated animals. Taken together, these results are consistent with previous observations in rodent EAE that soluble i.v. Ag decreases rather than enhances cognate immune reactions (14) and suggest that Ag therapy could be safe and effective for T cell-mediated autoimmune diseases. One of the most important outcomes of our study is that we did not find the emergence of severe demyelination or fatalities after Ag administration as previously observed with MOG treatment (34).
The hyperacute disease observed in the previous marmoset study could pose a very serious drawback to using Ag treatment in human MS (34). The difference between the previous study and our own likely lies in the fact that different Ags were used for treatment. In the prior study, marmosets were immunized with MOG and then treated with an 11-day course of i.p. injections of MOG every other day (34). A hallmark of the disease in that study was severe demyelination possibly due to activated B cells that caused an Ab response against MOG (29, 34, 39). Severe demyelinating disease can also be achieved by immunizing marmosets with total white matter which contains a small fraction of MOG (7, 8). MOG has been consistently shown to provoke strong Ab responses that cause severe demyelination and in the previous study, anti-MOG Ab levels were higher in the treated animals than in the placebo controls at day 21 (29, 34, 42). In contrast, using MBP/PLP epitopes, we found that disease was potently suppressed and that Ab levels against MBP were lower rather than higher in the treated animals at numerous points throughout 105 days of observation. It is also important that MOG treatment in the previous study caused immune deviation of T cells to a Th2 phenotype, which would promote B cell activity and Ab production (34). With MBP/PLP treatment, no such deviation was evident.
High dose MP4 treatment eliminated clinical disease, but it was evident
from the MRI scans that CNS tissue effects, although reduced, were not
completely abolished. However, the mean MRI scores for the treated
animals never reached the levels observed in the untreated animals,
which peaked at
8 wk and then fell to levels similar to those of the
high dose MP4-treated animals by 15 wk. This lower level of CNS disease
intensity on MRI in treated animals is reflected in the absence of
clinical symptoms. There is a general correlation in the untreated
group between trends in clinical symptoms and MRI scores. The
appearance of disease symptoms in some cases preceded evidence of CNS
disease as demonstrated by MRI. This is likely due to technical
limitations in our ability to visualize tiny, early lesions of <0.5 mm
(33). In some animals, CNS disease was observed in the
absence of clinical symptoms. This is a common observation in EAE and
MS and may reflect the fact that most lesions detected by MRI are
clinically silent, perhaps because of functional redundancy in the
brain or lack of involvement of vital neural pathways to clinically
apparent levels (33, 43). A larger lesion load, as was
observed in the untreated animals, may increase the likelihood that a
lesion will appear in an area in the CNS in which damage can produce an
observable clinical outcome. There is also a general correlation
between the inflammation demonstrated by histopathology and the MRI and
clinical score. Because of the many changes that may have occurred over
time including decreased inflammation and remyelination, the
histopathology may only dimly reflect the original appearance and
number of the lesions, some of which may have been 100 days old. The
limitations of histopathology in assessing the efficacy of a CNS
immunotherapy highlight the value of MRI in studies of this kind. With
these considerations in mind, the clinical, histopathological, and MRI
data tell a consistent story: that high dose Ag immunotherapy was
effective in reducing the lesion load and eliminating the clinical
symptoms of EAE.
Previously, we documented determinant spreading to MOG in three of four animals immunized with MP4 in adjuvant (29). Anti-MOG Abs occurred in only one of the three untreated animals, J81, which was the only animal to show persisting demyelination. This supports the association of determinant spreading to MOG with demyelination in MP4-immunized marmosets (29, 36). We observed no determinant spreading in MP4-treated animals by anti-MOG Ab titers; thus, abolition of immune responses to the abundant myelin Ags might have prevented demyelination by limiting determinant spreading. Additional studies with a greater number of animals are necessary to validate these trends. Nevertheless, our results suggest that the choice of Ag for immunomodulation may be critical for successful treatment and provide new hope for Ag-specific therapy in humans.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Infectious Diseases, Central Research Division, Pfizer, Inc., Eastern Point Road, Groton, CT 06340. ![]()
3 Address correspondence and reprints requests to Dr. Michael Lenardo, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Building 10, Room 11N311, 10 Center Drive, Bethesda, MD 20892-1892. ![]()
4 Abbreviations used in this paper: MS, multiple sclerosis; MBP, myelin basic protein; PLP, proteolipid protein; EAE, experimental allergic encephalomyelitis; MOG, myelin oligodendrocyte glycoprotein; MAG, myelin-associated glycoprotein; rMOG, rat myelin oligodendrocyte glycoprotein; MT, magnetization transfer; MRI, magnetic resonance imaging; HPRT, hypoxanthine phosphoribosyltransferase. ![]()
Received for publication August 2, 2000. Accepted for publication October 31, 2000.
| References |
|---|
|
|
|---|
. J. Clin. Invest. 86:981.
/
T lymphocytes for apoptosis. Nature 353:858.[Medline]
and interleukin-10 genes in rabbit HTLV-1-transformed T-cell lines. Immunogenetics 44:306.[Medline]
This article has been cited by other articles:
![]() |
F. Odoardi, N. Kawakami, Z. Li, C. Cordiglieri, K. Streyl, M. Nosov, W. E. F. Klinkert, J. W. Ellwart, J. Bauer, H. Lassmann, et al. Instant effect of soluble antigen on effector T cells in peripheral immune organs during immunotherapy of autoimmune encephalomyelitis PNAS, January 16, 2007; 104(3): 920 - 925. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Lutton, R. Winston, and T. C. Rodman Multiple Sclerosis: Etiological Mechanisms and Future Directions Experimental Biology and Medicine, January 1, 2004; 229(1): 12 - 20. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |