|
|
||||||||
Chains Associated with the V
14 Semi-Invariant TCR
-Chain in the Selection of CD4+ NK T Cells1

*
Unité de Biologie Moléculaire du Gène, Département dImmunologie, Institut Pasteur; and
Hôpital Necker, Paris, France
| Abstract |
|---|
|
|
|---|

int CD4+, or
double negative T cells (NK T cells) consist of a mixture of
CD1d-restricted and CD1d-unrestricted cells. The relationships between
CD4+NK1.1+ T cells and conventional T cells are
not understood. To compare their respective TCR repertoires,
NK1.1+TCR
int, CD4+ T cells
have been sorted out of the thymus, liver, spleen, and bone marrow of
C57BL/6 mice. Molecular analysis showed that thymus and liver used
predominantly the V
14-J
281 and V
2, 7, and 8 segments. These
cells are CD1d restricted and obey the original definition of NK T
cells. The complementarity-determining region 3 (CDR3) sequences of the
TCR V
8.2-J
2.5 chain of liver and thymus CD4+ NK T
cells were determined and compared with those of the same
rearrangements of conventional CD4+ T cells. No amino acid
sequence or usage characteristic of NK T cells could be evidenced: the
V
8.2-J
2.5 diversity regions being primarily the same in NK T and
in T cells. No clonal expansion of the
-chains was observed in
thymus and liver CD1d-restricted CD4+NK T cells, suggesting
the absence of acute or chronic Ag-driven stimulation. Molecular
analysis of the TCR used by V
14-J
281 transgenic mice on a
C
-/- background showed that the
-chain can
associate with
-chains using any V
segment, except in NK T cells
in which it paired predominately with V
2, 7, and 8+
-chains. The structure of the TCR of NK T cells thus reflects the
affinity for the CD1d molecule rather than a structural constraint
leading to the association of the invariant
-chain with a
distinctive subset of V
segment. | Introduction |
|---|
|
|
|---|

-TCR and NK cell markers, such as
NK1.1 in C57BL/6 mice, are a recently discovered lymphocyte population
distinct from T, B, and NK cells (1, 2, 3). When activated
through their TCR, they become cytotoxic and quickly release cytokines,
such as IL4 and IFN-
(4, 5). The physiological
functions of these cells remain unclear and they have been implicated
in very diverse conditions such as immune responses against infection
(6, 7, 8) or tumors (9, 10), maintenance of
pregnancy (11), granulomatous response (12, 13), and autoimmune responses (14). More precisely,
CD4+ NK T cells seem to be a population essential
to stimulating IL-12 production by APC (15) and to play
crucial roles in early stage of Leishmania major infection
(16) and to control acceptance of rat islet xenografts in
mice (17). The NK T cells are primarily isolated from the
thymus, liver, spleen, and bone marrow, in numbers ranging from 0.5 to
1.5 million in each organ, thus accounting for 0.51% of total T
cells in the thymus and the spleen and 2030% of all T lymphocytes of
the liver and bone marrow (3, 18). NK T cells (i.e., cells
defined as TCR-
int
NK1.1+ CD4+, or double
negative (DN)3) are
heterogeneous. Most of them are TCR
int,
CD4+, or DN, use an invariant V
14-J
281 TCR
-chain (2) preferentially associated to V
2, 7, or
8+ TCR
-chains (1, 3, 19, 20),
and are restricted by the MHC Ib CD1d molecules: these obey the
original definition of NK T cells (3). Recent FACS and
molecular analysis have shown that phenotypic NK T cells also contained
a variable proportion of cells that were not restricted by CD1d and
used all V
and V
segments (5, 18, 21).
The role of the
-chains of the TCR in the selection and in the
recognition of CD1d/ligand complexes may be approached by studying the
molecular features of the complementarity determining region 3 (CDR3)
of the
-chains. The CD1d molecules present GPI proteins, foreign or
altered glycolipids, such as
-galactosyl ceramide or cancer
glycolipids, as well as self-glycolipids (22, 23, 24, 25, 26, 27). The
lipidic moiety of the ligands is buried in the hydrophobic pocket
created by the folding of the
1 and
2 domains of CD1d molecule,
whereas the carbohydrate moiety of the glycolipids is exposed to the
outside and thus made accessible to the TCR. Indeed, all data available
so far concerning the stereochemistry of the recognition of
-galactosyl ceramide by the TCR of V
8.2+ NK
T cells point to the specific recognition of the carbohydrate moiety of
the ligand, particularly of the OH group at position 2 and of the
-linkage (28). The TCR
-chains of the
CD1d-restricted NK T cells are expected to contribute to recognition of
highly hydrophilic structures, a role that may be reflected in the
physicochemical features of the CDR3 of the
-chains
(29) as suggested by studies on T cell recognition of
glycopeptides (30) and on recognition of the carbohydrate
moiety of glycolipids by T cell hybridomas (31).
A prerequisite for this analytical study is the availability of
homogeneous populations of NK T cells. Because
CD4+ NK T cells seem essential in immune
responses to infection autoimmunity and transplantation, we have
focused our study on this population. Thus,
TCR-
intNK1.1+
CD4+ T cells were sorted out of the thymus,
spleen, bone marrow, and liver of 6-wk-old C57BL/6 mice and studied for
their V
and V
usage. Nearly homogeneous populations of
CD4+ T cells characterized by the usage of the
invariant V
14-J
281
-chain and a skewed V
usage (thus, CD1d
restricted-NK T cells) were identified in the thymus and the liver. The
repertoire of their TCR
-chain could thus be determined and compared
with that of the same V
-J
rearrangements present in conventional,
class II-restricted,
NK1.1-CD4+ T cells. No
distinctive CDR3 length or amino acid sequence and composition that
would be characteristic of CD1d-restricted NK T cells could be found.
Moreover, the amino acid distributions within the CDR3s of the
-chains of CD4+ NK T cells could not be
distinguished from those of conventional CD4+ T
cells. The invariant
-chain can pair with all
-chains in
CD8+NK1.1- T cells
isolated from V
14-J
281 transgenic (Tg) mice on a
C
-/- background, whereas the vast majority
CD4+NK1.1+ T cells of the
Tg mouse used V
2, 7, and 8 segments. Thus, these data suggest that
the invariant
-chain is dominant for the interaction of the TCR with
the CD1d molecules and may constitute the imprinting of the selection
by CD1d molecules.
| Materials and Methods |
|---|
|
|
|---|
The C57BL/6 mice used in this study were 68 wk old and were
obtained from IFFA-Credo (LArbresle, France). V
14-J
281 Tg mice
on C
-/- background have been previously
described (14).
Preparation of single-cell suspensions
Single-cell suspensions were prepared from liver, spleen, thymus, and bone marrow. Total liver cells were resuspended in a 80% isotonic Percoll solution (Pharmacia, Uppsala, Sweden) and overlaid with a 40% isotonic Percoll solution. Centrifugation for 30 min at 3000 rpm resulted in the concentration of the mononuclear cells at the 4080% interface. The collected cells were washed once with PBS supplemented with 2% FCS.
Thymus cells were dissociated and freed of connective tissue by
filtration. The thymocytes were depleted of CD8+
cells using biotinylated anti-
CD8 Ab (CT-CD8
; Caltag, South
San Francisco, CA) and streptavidin beads (Dynal, Oslo, Norway).
Total bone marrow cells were collected by flushing bones (tibia, femur)
with 2% FCS in PBS and spleen cells were isolated as for thymus. In
both cases, the cell suspension was first incubated with anti-Fc
III/II (Fcblock, 2.4G2) and then depleted using anti-B220
(RA3-6B2), anti-Mac1 (M1/70), anti-Gr1 (RB6-8C5) biotinylated
Abs, and magnetic streptavidin beads. All Abs were purchased from
PharMingen (San Diego, CA). After depletion, the cell suspension were
kept at 4°C in RPMI 1640 supplemented with 2% FCS.
Abs and flow cytometry analyses
Cells were first incubated 10 min with Fcblock followed by a
30-min exposure to anti-TCR
-FITC (H57-597), NK1.1-PE (PK136),
CD4-biotin (RM4-5), or CD8-Cy-Chrome (53-6.7) Abs (PharMingen). After
two washes, tricolor-streptavidin (Caltag) was added. After further
washes, the cells were resuspended in PBS containing 2% FCS and
analyzed using a FACSCalibur BD Becton Dickinson (San Jose,
CA).
The cells were sorted on FACStar (BD Becton Dickinson) as
TCR
+
NK1.1+CD4+,
TCR
+
NK1.1-CD4+, and
TCR
+NK1.1-CD4+
at a flow rate of 3500 events/s and collected in RPMI 1640 supplemented
with 20% FCS.
RNA extraction and cDNA synthesis
Total RNA was isolated by ultracentrifugation through a discontinuous CsCl gradient as described (32). cDNA was synthesized from 10 µg of total RNA using a (dT)17 primer, 25 U of Rnasin (Promega, Madison, WI), and 10 U of avian myeloblastosis virus reverse transcriptase (Boehringer Mannheim, Indianapolis, IN) in the provided buffer.
mRNA quantification, PCR procedure, and Immunoscope analysis
Quantification of PCR products was conducted using a locally
developed competitive PCR strategy based on size-altered CD3
cDNA.
Briefly, known number of copies of a plasmid
(102106 copies) harboring
the CD3
cDNA in which a 4-bp deletion has been introduced were mixed
with the cDNA solution and PCR-amplified in the same tube in the
presence of CD3
-specific primers (5' primer: GCCTCAGAAGCATGATAAGC;
3' primer: CCTTGGCCTTCCTATTCTTG). PCR was run at saturation (40 cycles;
94°C, 30 s; 60°C, 30 s; 72°C, 30 s). The resulting
PCR products were submitted to 5 cycles (94°C, 30 s; 60°C,
30 s; 72°C, 30 s) of extension using a nested fluorescent
primer specific of CD3
(FAM-CCCAGAGTGATACAGATGTC) and analyzed
for size and peak area on an automated 373A sequencer (Perkin-Elmer,
Norwalk, CT). The number of CD3
copies contained in the samples was
determined from a calibration curve.
A volume of cDNA solution containing 104 copies
of cDNA CD3
was PCR-amplified using each of the 24 V
-specific
primers (33) and a fluorescently labeled C
-specific
primer, (94°C, 30 s; 60°C, 30 s;72°C, 30 s) during
31 cycles, thus remaining within the exponential phase of
amplification. Products resulting of this PCR were analyzed on an
automatic sequencer. The size and the intensity of each band were
recorded and then analyzed using Immunoscope software (Applied
Biosystems, Foster City, CA) (34). A similar quantitative
approach was conducted for analysis of the V
repertoire.
V
-specific primers, with the exception of V
9 and 15, have been
described previously (12, 35) (V
9 primer:
ACACCGTTGTTAAAGGCACC; V
15 primer: GAGCCAAAGACTTATAGTTTT).
One microliter of the PCR product solution resulting from a first
amplification step using the V
8.2-specific primer were further
amplified for 20 more cycles (94°C, 45 s; 60°C, 45 s;
72°C, 1 min) using a nested primer J
2.5-chain and the PFU DNA
polymerase (Stratagene, La Jolla, CA) (32).
The PCR products could be further studied by run-off analysis
using fluorescently labeled J
-specific primers or were cloned for
sequencing (32).
Cloning and sequencing
Blunt PCR products were ligated into the commercially available vector Blunt II-Topo (Invitrogen, Groningen, The Netherlands) and cloned in Escherichia coli (Invitrogen). Sequence reactions were conducted on positive clones using standard protocols (Perkin-Elmer), and nucleotide sequences were determined using the ABI-Prism 373 sequencing equipment (Applied Biosystems).
| Results |
|---|
|
|
|---|

intNK1.1+ T cells from
different organs of C57BL/6 mice
Single-cell suspensions prepared from thymus, spleen, liver, and
bone marrow were first depleted using a mixture of anti-CD19,
Mac-1, Gr-1, and CD8 mAbs. The
CD4+TCR
intNK1.1+
T cells (which accounted for 15, 30, 1.2, and 5% of the depleted cell
population in the thymus, liver, bone marrow, and spleen, respectively)
were further sorted out as described in Materials and
Methods. The purity of the sorted cells exceeded 98% for all four
organs (the isolation of spleen cells is given as example, Fig. 1
, B1 and B2). The
average final recoveries for individual mice of sorted NK T
CD4+ cells were
105,
2 x 105, 3500, and 9000 cells in the
thymus, liver, bone marrow, and spleen, respectively. Conventional
NK1.1-CD4+TCR
high
T cells were sorted out from spleen using settings that excluded
TCR
intNK1.1- T and
were also found 98% pure (Fig. 1
, C1 and
C2).
|
14-J
281
-chain by
NK1.1+TCR
intCD4+ T cells
The usage of all V
segments by sorted
NK1.1+TCR
intCD4+
T cells was determined using a semiquantitative PCR-based analysis and
compared with that of conventional CD4+ T cells
isolated from age- and sex-matched, naive C57BL/6 mice. The
V
14 segment accounted for 75, 95, 40, and 40% of total V
segments used by thymus, liver, spleen, and bone marrow
NK1.1+TCR
intCD4+
T cells, respectively, compared with 35% detected in conventional
CD4+ T cells and was thus overrepresented in all
four organs (Fig. 2
). The size
distribution of the CDR3 of the rearranged V
14 chains was determined
using the Immunoscope technique. The analysis of total T cells of the
spleen showed that the V
14+
-chain could
use any size of the CDR3 (Fig. 3
). By
contrast, the V
14-C
Immunoscope analysis of the
NK1.1+TCR
intCD4+
T cell populations sorted out of all four organs showed the presence of
a unique 10 aa long CDR3 peak, further identified by sequencing and use
of a clonotypic primer, as being the V
14-J
281 NK T cell-specific
rearrangement (Fig. 3
).
|
|
-chains associated with the invariant
-chain
The V
segments used by cells of the four
NK1.1+TCR
intCD4+
T cell populations and of
CD4+NK1.1-TCR
high
conventional T cells sorted from the spleen and liver were determined
(Fig. 4
). The V
repertoire of the
liver and thymus
NK1.1+TCR
intCD4+
T cell populations was nearly completely skewed toward the usage of the
V
2, 7, and 8 segments. The skewing in the V
usage was less
marked in the spleen and bone marrow
NK1.1+TCR
intCD4+
T cells but was still apparent. No such skewing was observed in
conventional T cells. Altogether, these results confirm on a molecular
basis that the most of
NK1.1+TCR
intCD4+
liver T cells use the invariant V
14-J
281
-chain associated
with a limited set of
-chains, namely V
2, 7, and 8, a set of
markers that identifies the CD1d-restricted NK T cells. These cells
primarily also predominate among thymus
NK1.1+TCR
intCD4+
T cells and still contribute to 4050% of the spleen and bone marrow
NK1.1+TCR
intCD4+
T cells. The second
NK1.1+TCR
intCD4+
T cell population found in spleen and bone marrow displays V
and
V
usages more similar to that of conventional T cells: their
and
usages can be estimated by computing the expected
contributions of the V
14+-associated TCR
-chains and removing the resulting values from the total
V
values determined for total spleen and bone marrow
NK1.1+TCR
intCD4+
T cells; then, a V
usage close to that of conventional
CD4+ T cells could be calculated (data not
shown). Organ-specific heterogeneity, recently described among
NK1.1+, TCR
int, DN T
cells both by Immunoscope and FACS analyses (18, 21),
seems thus to be a general feature of the
NK1.1+TCR
int T cells.
Liver and, to a lesser extent, thymus
NK1.1+TCR
intCD4+
T cell populations are markedly enriched in molecularly defined
CD4+ NK T cells, which in addition are CD1d
restricted because they are not detectable in
CD1d-/- mice (18, 36) (data not
shown).
|
14-J
281
-chain can associate with
-chains using any V
segment
The bias in the V
usage observed in CD4+
NK T cells could be due to structural constraints associated with the
particular folding of the semi-invariant
-chain. Due to the absence
of the proper reagents, this problem had only be partly answered by
FACS analysis of V
14-J
281 Tg mice on a
C
-/- background (36). Thus,
CD4+NK1.1+TCR
cells
were sorted out of the liver, spleen, and bone marrow of these Tg mice.
The V
usage was determined using the same strategy as above (Fig. 5
). Eighty-five percent of liver
CD4+ NK T cells used the V
2, 7, and 8
segments. The remaining 15% were almost equally distributed among the
other V
segments with a bias in favor of V
1, 9, 10, 12, and 14.
By contrast, an identical analysis performed on the
CD8+NK1.1- T cell
population of the same mice showed a use of all V
segments, as in
wild-type mice. Thus, invariant V
14-J
281
-chain can associate
to any V
-chain in conventional T cells, but not in
CD4+ NK T cells.
|

int, and
CD4+ V
14-J
281+ T cells are polyclonal
Liver and thymic
NK1.1+TCR
intCD4+
T cells isolated from C57BL/6 wild-type mice were thus used in the
study of the putative Ag recognition region (CDR3) of the
-chains of
their TCR, in an analysis aimed at defining the clonality of the
populations. A V
-C
Immunoscope analysis of thymic and liver
CD4+ NK T cells yielded a gaussian distribution
of the CDR3 length of the V
2, V
7, V
8.1, 8.2, and 8.3 TCR
-chains (Fig. 6
), with no evidence of
a distortion that would be indicative of dominant expansions.
Similarly, the CDR3 size distribution observed for V
2, V
7, V
8.1, 8.2, and 8.3 TCR
-chains of NK T cells of V
14-J
281 Tg
mice were also polyclonal (data not shown). In addition to excluding
major clonal expansions, these data also exclude the existence of
structural constraints due to the length of the CDR3 of the
-chain
that would limit its association with the invariant
-chain.
|
8.2+
-chain of
liver and thymus CD4+ NK T cells was studied in
more detail because of the high frequency of the segment in NK T cells.
Nested fluorescent J
-specific primers were used to analyze the
V
8.2-C
PCR products (Fig. 6
2.1 to J
2.7 regions
were found preferentially used but a similar bias in the J
usage has
already been reported in conventional T cells (37) (data
not shown). All V
8.2-J
Immunoscope patterns were found gaussian,
with no evidence of expansions due to an Ag-specific proliferation,
which would have appeared as a peak distorting the gaussian profile.
These gaussian V-C and V-J profiles demonstrate the high degree of
polyclonality of the TCR
-chains of the CD4+
NK T cells. Assuming that NK T cells respond to Ag stimulation by
clonal expansions as conventional T cells do, the gaussian patterns
that we observed are indicative of the absence of a specific, acute, or
chronic, antigenic stimulation of NK T cells.
Similarities of the V
8.2-J
2.5 TCR
-chain used by
CD4+ NK T cells and T cells
The V
8.2-J
2.5 rearrangements predominate among NK T cells
because they represent
7 and 4% of all V
-J
rearrangements
used by liver and thymus NK T cells, respectively, on the basis of
quantitative PCR analysis on thymic and liver
CD4+ NK T cells. The V
8.2-J
2.5 PCR products
derived from thymus and liver CD4+ NK T cells
were thus cloned in E. coli and sequenced. A total of 278
and 372 sequences, respectively, were determined, of which 171 and 213
were different. The differences between "total" and "different"
numbers were accounted for by the determination of the same nucleotide
sequence in several clones. The size of the clones cannot be determined
accurately due to the small number of cells of the original samples;
however, it is most probably smaller than that of conventional T cells
(38) due to the low frequency of redundant sequences.
The V
8.2-J
2.5 PCR products of conventional
CD4+ T cells isolated from spleen were also
cloned and sequenced, resulting in a total of 200 independent sequences
that were taken as representative of the overall diversity of the CDR3
of V
8.2-J
2.5 rearranged
-chains, irrespective of the
-chain
with which they are associated. The absence of systematic biases in the
cloning/sequencing procedures was assessed by comparing the
distribution of the CDR3 length, determined by sequencing and
determined using the Immunoscope analysis; no obvious bias due to PCR
amplification and cloning could be seen (data not shown). The
contribution of the CDR3 sequences derived from CD1d-restricted
V
14-J
281+
CD4+NK1.1- T cells to the
total number of determined sequences (39, 40) was
calculated by comparison of V
14-C
Immunoscope profiles in
CD1+/+ and CD1-/- mice
and found to be in the 12% range and was thus considered as
negligible (Ronet et al., manuscript in preparation).
Because its CDR3 length occurs at the highest frequency among
rearranged V
8.2-J
2.5 using
-chains, the nucleotide sequences
that encode the 10 aa long CDR3 of V
8.2-J
2.5
-chains of
CD4+ NK T cells and of conventional
CD4+ T cells were analyzed in detail. The study
of 48 liver CD4+ NK T sequences, 54 thymus
CD4+ NK T sequences, and 79 spleen conventional
CD4+ T cell sequences showed that both N and P
additions were about as frequent and extensive in the
CD4+ T and CD4+ NK T cell
populations. No germline clone was found among the sequences studied.
The D
1 and D
2 segments were used at random. The genomic V
8.2
segment was shortened by 12 or 13 nucleotides in all NK T cell-derived
sequences as it was in conventional CD4+ T cells
(Table I
). Thus, recombinational and
diversity processes seem to be primarily the same in
CD4+ NK T and in conventional
CD4+ T cells.
|
8.2-J
2.5
nucleotide sequences described above were aligned (Fig. 7
|
| Discussion |
|---|
|
|
|---|

int T cells
are heterogeneous and, in addition to being either DN or
CD4+, consist in at least two populations. The
usage of an invariant V
14-J
281
-chain and of a set of
-chains skewed toward the nearly exclusive usage of the V
2, 7,
and 8 segments, characterizes one of the two populations. The second
population is defined by the same apparent cell surface phenotype but
differs from the previous one by a usage of the
- and
-segments
similar to that of conventional T cells. The existence of two cell
populations within the DN,
NK1.1+TCR
int T cells,
has been recently found by FACS and Immunoscope analyses (18, 21). Thus, the phenotypic description of DN or
CD4+, NK1.1+
TCR
int T cells does not define
unequivocally a cell population. We propose to restrict the use of the
expression NK T cells to the DN or CD4+,
NK1.1+ TCR
int T cells
that use the V
14-J
281 invariant
-chain in combination
with the V
2, 7, and 8+ segments. In that
respect, the liver and thymus CD4+
NK1.1+TCR
int T cells
obey this definition of NK T cells, and the cells sorted out from these
two organs on the basis of the CD4+
NK1.1+TCR
int
phenotype are rather homogeneous populations of NK T cells.
The exclusive usage of an invariant
-chain in thymus and liver NK T
cells permits the direct approach of the diversity of the associated
-chains. The Immunoscope profiles of the V
-C
TCR
-chains
associated to liver and thymus NK T cells showed a random usage of the
CDR3 length of the associated V
2, 7, and 8 TCR
-chains. This was
confirmed by further analysis of NK T cells in V
14J
281 Tg mice on
C
-/- background. No significant skewing of
the J
usage was detected on a sequence and Immunoscope basis. The
V
-J
Immunoscope analysis confirmed that the thymus and liver
V
14+ NK T cells were polyclonal with no
evidence for clonal expansions, a profile reminiscent of that of naive
CD4+ T cells. These findings are difficult to
reconcile with the observation using FACS analysis that NK T cells
display cell surface markers of activated and memory T cells (data not
shown) (18, 21), whereas clonal expansions are a hallmark
of conventional activated and memory T cells. This becomes
understandable if the replication rate of NK T cells is more limited
than that of T cells, as already suggested (3). The
absence of clonal expansion may also be explained by the absence of
activation of NK T cells at the periphery by nonself-ligands, the
activated phenotype being due to repeated exposure to a large array of
diverse self-glycolipids (25).
The comparison of the CDR3 sequences of CD4+ NK T
and T cells did not suggest the existence of any distinctive feature
that could unequivocally be attributed to the
-chain of the TCR of
NK T cells. On the contrary, the 10-aa-long sequences of the CDR3
V
8.2-J
2.5 rearrangements of NK T and of conventional
CD4+ T cells shared similar features; the details
of the machinery generating the
-chain diversity were also the same
in T and NK T cells. Thus, most of the properties of the TCR of NK T
cells seem to be dictated by the presence of the invariant
-chain.
The differentiation pathway of NK T cells, as well as the moment at
which they segregate from the mainstream of T cell differentiation
pathway, are not well understood. The CDR3s of the
-chains of NK T
cells are not different from those found associated to randomly taken
TCR
-chains of conventional CD4+ T cells.
Studies on the V
14 Tg mice on a C
-/-
background revealed that peripheral CD4+ NK T
cells used mainly V
2, 7, or 8, whereas the same invariant
-chain
can associate with any V
+ chain in
conventional CD8+NK1.1- T
cells. Thus there is no structural constraint caused by a particular
folding of the invariant
-chain. The predominant role of the
-chain in the selection of NK T cells on CD1d molecules is strongly
suggested by our data. Thus the clonotypic
-chain behaves as some
kind of a print of the recognition of the CD1d molecules.
In this respect, the similarity of the CDR3 sequences of naive
CD4+ T and of CD4+ NK T
cells, although the two populations are clearly endowed by distinct
functional properties, questions the role of the
-chain in the
selection of NK T cells. The role of the
-chain in carbohydrate
recognition is supported by the finding that some NK T cell clones, and
also ex vivo NK T cell populations, can discriminate between
sugar-derivatized ceramides and thus identify differences in the
structure of carbohydrates (41, 42). Recently acquired
data are more in favor of the conclusion that the CDR3 of the TCR
-chain of NK T cells is endowed with a highly degenerated
recognition ability. Indeed, the analysis of the human
V
24+ V
11+ NK T cells
in vitro expanded in the presence of
-galactosyl-ceramide was
indicative of a polyclonal activation of NK T cells with no evidence
for predominantly expanding clones (43). Also, the
isolation of CD1d-restricted NK T cells with CD1d tetramers loaded with
GalCer results in the sorting of the entire population that uses the
V
14-J
281
-chain, whatever NK1.1+ or
NK1.1- (40) rather than the sorting
of discrete, oligoclonal, Ag-specific populations, as for class I
tetramers loaded with peptides (44). Only the
3-dimensional structure of CD1d-glycolipid-TCR complexes will
definitely settle the problem of the relative contribution of TCR
-
and
-chains to the recognition of glycolipids.
| Acknowledgments |
|---|
plasmid, and A. Louise and H. Kiefer-Biasizzo
for the cell sorting. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Gabriel Gachelin, Unité de Biologie Moléculaire du Gène, Institut National de la Santé et de la Recherche Médicale U277, Departement dImmunologie, Institut Pasteur, 25 rue du Dr. Roux, 75015, Paris, France. ![]()
3 Abbreviations used in this paper: DN, double negative; CDR3, complementarity-determining region 3; Tg, transgenic. ![]()
Received for publication July 11, 2000.
| References |
|---|
|
|
|---|
-chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 190:1097.

intermediate cells increase during experimental malaria infection and are able to exhibit inhibitory activity against the parasite liver stage in vitro. J. Immunol. 164:1463.
-producing CD4+ natural killer T cells by Mycobacterium bovis bacillus Calmette Guerin. Eur. J. Immunol. 29:650.[Medline]
2 and Th1 cytokines and ameliorates listeriosis in mice. J. Immunol. 162:6955.
14 NKT cells in IL-12-mediated rejection of tumors. Science 278:1623.
14 NKT cells. Proc. Natl. Acad. Sci. USA 95:5690.
14 NKT cells in abortion. Proc. Natl. Acad. Sci. USA 97:740.
24-invariant NKT cells in T-cell reactive leprosy together with a highly biased TCR V
repertoire. Am. J. Pathol. 157:509.
14-J
281 transgenic nonobese diabetic mice against diabetes. J. Exp. Med. 188:1831.
14+CD4+NKT cells: stimulation of IL-12 production by antigen-presenting cells in the innate immune system. J. Immunol. 163:93.
14 NKT cells play a crucial role in an early stage of protective immunity against infection with Leishmania major. Int. Immunol. 12:1267.
14 natural killer T cells are essential for acceptance of rat islet xenografts in mice. J. Clin. Invest. 105:1761.[Medline]
14+ TCR
chain in NK1.1+ T cell populations. Int. Immunol. 7:1157.
requirement for the development of NK1.1+ T cell receptor-
+ cells in mouse liver. J. Exp. Med. 183:1277.
/
repertoires and differential distribution in lymphoid tissues. J. Immunol. 165:2481.
14 NKT cells by glycosylceramides. Science 278:1626.
-galactosylceramide specifically stimulates V
14+ NK T lymphocytes. J. Immunol. 161:3271.
-chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90:4319.
-chain in MRL lpr/lpr mice suggests a role for the fas protein in peripheral T cell selection. Eur. J. Immunol. 24:2761.[Medline]

-TCR repertoire of naive mouse splenocytes. J. Immunol. 164:5782.
14 T cell antigen receptor expression in the development of natural killer T cells. Proc. Natl. Acad. Sci. USA 93:11025.This article has been cited by other articles:
![]() |
D. G. Wei, S. A. Curran, P. B. Savage, L. Teyton, and A. Bendelac Mechanisms imposing the V{beta} bias of V{alpha}14 natural killer T cells and consequences for microbial glycolipid recognition J. Exp. Med., May 15, 2006; 203(5): 1197 - 1207. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Kjer-Nielsen, N. A. Borg, D. G. Pellicci, T. Beddoe, L. Kostenko, C. S. Clements, N. A. Williamson, M. J. Smyth, G. S. Besra, H. H. Reid, et al. A structural basis for selection and cross-species reactivity of the semi-invariant NKT cell receptor in CD1d/glycolipid recognition J. Exp. Med., March 20, 2006; 203(3): 661 - 673. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ronet, S. Darche, M. L. de Moraes, S. Miyake, T. Yamamura, J. A. Louis, L. H. Kasper, and D. Buzoni-Gatel NKT Cells Are Critical for the Initiation of an Inflammatory Bowel Response against Toxoplasma gondii J. Immunol., July 15, 2005; 175(2): 899 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Anfossi, S. H. Robbins, S. Ugolini, P. Georgel, K. Hoebe, C. Bouneaud, C. Ronet, A. Kaser, C. B. DiCioccio, E. Tomasello, et al. Expansion and Function of CD8+ T Cells Expressing Ly49 Inhibitory Receptors Specific for MHC Class I Molecules J. Immunol., September 15, 2004; 173(6): 3773 - 3782. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Schumann, R. B. Voyle, B.-Y. Wei, and H. R. MacDonald Cutting Edge: Influence of the TCR V{beta} Domain on the Avidity of CD1d:{alpha}-Galactosylceramide Binding by Invariant V{alpha}14 NKT Cells J. Immunol., June 15, 2003; 170(12): 5815 - 5819. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ranson, C. A. J. Vosshenrich, E. Corcuff, O. Richard, V. Laloux, A. Lehuen, and J. P. Di Santo IL-15 availability conditions homeostasis of peripheral natural killer T cells PNAS, March 4, 2003; 100(5): 2663 - 2668. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sidobre, O. V. Naidenko, B.-C. Sim, N. R. J. Gascoigne, K. C. Garcia, and M. Kronenberg The V{alpha}14 NKT Cell TCR Exhibits High-Affinity Binding to a Glycolipid/CD1d Complex J. Immunol., August 1, 2002; 169(3): 1340 - 1348. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Laloux, L. Beaudoin, C. Ronet, and A. Lehuen Phenotypic and Functional Differences Between NKT Cells Colonizing Splanchnic and Peripheral Lymph Nodes J. Immunol., April 1, 2002; 168(7): 3251 - 3258. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. OJCIUS, C. DELARBRE, P. KOURILSKY, and G. GACHELIN MHC and MHC-related proteins as pleiotropic signal molecules FASEB J, February 1, 2002; 16(2): 202 - 206. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mempel, C. Ronet, F. Suarez, M. Gilleron, G. Puzo, L. Van Kaer, A. Lehuen, P. Kourilsky, and G. Gachelin Natural Killer T Cells Restricted by the Monomorphic MHC Class 1b CD1d1 Molecules Behave Like Inflammatory Cells J. Immunol., January 1, 2002; 168(1): 365 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size PNAS, October 5, 2001; (2001) 221445298. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gilleron, C. Ronet, M. Mempel, B. Monsarrat, G. Gachelin, and G. Puzo Acylation State of the Phosphatidylinositol Mannosides from Mycobacterium bovis Bacillus Calmette Guerin and Ability to Induce Granuloma and Recruit Natural Killer T Cells J. Biol. Chem., September 7, 2001; 276(37): 34896 - 34904. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size PNAS, October 23, 2001; 98(22): 12636 - 12641. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |