| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
RI with IgA and Its Implications for Ligand Binding by Immunoreceptors of the Leukocyte Receptor Cluster1
The Helen M. Schutt Laboratory for Immunology and Biotechnology, Austin Research Institute, Austin Repatriation Medical Center, Heidelberg, Victoria, Australia
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RI (CD89):IgA
interaction, which is distinct from that of the other leukocyte Fc
receptors and their Ig ligands. A comprehensive analysis using both
cell-free (biosensor) and cell-based assays was used to define and
characterize the IgA binding region of FcRI. Biosensor analysis of
mutant FcRI proteins showed that residues Y35, Y81, and R82 were
essential for IgA binding, and R52 also contributed. The role of the
essential residues (Y35 and R82) was confirmed by analysis of mutant
receptors expressed on the surface of mammalian cells. These receptors
failed to bind IgA, but were detected by the mAb MY43, which blocks IgA
binding to FcRI, indicating that its epitope does not coincide with
these IgA binding residues. A homology model of the ectodomains of
FcRI was generated based on the structures of killer Ig-like
receptors, which share 30–34% identity with FcRI. Key structural
features of killer Ig-like receptors are appropriately reproduced in
the model, including the structural conservation of the interdomain
linker and hydrophobic core (residues V17, V97, and W183). In this
FcRI model the residues forming the IgA binding site identified by
mutagenesis form a single face near the N-terminus of the receptor,
distinct from other leukocyte Fc receptors where ligand binding is in
the second domain. This taken together with major differences in
kinetics and affinity for IgA:FcRI interaction that were observed
depending on whether FcRI was immobilized or in solution suggest a
mode of interaction unique among the leukocyte
receptors. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In humans, the induction of cellular effector functions by IgA is
dependent on the interaction with its specific receptor, FcRI, also
called CD89 (10, 11, 12). FcRI is expressed on neutrophils,
eosinophils, monocytes, and macrophages (10, 12, 13, 14, 15, 16, 17);
Kupffer cells (2); and alveolar macrophages
(18), and there have been several reports of possible
expression on mesangial cells in the kidney (3, 4, 5, 6).
IgA-dependant activation of cells via FcRI is believed to be a key
factor in host defense, and responses include phagocytosis, respiratory
burst, degranulation, and cytokine release (2, 14, 15, 16, 17, 18, 19).
Interestingly, despite the capacity to bind both serum and secreted IgA
(9, 10, 11) the form of IgA also influences FcRI-dependant
responses, as serum, but not secreted IgA, triggers phagocytosis
(2). In addition, FcRI can act cooperatively with other
arms of host resistance, including complement where CR3 is required for
Ag-dependent cellular cytotoxicity via FcRI (19).
Recent studies including the use of FcRI transgenic mice also
suggest that it plays a major role in IgA nephritis
(20).
Although FcRI is clearly an Fc receptor, and like Fc
RI,
Fc
RIIa, FcRIIb, FcRIIc, FcRIIIa, and FcRIIIb, is
composed of two extracellular Ig-like domains (ectodomain 1
(EC1)3 and EC2), it is more closely related to members of
the leukocyte receptor cluster: killer Ig-like receptors
(KIR), Ig-like transcripts (Ig-like transcript-1 (ILT) or
leukocyte Ig-like receptor), and the paired Ig-like receptors
(21). The FcRI shows greater amino acid sequence
identity with members of the leukocyte receptor cluster (30–40%)
compared with 20% with FcRII, FcRIII, and FcRI. In addition
FcRI contains the 5-aa interdomain linker that is conserved in the
leukocyte receptor cluster and is distinct from other FcRs, FcRII,
FcRIII, and FcRI, which have a 2-aa linker. This linker is
essential for a relative spatial orientation of EC1 to EC2 of the KIR,
which differs by 120° compared with the orientation of EC1 and EC2 of
the FcRII, FcRIII, and FcRI (22, 23, 24). In
addition, the FcRI gene maps within this cluster whose genes are
closely linked on chromosome 19q13.4. Thus, it is likely that FcRI
would exhibit other differences from the other leukocyte Fc receptors.
Indeed, in the limited analyses performed, comparison of the
FcRI:IgA interaction showed considerable differences from the
well-defined FcR:IgG and FcRI:IgE interactions (25, 26). Unlike other Fc receptors, in FcRI the ligand binding
site appears to be in the first domain, not the second, and in IgA,
unlike IgG or IgE, the receptor binding site is located at the
interface between CH2 and CH3, not the lower hinge of CH2 as for IgG or
its equivalent area in IgE C2 (27, 28).
Furthermore, in EC1 of FcRI, histidine 85 and arginine 82 were
identified as necessary for IgA binding and are located in the putative
F-G region of EC1 (25). In other Fc receptors the F-G
region of the second domain (EC2) is used as well as additional
adjacent areas of EC2. In the study described herein additional areas
of FcRI were examined for their contributions to the binding of IgA.
The F-G region was completely scanned for binding site residues by
mutagenesis, and the B-C, C'-E, and N-terminal regions were also
mutated. In addition, a homology model of the ectodomains of FcRI
was constructed using the related KIR structure as a template. Thus,
knowledge of the FcRI:IgA interaction may have broader implications
for receptor-ligand interactions generally in the members of leukocyte
receptor cluster on chromosome 19.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Two constructs encoding the two EC domains and the EC membrane
proximal region of human FcRI were generated by PCR of the pHuIgAR
(11), using the polymerase Pwo (Roche, Castle
Hill, Australia), and the forward primer oBW21
(5'-CCCGGGGAATTCCAGGAAGGGGACTTTCCC-3') and either reverse
primer oBW32
(5'-GGCCTAGGCCCATTCAGATCCTCTTCTGAGATGAGTTTTTGTTCTGCCCCGGGCCCGATCAAGTTCTGCGTCGTG-3'),
which encodes a c-Myc tag for the rsFcRI C-terminal, or reverse
primer oBW35
(5'-GGCCTAGGGTGATGATGGTGATGATGTGAGCTGCTCCCGGGCCCGATCAAGTTCTGCGTCGTG3'),
which encodes a six-histidine tag for the rsFcRI C-terminal. The PCR
product was cloned into the EcoRI and AvrII (New
England Biolabs, Beverly, MA) sites of the Pichia expression
vector pPIC-9 (Invitrogen, San Diego, CA), producing constructs pBAR62
and pBAR66, respectively. The vector pBAR66 was digested with
SmaI and XbaI, liberating a fragment encoding the
hexahistidine sequence. This fragment was ligated into the
NotI (cut and then filled in using the Klenow fragment of
DNA polymerase) and XbaI sites of pBAR62 to give pBAR151, a
Pichia vector expressing rsFcRI with a dual Myc and
hexahistidine tag at the C-terminal. For expression in baculovirus, the
PvuII/NotI fragment from pBAR 141, a pFastBac1
vector (Life Technologies, Gaithersburg, MD) encoding the ectodomains
EC1 and EC2 of FcRI (rsFcRI) (25) was released and
replaced with the PvuII/NotI fragment from pBAR
151. This construct (pBAR152) encoding Myc-histidine-tagged rsFcRI
was used as a template for alanine mutagenesis using a QuikChange
mutagenesis kit (Stratagene, La Jolla, CA). Constructs were confirmed
using a Thermosequenase dye terminator cycle sequencing kit and an ABI
Prism 377 DNA sequencer (Applied Biosystems, Foster City, CA). The
mutant rsFcRs in the F-G region were Y81A, R82A, I83A, G84A, H85A,
Y86A, and R87A, and those in the B-C region were Q29A, I31A, R32A,
E33A, and Y35A. In the putative C'-E region, two mutants, R52A and
R53A, were constructed. Normal and mutant rsFcRI proteins were
produced in baculovirus using the Fastbac system according to the
manufacturer’s instructions (Life Technologies). Nickel agarose
chromatography (Qiagen, Melbourne, Australia) was used to purify the
recombinant soluble receptors as described previously
(25). For mammalian cell surface expression of FcRI,
PCR was performed on the plasmid pHuIgAR (11), with the
polymerase Pwo (Roche), using the forward primer oBW146
(5'-CCGAATTCCACGATGGACCCCAAAC-3') and the reverse
primer HT57 (5'-ACCTCCTCTAGATTACTTGCAGACACTTGG-3') and
the PCR product cloned into the vector pcDNA3 (Invitrogen) to construct
pBAR234. Mutagenesis of pBAR234 to produce plasmids for expression of
the Y35A, R52A, R82A, and R87A mutant receptors was performed as
described above. The chimeric receptor with the N-terminal peptide of
ILT1 was constructed by PCR of pBAR234 with the primers oBW198
(5'-CACCTCCCCAAGCCCACCCTCTCTGCCAAATCGAGTCCTG-3') and oBW199
(5'-CCCTGCCTGTGCCTGAATCCTCTG-3'), using Turbo Pfu
(Stratagene, La Jolla, CA) followed by phosphorylation and ligation of
the linear PCR product by standard methods.
Transient expression in COS-7 cells was performed by transfection of
106 cells with 5 µg of plasmid DNA and
Lipofectamine Plus reagent according to the manufacturer’s
instructions (Life Technologies). After 48 h the IgA binding
activity of mutant FcRI was measured by indirect immunofluorescence
quantitated by flow cytometry. Cells (105) were
incubated with 5 µg/ml serum IgA (Calbiochem) for 30 min, washed with
PBS containing 0.1% BSA, and incubated for an additional 30 min with
FITC-labeled sheep Fab'2 anti-human IgA
(Silenus, Melbourne, Australia). Cells were washed, and fluorescence
was measured using a FACSCalibur (Becton Dickinson, Melbourne,
Australia). FcRI expression was independently measured by
immunofluorescence as described above, but using the
FcRI-specific mAb MY43 and FITC-labeled sheep
Fab'2 anti-mouse Ig (Silenus). The MY43 Ab
was obtained from Medarex West (Lebanon, NH).
Biosensor analysis of normal and mutant rsFcRI binding to IgA
FcRI binding was measured using a biosensor as described
previously (25). Serum IgA (Calbiochem-Novabiochem,
Alexandria, Australia) was coupled (600–1300 resonance U) to a BIAcore
CM5 carboxyldextran biosensor chip (BIAcore, Melbourne, Australia)
using the established carbodiimide-mediated amine reaction protocol.
Binding assays were typically performed at flow rates of 10 µl/min
using 20 mM HEPES, 150 mM NaCl, and 3.4 mM EDTA pH 7.4.
The sensograms for wild-type and mutant rsFcRI binding to IgA were
analyzed by taking the midpoint of each injection as the equilibrium
binding response, even though the sensograms showed a small amount of
additional binding that accumulated relatively slowly with increased
time of injection. This small contribution of higher affinity binding
was attributed to a small amount of aggregates in the receptor
preparation. These equilibrium data were fitted (for the wild-type
rsFcRI) to a single binding site model, R =
(Bmax x
[FcR])/(Kdapp + [FcR]), where
R is the binding response,
Bmax is the response at saturation,
[FcR] is the concentration of rsFcRI, and
Kdapp is the apparent
Kd. The number of receptor binding
sites (Bmax) was constant in these
experiments, as the same immobilized IgA was used to measure the
binding of the normal rsFcRI and the rsFcRI mutants. Therefore,
the value for Bmax determined in the
normal rsFcRI binding analysis was set as a constant during the
analyses of binding data to determine the
Kd values for the mutant receptors.
The measured affinities of the mutant rsFcRI were compared with
those of the wild-type rsFcRI, and the significance of differences
in affinity was determined using an unpaired t test with
two-tailed p values. p < 0.05 was taken as
significant, and p < 0.01 as very significant.
Biosensor analysis of the FcR:IgA interaction comparing
rsFcRI and IgA immobilization
Different channels of the same BIAcore CM5 carboxyldextran
biosensor chip were coupled with IgA and rsFcRI as described, using
carbodiimide chemistry. The binding of serum IgA to the immobilized
receptor and that of soluble receptor to immobilized IgA were analyzed
by global fitting of the sensograms using the program Biaevaluation 2.1
(BIAcore).
Modeling
Nonredundant Protein Data Base (PDB) sequences were searched for
homologues to the Fc receptor ectodomain sequence using PSI-BLAST
(29, 30) at the web site "Predicting protein 3D
structures based on homologous sequence search"
(http://dove.embl-heidelberg.de/3D) (30). A model of the
extracellular domains of FcRI (residues 6–195) was constructed
using the coordinates of five KIR structures in the protein database
(31) as templates. The PDB accession numbers of these were
1NKR (32), 2DLI, 2DL2 (33), 1EFX
(34), and 1B6U. The sequence alignment obtained with
PSI-BLAST (29) and the MODELLER (35) module
of Insight II molecular modeling software (version 97.2, Molecular
Simulations, San Diego, CA) was adjusted by inspection to maximize
identities in putative strands. Ten models were constructed using
MODELLER (35) without subjective intervention. An
evaluation of the internal consistency of each predicted structure was
obtained using the program PROFILES 3D, and the highest scoring
structure was retained (36).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In our previous study two residues, R82 and H85 in EC1, were shown
to be necessary for IgA binding (25) and are likely to lie
in the putative F-G loop of this domain. In contrast, the binding site
of other FcRs is located in EC2, but in this domain includes, in
addition to the F-G region, the adjacent B-C and C-C'-E regions. To
assess whether a similar configuration was retained in the EC1 of
FcRI, putative F-G, B-C, and C'-E regions were targeted for
mutagenesis. In addition, as these regions may be expected to be close
to the N-terminus in a typical Ig domain, the first 10 N-terminal
residues of FcRI were also mutated. All mutant proteins were then
tested for their capacity to bind IgA. It should be noted that the
assignment of these regions to residues was based on alignment to
equivalent sequence of the related p58 KIR using the same secondary
structure assignment of the p58 KIR (32). Hence, residues
81–87 were assigned to the putative F-G region, residues 29–35 to the
B-C region, and C strand region and residues 52–53 were between the C'
and E strands.
Analysis of soluble FcRI mutants
Recombinant soluble normal and mutant FcRI proteins (rsFcR),
consisting of both extracellular domains and membrane-proximal region
fused to a dual c-Myc and hexahistidine tag, were produced using the
baculovirus expression system and were purified by chromatography on
nickel agarose (25). The purified recombinant normal and
mutant soluble receptors were visualized by SDS-PAGE analysis as a
tight cluster of bands with a Mr of
approximately 40 kDa (Fig. 1
).
|
Biosensor analysis of rs mutant FcRI
Soluble wild-type and mutants of rsFcRI in the F-G region were
injected, at concentrations from 0.01 to 0.3 µM, over immobilized
serum IgA, and the equilibrium binding responses were recorded using a
BIAcore biosensor (Fig. 2). These data
were fitted to a single site binding model, yielding values for the
apparent Kd of the normal and mutant
soluble receptors (Fig. 3A).
Mutation of six of the seven residues resulted in profound reductions
in IgA binding (Figs. 2 and 3A). The effect of the alanine
substitutions ranged from an ablation of binding for the Y81A and R82A
FcRI proteins to large reductions in apparent affinity for, I83A
(11-fold), G84A (19-fold), H85A (4-fold), and Y86A (3-fold). Only R87A
had an insignificant (1.2-fold) reduction (p >
0.05) in its apparent Kd for
IgA.
|
|
B). The region
between the C' and E strands also contributed to IgA binding, since the
R52A showed an 8-fold reduction in apparent affinity compared with
wild-type FcRI. However, R53 appeared to play no role, as IgA
binding to R53A FcRI, was indistinguishable from binding to
wild-type FcRI.
Analysis of mutant FcRI on the cell surface
The results obtained using baculovirus-expressed soluble receptors
were confirmed using mammalian cell surface expression of selected
FcRI mutants in COS cells (Fig. 4).
Mutations of the B-C region (Y35), the C'-E region (R52A), and the F-G
region (R82A, R87A) were introduced into the cDNA encoding the entire
receptor, including the membrane-spanning and cytoplasmic regions.
These mutants were then analyzed in a transient expression system at
the surface of COS cells and were tested by flow cytometry for IgA
binding using serum IgA and for expression at the cell surface using
anti-FcRI mAb. The mutation R82A in the F-G region and Y35A in
the B-C region completely inactivated the IgA binding activity of the
receptor. These proteins showed no detectable IgA binding (0.04 and
0.00% of cells stained positively for IgA) compared with 9.1% of
cells transfected with the wild-type FcRI staining positively for
IgA binding, with a maximum mean fluorescent intensity of approximately
500 (Fig. 4). Thus, the IgA binding experiments with cell surface
expression of FcRI confirmed the results of the biosensor analysis
using baculovirus rsFcRI. The R52A mutant, unlike the foregoing
mutants where IgA binding was completely lost, had only 8-fold
reduction in IgA binding affinity in the biosensor assay. When tested
in the FACS assay, 11.9% of the transfected cells stained positively
for IgA binding. Thus, the activity of this mutant could not be
distinguished from that of the normal receptor, but this was likely to
be a consequence of the lesser sensitivity of the FACS assay compared
with the BIAcore in measuring relatively small differences in binding
affinities. Moreover, in the FACS assay the FITC-labeled
Fab'2 anti-IgA cross-links the bound IgA,
which would enhance the apparent affinity of weak interactions.
Finally, as expected, introduction of the R87A mutation, which did not
significantly alter the affinity of the rsFcRI, likewise did not
measurably alter the interaction of the full-length cell surface
receptor with IgA.
|
RI and/or prevented its expression on the cell
surface rather than altering a ligand contact. Thus, the cell surface
expression of each construct was monitored by staining the transfected
COS cells with the anti-FcRI mAb MY43. The range of expression
of each mutant (maximum mean fluorescent intensity, 2000) and the
proportion of transfected cells (16–23%) were equivalent (Fig. 4).
Hence, there is no evidence from the cell surface expression that any
mutant protein was unstable compared with the normal receptor.
Furthermore, since MY43 blocks IgA binding to the receptor, MY43
binding to the mutant receptors is the best available probe for the
integrity of the protein in the vicinity of the binding site. The MY43
binding of the Y35 (22%) and R82 (18%) mutant receptors was
equivalent to that of the normal receptor (19%), indicating that even
in those receptors with no IgA binding activity, the structural
integrity of the protein close to the ligand binding site was
preserved.
Since the IgA binding site on the FcRI is near the N-terminal end of
EC1, as the ectodomains are Ig-like folds, we tested whether the
N-terminal peptide contributed to the binding site. The N-terminal
peptide, comprising the first 10 residues of the receptor,
QEGDFPMPFI was altered
to the corresponding sequence of ILT1, the leukocyte receptor cluster
(LRC) molecule with highest overall homology with FcRI (38%
identity over both ectodomains). This sequence
QAGHLPKPSL has six
changes (shown underlined) from the FcRI sequence, but maintains the
residues G3, P6, and P8, which may be important in the structure of
this region of the protein. Expression of this N-terminal chimeric
receptor in COS cells as measured by MY43 binding was equivalent to
that of normal receptor (8.0% compared with 8.8% positive cells),
indicating that the chimeric protein was not less stable than the
normal receptor (Fig. 5). Furthermore, as
MY43 binding to its blocking epitope was not compromised, the protein
structure close to the IgA binding site was presumably undisrupted. IgA
binding to the normal and that to the chimeric FcRI were also
equivalent, with 7.0 and 7.4% of cells binding IgA, respectively (Fig. 5). Thus, the N-terminus of the FcRI does not contribute to the IgA
binding site.
|
RI
The interpretation of how residues identified as essential for
ligand binding form a binding site is best understood in the context of
the three-dimensional structure of the protein. In the absence of a
solved crystal structure of the FcRI a homology-based model of the
ectodomains of the receptor was constructed (Fig. 6). A sequence search of the nonredundant
PDB using PSI-BLAST (29) on the web
(http://dove.embl-heidelberg.de/3D) (30) predicted the KIR
to be the most closely related and thus to have the best match for the
fold of FcRI. FcRI has sequence identity of 34% to KIR (2DL1)
over both ectodomains, 26% between their respective EC1s, and 44%
between their EC2s. Modeling of FcRI on KIR will correctly predict
the fold of this receptor and will most accurately predict the
structure of EC2. Thus, a model of the extracellular domains of the
FcRI was constructed using the coordinates of five KIR structures in
the PDB as templates. The optimized sequence alignment consisted of
nine blocks of homology between FcRI (residues P8-I18, S23-C28,
N44-G51, T60-C79, S91-A109, V114-S127, F132-E142, A155-V162, and
G168-L190) and KIR (1NKR: residues P8-V18, T23-C28, N46-G53, S60-C79,
S94-A112, T117-S130, Y134-E144, A162-V169, and G173-L200). Ten models
were constructed using the MODELLER (35) modeling software
(Molecular Simulations, San Diego, CA) without subjective intervention.
Scores of internal consistency of each model were obtained using the
program PROFILES 3D (36) and ranged from 54–73 from a
theoretical best score of 86. The highest scoring structure was
retained as the model for the FcRI ectodomains.
|
RI are
appropriately reproduced in the FcRI model, which indicates that the
KIR was a valid template for the FcRI model. Firstly, the buried
central hydrophobic core of the KIR is composed of a cluster of three
residues from distinct parts of the protein, with L17 and V100 packing
against W188 (32). This feature is reproduced in the
FcRI model by the near identical positioning of residues V17, V97,
and W183, from near the start, middle, and end of the primary sequence,
indicating that the model has folded these regions correctly to bring
these core residues together appropriately (Fig. 6). Secondly the
linker peptide between the ectodomains is almost identical between KIR
(GLYEK) and the FcRI (GLYGK), including the pivot Leu residue. This
conserved interdomain linker allied with the conserved hydrophobic core
of these proteins would suggest that the FcRI will be a bent
molecule like the KIR, for which bend angles between EC1 and EC2 of
66–80 degrees have been reported (33). These structural
features would not be generated by modeling FcRI on the other Fc
receptors where sequence identity is less (only 
20%), and the
orientation of EC1 to EC2 differs by 120 degrees compared with KIR. It
is noteworthy that EC1 and EC2 of KIR share only 40% identity, and
these structures are superimposable upon each other. It is apparent
that the EC2 of FcRI, with 44% identity to the same domain of KIR,
will be well modeled on the KIR template. The 26% identity between the
respective EC1s means that EC1 of the FcRI model will be less
representative of the authentic FcRI structure than is EC2.
It is apparent that there will be some structural differences between
the KIR and the FcRI. The WSXWS motif
characteristic of hemopoietic receptors is varied in EC2 of the KIRs to
WSXSS, but the serine hydroxyls that hydrogen
bond to the backbone of the F strand (underlined) are conserved. In EC1
of the KIR the motif is VSAPS and is a more
marked deviation from the hemopoietic receptor motif, but still
maintains the structural serine residues. Likewise, in the EC2 of
FcRI a slight variant of this structural motif is found,
WSFPS, which is a composite of the motifs from
EC1 and EC2 of the KIR. EC1 of FcRI has no equivalent to the KIR
VSAPS motif. The absence of this structural motif and the lower
sequence identity between the N-terminal domains of KIR and FcRI
indicate that EC1 of the FcRI will be the domain that differs in
structure most from the KIR structure. A second structural difference
apparent between KIR and FcRI is that the KIRs have a sequence motif
PGP, residues 14–16 in EC1 and residues 114–116 in EC2, the first
proline of which kinks the A strand, splitting it into an A and an A'
strand. This proline kinking motif is absent in the FcRI, suggesting
that the A strand may not be split in this protein.
Displaying the binding site residues of FcRI on the model (Fig. 7A) predicts that these lie on
one face of the receptor at the N-terminal end of the EC1. The side
chains of residues essential for IgA binding are shown in red. The side
chains of residues 82–87 from the F-G region and Y35 from the B-C
region are closely packed and in van der Waals contact. The F-G loop
forms a distinct protrusion from the domain, with the
Arg82 and His85, in
particular, being prominent. Residue Tyr81, on
the other hand, is less exposed and may play an important role in the
structure of the F-G loop. If viewed with EC1 end on (Fig. 7B), the most important binding site residues,
Tyr35, Tyr81,
Ile83, Gly84, and
Arg82, form a ridge flanked on one side by the
less crucial residues, His85 and
Tyr86. On the opposite side is
Arg52 in the C'-E region, with unexamined
residues in the C and C' regions lying between
Arg52 and Tyr35. The
arginyls will give the binding site a positive charged nature with
His85, Tyr35, and
Tyr86 possibly contributing hydrophobic
interactions.
|
RI resulted
in identification of Ab Fabs at low identity (10%). The site at the
CH2/CH3 interface of IgG-Fc for rheumatoid factor binding is similar to
the site at the CH2/CH3 interface of IgA recognized by FcRI. Hence,
the cocrystal structure of rheumatoid Fab with human IgG-Fc
(38) (PDB accession no. 1ADQ) was used to produce a
schematic view of how FcRI might bind IgA-Fc. A model of IgA
(39) (PDB accession no. 1IGA) was superimposed over the
carbon trace of the IgG-Fc in the Fc:rheumatoid Fab complex. The
carbon atoms of the sequence flanking the half cystines in EC1 of
the FcRI model were superimposed onto those of the
VH domain of the rheumatoid factor Fab (Fig. 8). This arrangement of FcRI
ectodomains and IgA placed the F-G region of the FcRI model close to
the essential residues (LLG 257–259, PLAF 440–443) at the CH2/CH3
interface of the IgA. The FcRI C-terminus is in proximity to the
membrane, while the ectodomains are rotated to present domain 1 away
from the plasma membrane and available for binding the IgA Fc. In this
representation each IgA heavy chain would appear to be able to interact
independently with an FcRI. Such an interaction would give a higher
apparent affinity of binding if IgA was bound by two receptors, one on
each H chain, than if bound by one receptor only. We addressed this
question using purified IgA and rsFcRI in a biosensor assay.
|
RI with one H chain by measuring the binding of rsFcRI to
immobilized IgA. Conversely, it is possible to measure the affinity of
potentially multiple receptor interactions with IgA by immobilizing the
receptor and capturing soluble IgA. To test this, the kinetics of
FcR:IgA interactions were measured under conditions where both
proteins were, in turn, immobilized separately. The binding of
rsFcRI to immobilized IgA (Fig. 9, thick line) showed a composite binding curve that included a small
component of higher affinity binding to IgA. This small component of
higher affinity binding was attributed to the presence of some
aggregates of the receptor that bound more avidly and hence the
sensogram fitted optimally to a model of competing reactions between a
heterogeneous analyte. The affinity for the monomer binding reaction
was estimated at 4.0 x 106
M-1 with a 
2 of 60. The
immobilization of rsFcRI had a pronounced effect on this interaction
(Fig. 9, dotted line). The binding of IgA by immobilized rsFcRI
fitted well (2 = 6) to a single-site model
with a Ka of 1.1 x
108 M-1. This was a
30-fold increase in the apparent affinity of the interaction over that
of the monomer soluble receptor binding to the immobilized IgA. If this
IgA were bound to receptor at only one heavy chain, then the binding
site on the other heavy chain should be unoccupied and available to
bind additional receptor. Therefore, this IgA, bound with high affinity
to immobilized rsFcRI, was tested for the capacity to bind
additional soluble receptor (Fig. 9, thin line). There was no
additional binding of rsFcRI to IgA bound to immobilized rsFcRI;
in fact, the soluble receptor marginally increased the dissociation of
the IgA from the layer (indicating that there is minimal rebinding of
IgA to the layer in the dissociation phase). Thus, there are no free
binding sites (CH2/CH3 interface) on IgA captured by immobilized
FcRI to which additional soluble rsFcRI can bind. The simplest
conclusion, since this binding is of much greater affinity than the
intrinsic rsFcR:IgA interaction, is that capture of IgA by the
immobilized FcRI involves interaction of receptors at both CH2/CH3
interfaces of the IgA.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RI with IgA is important in IgA-mediated
immunity and potentially in diseases such as IgA nephropathy. In the
study described herein we have made a detailed site-directed
mutagenesis survey of the F-G region and other regions of FcRI that
may bind to IgA, viz., the B-C, C'-E, and N-terminal regions. Normal
and mutant rsFcRs were produced in baculovirus, and IgA binding
affinities were assayed using a biosensor. The F-G region contributed
six residues that interacted with IgA. Substitution of residues Y81 or
R82 abolished IgA binding (Ka reduced
>100-fold), while substitution of residues I83, G84, H85, and Y86
reduced the receptor apparent affinity 11-, 19-, 4-, and 3-fold,
respectively. Substitution of R87 did not significantly decrease
binding. Thus, the contribution of the F-G region residues to the
FcR:IgA interaction was greatest at the start of the loop and
diminished as the alanine scan progressed along the loop. In addition
to residues Y81 and R82 in the F-G region, Y35 in the BC region proved
essential for IgA binding. Also, the R52A mutation in the putative C'-E
region reduced IgA binding 8-fold, showing that the ligand binding site
contains residues from at least three distinct regions of the receptor
primary sequence. Different substitutions to amino acid residues with
different size or charge properties would have more or less profound
effects on the binding activity of mutant receptors. Thus, the
definition of essential binding site residues can also vary depending
on the nature of the amino acid substitutions. For example, the
substitution of H85 with alanine resulted in a relatively small
reduction in binding activity, but substitution with glutamate
completely abolished the activity of the receptor
(25). The abrogation of IgA binding with the alanine substitution of R82 in the F-G region or Y35 in the C strand region was probably due to changing a binding contact with IgA rather than a global disruption to structure, as these results were confirmed by the expression of these mutant receptors at the surface of transfected COS cells. While IgA binding activity was completely lost, mAb MY43 binding, which blocks IgA binding to the receptor, was unaffected. Thus, the MY43 epitope does not include these IgA binding site residues. Furthermore, in these mutants the protein structure is not disrupted, as MY43 binding, near the IgA binding site, is preserved.
The fourth region tested for participation in IgA binding was the
N-terminal region of FcR. The first 10 aa of the receptor were
exchanged for those of the related LRC receptor ILT1, effectively
changing 6 aa residues in this N-terminal region. No effect was seen on
either MY43 binding or IgA binding to this mutant receptor compared
with the normal receptor. Thus, the N-terminus does not participate
directly in ligand binding. Thus FcRI is unlike the p58 KIR, where
the N-terminal peptide is a binding site for a ligand
(40).
Rather, the IgA binding site of FcRI has a number of features in
common with that of other Fc receptors. This is despite the fact that
the principal ligand interacting domain in other FcRs is EC2
(41), while interaction occurs through EC1 in FcRI. The
interactions of other FcRs and Igs have been characterized by extensive
mutagenesis (41) and recently for FcRIII/IgG-Fc
(22) and FcRI/IgE-Fc (23) by the solution
of crystal cocomplexes. These studies have shown that the B-C-C'-E
regions and the F-G region comprise the ligand binding sites of these
receptors. This study shows that this is also the case with the IgA
binding site of FcRI despite its low sequence relatedness (20%
identity) to other FcRs and the location of the ligand binding site
being in EC1 and not EC2. For receptors belonging to the LRC, which are
more closely related to FcRI and in which non-MHC ligands are
engaged, a similar binding site might be involved.
As an aid to visualizing the mutagenesis data we constructed a homology
model of the ectodomains of FcRI based on the KIR ectodomain
structures in the protein database. The basis of homology modeling lies
in the fact that there are expected to be only several 1000 distinct
protein folds possible for all globular proteins. There are currently
approximately 10,000 solved protein structures, but these represent
only 900 distinct folds. Modeling, therefore, requires identifying a
correct fold to serve as a template. The identification of folds using
the program PSI-BLAST (29) has a reported predictive
accuracy of 98% in a test search of 685 PDB entries with <25%
identity (30). PSI-BLAST identified KIR as a template for
the FcRI ectodomains, and a homology model was constructed. Several
features of the FcRI model indicated that KIR was a suitable
template, and predictions based on this theoretical structure should be
valid. The 44% identity between EC2 of KIR and FcRI is indicative
of an outcome from automated modeling equivalent to a low resolution
x-ray structure (35). The EC1 and EC2 of KIR have 40%
identity to each other, and these structures are superimposable.
Although the identity between ECs1 of KIR and FcRI was less (26%),
several structural elements validate the FcRI model. Firstly, the
packing of the central hydrophobic core residues L17, V100, and W188 in
KIR is emulated appropriately in the FcRI model by the near
identical packing of residues V17, V97, and W183. Since these residues
come from three distinct regions of primary sequence, the overall
fold of the model should be correct to achieve the packing of these
three residues against each other. Secondly, the interdomain linker
between EC1 and EC2 of KIR, GLYEK, was almost identical with that of
FcRI, GLYGK, including the conservation of the hinge Leu residue.
Thus, the FcRI ectodomains should be bent similar to the
KIR.
The homology model of FcRI was used to interpret the binding site
residues identified by mutagenesis. The model predicts that the
identified regions, while distant in primary sequence, are closely
spaced in the folded protein and is suggestive of a single binding
surface (Fig. 7). In particular, the residues from the B-C region and
F-G loop, which contribute essential residues for ligand binding, form
a single patch, with the most important residues, Y81, R82, I83, G84,
and Y35, forming a central band within this patch. The less important
F-G region residues H85 and Y86 lie alongside one edge of the central
band of essential residues. R52 lies on the opposite side of this
central band and is separated from Y35 by the C and C' strands. As
mutation of R52 also reduced binding, it may well be that residues in
the intervening C and C' regions between R52 and Y35 also contribute to
ligand binding. In short, the essential residues Y35, Y81, and R82
together with the other important ligand binding residues (R52, I83,
G84, and H85) form a single face near the end, but not including the
N-terminus, of EC1.
Using the solved cocrystal structure of rheumatoid factor Fab and
IgG-Fc, we have proposed an illustration of how FcRI may interact
with IgA-Fc. The identified ligand binding site is shown interacting at
the CH2/CH3 domains of the IgA where mutagenesis of IgA determined
FcRI binding to occur (27, 28). The FcRI residues
important in IgA binding include hydrophobic residues that may
complement the hydrophobic binding site residues (e.g., LLG 257–259,
PLAF 440–443, Bur numbering) identified in the CH2/CH3 interface
region of the IgA Fc (27, 28). There are also acidic
residues in the CH2/CH3 interface critical for binding that may
interact with positively charged FcRI residues (e.g., R82) important
in IgA binding. This rheumatoid Fab-based arrangement placed the
FcRI orientated to present domain 1 for binding at the IgA CH2/CH3
interface, but this is only one possible orientation. The
interaction of IgG-Fc and IgE-Fc with their FcRs occurs with the Fc
orientated almost upside down with respect to the FcR, such that the
segmental flexibility of the Ab must be important in the simultaneous
binding of Ag and Fc receptor (22, 23). The interaction of
IgA with FcRI is different to IgG and the FcRs, in that binding
occurs at the CH2/CH3 interface, and the mucin-like hinge region of
IgA1 may not confer the same segmental flexibility as the hinge of
IgGs. Therefore, we have represented the IgA Fc "standing up" to
interact with the FcR, as one possible configuration.
One distinctive and testable feature of this representation of the
FcR:IgA interaction is that either one or two receptors may bind to
the IgA, resulting in a low 1:1 and a high 2:1 affinity interaction
with IgA, respectively. Several experiments reported by others are
compatible with the FcRI binding independently to each IgA heavy
chain. Firstly, a C3-deficient IgA myeloma protein that consisted of
half molecules containing only one heavy chain bound FcRI
(10). Secondly, the binding site on IgA has been localized
to the CH2/CH3 interface, so that two independent sites could exist per
IgA (27, 28). Thus, although these experiments were not
determinations of the stoichiometry of the interaction of intact IgA,
they would suggest that a 2:1 interaction is possible between receptor
and intact IgA. Such potential ligand binding behavior is likely to be
significant in the biology of the receptor on leukocytes, as it has
been observed that pretreatment of myeloid cell lines with IgA does not
alter receptor number, but increases affinity for IgA
(42). Also, the GM-CSF treatment of human neutrophils
(43), cytokine treatment of eosinophils (44),
or FcRI-transfected BaF3 cells (45) increase FcRI
affinity for IgA without an increase in receptor number. This low or
high affinity IgA binding behavior must depend on the organization of
the receptors in the cell membrane and/or their association with other
accessory surface molecules and may result from a switch from a 1:1
binding stoichiometry to a 2:1 binding stoichiometry.
This switch from low to high FcRI binding affinity was shown in BaF3
cells to be independent of the subunit (45). In this
report we have shown low and high affinity FcR:monomer IgA
interaction in a biosensor system using only purified receptor and IgA
proteins. This involved comparing the binding of rsFcRI to IgA
immobilized to a biosensor surface with that of IgA binding to
immobilized rsFcR. The immobilization of the rsFcRI resulted in
an approximately 30-fold increase in apparent affinity over the
reaction of soluble FcRI with immobilized IgA. This corresponded to
a change in Kd from 0.25 µM to 9.1
nM. The low affinity binding found with soluble receptor approximates
previous studies where micromolar Kd
and Ki values have been reported with
soluble proteins and at the cell surface (10, 15, 25, 46).
The high affinity binding observed with immobilized receptor
(Kd = 9 nM) more closely approximates
the result from a study in which GM-CSF priming of neutrophils
determined a Kd of 6 nM, although in
this study the resting Kd was still
high at 21 nM (43). The location of the rsFcRI binding
site at the CH2/CH3 interface of the IgA-Fc is similar to the binding
site at the CH2/CH3 interface of IgG-Fc for the neonatal FcR (FcRn).
Similar to the FcR:IgA interaction described here, the rsFcRn:IgG
interaction studied using the biosensor also demonstrated high affinity
binding only when the FcRn was immobilized (47, 48).
In summary, we have presented an analysis of the interaction of FcRI
with IgA at the level of individual amino acids. Mutagenesis identified
residues important in IgA binding from three different regions: C
strand (Y35), C'-E region (R52), and F-G loop (Y81, R82, I83, G84, H85,
and Y86). A model of rsFcRI placed these residues in a single
contiguous face of domain 1. The N-terminal peptide was not involved in
IgA binding. In addition, we have shown immobilized rsFcRI binds IgA
with increased affinity, a behavior compatible with IgA interaction
with FcRI at the cell surface, where low and high affinity modes of
binding have been observed. These data should help define the
FcR:IgA interaction, which is of increasing interest in immunity,
disease, and immunotherapy.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 B.D.W. and C.T.S. contributed equally to this work.
3 Address correspondence and reprint requests to Dr. P. Mark Hogarth, Austin Research Institute, Austin Repatriation Medical Center, Studley Road, Heidelberg, Victoria 3084, Australia.
4 Abbreviations used in this paper: EC, ectodomain; KIR, killer Ig-like receptor; LRC, leukocyte receptor cluster; ILT1, Ig-like transcript-1; PDB, Protein Data Base; FcRn, neonatal FcR.
Received for publication November 30, 1999. Accepted for publication November 15, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RI-positive liver Kupffer cells: reappraisal of the function of immunoglobulin A in immunity. Nat. Med. 6:680.[Medline]
receptor expressed by human mesangial cells. Kidney Int. 57:1936.[Medline]
chain in human mesangial cells. Nephrol. Dial. Transplant. 14:1117. receptor (CD89). J. Am. Soc. Nephrol. 10:770. receptors on blood cells of IgA nephropathy patients: evidence for a negative regulatory role of serum IgA. Kidney Int. 53:1321.[Medline]
R. Crit. Rev. Immunol. 16:423.[Medline]
receptor in humans. J. Exp. Med. 171:597.R determined by measurement of chemiluminescence induced by serum or secretory IgA1 or IgA2. Immunology 71:328.[Medline]
R at physiological concentrations and is endocytosed but cross-linking is necessary to elicit a respiratory burst. J. Leukocyte Biol. 56:481.[Abstract]
R but not FcRIII trigger a respiratory burst in neutrophils although both trigger an increase in intracellular calcium levels and degranulation. Biochem. J. 306:519.
RI, CD89) function in transgenic mice requires both FcR chain and CR3 (CD11b/CD18). Blood 93:4387. receptor (CD89) mediates the development of immunoglobulin A (IgA) nephropathy (Berger’s disease): evidence for pathogenic soluble receptor-IgA complexes in patients and CD89 transgenic mice. J. Exp. Med. 191:1999.RIIa. Nat. Struct. Biol. 6:437.[Medline]
RIII complex. Nature 406:267.[Medline]
RI. Nature 406:259.[Medline]
receptor essential for interaction with IgA. J. Immunol. 162:2146.RI (CD89) and bovine Fc2R are located in their membrane-distal extracellular domains. J. Exp. Med. 189:1715.2 and C3 in human IgA1. J. Exp. Med. 183:1579. receptor (FcR) CD89. J. Biol. Chem. 274:23508. receptor II (CD32) isoforms produced in insect cells. Biochemistry 38:8469.[Medline]
receptors detected by receptor specific monoclonal antibodies. J. Immunol. 148:1764.[Abstract]
-receptor activation. Blood 95:2037.This article has been cited by other articles:
|
|
 |
|
  J. Purzel, R. Schmitt, B. C. Viertlboeck, and T. W. Gobel Chicken IgY Binds Its Receptor at the CH3/CH4 Interface Similarly as the Human IgA:Fc{alpha}RI Interaction J. Immunol., October 1, 2009; 183(7): 4554 - 4559. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. Ramsland, N. Willoughby, H. M. Trist, W. Farrugia, P. M. Hogarth, J. D. Fraser, and B. D. Wines Structural basis for evasion of IgA immunity by Staphylococcus aureus revealed in the complex of SSL7 with Fc of human IgA1 PNAS, September 18, 2007; 104(38): 15051 - 15056. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Abi-Rached, K. Dorighi, P. J. Norman, M. Yawata, and P. Parham Episodes of Natural Selection Shaped the Interactions of IgA-Fc with Fc{alpha}RI and Bacterial Decoy Proteins J. Immunol., June 15, 2007; 178(12): 7943 - 7954. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Zeng, M. E. Aldridge, X. Tian, D. Seiler, X. Zhang, Y. Jin, J. Rao, W. Li, D. Chen, M. P. Langford, et al. Dendritic Cell Surface Calreticulin Is a Receptor for NY-ESO-1: Direct Interactions between Tumor-Associated Antigen and the Innate Immune System J. Immunol., September 15, 2006; 177(6): 3582 - 3589. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Bakema, S. de Haij, C. F. den Hartog-Jager, J. Bakker, G. Vidarsson, M. van Egmond, J. G. J. van de Winkel, and J. H. W. Leusen Signaling through Mutants of the IgA Receptor CD89 and Consequences for Fc Receptor {gamma}-Chain Interaction J. Immunol., March 15, 2006; 176(6): 3603 - 3610. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. D. Wines, N. Willoughby, J. D. Fraser, and P. M. Hogarth A Competitive Mechanism for Staphylococcal Toxin SSL7 Inhibiting the Leukocyte IgA Receptor, Fc{alpha}RI, Is Revealed by SSL7 Binding at the C{alpha}2/C{alpha}3 Interface of IgA J. Biol. Chem., January 20, 2006; 281(3): 1389 - 1393. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Langley, B. Wines, N. Willoughby, I. Basu, T. Proft, and J. D. Fraser The Staphylococcal Superantigen-Like Protein 7 Binds IgA and Complement C5 and Inhibits IgA-Fc{alpha}RI Binding and Serum Killing of Bacteria J. Immunol., March 1, 2005; 174(5): 2926 - 2933. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. C. Morton, R. J. Pleass, J. M. Woof, and P. Brandtzaeg Characterization of the Ligand Binding Site of the Bovine IgA Fc Receptor (bFc{alpha}R) J. Biol. Chem., December 24, 2004; 279(52): 54018 - 54022. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Lecut, V. Arocas, H. Ulrichts, A. Elbaz, J.-L. Villeval, J.-J. Lacapere, H. Deckmyn, and M. Jandrot-Perrus Identification of Residues within Human Glycoprotein VI Involved in the Binding to Collagen: EVIDENCE FOR THE EXISTENCE OF DISTINCT BINDING SITES J. Biol. Chem., December 10, 2004; 279(50): 52293 - 52299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Wines, H. M. Trist, R. C. Monteiro, C. van Kooten, and P. M. Hogarth Fc Receptor {gamma} Chain Residues at the Interface of the Cytoplasmic and Transmembrane Domains Affect Association with Fc{alpha}RI, Surface Expression, and Function J. Biol. Chem., June 18, 2004; 279(25): 26339 - 26345. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. Smethurst, L. Joutsi-Korhonen, M. N. O'Connor, E. Wilson, N. S. Jennings, S. F. Garner, Y. Zhang, C. G. Knight, T. R. Dafforn, A. Buckle, et al. Identification of the primary collagen-binding surface on human glycoprotein VI by site-directed mutagenesis and by a blocking phage antibody Blood, February 1, 2004; 103(3): 903 - 911. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Foster, M. Colonna, and P. D. Sun Crystal Structure of the Human Natural Killer (NK) Cell Activating Receptor NKp46 Reveals Structural Relationship to Other Leukocyte Receptor Complex Immunoreceptors J. Biol. Chem., November 14, 2003; 278(46): 46081 - 46086. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ding, G. Xu, M. Yang, M. Yao, G. F. Gao, L. Wang, W. Zhang, and Z. Rao Crystal Structure of the Ectodomain of Human Fc{alpha}RI J. Biol. Chem., July 18, 2003; 278(30): 27966 - 27970. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. M. van der Boog, G. van Zandbergen, J. W. de Fijter, N. Klar-Mohamad, A. van Seggelen, P. Brandtzaeg, M. R. Daha, and C. van Kooten Fc{alpha}RI/CD89 Circulates in Human Serum Covalently Linked to IgA in a Polymeric State J. Immunol., February 1, 2002; 168(3): 1252 - 1258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. C. Morton, C. J. Howard, A. K. Storset, and P. Brandtzaeg Identification of Residues within the Extracellular Domain 1 of Bovine Fcgamma 2R Essential for Binding Bovine IgG2 J. Biol. Chem., December 14, 2001; 276(51): 47794 - 47800. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and
receptors mutated in the F-G region at Y81 (•), R82 (
), I83 (
),
G84 (
), H85 (
), Y86 (
), and R87 (
).
