The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ronet, C.
Right arrow Articles by Gachelin, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ronet, C.
Right arrow Articles by Gachelin, G.
The Journal of Immunology, 2001, 166: 1755-1762.
Copyright © 2001 by The American Association of Immunologists

Role of the Complementarity-Determining Region 3 (CDR3) of the TCR-{beta} Chains Associated with the V{alpha}14 Semi-Invariant TCR {alpha}-Chain in the Selection of CD4+ NK T Cells1

Catherine Ronet, Martin Mempel, Nathalie Thieblemont, Agnès Lehuen{dagger}, Philippe Kourilsky* and Gabriel Gachelin2,*

* Unité de Biologie Moléculaire du Gène, Département d’Immunologie, Institut Pasteur; and {dagger} Hôpital Necker, Paris, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The NK1.1+TCR{alpha}{beta}int CD4+, or double negative T cells (NK T cells) consist of a mixture of CD1d-restricted and CD1d-unrestricted cells. The relationships between CD4+NK1.1+ T cells and conventional T cells are not understood. To compare their respective TCR repertoires, NK1.1+TCR{alpha}{beta}int, CD4+ T cells have been sorted out of the thymus, liver, spleen, and bone marrow of C57BL/6 mice. Molecular analysis showed that thymus and liver used predominantly the V{alpha}14-J{alpha}281 and V{beta} 2, 7, and 8 segments. These cells are CD1d restricted and obey the original definition of NK T cells. The complementarity-determining region 3 (CDR3) sequences of the TCR V{beta}8.2-J{beta}2.5 chain of liver and thymus CD4+ NK T cells were determined and compared with those of the same rearrangements of conventional CD4+ T cells. No amino acid sequence or usage characteristic of NK T cells could be evidenced: the V{beta}8.2-J{beta}2.5 diversity regions being primarily the same in NK T and in T cells. No clonal expansion of the {beta}-chains was observed in thymus and liver CD1d-restricted CD4+NK T cells, suggesting the absence of acute or chronic Ag-driven stimulation. Molecular analysis of the TCR used by V{alpha}14-J{alpha}281 transgenic mice on a C{alpha}-/- background showed that the {alpha}-chain can associate with {beta}-chains using any V{beta} segment, except in NK T cells in which it paired predominately with V{beta} 2, 7, and 8+ {beta}-chains. The structure of the TCR of NK T cells thus reflects the affinity for the CD1d molecule rather than a structural constraint leading to the association of the invariant {alpha}-chain with a distinctive subset of V{beta} segment.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Murine T cells, which express both an {alpha}{beta}-TCR and NK cell markers, such as NK1.1 in C57BL/6 mice, are a recently discovered lymphocyte population distinct from T, B, and NK cells (1, 2, 3). When activated through their TCR, they become cytotoxic and quickly release cytokines, such as IL4 and IFN-{gamma} (4, 5). The physiological functions of these cells remain unclear and they have been implicated in very diverse conditions such as immune responses against infection (6, 7, 8) or tumors (9, 10), maintenance of pregnancy (11), granulomatous response (12, 13), and autoimmune responses (14). More precisely, CD4+ NK T cells seem to be a population essential to stimulating IL-12 production by APC (15) and to play crucial roles in early stage of Leishmania major infection (16) and to control acceptance of rat islet xenografts in mice (17). The NK T cells are primarily isolated from the thymus, liver, spleen, and bone marrow, in numbers ranging from 0.5 to 1.5 million in each organ, thus accounting for 0.5–1% of total T cells in the thymus and the spleen and 20–30% of all T lymphocytes of the liver and bone marrow (3, 18). NK T cells (i.e., cells defined as TCR-{alpha}{beta}int NK1.1+ CD4+, or double negative (DN)3) are heterogeneous. Most of them are TCR{alpha}{beta}int, CD4+, or DN, use an invariant V{alpha}14-J{alpha}281 TCR {alpha}-chain (2) preferentially associated to V{beta} 2, 7, or 8+ TCR {beta}-chains (1, 3, 19, 20), and are restricted by the MHC Ib CD1d molecules: these obey the original definition of NK T cells (3). Recent FACS and molecular analysis have shown that phenotypic NK T cells also contained a variable proportion of cells that were not restricted by CD1d and used all V{alpha} and V{beta} segments (5, 18, 21).

The role of the {beta}-chains of the TCR in the selection and in the recognition of CD1d/ligand complexes may be approached by studying the molecular features of the complementarity determining region 3 (CDR3) of the {beta}-chains. The CD1d molecules present GPI proteins, foreign or altered glycolipids, such as {alpha}-galactosyl ceramide or cancer glycolipids, as well as self-glycolipids (22, 23, 24, 25, 26, 27). The lipidic moiety of the ligands is buried in the hydrophobic pocket created by the folding of the {alpha}1 and {alpha}2 domains of CD1d molecule, whereas the carbohydrate moiety of the glycolipids is exposed to the outside and thus made accessible to the TCR. Indeed, all data available so far concerning the stereochemistry of the recognition of {alpha}-galactosyl ceramide by the TCR of V{beta}8.2+ NK T cells point to the specific recognition of the carbohydrate moiety of the ligand, particularly of the OH group at position 2 and of the {alpha}-linkage (28). The TCR {beta}-chains of the CD1d-restricted NK T cells are expected to contribute to recognition of highly hydrophilic structures, a role that may be reflected in the physicochemical features of the CDR3 of the {beta}-chains (29) as suggested by studies on T cell recognition of glycopeptides (30) and on recognition of the carbohydrate moiety of glycolipids by T cell hybridomas (31).

A prerequisite for this analytical study is the availability of homogeneous populations of NK T cells. Because CD4+ NK T cells seem essential in immune responses to infection autoimmunity and transplantation, we have focused our study on this population. Thus, TCR-{alpha}{beta}intNK1.1+ CD4+ T cells were sorted out of the thymus, spleen, bone marrow, and liver of 6-wk-old C57BL/6 mice and studied for their V{alpha} and V{beta} usage. Nearly homogeneous populations of CD4+ T cells characterized by the usage of the invariant V{alpha}14-J{alpha}281 {alpha}-chain and a skewed V{beta} usage (thus, CD1d restricted-NK T cells) were identified in the thymus and the liver. The repertoire of their TCR {beta}-chain could thus be determined and compared with that of the same V{beta}-J{beta} rearrangements present in conventional, class II-restricted, NK1.1-CD4+ T cells. No distinctive CDR3 length or amino acid sequence and composition that would be characteristic of CD1d-restricted NK T cells could be found. Moreover, the amino acid distributions within the CDR3s of the {beta}-chains of CD4+ NK T cells could not be distinguished from those of conventional CD4+ T cells. The invariant {alpha}-chain can pair with all {beta}-chains in CD8+NK1.1- T cells isolated from V{alpha}14-J{alpha}281 transgenic (Tg) mice on a C{alpha}-/- background, whereas the vast majority CD4+NK1.1+ T cells of the Tg mouse used V{beta} 2, 7, and 8 segments. Thus, these data suggest that the invariant {alpha}-chain is dominant for the interaction of the TCR with the CD1d molecules and may constitute the imprinting of the selection by CD1d molecules.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

The C57BL/6 mice used in this study were 6–8 wk old and were obtained from IFFA-Credo (L’Arbresle, France). V{alpha}14-J{alpha}281 Tg mice on C{alpha}-/- background have been previously described (14).

Preparation of single-cell suspensions

Single-cell suspensions were prepared from liver, spleen, thymus, and bone marrow. Total liver cells were resuspended in a 80% isotonic Percoll solution (Pharmacia, Uppsala, Sweden) and overlaid with a 40% isotonic Percoll solution. Centrifugation for 30 min at 3000 rpm resulted in the concentration of the mononuclear cells at the 40–80% interface. The collected cells were washed once with PBS supplemented with 2% FCS.

Thymus cells were dissociated and freed of connective tissue by filtration. The thymocytes were depleted of CD8+ cells using biotinylated anti-{alpha}CD8 Ab (CT-CD8{alpha}; Caltag, South San Francisco, CA) and streptavidin beads (Dynal, Oslo, Norway).

Total bone marrow cells were collected by flushing bones (tibia, femur) with 2% FCS in PBS and spleen cells were isolated as for thymus. In both cases, the cell suspension was first incubated with anti-Fc{gamma} III/II (Fcblock, 2.4G2) and then depleted using anti-B220 (RA3-6B2), anti-Mac1 (M1/70), anti-Gr1 (RB6-8C5) biotinylated Abs, and magnetic streptavidin beads. All Abs were purchased from PharMingen (San Diego, CA). After depletion, the cell suspension were kept at 4°C in RPMI 1640 supplemented with 2% FCS.

Abs and flow cytometry analyses

Cells were first incubated 10 min with Fcblock followed by a 30-min exposure to anti-TCR{beta}-FITC (H57-597), NK1.1-PE (PK136), CD4-biotin (RM4-5), or CD8-Cy-Chrome (53-6.7) Abs (PharMingen). After two washes, tricolor-streptavidin (Caltag) was added. After further washes, the cells were resuspended in PBS containing 2% FCS and analyzed using a FACSCalibur BD Becton Dickinson (San Jose, CA).

The cells were sorted on FACStar (BD Becton Dickinson) as TCR{alpha}{beta}+ NK1.1+CD4+, TCR{alpha}{beta}+ NK1.1-CD4+, and TCR{alpha}{beta}+NK1.1-CD4+ at a flow rate of 3500 events/s and collected in RPMI 1640 supplemented with 20% FCS.

RNA extraction and cDNA synthesis

Total RNA was isolated by ultracentrifugation through a discontinuous CsCl gradient as described (32). cDNA was synthesized from 10 µg of total RNA using a (dT)17 primer, 25 U of Rnasin (Promega, Madison, WI), and 10 U of avian myeloblastosis virus reverse transcriptase (Boehringer Mannheim, Indianapolis, IN) in the provided buffer.

mRNA quantification, PCR procedure, and Immunoscope analysis

Quantification of PCR products was conducted using a locally developed competitive PCR strategy based on size-altered CD3{epsilon} cDNA. Briefly, known number of copies of a plasmid (102–106 copies) harboring the CD3{epsilon} cDNA in which a 4-bp deletion has been introduced were mixed with the cDNA solution and PCR-amplified in the same tube in the presence of CD3{epsilon}-specific primers (5' primer: GCCTCAGAAGCATGATAAGC; 3' primer: CCTTGGCCTTCCTATTCTTG). PCR was run at saturation (40 cycles; 94°C, 30 s; 60°C, 30 s; 72°C, 30 s). The resulting PCR products were submitted to 5 cycles (94°C, 30 s; 60°C, 30 s; 72°C, 30 s) of extension using a nested fluorescent primer specific of CD3{epsilon} (FAM-CCCAGAGTGATACAGATGTC) and analyzed for size and peak area on an automated 373A sequencer (Perkin-Elmer, Norwalk, CT). The number of CD3{epsilon} copies contained in the samples was determined from a calibration curve.

A volume of cDNA solution containing 104 copies of cDNA CD3{epsilon} was PCR-amplified using each of the 24 V{beta}-specific primers (33) and a fluorescently labeled C{beta}-specific primer, (94°C, 30 s; 60°C, 30 s;72°C, 30 s) during 31 cycles, thus remaining within the exponential phase of amplification. Products resulting of this PCR were analyzed on an automatic sequencer. The size and the intensity of each band were recorded and then analyzed using Immunoscope software (Applied Biosystems, Foster City, CA) (34). A similar quantitative approach was conducted for analysis of the V{alpha} repertoire. V{alpha}-specific primers, with the exception of V{alpha} 9 and 15, have been described previously (12, 35) (V{alpha}9 primer: ACACCGTTGTTAAAGGCACC; V{alpha} 15 primer: GAGCCAAAGACTTATAGTTTT).

One microliter of the PCR product solution resulting from a first amplification step using the V{beta} 8.2-specific primer were further amplified for 20 more cycles (94°C, 45 s; 60°C, 45 s; 72°C, 1 min) using a nested primer J{beta}2.5-chain and the PFU DNA polymerase (Stratagene, La Jolla, CA) (32).

The PCR products could be further studied by run-off analysis using fluorescently labeled J{beta}-specific primers or were cloned for sequencing (32).

Cloning and sequencing

Blunt PCR products were ligated into the commercially available vector Blunt II-Topo (Invitrogen, Groningen, The Netherlands) and cloned in Escherichia coli (Invitrogen). Sequence reactions were conducted on positive clones using standard protocols (Perkin-Elmer), and nucleotide sequences were determined using the ABI-Prism 373 sequencing equipment (Applied Biosystems).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recovery of CD4+TCR{alpha}{beta}intNK1.1+ T cells from different organs of C57BL/6 mice

Single-cell suspensions prepared from thymus, spleen, liver, and bone marrow were first depleted using a mixture of anti-CD19, Mac-1, Gr-1, and CD8 mAbs. The CD4+TCR{alpha}{beta}intNK1.1+ T cells (which accounted for 15, 30, 1.2, and 5% of the depleted cell population in the thymus, liver, bone marrow, and spleen, respectively) were further sorted out as described in Materials and Methods. The purity of the sorted cells exceeded 98% for all four organs (the isolation of spleen cells is given as example, Fig. 1Go, B1 and B2). The average final recoveries for individual mice of sorted NK T CD4+ cells were ~105, 2 x 105, 3500, and 9000 cells in the thymus, liver, bone marrow, and spleen, respectively. Conventional NK1.1-CD4+TCR{alpha}{beta}high T cells were sorted out from spleen using settings that excluded TCR{alpha}{beta}intNK1.1- T and were also found 98% pure (Fig. 1Go, C1 and C2).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1. Purity of NK1.1+CD4+TCR{alpha}{beta}int T cells from the spleen of a C57BL/6 mouse. A, FACScan analysis of NK1.1/TCR{alpha}{beta} spleen cell suspension after depletion of CD8+ cells, B cells, macrophages, and granulocytes. The populations used are depicted as a circle (NK1.1+TCR{alpha}{beta}int) and a square (NK1.1-TCR{alpha}{beta}+). B, Purity of NK1.1+CD4+TCR{alpha}{beta}int T cells. C, Purity of NK1.1-CD4+ TCR{alpha}{beta}+ T cells.

 
Overexpression of the invariant V{alpha}14-J{alpha}281{alpha}-chain by NK1.1+TCR{alpha}{beta}intCD4+ T cells

The usage of all V{alpha} segments by sorted NK1.1+TCR{alpha}{beta}intCD4+ T cells was determined using a semiquantitative PCR-based analysis and compared with that of conventional CD4+ T cells isolated from age- and sex-matched, naive C57BL/6 mice. The V{alpha}14 segment accounted for 75, 95, 40, and 40% of total V{alpha} segments used by thymus, liver, spleen, and bone marrow NK1.1+TCR{alpha}{beta}intCD4+ T cells, respectively, compared with 3–5% detected in conventional CD4+ T cells and was thus overrepresented in all four organs (Fig. 2Go). The size distribution of the CDR3 of the rearranged V{alpha}14 chains was determined using the Immunoscope technique. The analysis of total T cells of the spleen showed that the V{alpha}14+ {alpha}-chain could use any size of the CDR3 (Fig. 3Go). By contrast, the V{alpha}14-C{alpha} Immunoscope analysis of the NK1.1+TCR{alpha}{beta}intCD4+ T cell populations sorted out of all four organs showed the presence of a unique 10 aa long CDR3 peak, further identified by sequencing and use of a clonotypic primer, as being the V{alpha}14-J{alpha}281 NK T cell-specific rearrangement (Fig. 3Go).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 2. Quantitative expression of V{alpha}-chains by NK1.1+CD4+ T cells sorted out from thymus, liver, spleen, and bone marrow. PCR products derived from exponential phase cycles (31 cycles) were loaded onto a 6% polyacrylamide gel, and peaks were analyzed using an automatic sequencer with Immunoscope software. The area under the peak is proportional to the relative quantitative usage of each V{alpha}. Results were represented by percentage of V{alpha} usage with black histograms for CD4+NK T cells and gray histograms for conventional CD4+ T cells.

 


View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 3. Use of the invariant V{alpha}14-J{alpha}281 {alpha}-chain by CD4+NK T cells and by CD4+ conventional spleen T cells. Immunoscope profiles of V{alpha}14-C{alpha} and V{alpha}14-J{alpha}281 rearrangements of sorted CD4+NK T in thymus, spleen, liver, and bone marrow.

 
Skewed usage of the {beta}-chains associated with the invariant {alpha}-chain

The V{beta} segments used by cells of the four NK1.1+TCR{alpha}{beta}intCD4+ T cell populations and of CD4+NK1.1-TCR{alpha}{beta}high conventional T cells sorted from the spleen and liver were determined (Fig. 4Go). The V{beta} repertoire of the liver and thymus NK1.1+TCR{alpha}{beta}intCD4+ T cell populations was nearly completely skewed toward the usage of the V{beta} 2, 7, and 8 segments. The skewing in the V{beta} usage was less marked in the spleen and bone marrow NK1.1+TCR{alpha}{beta}intCD4+ T cells but was still apparent. No such skewing was observed in conventional T cells. Altogether, these results confirm on a molecular basis that the most of NK1.1+TCR{alpha}{beta}intCD4+ liver T cells use the invariant V{alpha}14-J{alpha}281 {alpha}-chain associated with a limited set of {beta}-chains, namely V{beta} 2, 7, and 8, a set of markers that identifies the CD1d-restricted NK T cells. These cells primarily also predominate among thymus NK1.1+TCR{alpha}{beta}intCD4+ T cells and still contribute to 40–50% of the spleen and bone marrow NK1.1+TCR{alpha}{beta}intCD4+ T cells. The second NK1.1+TCR{alpha}{beta}intCD4+ T cell population found in spleen and bone marrow displays V{alpha} and V{beta} usages more similar to that of conventional T cells: their {alpha} and {beta} usages can be estimated by computing the expected contributions of the V{alpha}14+-associated TCR {beta}-chains and removing the resulting values from the total V{beta} values determined for total spleen and bone marrow NK1.1+TCR{alpha}{beta}intCD4+ T cells; then, a V{beta} usage close to that of conventional CD4+ T cells could be calculated (data not shown). Organ-specific heterogeneity, recently described among NK1.1+, TCR{alpha}{beta}int, DN T cells both by Immunoscope and FACS analyses (18, 21), seems thus to be a general feature of the NK1.1+TCR{alpha}{beta}int T cells. Liver and, to a lesser extent, thymus NK1.1+TCR{alpha}{beta}intCD4+ T cell populations are markedly enriched in molecularly defined CD4+ NK T cells, which in addition are CD1d restricted because they are not detectable in CD1d-/- mice (18, 36) (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 4. V{beta}-C{beta} usage by CD4+NK T cells. Semiquantitative analysis of TCR-V{beta} usage in CD4+ NK T cells sorted out from thymus, liver, spleen, and bone marrow (in black) and in conventional CD4+ T cells sorted out from spleen (in gray).

 
The invariant V{alpha}14-J{alpha}281 {alpha}-chain can associate with {beta}-chains using any V{beta} segment

The bias in the V{beta} usage observed in CD4+ NK T cells could be due to structural constraints associated with the particular folding of the semi-invariant {alpha}-chain. Due to the absence of the proper reagents, this problem had only be partly answered by FACS analysis of V{alpha}14-J{alpha}281 Tg mice on a C{alpha}-/- background (36). Thus, CD4+NK1.1+TCR{alpha}{beta} cells were sorted out of the liver, spleen, and bone marrow of these Tg mice. The V{beta} usage was determined using the same strategy as above (Fig. 5Go). Eighty-five percent of liver CD4+ NK T cells used the V{beta} 2, 7, and 8 segments. The remaining 15% were almost equally distributed among the other V{beta} segments with a bias in favor of V{beta} 1, 9, 10, 12, and 14. By contrast, an identical analysis performed on the CD8+NK1.1- T cell population of the same mice showed a use of all V{beta} segments, as in wild-type mice. Thus, invariant V{alpha}14-J{alpha}281 {alpha}-chain can associate to any V{beta}-chain in conventional T cells, but not in CD4+ NK T cells.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 5. V{beta}-C{beta} usage by V{alpha}14+CD4+NK T cells in V{alpha}14 Tg C{alpha}-/- mice. Semiquantitative analysis of TCR-V{beta} usage in V{alpha}14+ CD4+ NK T cells sorted out from liver, spleen, and bone marrow (in black) and in conventional V{alpha}14+ NK1.1-CD8+ T cells sorted out from spleen and liver (in gray).

 
The NK1.1+, TCR{alpha}{beta}int, and CD4+ V{alpha}14-J{alpha}281+ T cells are polyclonal

Liver and thymic NK1.1+TCR{alpha}{beta}intCD4+ T cells isolated from C57BL/6 wild-type mice were thus used in the study of the putative Ag recognition region (CDR3) of the {beta}-chains of their TCR, in an analysis aimed at defining the clonality of the populations. A V{beta}-C{beta} Immunoscope analysis of thymic and liver CD4+ NK T cells yielded a gaussian distribution of the CDR3 length of the V{beta}2, V{beta}7, V{beta} 8.1, 8.2, and 8.3 TCR {beta}-chains (Fig. 6Go), with no evidence of a distortion that would be indicative of dominant expansions. Similarly, the CDR3 size distribution observed for V{beta}2, V{beta}7, V{beta} 8.1, 8.2, and 8.3 TCR {beta}-chains of NK T cells of V{alpha}14-J{alpha}281 Tg mice were also polyclonal (data not shown). In addition to excluding major clonal expansions, these data also exclude the existence of structural constraints due to the length of the CDR3 of the {beta}-chain that would limit its association with the invariant {alpha}-chain.



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 6. Polyclonality of V{beta} 2, 7, and 8 TCR {beta}-chains associated to the invariant {alpha}-chain in CD4+NK T cells. Immunoscope profiles of representative V{beta}-C{beta} rearrangements obtained in CD4+NK T cells isolated from thymus and liver and in conventional spleen CD4+ T cells are shown in arbitrary units.

 
The repertoire of the V{beta} 8.2+ {beta}-chain of liver and thymus CD4+ NK T cells was studied in more detail because of the high frequency of the segment in NK T cells. Nested fluorescent J{beta}-specific primers were used to analyze the V{beta}8.2-C{beta} PCR products (Fig. 6Go). The J{beta} 2.1 to J{beta} 2.7 regions were found preferentially used but a similar bias in the J{beta} usage has already been reported in conventional T cells (37) (data not shown). All V{beta} 8.2-J{beta} Immunoscope patterns were found gaussian, with no evidence of expansions due to an Ag-specific proliferation, which would have appeared as a peak distorting the gaussian profile. These gaussian V-C and V-J profiles demonstrate the high degree of polyclonality of the TCR {beta}-chains of the CD4+ NK T cells. Assuming that NK T cells respond to Ag stimulation by clonal expansions as conventional T cells do, the gaussian patterns that we observed are indicative of the absence of a specific, acute, or chronic, antigenic stimulation of NK T cells.

Similarities of the V{beta}8.2-J{beta}2.5 TCR {beta}-chain used by CD4+ NK T cells and T cells

The V{beta}8.2-J{beta}2.5 rearrangements predominate among NK T cells because they represent ~7 and 4% of all V{beta}-J{beta} rearrangements used by liver and thymus NK T cells, respectively, on the basis of quantitative PCR analysis on thymic and liver CD4+ NK T cells. The V{beta}8.2-J{beta}2.5 PCR products derived from thymus and liver CD4+ NK T cells were thus cloned in E. coli and sequenced. A total of 278 and 372 sequences, respectively, were determined, of which 171 and 213 were different. The differences between "total" and "different" numbers were accounted for by the determination of the same nucleotide sequence in several clones. The size of the clones cannot be determined accurately due to the small number of cells of the original samples; however, it is most probably smaller than that of conventional T cells (38) due to the low frequency of redundant sequences.

The V{beta}8.2-J{beta}2.5 PCR products of conventional CD4+ T cells isolated from spleen were also cloned and sequenced, resulting in a total of 200 independent sequences that were taken as representative of the overall diversity of the CDR3 of V{beta}8.2-J{beta}2.5 rearranged {beta}-chains, irrespective of the {alpha}-chain with which they are associated. The absence of systematic biases in the cloning/sequencing procedures was assessed by comparing the distribution of the CDR3 length, determined by sequencing and determined using the Immunoscope analysis; no obvious bias due to PCR amplification and cloning could be seen (data not shown). The contribution of the CDR3 sequences derived from CD1d-restricted V{alpha}14-J{alpha}281+ CD4+NK1.1- T cells to the total number of determined sequences (39, 40) was calculated by comparison of V{alpha}14-C{alpha} Immunoscope profiles in CD1+/+ and CD1-/- mice and found to be in the 1–2% range and was thus considered as negligible (Ronet et al., manuscript in preparation).

Because its CDR3 length occurs at the highest frequency among rearranged V{beta}8.2-J{beta}2.5 using {beta}-chains, the nucleotide sequences that encode the 10 aa long CDR3 of V{beta}8.2-J{beta}2.5 {beta}-chains of CD4+ NK T cells and of conventional CD4+ T cells were analyzed in detail. The study of 48 liver CD4+ NK T sequences, 54 thymus CD4+ NK T sequences, and 79 spleen conventional CD4+ T cell sequences showed that both N and P additions were about as frequent and extensive in the CD4+ T and CD4+ NK T cell populations. No germline clone was found among the sequences studied. The D{beta}1 and D{beta}2 segments were used at random. The genomic V{beta}8.2 segment was shortened by 12 or 13 nucleotides in all NK T cell-derived sequences as it was in conventional CD4+ T cells (Table IGo). Thus, recombinational and diversity processes seem to be primarily the same in CD4+ NK T and in conventional CD4+ T cells.


View this table:
[in this window]
[in a new window]
 
Table I. Comparison of diversity of 10-aa sequences from CD4+NKT cells from liver, thymus, and CD4+ conventional T cells

 
The 10 aa long CDR3 sequences encoded by the same V{beta}8.2-J{beta}2.5 {beta} nucleotide sequences described above were aligned (Fig. 7Go). Positions 1 and 2 (Ser-Gly) were encoded by the genomic BV8S2A2 segment. All sequences retained for analysis differed at least at one position along the sequence, redundant sequences having been excluded. Position 3 (except D encoded by the genomic segment BV8S2A1) was always created by N diversity in both CD4+ conventional and CD4+ NK T cells. Except at position 3 (and to a much lesser extent at position 4) the diversity of which correlates with the extent of N diversity in the two cell populations, the amino acids present at each of the 10 positions of the CDR3 were primarily the same in CD4+ T and CD4+ NK T cells. Also, the nature of the amino acids detected at position 3 was primarily the same in both cell types, and these amino acids were used at similar frequencies; they were A, D, E, G, K, N, T, V and A, D, E, G, K, P, T, and V, respectively. No statistical bias in the usage of the protonated or hydrophilic amino acid was associated specifically to CD4+ NK T cells, although the CDR3 of CD4+ NK T cells was expected to be enriched in amino acids able to interact with the OH side chains of the carbohydrate moiety of glycolipids. Finally, the 3-dimensional display of the frequency of the amino acid used by CD4+ NK T and CD4+ T cells at defined positions along the CDR3 sequences illustrates the absence of NK T cell- or T cell-specific distribution of amino acids (Fig. 7Go).



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 7. Similarity in the patterns of the V{beta}8.2-J{beta}2.5 rearrangement used by NK T cells and T cells. Extensive sequencing was performed in CD4+NK T cells from liver, thymus, and in conventional CD4+ T cells. For each organ, the analysis of all sequences permits the determination of the amino acid usage in percentage at each given position in a CDR3 of 10 aa.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
These data confirm and extend the emerging conclusion that NK1.1+TCR{alpha}{beta}int T cells are heterogeneous and, in addition to being either DN or CD4+, consist in at least two populations. The usage of an invariant V{alpha}14-J{alpha}281 {alpha}-chain and of a set of {beta}-chains skewed toward the nearly exclusive usage of the V{beta} 2, 7, and 8 segments, characterizes one of the two populations. The second population is defined by the same apparent cell surface phenotype but differs from the previous one by a usage of the {alpha}- and {beta}-segments similar to that of conventional T cells. The existence of two cell populations within the DN, NK1.1+TCR{alpha}{beta}int T cells, has been recently found by FACS and Immunoscope analyses (18, 21). Thus, the phenotypic description of DN or CD4+, NK1.1+ TCR{alpha}{beta}int T cells does not define unequivocally a cell population. We propose to restrict the use of the expression NK T cells to the DN or CD4+, NK1.1+ TCR{alpha}{beta}int T cells that use the V{alpha}14-J{alpha}281 invariant {alpha}-chain in combination with the V{beta} 2, 7, and 8+ segments. In that respect, the liver and thymus CD4+ NK1.1+TCR{alpha}{beta}int T cells obey this definition of NK T cells, and the cells sorted out from these two organs on the basis of the CD4+ NK1.1+TCR{alpha}{beta}int phenotype are rather homogeneous populations of NK T cells.

The exclusive usage of an invariant {alpha}-chain in thymus and liver NK T cells permits the direct approach of the diversity of the associated {beta}-chains. The Immunoscope profiles of the V{beta}-C{beta} TCR {beta}-chains associated to liver and thymus NK T cells showed a random usage of the CDR3 length of the associated V{beta} 2, 7, and 8 TCR {beta}-chains. This was confirmed by further analysis of NK T cells in V{alpha}14J{alpha}281 Tg mice on C{alpha}-/- background. No significant skewing of the J{beta} usage was detected on a sequence and Immunoscope basis. The V{beta}-J{beta} Immunoscope analysis confirmed that the thymus and liver V{alpha}14+ NK T cells were polyclonal with no evidence for clonal expansions, a profile reminiscent of that of naive CD4+ T cells. These findings are difficult to reconcile with the observation using FACS analysis that NK T cells display cell surface markers of activated and memory T cells (data not shown) (18, 21), whereas clonal expansions are a hallmark of conventional activated and memory T cells. This becomes understandable if the replication rate of NK T cells is more limited than that of T cells, as already suggested (3). The absence of clonal expansion may also be explained by the absence of activation of NK T cells at the periphery by nonself-ligands, the activated phenotype being due to repeated exposure to a large array of diverse self-glycolipids (25).

The comparison of the CDR3 sequences of CD4+ NK T and T cells did not suggest the existence of any distinctive feature that could unequivocally be attributed to the {beta}-chain of the TCR of NK T cells. On the contrary, the 10-aa-long sequences of the CDR3 V{beta}8.2-J{beta}2.5 rearrangements of NK T and of conventional CD4+ T cells shared similar features; the details of the machinery generating the {beta}-chain diversity were also the same in T and NK T cells. Thus, most of the properties of the TCR of NK T cells seem to be dictated by the presence of the invariant {alpha}-chain. The differentiation pathway of NK T cells, as well as the moment at which they segregate from the mainstream of T cell differentiation pathway, are not well understood. The CDR3s of the {beta}-chains of NK T cells are not different from those found associated to randomly taken TCR {alpha}-chains of conventional CD4+ T cells. Studies on the V{alpha}14 Tg mice on a C{alpha}-/- background revealed that peripheral CD4+ NK T cells used mainly V{beta} 2, 7, or 8, whereas the same invariant {alpha}-chain can associate with any V{beta}+ chain in conventional CD8+NK1.1- T cells. Thus there is no structural constraint caused by a particular folding of the invariant {alpha}-chain. The predominant role of the {alpha}-chain in the selection of NK T cells on CD1d molecules is strongly suggested by our data. Thus the clonotypic {alpha}-chain behaves as some kind of a print of the recognition of the CD1d molecules.

In this respect, the similarity of the CDR3 sequences of naive CD4+ T and of CD4+ NK T cells, although the two populations are clearly endowed by distinct functional properties, questions the role of the {beta}-chain in the selection of NK T cells. The role of the {beta}-chain in carbohydrate recognition is supported by the finding that some NK T cell clones, and also ex vivo NK T cell populations, can discriminate between sugar-derivatized ceramides and thus identify differences in the structure of carbohydrates (41, 42). Recently acquired data are more in favor of the conclusion that the CDR3 of the TCR {beta}-chain of NK T cells is endowed with a highly degenerated recognition ability. Indeed, the analysis of the human V{alpha}24+ V{beta}11+ NK T cells in vitro expanded in the presence of {alpha}-galactosyl-ceramide was indicative of a polyclonal activation of NK T cells with no evidence for predominantly expanding clones (43). Also, the isolation of CD1d-restricted NK T cells with CD1d tetramers loaded with {alpha}GalCer results in the sorting of the entire population that uses the V{alpha}14-J{alpha}281 {alpha}-chain, whatever NK1.1+ or NK1.1- (40) rather than the sorting of discrete, oligoclonal, Ag-specific populations, as for class I tetramers loaded with peptides (44). Only the 3-dimensional structure of CD1d-glycolipid-TCR complexes will definitely settle the problem of the relative contribution of TCR {alpha}- and {beta}-chains to the recognition of glycolipids.


    Acknowledgments
 
We thank Drs. P. Bousso and D. Guy-Grand for helpful discussions and critical reading of the manuscript. We thank A. Lim and S. Darche for technical advice, S. Dalle for construction of the CD3{epsilon} plasmid, and A. Louise and H. Kiefer-Biasizzo for the cell sorting.


    Footnotes
 
1 C.R., M.M., and N.T. were supported by fellowships of the Ministère de la Recherche et de la Technologie, Deutsche Forschungsgemeinschaft and the Association pour la Recherche contre le Cancer, respectively. The work conducted in the laboratory of "Biologie Moléculaire du Gène" was supported by La Ligue Nationale contre le Cancer, L’Association pour la Recherche contre le Cancer, the Collège de France, and the European Communities. Back

2 Address correspondence and reprint requests to Dr. Gabriel Gachelin, Unité de Biologie Moléculaire du Gène, Institut National de la Santé et de la Recherche Médicale U277, Departement d’Immunologie, Institut Pasteur, 25 rue du Dr. Roux, 75015, Paris, France. Back

3 Abbreviations used in this paper: DN, double negative; CDR3, complementarity-determining region 3; Tg, transgenic. Back

Received for publication July 11, 2000.
    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bendelac, A., N. Killeen, D. Littman, R. Schwartz. 1994. A subset of CD4+ thymocytes selected by MHC class I molecules. Science 263:1774.[Abstract/Free Full Text]
  2. Lantz, O., A. Bendelac. 1994. An invariant T cell receptor {alpha}-chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 190:1097.
  3. Bendelac, A., M. Rivera, S. Park, J. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15:535.[Medline]
  4. Arase, H., N. Arase, K. Nakagawa, R. A. Good, K. Onoe. 1993. NK1.1+ CD4+ CD8- thymocytes with specific lymphokine secretion. Eur. J. Immunol. 23:307.[Medline]
  5. Hammond, K., S. Pelikan, N. Crowe, E. Randle-Barrett, T. Nakayama, M. Taniguchi, M. Smyth, I. van Driel, R. Scollay, A. Baxter, D. Godfrey. 1999. NKT cells are phenotypically and functionally diverse. Eur. J. Immunol. 29:3768.[Medline]
  6. Pied, S., J. Roland, A. Louise, D. Voegtle, V. Soulard, D. Mazier, P. Cazenave. 2000. Liver CD4-CD8- NK1.1+ TCR-{alpha}{beta} intermediate cells increase during experimental malaria infection and are able to exhibit inhibitory activity against the parasite liver stage in vitro. J. Immunol. 164:1463.[Abstract/Free Full Text]
  7. Emoto, M., Y. Emoto, I. Buchwalow, S. Kaufmann. 1999. Induction of IFN-{gamma}-producing CD4+ natural killer T cells by Mycobacterium bovis bacillus Calmette Guerin. Eur. J. Immunol. 29:650.[Medline]
  8. Szalay, G., C. Ladel, C. Blum, L. Brossay, M. Kronenberg, S. Kaufmann. 1999. anti-CD1 monoclonal antibody treatment reverses the production patterns of TGF-{beta}2 and Th1 cytokines and ameliorates listeriosis in mice. J. Immunol. 162:6955.[Abstract/Free Full Text]
  9. Cui, J., T. Shin, T. Kawano, H. Sato, E. Kondo, I. Toura, Y. Kaneko, H. Koseki, M. Kanno, M. Taniguchi. 1997. Requirement for V{alpha}14 NKT cells in IL-12-mediated rejection of tumors. Science 278:1623.[Abstract/Free Full Text]
  10. Kawano, T., J. Cui, Y. Koezuka, I. Toura, Y. Kaneko, H. Sato, E. Kondo, M. Harada, H. Koseki, T. Nakayama, et al 1998. Natural killer-like nonspecific tumor cell lysis mediated by specific ligand-activated V{alpha}14 NKT cells. Proc. Natl. Acad. Sci. USA 95:5690.[Abstract/Free Full Text]
  11. Ito, K., M. Karasawa, T. Kawano, T. Akasaka, H. Koseki, Y. Akutsu, E. Kondo, S. Sekiya, K. Sekikawa, M. Harada, et al 2000. Involvement of decidual V{alpha}14 NKT cells in abortion. Proc. Natl. Acad. Sci. USA 97:740.[Abstract/Free Full Text]
  12. Apostolou, I., Y. Takahama, C. Belmant, T. Kawano, M. Huerre, G. Marchal, J. Cui, M. Taniguchi, H. Nakauchi, J.-J. Fournie, et al 1999. Murine natural killer T-cells contribute to the granulomatous reaction caused by mycobacterial cell walls. Proc. Natl. Acad. Sci. USA 96:5141.[Abstract/Free Full Text]
  13. Mempel, M., B. Flageul, F. Suarez, C. Ronet, L. Dubertret, P. Kourilsky, G. Gachelin, P. Musette. 2000. Comparison of the T-cell patterns in leprous and cutaneous sarcoid granulomas: presence of V{alpha}24-invariant NKT cells in T-cell reactive leprosy together with a highly biased TCR V{alpha} repertoire. Am. J. Pathol. 157:509.[Abstract/Free Full Text]
  14. Lehuen, A., O. Lantz, L. Beaudoin, V. Laloux, C. Carnaud, A. Bendelac, J. Bach, R. Monteiro. 1998. Overexpression of natural killer T cells protects V{alpha}14-J{alpha}281 transgenic nonobese diabetic mice against diabetes. J. Exp. Med. 188:1831.[Abstract/Free Full Text]
  15. Tomura, M., W. G. Yu, H. J. Ahn, M. Yamashita, Y. F. Yang, S. Ono, T. Hamaoka, T. Kawano, M. Taniguchi, Y. Koezuka, H. Fujiwara. 1999. A novel function of V{alpha}14+CD4+NKT cells: stimulation of IL-12 production by antigen-presenting cells in the innate immune system. J. Immunol. 163:93.[Abstract/Free Full Text]
  16. Ishikawa, H., H. Hisaeda, M. Taniguchi, T. Nakayama, T. Sakai, Y. Maekawa, Y. Nakano, M. Zhang, T. Zhang, M. Nishitani, et al 2000. CD4+ V{alpha}14 NKT cells play a crucial role in an early stage of protective immunity against infection with Leishmania major. Int. Immunol. 12:1267.[Abstract/Free Full Text]
  17. Ikehara, Y., Y. Yasunami, S. Kodama, T. Maki, M. Nakano, T. Nakayama, M. Taniguchi, S. Ikeda. 2000. CD4+ V{alpha}14 natural killer T cells are essential for acceptance of rat islet xenografts in mice. J. Clin. Invest. 105:1761.[Medline]
  18. Eberl, G., R. Lees, S. Smiley, M. Taniguchi, M. Grusby, H. MacDonald. 1999. Tissue-specific segregation of CD1d-dependent and CD1d-independent NK T cells. J. Immunol. 162:6410.[Abstract/Free Full Text]
  19. Makino, Y., R. Kanno, T. Ito, K. Higashino, M. Taniguchi. 1995. Predominant expression of invariant V{alpha}14+ TCR {alpha} chain in NK1.1+ T cell populations. Int. Immunol. 7:1157.[Abstract/Free Full Text]
  20. Ohteki, T., H. MacDonald. 1996. Stringent V{beta} requirement for the development of NK1.1+ T cell receptor-{alpha}{beta}+ cells in mouse liver. J. Exp. Med. 183:1277.[Abstract/Free Full Text]
  21. Apostolou, I., A. Cumano, G. Gachelin, P. Kourilsky. 2000. Evidence for two sub-groups of CD4-CD8- natural killer T cells with distinct TCR {alpha}/{beta} repertoires and differential distribution in lymphoid tissues. J. Immunol. 165:2481.[Abstract/Free Full Text]
  22. Kawano, T., J. Cui, Y. Koezuka, I. Toura, Y. Kaneko, K. Motoki, H. Ueno, R. Nakagawa, H. Sato, E. Kondo, et al 1997. CD1d-restricted and TCR-mediated activation of V{alpha}14 NKT cells by glycosylceramides. Science 278:1626.[Abstract/Free Full Text]
  23. Schofield, L., M. J. McConville, D. Hansen, A. S. Campbell, B. Fraser-Reid, M. Grusby, S. D. Tachado. 1999. CD1d- restricted immunoglobulin G formation to GPI-anchored antigens mediated by NKT cells. Science 283:225.[Abstract/Free Full Text]
  24. Burdin, N., L. Brossay, Y. Koezuka, S. Smiley, M. Grusby, M. Gui, M. Taniguchi, K. Hayakawa, M. Kronenberg. 1998. Selective ability of mouse CD1 to present glycolipids: {alpha}-galactosylceramide specifically stimulates V{alpha}14+ NK T lymphocytes. J. Immunol. 161:3271.[Abstract/Free Full Text]
  25. Shamshiev, A., A. Donda, I. Carena, L. Mori, L. Kappos, G. De Libero. 1999. Self glycolipids as T-cell autoantigens. Eur. J. Immunol. 5:1667.
  26. Gumperz, J., C. Roy, A. Makowska, D. Lum, M. Sugita, T. Podrebarac, Y. Koezuka, S. Porcelli, S. Cardell, M. Brenner, S. Behar. 2000. Murine CD1d-restricted T cell recognition of cellular lipids. Immunity 12:211.[Medline]
  27. Kronenberg, M., L. Brossay, Z. Kurepa, J. Forman. 1999. Conserved lipid and peptide presentation functions of nonclassical class I molecules. Immunol. Today 20:515.[Medline]
  28. Brossay, L., O. Naidenko, N. Burdin, J. Matsuda, T. Sakai, M. Kronenberg. 1998. Structural requirements for galactosylceramide recognition by CD1-restricted NK T cells. J. Immunol. 161:5124.[Abstract/Free Full Text]
  29. Naidenko, O., J. Maher, W. Ernst, T. Sakai, R. Modlin, M. Kronenberg. 1999. Binding and antigen presentation of ceramide-containing glycolipids by soluble mouse and human CD1d molecules. J. Exp. Med. 190:1069.[Abstract/Free Full Text]
  30. Jensen, T., P. Hansen, A. Faurskov Nielsen, M. Meldal, S. Komba, O. Werdelin. 1999. Shared structural motifs in TCR of glycopeptide-recognizing T cell hybridomas. Eur. J. Immunol. 29:2759.[Medline]
  31. Grant, E., M. Degano, J. Rosat, S. Stenger, R. Modlin, I. Wilson, S. Porcelli, M. Brenner. 1999. Molecular recognition of lipid antigens by T cell receptors. J. Exp. Med. 189:195.[Abstract/Free Full Text]
  32. Levraud, J., C. Pannetier, P. Langlade-Demoyen, V. Brichard, P. Kourilsky. 1996. Recurrent T cell receptor rearrangements in the cytotoxic T lymphocyte response in vivo against the p815 murine tumor. J. Exp. Med. 183:439.[Abstract/Free Full Text]
  33. Pannetier, C., J. Even, P. Kourilsky. 1995. T-cell repertoire diversity and clonal expansions in normal and clinical samples. Immunol. Today 16:176.[Medline]
  34. Pannetier, C., M. Cochet, S. Darche, A. Casrouge, M. Zoller, P. Kourilsky. 1993. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor {beta}-chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90:4319.[Abstract/Free Full Text]
  35. Casanova, J., P. Romero, C. Widmann, P. Kourilsky, J. Maryanski. 1991. T cell receptor genes in a series of class I major histocompatibility complex-restricted cytotoxic T lymphocyte clones specific for a Plasmodium berghei nonapeptide: implications for T cell allelic exclusion and antigen-specific repertoire. J. Exp. Med. 174:1371.[Abstract/Free Full Text]
  36. Bendelac, A., R. D. Hunziker, O. Lantz. 1996. Increased interleukin 4 and immunoglobulin E production in transgenic mice overexpressing NK1 T cells. J. Exp. Med. 184:1285.[Abstract/Free Full Text]
  37. Musette, P., C. Pannetier, G. Gachelin, P. Kourilsky. 1994. The expansion of a CD4+ T cell population bearing a distinctive {beta}-chain in MRL lpr/lpr mice suggests a role for the fas protein in peripheral T cell selection. Eur. J. Immunol. 24:2761.[Medline]
  38. Casrouge, A., E. Beaudoing, S. Dalle, C. Pannetier, J. Kanellopoulos, P. Kourilsky. 2000. Size estimate of the {alpha}{beta}-TCR repertoire of naive mouse splenocytes. J. Immunol. 164:5782.[Abstract/Free Full Text]
  39. Chen, H., W. Paul. 1998. A population of CD62Llow Nk1.1- CD4+ T cells that resembles NK1.1+ CD4+ T cells. Eur. J. Immunol. 28:3172.[Medline]
  40. Benlagha, K., A. Weiss, A. Beavis, L. Teyton, A. Bendelac. 2000. In vivo identification of glycolipid antigen-specific T cells using fluorescent CD1d tetramers. J. Exp. Med. 191:1895.[Abstract/Free Full Text]
  41. Taniguchi, M., H. Koseki, T. Tokuhisa, K. Masuda, H. Sato, E. Kondo, T. Kawano, J. Cui, A. Perkes, S. Koyasu, Y. Makino. 1996. Essential requirement of an invariant V{alpha}14 T cell antigen receptor expression in the development of natural killer T cells. Proc. Natl. Acad. Sci. USA 93:11025.[Abstract/Free Full Text]
  42. Burdin, N., L. Brossay, M. Degano, H. Iijima, M. Gui, I. A. Wilson, M. Kronenberg. 2000. Structural requirements for antigen presentation by mouse CD1. Proc. Natl. Acad. Sci. USA 97:10156.[Abstract/Free Full Text]
  43. Kawano, T., Y. Tanaka, E. Shimizu, Y. Kaneko, N. Kamata, H. Sato, H. Osada, S. Sekiya, T. Nakayama, M. Taniguchi. 1999. A novel recognition motif of human NKT antigen receptor for a glycolipid ligand. Int. Immunol. 11:881.[Abstract/Free Full Text]
  44. Bousso, P., A. Casrouge, J. Altman, M. Haury, J. Kanellopoulos, J. Abastado, P. Kourilsky. 1998. Individual variations in the murine T cell response to a specific peptide reflect variability in naive repertoires. Immunity 9:169.[Medline]



This article has been cited by other articles:


Home page
JEMHome page
D. G. Wei, S. A. Curran, P. B. Savage, L. Teyton, and A. Bendelac
Mechanisms imposing the V{beta} bias of V{alpha}14 natural killer T cells and consequences for microbial glycolipid recognition
J. Exp. Med., May 15, 2006; 203(5): 1197 - 1207.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
L. Kjer-Nielsen, N. A. Borg, D. G. Pellicci, T. Beddoe, L. Kostenko, C. S. Clements, N. A. Williamson, M. J. Smyth, G. S. Besra, H. H. Reid, et al.
A structural basis for selection and cross-species reactivity of the semi-invariant NKT cell receptor in CD1d/glycolipid recognition
J. Exp. Med., March 20, 2006; 203(3): 661 - 673.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Ronet, S. Darche, M. L. de Moraes, S. Miyake, T. Yamamura, J. A. Louis, L. H. Kasper, and D. Buzoni-Gatel
NKT Cells Are Critical for the Initiation of an Inflammatory Bowel Response against Toxoplasma gondii
J. Immunol., July 15, 2005; 175(2): 899 - 908.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Anfossi, S. H. Robbins, S. Ugolini, P. Georgel, K. Hoebe, C. Bouneaud, C. Ronet, A. Kaser, C. B. DiCioccio, E. Tomasello, et al.
Expansion and Function of CD8+ T Cells Expressing Ly49 Inhibitory Receptors Specific for MHC Class I Molecules
J. Immunol., September 15, 2004; 173(6): 3773 - 3782.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Schumann, R. B. Voyle, B.-Y. Wei, and H. R. MacDonald
Cutting Edge: Influence of the TCR V{beta} Domain on the Avidity of CD1d:{alpha}-Galactosylceramide Binding by Invariant V{alpha}14 NKT Cells
J. Immunol., June 15, 2003; 170(12): 5815 - 5819.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Ranson, C. A. J. Vosshenrich, E. Corcuff, O. Richard, V. Laloux, A. Lehuen, and J. P. Di Santo
IL-15 availability conditions homeostasis of peripheral natural killer T cells
PNAS, March 4, 2003; 100(5): 2663 - 2668.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Sidobre, O. V. Naidenko, B.-C. Sim, N. R. J. Gascoigne, K. C. Garcia, and M. Kronenberg
The V{alpha}14 NKT Cell TCR Exhibits High-Affinity Binding to a Glycolipid/CD1d Complex
J. Immunol., August 1, 2002; 169(3): 1340 - 1348.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Laloux, L. Beaudoin, C. Ronet, and A. Lehuen
Phenotypic and Functional Differences Between NKT Cells Colonizing Splanchnic and Peripheral Lymph Nodes
J. Immunol., April 1, 2002; 168(7): 3251 - 3258.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
D. M. OJCIUS, C. DELARBRE, P. KOURILSKY, and G. GACHELIN
MHC and MHC-related proteins as pleiotropic signal molecules
FASEB J, February 1, 2002; 16(2): 202 - 206.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Mempel, C. Ronet, F. Suarez, M. Gilleron, G. Puzo, L. Van Kaer, A. Lehuen, P. Kourilsky, and G. Gachelin
Natural Killer T Cells Restricted by the Monomorphic MHC Class 1b CD1d1 Molecules Behave Like Inflammatory Cells
J. Immunol., January 1, 2002; 168(1): 365 - 371.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Gilleron, C. Ronet, M. Mempel, B. Monsarrat, G. Gachelin, and G. Puzo
Acylation State of the Phosphatidylinositol Mannosides from Mycobacterium bovis Bacillus Calmette Guerin and Ability to Induce Granuloma and Recruit Natural Killer T Cells
J. Biol. Chem., September 7, 2001; 276(37): 34896 - 34904.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg
Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size
PNAS, October 23, 2001; 98(22): 12636 - 12641.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ronet, C.
Right arrow Articles by Gachelin, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ronet, C.
Right arrow Articles by Gachelin, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS