HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ariga, T. Articles by Sakiyama, Y. Search for Related Content PubMed PubMed Citation Articles by Ariga, T. Articles by Sakiyama, Y.

Molecular Basis for Paradoxical Carriers of Adenosine Deaminase (ADA) Deficiency That Show Extremely Low Levels of ADA Activity in Peripheral Blood Cells Without Immunodeficiency¹

Tadashi Ariga^2,*, Noriko Oda^*, Ines Sanstisteban, Francisco X. Arredondo-Vega, Mitsutaka Shioda, Hideki Ueno, Kihei Terada^¶, Kunihiko Kobayashi, Michael S. Hershfield and Yukio Sakiyama^*

^* Department of Human Gene Therapy and Department of Pediatrics, Hokkaido University School of Medicine, Sapporo, Japan; Department of Medicine and Biochemistry, Duke University Medical Center, Durham, NC 27710; Department of Pediatrics, Matsue Red Cross Hospital, Matsue, Japan; and ^¶ Department of Pediatrics, Kawasaki Medical School, Kurashiki, Japan

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Adenosine deaminase (ADA) deficiency causes an autosomal recessive form of severe combined immunodeficiency and also less severe phenotypes, depending to a large degree on genotype. In general, ADA activity in cells of carriers is approximately half-normal. Unexpectedly, healthy first-degree relatives of two unrelated ADA-deficient severe combined immunodeficient patients (mother and brother in family I; mother in family II) had only 1–2% of normal ADA activity in PBMC, lower than has previously been found in PBMC of healthy individuals with so-called "partial ADA deficiency." The level of deoxyadenosine nucleotides in erythrocytes of these paradoxical carriers was slightly elevated, but much lower than levels found in immunodeficient patients with ADA deficiency. ADA activity in EBV-lymphoblastoid cell lines (LCL) and T cell lines established from these carriers was 10–20% of normal. Each of these carriers possessed two mutated ADA alleles. Expression of cloned mutant ADA cDNAs in an ADA-deletion strain of Escherichia coli indicated that the novel mutations G239S and M310T were responsible for the residual ADA activity. ADA activity in EBV-LCL extracts of the paradoxical carriers was much more labile than ADA from normal EBV-LCL. Immunoblotting suggested that this lability was due to denaturation rather than to degradation of the mutant protein. These results further define the threshold level of ADA activity necessary for sustaining immune function.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Adenosine deaminase (ADA;³ EC 3.5.4.4), an enzyme of the purine salvage pathway, catalyzes the conversion of adenosine and 2'-deoxyadenosine (dAdo) to inosine and 2'-deoxyinosine, respectively. The 32-kb ADA gene consists of 12 exons located on chromosome 20q1-2 (1, 2). Inherited deficiency of ADA causes one of the autosomal recessive forms of severe combined immunodeficiency (SCID) (3), which is thought to result from accumulation of toxic metabolites of ADA substrates in lymphoid cells (4). A marked increase in the level of dAdo nucleotides (dAXP) in erythrocytes is characteristic of ADA-deficient SCID. ADA deficiency has also been found in less severely affected patients with delayed or late/adult onset of immune deficiency (3, 5, 6, 7, 8, 9, 10). In addition, screening of populations and relatives of SCID patients has identified rare healthy individuals with so-called "partial ADA deficiency" (10, 11, 12, 13, 14, 15, 16, 17). Erythrocytes of "partials" have low ADA activity but minimal dAXP elevation, and their circulating lymphocytes and other nucleated cells possess significant residual ADA activity. Although ADA deficiency is rare and genetically heterogeneous, investigation of the expression of mutant alleles has established a good correlation between ADA genotype and both metabolic and clinical phenotype (4, 18, 19). Based on studies of partials, it has been estimated that about 5% of normal ADA activity is sufficient to sustain a normal immune system.

As expected for carriers of an autosomal recessive metabolic disorder, cells of parents of children with ADA-deficient SCID have approximately half-normal ADA activity, owing to the expression of one normal and one mutant ADA allele. Unexpectedly, we have found very low ADA activity in both erythrocytes and PBMC in healthy carriers in two unrelated Japanese families. Erythrocyte dAXP levels were only slightly higher than normal. We found that each of these paradoxical carriers possessed two mutant ADA alleles; three of the four alleles are novel. We have characterized the activity and thermal stability of these ADA proteins. Our findings provide a more refined estimate of the minimal ADA activity that is necessary for permitting normal development and maintenance of immune function.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
ADA-deficient families

Family I. We have reported the proband with SCID previously (20). The diagnosis (at age of 3 mo) was based on evaluation of ADA activity in PBMC. She was found to be heteroallelic for a paternally derived ADA allele with a one base deletion in exon 4, and a maternally derived allele with a missense mutation, R235Q, in exon 7. Evaluation of carrier status as well as ADA activity in family members (her parents and brother) were performed with informed consent.

Family II. The proband also had SCID due to ADA deficiency. Shortly after diagnosis (at the age of 5 mo) she received a bone marrow transplant from her healthy HLA-identical sister. ADA activity was determined in her parents and two siblings. Genetic analysis was performed only in the case of the patient’s mother, with informed consent (material for genotype analysis was not available from other family members).

Cell lines

EBV-lymphoblastoid cell lines (EBV-LCL) were established by standard procedure using the supernatant of B95-8 cells. T cell lines were established using herpesvirus Saimiri as described elsewhere (21).

Mutation analysis

Primers encompassing all exons and flanking intronic sequences of the ADA gene and PCR conditions were described previously (8, 22, 23). Each PCR-amplified fragment was purified from agarose gel and then directly sequenced. Sequencing was performed with an Applied Biosystems Prism Dye Terminator Cycle Sequencing kit (Perkin-Elmer, Foster City, CA) and an ABI 373A DNA analyzer (Perkin-Elmer).

Western blot analysis

Cells washed with PBS were lysed with buffer containing 1% of Nonidet P-40. Aliquots of supernatant containing 20 µg of protein were subjected to SDS-PAGE with a 10% separating gel and a 4% stacking gel. After electrophoresis, the proteins were transferred to a nitrocellulose membrane (Hybond ECL; Amersham Pharmacia Biotech, Piscataway, NJ). Detection of human ADA protein was performed as described previously (24) using 1:250 diluted goat anti-human ADA serum kindly supplied by Dan Winginton (University of Cincinnati, Cincinnati, OH), followed by a rabbit anti-goat IgG-alkaline phosphatase conjugate (Jackson ImmunoResearch, West Grove, PA).

ADA enzyme assay and measurement of adenine nucleotides

ADA activity in PBMC and granulocytes was assayed by a radiochemical TLC method, as previously reported (8, 25, 26). In brief, cells washed twice with PBS were suspended in 100 mM Tris-HCl (pH 7.4) containing 1% BSA (Tris-BSA buffer). After five rapid freeze-thaw cycles, debris were removed by centrifugation and the lysates were stored at -80°C until used. ADA activity was quantitated by measuring the conversion of [¹⁴C]adenosine (Amersham Pharmacia Biotech) to [¹⁴C]inosine and [¹⁴C]hypoxanthine, determined after TLC separation of the reaction products. The results are expressed as nanomoles of inosine plus hypoxanthine produced per minute by 10⁸ cells (nmol/min/10⁸ cells). The level of adenosine nucleotides (AXP) and dAXP in erythrocytes was determined as previously described (27). dAXP are expressed as micromoles per milliliter of packed erythrocytes (RBC) and as the percentage of total adenine nucleotides (AXP + dAXP).

Expressed ADA activity of mutant alleles

Total RNA isolated from EBV-LCL was used for cDNA synthesis (First-strand cDNA synthesis kit; Amersham Pharmacia Biotech). To obtain each ADA mutant, we first amplified two overlapping segments consisting of the 5' and 3' portions of ADA cDNA. Primers used are as follows. For the 5' half: ACCGAGCCGGCAGAGACCCAC (sense primer located in exon 1) and CAGGCCTACCAGGAGGCTGTG (antisense primer located at the exon 6–7 junction); for the 3' half: CCACCAGCCCAACTGGTCCC (sense primer located at the exon 5–6 junction) and GCTCAGCCCCACAGAGTTGGG (antisense primer located in exon 12). To obtain full-length ADA cDNA the two amplified fragments were combined for another PCR using the sense primer for the 5' half and the antisense primer for the 3' half. The PCR condition used was as follows: denaturation 94°C, 30 s; annealing 58°C, 30 s; and extension 72°C, 30 s. Thirty amplification cycles were performed, with an initial 9-min denaturation step at 94°C and a final incubation at 72°C for 7 min. Each mutant cDNA was cloned into the TA vector (PCR 2.1; Invitrogen, Carlsbad, CA) and was then sequenced. The cDNAs containing only the mutations of interest were recloned into the pZ plasmid and introduced into the ADA-deficient Escherichia coli strain SØ3834; expression of ADA activity in pZ-ADA cDNA transformants of SØ3834 was quantitated under standard conditions as described previously (19).

Thermal stability of ADA in extracts of EBV-LCL

EBV-LCL derived from the carriers possessed detectable ADA activity. For determining the thermal stability of ADA activity, extracts (prepared by lysing 2 x 10⁶ EBV-LCL in 0.4 ml of Tris-BSA buffer) were preheated at 56°C for various times and then were assayed for ADA activity. Aliquots containing the equivalent of 2.5 x 10⁴ cells were subjected to Western blotting as described above; protein in the band representing ADA was quantitated by denistometric analysis. To better evaluate the change in ADA protein caused by the heat treatment, 3-to 4-fold higher amounts of protein from extracts of the EBV-LCL of the paradoxical carriers were loaded. Results are presented as the percentage of the original value at 0 min.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
ADA activity and dAdo nucleotide levels in members of family I and family II

ADA activity was measured in PBMC, granulocytes, EBV-LCL, and T cell lines (Table I). In family I, the ADA activity of PBMC, granulocytes, and RBC from the patient’s father was approximately half of the normal value. Unexpectedly, ADA activity in these cells from the mother and brother, who were both healthy and had normal blood lymphocyte counts, was as low as in the cells of the SCID proband. The level of total dAXP in RBC of the mother and brother was only slightly elevated to about 1% of total adenine nucleotides (normal <0.2%) compared with dAXP levels of 0.1% in RBC of the father and 14% in RBC of the child with SCID. As shown in Table I, established patient’s T cell line, not B cell line, showed significant ADA activity due to reversion of the maternal mutation (20).

EBV-LCL established from circulating PBMC of the paradoxical carriers (the mother and brother in family I, the mother in family II) had 10–20% of ADA activity found in EBV-LCL established from normal individuals. ADA activity in EBV-LCL of the father in family I was 62% of normal (Table I).

Consistent with the enzyme activity, ADA protein in PBMC from the mother and brother in family I and the mother in family II was hardly visible on Western blot. In contrast, an ADA band was clearly detected in extracts of the father’s PBMC, although it was of less intensity compared with normal individuals (data not shown).

Mutation analysis

We have reported the mutations in family I previously (20). The SCID proband had inherited an ADA allele with the R235Q mutation in exon 8 from her mother and an allele with a 1-bp deletion in exon 4 from her father; her brother also carried the paternal allele. In view of their low ADA activity, we suspected that the mother and brother shared a third mutant ADA allele, and this was confirmed by further investigation. In each case, their second ADA allele encoded a substitution in exon 10, M310T, which has not previously been reported. The genotype of the SCID patient in family II is unknown (she had already received a marrow transplant). However, we analyzed her mother’s DNA and found two novel ADA gene mutations, G74D and G239S, which were located on different alleles. The pedigree of both the families is shown in Fig. 1.

View larger version (36K): [in this window] [in a new window]   FIGURE 1. Pedigree of family I (A) and II (B). Asterisks indicate the paradoxical carriers studied. Arrows indicate SCID probands with ADA deficiency (SCID).

We used a previously described (19) sensitive system, involving constitutive expression in the SØ3834 ADA deletion strain of E. coli, to quantify ADA activity derived from the four relevant mutant alleles (R235Q and M310T from family I; G74D and G239S from family II) (Table II). G239S and M310T expressed, respectively, 1.0 and 1.5% of the ADA activity obtained with wild-type human ADA cDNA, whereas G74D and R235Q expressed, respectively, 0.07 and <0.01%.

ADA activity in extracts of EBV-LCL from a control and the father in family I did not change significantly during a 20-min incubation at 56°C. In contrast, ADA activity in LCL extracts from the three paradoxical carriers (the mother and brother in family I and the mother in family II) showed rapid inactivation, with a loss of 65–80% of the initial activity by 5 min (Fig. 2A). In contrast to enzyme activity, ADA protein did not show a significant change during the same period of heat treatment (Fig. 2B). With longer heat exposure (>3 h), however, ADA protein in extracts of the paradoxical carriers did decrease to a greater extent than found for normal ADA (data not shown).

View larger version (23K): [in this window] [in a new window]   FIGURE 2. Thermal stability of ADA in EBV-LCL extracts. A, Stability of ADA activity. After incubating EBV-LCL extracts at 56°C for 0, 5, 10, and 20 min, aliquots were removed and ADA activity was determined. Results are presented as percentage of the activity presented at 0 min. Error bars indicate SD. The 0-min values are as reported in Table I. B, Stability of ADA protein. After incubating the EBV-LCL extracts at 56°C for 0, 10, and 20 min, aliquots were subjected to Western blot analysis and densitometry (see Materials and Methods). The results are presented as the percentage of the 0-min value. Error bars indicate SD.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

We note that the residual ADA activity in the PBMC of the presently described paradoxical carriers is only 1–2% of normal, significantly less than the 4–70% that has been reported for previously identified ADA partials (10, 12, 13, 14, 15, 16, 17). Nevertheless, their overall ability to catabolize dAdo in vivo is apparently sufficient to prevent the metabolic abnormalities responsible for lymphopenia and immune dysfunction. We therefore considered it important to identify the mutant alleles of these carriers and to quantify the ADA activity of their mutant enzymes to better define the threshold level of ADA activity that is necessary to prevent the development of immune deficiency.

We postulated that these paradoxical carriers were compound heterozygotes, expressing two different mutant ADA proteins: one disease-causing, with minimal enzymatic activity, that is shared with the SCID proband, and a second nonpathogenic mutant with low but detectable catalytic activity. This proved to be the case in family I. The mother and SCID proband shared the R235Q allele, which yielded <0.01% of wild-type ADA activity when expressed under standard conditions in the SØ3834 ADA deletion strain of E. coli. The proband and his brother shared a paternally inherited null allele with a 1-bp deletion in exon 4. The mother and brother share the novel M310T allele, which expressed 1% of wild-type activity in SØ3834, and is responsible for their healthy phenotype. Although the genotype of the immunodeficient proband in family II is unknown, this patient’s mother was also found to possess two mutant ADA alleles: G74D, which expressed 0.07% of wild-type ADA activity, and the presumably nonpathogenic G239S allele, which expressed 1.5% of wild-type activity.

The quantitative expression in E. coli strain SØ3834 of the four missense alleles from these two families adds to the initial study of 29 other alleles from 52 ADA-deficient individuals with diverse genotypes and clinical phenotypes (19). That study proposed a quantitative scale for ranking genotypes according to the total ADA activity expressed in strain SØ3834 by both alleles of any patient with ADA deficiency. Based on that scale, R235Q and G74D are classified as group I and II alleles, respectively. Group I alleles (0.001–0.05% of wild-type activity) were almost always associated with SCID when combined with another allele that provides the same or lower ADA activity, whereas group II (0.06–0.17%) and group III (0.3–0.6%) alleles were found to confer delayed or late/adult onset phenotypes when so combined. For example, among the alleles previously studied were two others with mutations of Gly74, G74V (group I) and G74C (group III), which were identified in patients with SCID and late onset phenotypes, respectively (30, 31). The G239S and M310T alleles fall in group IV, which expressed >0.6% of wild-type ADA activity and had been found in healthy individuals with partial ADA deficiency. Thus, findings in the present families are consistent with our earlier study and validate the prediction that new ADA mutations falling into the group IV range would occur in healthy individuals.

ADA activity in EBV-LCL and T cell lines derived from the paradoxical carriers had 10–20% of normal ADA activity compared with 1–2% in their PBMC (in contrast, EBV-LCL and PBMC from the SCID patient in family I had very low ADA activity) (Table I). ADA activity in normal EBV-LCL is also severalfold higher than in PBMC, probably due to a greater rate of production and/or decreased rate of degradation of wild-type ADA protein. We postulated that the G239S and M310T proteins might be less stable than wild-type ADA, resulting in lower steady-state ADA activity in resting cells such as PBMC than in metabolically active LCL. Consistent with this, the ADA activity in extracts of EBV-LCL carrying these mutants was much less stable at an elevated temperature than was ADA activity from normal EBV-LCL (Fig. 2A). The difference between mutant and wild-type ADA is most directly demonstrated by results with LCL from the father and brother in family I. These LCL share one nonfunctional ADA allele, but the father’s second allele is wild type whereas the brother’s is M310T.

Interestingly, the rates of thermal inactivation for ADA of the mother and brother in family I were identical and more rapid than for ADA from the mother in family II. This may reflect different structural effects of the M310T and G239S mutations. The results of Western blot analysis suggest that the loss of activity in each case was probably due to a change in conformation rather than to degradation of the mutant protein, at least under the conditions of the experiment. Heterogeneity of ADA heat stability has previously been reported in cells from other individuals with partial ADA deficiency (13, 32). In one case, the responsible mutation was identified as P297Q (14). Atomic structural and biophysical analysis of these mutant proteins may provide a more precise understanding of the mechanism for thermal instability.

	Footnotes

 
¹ This work was supported by a Health Science Research grant from the Ministry of Health and Welfare of Japan, Genome Project 029. Support for I.S., F.X.A.-V., and M.S.H. was from Grant DK20902 from the National Institutes of Health and a grant from Enzon, Inc.

² Address correspondence and reprint requests to Dr. Tadashi Ariga, Department of Human Gene Therapy, Hokkaido University School of Medicine, N-14, W-5, Kita-ku, Sapporo, 060-8638, Japan.

³ Abbreviations used in this paper: ADA, adenosine deaminase; dAdo, 2'-deoxyadenosine; SCID, severe combined immunodeficiency; dAXP, deoxyadenosine nucleotides; LCL, lymphoblastoid cell line; AXP, adenosine nucleotides.

Received for publication September 11, 2000. Accepted for publication October 31, 2000.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Wiginton, D. A., D. J. Kaplan, J. C. States, A. L. Akeson, C. M. Perme, I. J. Bilyk, A. J. Vaughn, D. L. Lattier, J. J. Hutton. 1986. Complete sequence and structure of the gene for human adenosine deaminase. Biochemistry 25:8234.[Medline]
2. Jhanwar, S. C., T. M. Berkvens, C. Breukel, H. van Ormondt, A. J. van der Eb, P. Meera Kahn. 1989. Localization of human adenosine deaminase (ADA) gene sequences to the q12–q13.11 region of chromosome 20 by in situ hybridization. Cytogenet. Cell Genet. 50:168.[Medline]
3. Giblett, E. R., J. E. Anderson, F. Cohen, B. Pollara, H. J. Meuwissen. 1972. Adenosine deaminase deficiency in two patients with severely impaired cellular immunity. Lancet 2:1067.[Medline]
4. Hershfield, M. S., B. S. Mitchell. 1995. Immunodeficiency diseases caused by adenosine deaminase deficiency and purine nucleoside phosphorylase deficiency. C. R. Scriver, and A. L. Beaudet, and W. S. Sly, and D. Valle, eds. The Metabolic and Molecular Bases of Inherited Disease 1725. McGraw-Hill, New York.
5. Hirschhorn, R., G. F. Vawter, Jr J. A. Kirkpatrick, F. S. Rosen. 1979. Adenosine deaminase deficiency: frequency and comparative pathology in autosomally recessive severe combined immunodeficiency. Clin. Immunol. Immunopathol. 14:107.[Medline]
6. Geffner, M. E., E. R. Stiehm, D. Stephure, M. J. Cowan. 1986. Probable autoimmune thyroid disease and combined immunodeficiency disease. Am. J. Dis. Child. 140:1194.[Abstract/Free Full Text]
7. Levy, Y., M. S. Hershfield, C. Fernandez-Mejia, S. H. Polmar, D. Scudiery, M. Berger, R. U. Sorensen. 1988. Adenosine deaminase deficiency with late onset of recurrent infections: response to treatment with polyethylene glycol-modified adenosine deaminase (PEG-ADA). J. Pediatr. 113:312.[Medline]
8. Santisteban, I., F. X. Arredondo-Vega, S. Kelly, A. Mary, A. Fischer, D. S. Hummell, A. Lawton, R. U. Sorensen, E. R. Stiehm, L. Uribe, et al 1993. Novel splicing, missense, and deletion mutations in 7 adenosine deaminase-deficient patients with late/delayed onset of combined immunodeficiency disease: contribution of genotype to phenotype. J. Clin. Invest. 92:2291.
9. Shovlin, C. L., H. A. Simmonds, L. D. Fairbanks, S. J. Deacock, J. M. Hughes, R. I. Lechler, A. D. Webster, X. M. Sun, J. C. Webb, A. K. Soutar. 1994. Adult onset immunodeficiency caused by inherited adenosine deaminase deficiency. J. Immunol. 153:2331.[Abstract]
10. Ozsahin. H., F. X., I. Arredondo-Vega, H. Santisteban, P. Fuhrer, W. Tuchschmid, A. Jochum, H. M. Aguzzi, A. Lederman, J. A. Fleischman, J. A. Winkelstein, et al 1997. Adenosine deaminase deficiency in adults. Blood 89:2849.[Abstract/Free Full Text]
11. Jenkins. T., A. R., G.T. Rabson, G.T. Nurse, A. B. Lane. 1976. Deficiency of adenosine deaminase not associated with severe combined immunodeficiency. J. Pediatr. 89:732.[Medline]
12. Daddona, P. E., B. L. Davidson, J. L Perignon., W. N. Kelley. 1985. Genetic expression in partial adenosine deaminase deficiency: mRNA levels and protein turnover for the enzyme variants in human B-lymphoblast cell lines. J. Biol. Chem. 260:3875.[Abstract/Free Full Text]
13. Hirschhorn, R., A. Ellenbogen. 1986. Genetic heterogeneity in adenosine deaminase (ADA) deficiency: five different mutations in five new patients with partial ADA deficiency. Am. J. Hum. Genet. 38:13.[Medline]
14. Hirschhorn, R., S. Tzall, A. Ellenbogen, S. H. Orkin. 1989. Identification of a point mutation resulting in a heat-labile adenosine deaminase (ADA) in two unrelated children with partial ADA deficiency. J. Clin. Invest. 83:497.
15. Hirschhorn, R., S. Tzall, A. Ellenbogen. 1990. Hot spot mutations in adenosine deaminase deficiency. Proc. Natl. Acad. Sci. USA 87:6171.[Abstract/Free Full Text]
16. Santisteban, I., F. X. Arredondo-Vega, S. Kelly, M. Loubser, N. Meydan, C. Roifman, P. L. Howell, T. Bowen, K. I. Weinberg, M. L. Schroeder, M. S. Hershfield. 1995. Three new adenosine deaminase mutations that define a splicing enhancer and cause severe and partial phenotypes: implications for evolution of a CpG hotspot and expression of a transduced ADA cDNA. Hum. Mol. Genet. 4:2081.[Abstract/Free Full Text]
17. Hirschhorn, R., W. Borkowsky, C. K. Jiang, D. R. Yang, T. Jenkins. 1997. Two newly identified mutations (Thr²³³Ile and Leu¹⁵²Met) in partial adenosine deaminase-deficient (ADA^-) individuals that result in differing biochemical and metabolic phenotypes. Hum. Genet. 100:22.[Medline]
18. Hirschhorn, R.. 1995. Adenosine deaminase deficiency: molecular basis and recent developments. Clin. Immunol. Immunopathol. 76:S219.[Medline]
19. Arredondo-Vega, F. X., I. Santisteban, S. Daniels, S. Toutain, M. S. Hershfield. 1998. Adenosine deaminase deficiency: genotype-phenotype correlations based on expressed activity of 29 mutant alleles. Am. J. Hum. Genet. 63:1049.[Medline]
20. Ariga, T., N. Oda, K. Yamaguchi, N. Kawamura, H. Kikuta, S. Taniuchi, Y. Kobayashi, K. Terada, M. S. Hershfield, and Y. Sakiyama. 2001. T cell lines from two patients with adenosine deaminase (ADA) deficiency showed the restration of ADA activity resulted from the reversion of an inherited mutation. Blood. In press.
21. Biesinger, B., I. Muller-Fleckenstein, B. Simmer, G. Lang, S. Wittmann, E. Platzer, R. C. Desrosiers, B. Fleckenstein. 1992. Stable growth transformation of human T lymphocytes by herpesvirus saimiri. Proc. Natl. Acad. Sci. USA 89:3116.[Abstract/Free Full Text]
22. Hirschhorn, R., A. Ellenbogen, S. Tzall. 1992. Five missense mutations at the adenosine deaminase locus (ADA) detected by altered restriction fragments and their frequency in ADA^- patients with severe combined immunodeficiency (ADA-SCID). Am. J. Med. Genet. 42:201.[Medline]
23. Hirschhorn, R., D. R. Yang, A. Israni. 1994. An Asp⁸Asn substitution in the adenosine deaminase (ADA) genetic polymorphism (ADA 2 allozyme): occurrence on different chromosomal backgrounds and apparent intragenic crossover. Ann. Hum. Genet. 58:1.[Medline]
24. Arredondo-Vega, F. X., J. Kurtzberg, S. Chaffee, I. Santisteban, E. Reisner, M. S. Povey, M. S. Hershfield. 1990. Paradoxical expression of adenosine deaminase in T cells cultured from a patient with adenosine deaminase deficiency and combined immunodeficiency. J. Clin. Invest. 86:444.
25. Onodera, M., T. Ariga, N. Kawamura, I. Kobayashi, M. Ohtsu, M. Yamada, A. Tame, H. Furuta, M. Okano, S. Matsumoto, et al 1998. Successful peripheral T-lymphocyte-directed gene transfer for a patient with severe combined immune deficiency caused by adenosine deaminase deficiency. Blood 91:30.[Abstract/Free Full Text]
26. Kohn, D. B., H. Mitsuya, M. Ballow, J. E. Selegue, J. Barankiewicz, A. Cohen, E. Gelfand, W. F. Anderson, R. M. Blaese. 1989. Establishment and characterization of adenosine deaminase deficient human T cell lines. J. Immunol. 142:3971.[Abstract]
27. Hershfield, M. S., R. H. Buckley, M. L. Greenberg, A. L. Melton, R. Schiff, C. Hatem, J. Kurtzberg, M. L. Markert, R. H. Kobayashi, A. L. Kobayashi, A. Abuchowski. 1987. Treatment of adenosine deaminase deficiency with polyethylene glycol-modified adenosine deaminase. N. Engl. J. Med. 316:589.[Abstract]
28. Hirschhorn, R.. 1993. Overview of biochemical abnormalities and molecular genetics of adenosine deaminase deficiency. Pediatr. Res. 33:(Suppl):S35.
29. Schmalstieg, F. C., G. C. Mills, H. Tsuda, A. S. Goldman. 1983. Severe combined immunodeficiency in a child with a healthy adenosine deaminase deficient mother. Pediatr. Res. 17:935.[Medline]
30. Bollinger, M. E., F. X. Arredondo-Vega, I. Santisteban, K. Schwarz, M. S. Hershfield, H. M. Lederman. 1996. Hepatic dysfunction as a complication of adenosine deaminase deficiency. N. Engl. J. Med. 334:1367.[Free Full Text]
31. Arredondo-Vega, F. X., I. Santisteban, L. D. Notarangelo, J. El Dahr, R. Buckley, C. Roifman, M. E. Conley, M. S. Hershfield. 1998. Seven novel mutations in the adenosine deaminase (ADA) gene in patients with severe and delayed onset combined immunodeficiency: G74C, V129M, G140E, R149W, Q199P, 462delG, and E337del. Hum. Mut. 11:482. (or available at http://journals.wiley.com/1059-7794/html/mutation/arretext.htm). [Medline]
32. Hirschhorn, R., F. Martiniuk, V. Roegner-Maniscalco, A. Ellenbogen, J. L Perignon., T. Jenkins. 1983. Genetic heterogeneity in partial adenosine deaminase deficiency. J. Clin. Invest. 71:1887.

This article has been cited by other articles:

				F. Carlucci, A. Tabucchi, A. Aiuti, F. Rosi, F. Floccari, R. Pagani, and E. Marinello Capillary Electrophoresis in Diagnosis and Monitoring of Adenosine Deaminase Deficiency Clin. Chem., November 1, 2003; 49(11): 1830 - 1838. [Abstract] [Full Text] [PDF]

				F. X. Arredondo-Vega, I. Santisteban, E. Richard, P. Bali, M. Koleilat, M. Loubser, A. Al-Ghonaium, M. Al-Helali, and M. S. Hershfield Adenosine deaminase deficiency with mosaicism for a "second-site suppressor" of a splicing mutation: decline in revertant T lymphocytes during enzyme replacement therapy Blood, February 1, 2002; 99(3): 1005 - 1013. [Abstract] [Full Text] [PDF]

				T. Ariga, N. Oda, K. Yamaguchi, N. Kawamura, H. Kikuta, S. Taniuchi, Y. Kobayashi, K. Terada, H. Ikeda, M. S. Hershfield, et al. T-cell lines from 2 patients with adenosine deaminase (ADA) deficiency showed the restoration of ADA activity resulted from the reversion of an inherited mutation Blood, May 1, 2001; 97(9): 2896 - 2899. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ariga, T. Articles by Sakiyama, Y. Search for Related Content PubMed PubMed Citation Articles by Ariga, T. Articles by Sakiyama, Y.