| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Institute of Medical Microbiology and Immunology, University of Ulm, Ulm, Germany;
Institute of Virology, University of Essen, Essen, Germany;
Department of Internal Medicine II, University Hospital of Freiburg, Freiburg, Germany; and
Division of Experimental Pathology, The Scripps Research Institute, La Jolla, CA 92037
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In DNA vaccination, proteins are expressed after transient in vivo transfection and subjected to the same posttranslational modifications, changes in conformation, or oligomerizations as during virus infection. In contrast to recombinant Ags purified from eukaryotic or prokaryotic expression systems, genetic vaccination readily maintains the integrity of epitopes that stimulate neutralizing Ab (B cell) responses. DNA (or RNA) immunization is known to be exceptionally potent in stimulating T cell responses because antigenic peptides are efficiently generated from intracellular or extracellular protein Ags expressed from introduced genes in endogenous or exogenous processing pathways (without interference by viral proteins) (3, 4). In DNA vaccines, sequences can easily be exchanged between Ag-encoding genes to construct chimeric immunogens. We constructed chimeric VLP from the middle-surface (MS) Ag containing woodchuck hepatitis virus (WHV) and/or hepatitis B virus (HBV) determinants. Three surface protein species are present in the envelope of HBV virions, designated the large-surface (LS) (pre-S1/pre-S2/S), MS (pre-S2/S), and small-surface (S) proteins. In the LS protein (p39, gp42), the 108-residue pre-S1 sequence and the 55-residue pre-S2 sequence precede the S protein; in the MS protein (p31), the 55-residue pre-S2 sequence precedes the S protein (reviewed in Ref. 1). Using DNA-based vaccination, we characterized the humoral (serum Ab) and cellular (CTL) response of mice to selected determinants or epitopes of HBV expressed by these VLP. The MS proteins from HBV and WHV have sequence homology of about 70% (1). We show that Ab-defined pre-S2 determinants (of MS) and "a" determinants (of S), as well as the Ld- and Kb-restricted CTL epitopes of HBV, show no cross-reaction to the respective determinants of MS or S from WHV. This approach allowed us to assay the biological role of selected Ab- or CTL-defined determinants of the MS Ag in a transgenic (tg) model.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C57BL/6J (B6) mice (H-2b) and BALB/cJ (H-2d) mice were kept under standard pathogen-free conditions in the animal colonies of Ulm University (Ulm, Germany). B6-TgN(Alb1HBV)44Bri-tg (HBs-tg) mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Mice were used at 10–16 wk of age.
Ag-encoding plasmid DNA used for nucleic acid vaccination
The coding regions of hepatitis B surface Ag (HBsAg) and woodchuck hepatitis surface Ag (WHsAg) were dissected by PCR. The following primers were used for constructing chimeric genes from HBsAg and WHsAg: PCR-defined coding regions included HBsAg-55/120 with primers HBs55s ATCCTCAGGCCATGCAGTGG (sense, 3163a)/HBs120a CTGCAATTGCCCGTGCTGGTAGTTG (antisense, 521a), HBsAg-55/147 with primers HBs55s ATCCTCAGGCCATGCAGTGG (sense, 3163a)/HBs147a ATACACGTGCAATTTCCGTCCG (antisense, 605a), HBs-148/226 with primers HBs148s ATTGCACGTGTATTCCCATCCC (sense, 593a)/HBsstop CCATCTTTTTGTTTTGTTAGGG (antisense, 860a), HBs-121/147 with primers HBs121s CGGGCAATTGCAGAACCTGCATGACT (sense, 509a)/HBs147a ATACACGTGCAATTTCCGTCCG (antisense, 605a), WHs-121/226 with WHs121s CAGTCAATTGCAGACAATGC (sense, 636b)/Wsp2 CCACCATTTTGTTTTATTAA (antisense, 987b), WHs-148/226 with primers WHs148s ATTGCACGTGTTGGCCCATC (sense, 720b)/Wsp2 CCACCATTTTGTTTTATTAA (antisense, 987b), WHs-55/147 with primers Wpre-S2 CAGTTAACTATGAAAAATCAGAC (sense, 107b)/WHs147a CCAACACGTGCAATTTCCTGCC (antisense, 733b), and WHs-55/120 with primers Wpre-S2 CAGTTAACTATGAAAAATCAGAC (sense, 107b)/WHs120a GTCTGCAATTGACTGTGTTGTTTC (antisense, 650b). The numbering of the HBV genomea and WHV genomeb is according to Refs. 5 and 6 .
Sequences of eight primers were modified to create MunI and BbrpI sites for the construction of chimeric HBsAg/WHsAg genes. PCR fragments were cloned into pCR2.1 according to the manufacturer’s instructions. The cloned fragments were subjected to DNA sequencing analysis to verify the correctness of the sequences. These fragments were recloned into pcDNA3 at the restriction sites HindIII and XhoI. Four chimeric genes of HBsAg and WHsAg were constructed by ligation of fragments: construct I with HBs-55/120 and WHs-121/226, construct II with HBs-55/147 and WHs-148/226, construct III with WHs-55/147 and HBs-148/226, and construct IV with WHs-55/120, HBs-120/147, and WHs-148/226. The fragments were ligated either by the MunI site at junction 120/121 or by the Bbrp I site at junction 147/148. In the generated plasmid constructs, the Ags were expressed under control of the human CMV immediate early promoter.
Vaccination of mice
Adult mice were immunized i.m. into the tibialis anterior muscle with the indicated amounts of plasmid DNA as described previously (7). For the adoptive transfer experiments, spleens were obtained from B6 mice primed and boosted with the indicated vaccines. Single-cell suspensions were prepared from these spleens in PBS/BSA. A total of 3 x 107 spleen cells were injected i.p. or i.v. into HBs-tg hosts. Where indicated, CD4+ T cells were suppressed in mice by repeated i.p. injections of 200 µg anti-CD4 mAb YTS 191.1 (in 200 µl PBS) as described previously (8, 9). For Ab transfer (serotherapy), 200 µl sera containing the indicated levels of anti-"a" reactivity or anti-pre-S2 reactivity from DNA-immunized mice was injected i.p.
HBsAg expression in transiently transfected cells
LMH-chicken hepatoma cells (a generous gift of Dr. H.-J. Schlicht, Ulm, Germany) were transiently transfected with the indicated plasmid DNA using the CaPO4 precipitation method or the commercial liposome-based FuGENE6 transfection reagent (cat. no.1815091; Roche Diagnostics, Mannheim, Germany). Two days later, steady-state levels of secreted HBsAg particles were quantitatively determined in supernatants of cells using a commercial AXSYM HBsAg (V2) kit (cat. no. 7A40-22; Abbott, Wiesbaden, Germany).
HBsAg-specific CTL
Single-cell suspensions were prepared from spleens of immunized mice. A total of 3 x 107 responder cells were cocultured with 1 x 106 irradiated syngenic HBsAg-expressing transfectants. Where indicated, 3 x 107 responder cells were cocultured with 1 x 106 irradiated syngenic stimulator cells pulsed with recombinant HBsAg. After 5 days of culture, CTL were harvested, washed, and assayed for HBsAg-specific cytolytic reactivity as described previously (10).
Determination of serum Ab levels
Serum samples were repeatedly obtained from individual, immunized, or control mice by tail bleedings at different time points postinjection. Abs against the HBV-S protein were detected in mouse sera using the commercial IMxAUSAB test (cat. no. 7A39-20; Abbott). Ab levels were quantified using six standard sera. The tested sera were diluted so that the measured OD values were between standard serums one and six. Values presented in this paper were calculated by multiplying the serum dilution by the measured Ab level (mIU/ml). In addition, HBsAg-specific IgG serum Abs were determined by an end-point dilution ELISA. MicroELISA plates (Maxisorp; Nunc, Wiesbaden, Germany) were coated with 150 ng recombinant HBV- or WHV-derived surface Ag particles per well in 50 µl 0.1 M sodium carbonate buffer (pH 9.5) at 4°C. Serial dilutions of the sera in loading buffer (PBS supplemented with 3% BSA and 2% Tween 20) were added to the Ag-coated wells. Serum Abs were incubated for 2 h at 37°C followed by four washes with PBS supplemented with 0.05% Tween 20. Bound serum Abs were detected using HRP-conjugated anti-mouse IgG Abs (cat. no. 02067E; PharMingen, Hamburg, Germany) at a dilution of 1:2000 followed by incubation with o-phenylendiamine and 2x HCl (cat. no. 6172-24; Abbott) in PBS (pH 6.0). The reaction was stopped by 1 M H2SO4, and the extinction was determined at 492 nm. End-point titers were defined as the highest serum dilution that resulted in an absorbance value three times greater than that of negative control sera (derived from nonimmunized mice).
Western blot analyses
Western blotting was performed as described previously (11). cT-HBV/pre-S1pre-S2 fusion Ag expressed in Chinese hamster ovary (CHO) cells was immunoprecipitated using an anti-T-Ag Ab. Immunoprecipitates were processed for SDS-PAGE, and proteins were electroblotted onto nitrocellulose paper. Thereafter, sheets were incubated with murine serum Abs (at the indicated dilutions), washed, and incubated with 1:500 diluted rabbit anti-mouse Abs (a generous gift of Dr. W. Deppert, Heinrich-Pette-Institut, Hamburg, Germany). Ab reactivity was developed with 35S-labeled protein A.
Recombinant HBsAg
Nonglycosylated HBsAg containing the S protein of HBV was produced in the Hansenula polymorpha host strain RB10 (12). HBsAg particles purified from crude yeast extracts by adsorption to silica gel, column chromatography, and isopyknic ultracentrifugation were obtained from Dr. K. Melber (Rhein Biotech, Düsseldorf, Germany) (12). Mixed HBsAg particles were expressed in CHO cells (a generous gift from Drs. M. Goreki and N. Moav, Bio-Technology General, Rehovot, Israel) as described (13). In these cells, HBsAg genes are expressed under the control of the S gene promoter. The transfected CHO cells synthesize and secrete HBsAg particles, which are harvested from the growth medium using a combination of gel exclusion and ion exchange chromatography. The peptide composition, analyzed by SDS-PAGE with a reducing agent, revealed glycosylated and nonglycosylated LS (pre-S1/pre-S2/S), MS (pre-S2/S), and S proteins. WHsAg was extracted from serum stocks of chronically WHV-infected woodchucks as described previously (14). These recombinant Ags allowed us to detect HBV- or WHV-specific pre-S2 and/or S Ab responses.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The MS Ag of HBV comprises the 55-aa pre-S2 and the 226-aa S
sequence. It contains different Ab-binding determinants and
(H-2d or H-2b) CTL-defined
epitopes (Fig. 1
A). Most human
and murine anti-S Abs bind to the conformational "a"
determinant located at the S120–147 region
(1, 15, 16, 17). In H-2d and
H-2b mice, Ab responses but not CTL responses are
readily primed against determinants in the pre-S2 domain of HBsAg
(11). The S Ag contains the
Ld-restricted CTL epitope
S28–39 (18) and the
Kb-restricted CTL epitopes
S208–215 (19) and
S172–191 (this study).
|
B). Construct I
encodes the pre-S2 domain and the N-terminal 1–120 aa of the S Ag of
HBV and the C terminus of the S Ag of WHV. It contains the
Ld-restricted S28–39 CTL
epitope, but neither the Kb-restricted CTL
epitopes nor the Ab-defined "a" determinant of HBV S Ag. Construct
II encodes the pre-S2 domain and the N-terminal 1–147 aa of the S Ag
of HBV and the C terminus of the S Ag of WHV. It contains the "a"
determinant, as well as the Ld-restricted
S28–39 CTL epitope, but does not include the
Kb-restricted CTL epitopes of HBV because the
C-terminal sequence is from WHV. Construct III encodes the C-terminal
148–226 aa of S Ag of HBV and the corresponding N terminus (including
the pre-S2 domain) of S Ag of WHV. It contains only the
Kb-restricted CTL epitopes of S Ag from HBV.
Construct IV encodes the 120–147 aa domain of the S Ag of HBV, whereas
the remaining pre-S2, N-terminal, and C-terminal S sequences were from
WHV. It contains only the "a" determinant of the S Ag of HBV. These
four constructs allowed us to prime humoral and CTL responses to
selected determinants of the MS Ag of HBV by DNA vaccination in
mice. Priming CTL responses to HBsAg by injecting recombinant plasmid DNA encoding chimeric HBV/WHV MS Ag
BALB/c and B6 mice were injected i.m. with 100 µg plasmid DNA
encoding wild-type (wt) MS (pre-S2/S) from either HBV or WHV. Immune
spleen cells were restimulated in vitro with irradiated syngenic
transfectants expressing either the LS (pre-S1/pre-S2/S) or the S of
HBV (19, 20, 21) and assayed for specific CTL reactivity. HBV
S-specific CTL reactivity was readily detected in mice vaccinated with
MS-encoding plasmid DNA from HBV but not WHV (Fig. 2, A and C, lanes a
and b). These CTL were specific for either the
immunodominant, Ld-restricted HBV
S28–39 epitope in BALB/c mice (Fig. 2B, lanes a and b) or the
Kb-restricted HBV S172–191
peptide in B6 mice (Fig. 2D, lanes a and
b). The latter CTL epitope was recognized by spleen cells
from primed B6 mice in the context of Kb because
peptide-pulsed P1-Kb cells
(Kb-expressing P815 transfectants) were
efficiently lysed (Fig. 2D, lane a). Mapping of
the correct Kb-binding motif in this 20-mer
proved to be difficult because of the extreme hydrophobicity of this
peptide. In addition, we analyzed HBV S-specific CTL reactivity in B6
mice generated during MHC class I (MHC-I)-restricted processing of
recombinant (exogenous) but not endogenous expressed HBsAg
(19). Spleen cells derived from immunized B6 mice were
restimulated in vitro with irradiated syngenic cells pulsed with
recombinant HBsAg as described previously (19). CTL
specific for exogenous HBsAg (Fig. 2E) and the
Kb-restricted HBV S208–215
peptide (Fig. 2F) were detected in mice vaccinated with
MS-encoding plasmid DNA from HBV but not from WHV (Fig. 2, E
and F, lanes a and b). Our readout was
not designed to detect CTL reactivity in H-2d or
H-2b mice specific for MS from WHV. The data
indicate that if CTL are primed by plasmid DNA vaccination to epitopes
of the MS Ag of WHV, they do not cross-react with the known CTL
epitopes of the MS Ag of HBV. The sequence of the CTL
epitope(s) S28–39 IPQSLDSWWTSL from HBV
differs in three positions:
IAQMLDWWWTSL from the respective
sequence of the WHV surface Ag; the sequence of the
Kb-binding S172–191
epitope WLSLLVPFVQWFVGLSPTVW of HBV differs in nine positions
WLNLLVPLLQWLGGISLIAW
from the respective sequence of WHV S Ag; and the
Kb-binding S208–215
epitope ILSPFLPL of HBV differs in three positions:
ILPPFIPI from the respective
sequence of the S Ag of WHV. The species differences in the sequences
of the MS Ag from HBV and WHV are thus large enough to exclude
cross-reactivity at the CTL level.
|
A, lanes c–f).
These CTL were Ld-restricted and specific for the
well-known S28–39 epitope (Fig. 2B,
lanes c and d). Vaccination of B6 mice with DNA
from construct III but not construct I, II, or IV primed CTL that were
specific for the Kb-restricted HBV
S172–191 peptide generated during endogenous
processing of HBsAg (Figs. 2C, lanes c–f, and
2D, lane c) and the
Kb-restricted HBV S208–215
peptide generated during exogenous processing of HBsAg (Figs. 2E, lanes c and d; 2F,
lane c; and data not shown). All CTL expressed the
CD3+CD8+CD4-
surface phenotype (data not shown). These results confirm the known
MHC-I-restricted epitopes of S Ag from HBV that are recognized by CTL
from vaccinated H-2d or
H-2b mice. They demonstrate that these epitopes
are equally well processed from wt or chimeric MS Ag. The studies did
not reveal cryptic or subdominant CTL-defined epitopes of the MS Ag of
HBV that could prime CTL when immunodominant epitopes are deleted. Vaccination with plasmid DNA encoding chimeric HBV/WHV MS Ag primes species-specific Ab responses to pre-S2 and "a" determinants
Mice were primed and boosted with plasmid DNA encoding either the
wt MS Ag from HBV or WHV, or one of the chimeric HBV/WHV MS Ags. Sera
were collected at different time points postvaccination. Serum Abs
binding to the conformational "a" determinant of the HBsAg were
detected in the commercial IMxAUSAB test (Abbott) and were measured in
mIU/ml. This read-out revealed "a"-specific Abs in mice
vaccinated with plasmid DNA encoding either the wt MS Ag of HBV
or the chimeric MS Ags II and IV (Fig. 3A, lanes a,
d, and f). No "a"-specific Abs were
measurable in mice vaccinated with wt MS Ag from WHV or with the
chimeric MS Ags I and III (Fig. 3A, lanes b,
c, and e). Priming Ab responses against the
"a" determinant of the S Ag of HBV thus correlated with the
presence of the S120–147 sequence of HBV (Fig. 1B). This was confirmed when we studied the expression of wt
or chimeric MS Ag in vitro in cells transiently transfected with
plasmid DNA that was also used for DNA vaccination (Fig. 3B). Release by cells of MS Ag bearing the "a"
determinant was measured 48 h posttransfection in the commercial
AXSYM HBsAg (V2) ELISA (Abbott) that relies on "a"-specific mAb.
The assay detected HBV-specific "a"-bearing MS Ag in supernatants
conditioned by cells transfected with DNA encoding wt HBV MS Ag or the
chimeric MS Ags II and IV (Fig. 3B, lanes a,
d, and f). The level of HBsAg expression was
lower in cells transfected with construct IV (compare lanes
a and d with lane f). In contrast,
"a"-bearing MS Ag was not detected in cells transfected with DNA
encoding wt WHV MS Ag or the chimeric MS Ags I or III (Fig. 3B, lanes b, c, and e).
Thus, the murine Ab response to the "a" determinant of the HBsAg
shows no cross-reactivity to the "a" determinant of the WHsAg.
|
, C and
D). A similar pattern of Ab binding to HBV S Ag was seen,
both when yeast-derived S particles were used as the test Ag in the
ELISA and when the commercial ELISA test was used (compare Fig. 3, A and C). An apparently similar Ab-binding
pattern was seen when CHO-derived HBV large surface Ag (composed of LS,
MS, and S Ag) (13) was used for Ab detection (Fig. 3D, lanes a, d, and f).
With the latter test Ag we detected Abs binding to the native pre-S2
domain of the MS Ag of HBV that were elicited by vaccination with DNA
encoding construct I (Fig. 3D, lane c). Note that
these mice had no Abs in the serum that bound to the "a"
determinant of the S Ag of HBV (Fig. 3, A and C,
lane c). Abs binding the pre-S2 domain of the MS Ag of HBV
were also detected in Western blot analyses. We have described a system
that allows stable expression of mutated, truncated, or chimeric
protein domains fused to a hsp73-binding cytosolic T-Ag fragment
(11, 22, 23). We expressed the N-terminal 163-aa pre-S
(i.e., pre-S1pre-S2) domain of the LS Ag of HBV in this system
(11). These analyses showed that Abs binding to linear
epitopes of the HBV pre-S2 domain were present in the serum of mice
vaccinated with DNA encoding construct I or II (or wt MS Ag of HBV) but
not with DNA encoding wt MS Ag of WHV or construct III or IV (which all
contained a pre-S2 domain of the MS Ag of WHV) (Fig. 3F, and
data not shown).
In addition, we analyzed by ELISA the serum Ab response of vaccinated
mice against the pre-S2 or "a" determinant of the surface Ag of
WHV, using surface particles purified from the serum of chronically
WHV-infected woodchucks (which contain LS, MS, and S Ag from WHV) (Fig. 3E). Abs binding WHV-derived surface particles were present
in sera of mice vaccinated with DNA encoding wt MS from WHV but not
from HBV (Fig. 3E, lanes a and b).
These Abs do not cross-react with the S and LS Ag of HBV (Fig. 3, C and D, lane b). Similar to the
exquisite species specificity of the murine CTL response to epitopes on
the S Ag of HBV, the murine Ab response to the pre-S2 and to the
"a" determinant of the MS Ag of HBV is specific and does not
cross-react with homologous determinants of the MS Ag from
WHV.
CD4+ T cell-dependent Ab responses against the pre-S2 or the "a" domain of the MS Ag suppress HBsAg antigenemia of HBs-tg mice
We used HBs-tg mice (24) to test the biological effect of Ab responses primed to selected domains of the MS Ag. HBs-tg mice produce large amounts of surface particles from HBV (containing LS, MS, and S Ag) in the liver, and readily detectable levels of antigenemia build up in their blood and peripheral tissues. Using an adoptive transfer system described previously (9), we engrafted immune cells with different well-characterized immune reactivities to MS Ag into congenic HBs-tg hosts. We have shown that this adoptive transfer of congenic immune spleen cells into HBs-tg hosts establishes a stable and rising CD4+ T cell-dependent Ab response to HBsAg that suppresses antigenemia (9, 25).
B6 mice were primed and boosted by injections of plasmid DNA encoding
either the wt MS Ag of HBV or the hybrid MS Ag constructs I-IV. The
immune mice were shown to have developed the expected Ab and CTL
reactivity against MS described above (Figs. 2 and 3). Injection of
serum from immune B6 mice into HBs-tg hosts (serotherapy) transiently
suppressed HBsAg antigenemia in some (Fig. 4, F–H and K) but
not all (Fig. 4I) groups of treated tg mice. We injected
i.p. either 200 µl serum containing either 260 mIU (Fig. 4F), 190 mIU (Fig. 4H), or 40 mIU (Fig. 4K) anti-"a" seroreactivity, or antiserum with a
1:3000 anti-pre-S2 titer (Fig. 4G). Suppression of HBsAg
antigenemia was transient, and serum HBsAg always reappeared 2–10 days
after the serotherapy. HBsAg antigenemia was transiently suppressed in
mice injected with sera from immune donor B6 mice vaccinated with
plasmid DNA encoding wt MS Ag from HBV or chimeric MS Ag expressed from
constructs I, II, and IV (Fig. 4, F–H and K).
HBsAg antigenemia was not suppressed in HBs-tg hosts injected with
immune sera from B6 donor mice vaccinated with plasmid DNA encoding
chimeric MS Ag expressed by construct III or injected with 100 µl
nonimmune sera (from donor B6 mice injected with noncoding plasmid DNA)
(Fig. 4I, and data not shown). The transfer of Abs specific
for either the "a" determinant (Fig. 4K) or the pre-S2
determinant (Fig. 4G) of MS from HBV could therefore
transiently suppress HBsAg antigenemia in HBs-tg mice.
|
, A–E). The transfer of immune spleen cells (3 x
107 cells/mouse) from B6 donor mice vaccinated
with plasmid DNA encoding wt MS of HBV (Fig. 4A) or with the
chimeric variant MS constructs I, II, or IV (Fig. 4, B, C,
and E) but not III (Fig. 4D) led to stable
suppression of HBsAg antigenemia and the appearance of a HBV S-specific
serum Ab titer in the HBs-tg host (Fig. 4, A, C,
and E). The HBsAg-specific serum Ab titers increased for
months posttransplantation in the HBs-tg hosts, suggesting a
restimulation of the Ab response in the adoptive host by
transgene-encoded HBsAg (Refs. 9, 25 , and 26 ,
and data not shown). A stable suppression of HBsAg antigenemia in the
absence of anti-S serum Ab titers was observed in tg mice
transplanted with cells from immune donors vaccinated with plasmid DNA
encoding construct I (Fig. 4B). However, sera of these
transplanted mice contained increasing serum Ab levels binding the HBV
pre-S2 domain of MS that efficiently clear up serum HBsAg
antigenemia (Fig. 4B). Hence, all serum HBsAg particles in
HBs-tg mice carry Ab-binding pre-S2 determinants (present on the LS or
MS Ags) and can be eliminated by an Ab-dependent effector mechanism
specific for this epitope. The establishment of stable humoral immunity to HBsAg was CD4+ T cell dependent because the depletion of CD4+ T cells from the immune donor cell inoculum prevented its establishment in the tg host (data not shown), confirming previously published data (9, 26). Thus, primed donor-derived CD4+ T cells are critical for the establishment of HBsAg-specific Ab responses in the HBs-tg host. The immunity to HBsAg we adoptively established in HBs-tg mice did not suppress HBsAg expression in the liver from the transgene. Despite the rising titers of anti-HBsAg Abs and the stable suppression of HBsAg antigenemia in transplanted HBs-tg mice, we detected no decrease in the HBsAg content of the liver (data not shown), confirming previous data (9, 26). Furthermore, we detected no increase in serum transaminase levels after immune cell transfer and/or Ab transfer, indicating that the adoptive transfer of this type of immunity does not damage HBsAg-expressing liver cells.
A MHC-I (H-2b)-restricted CTL reactivity against
epitopes in the C terminus of HBsAg was present in immune cell
populations primed by plasmid DNA encoding either the complete wt MS Ag
of HBV or the chimeric MS Ag III (Figs. 1 and 2). Using immune spleen
cells from B6 mice vaccinated with DNA of construct III, we selectively
transferred the Kb-restricted CTL (immune cells
did not contain anti-HBV "a" or pre-S2-reactivity) to HBs-tg
hosts (Fig. 4D). However, this transfer established neither
humoral (Fig. 4D) nor cellular immunity to HBsAg (data not
shown) in the tg host, nor did it induce histopathological changes in
the liver or a rise in serum transaminase levels (data not shown) when
tested at different time points posttransfer. In addition,
the tg-specific HBsAg expression in the liver was not reduced.
Following transfer of immune spleen cells from B6 donors vaccinated
with these two vector DNA constructs, we could not recover this
HBsAg-specific CTL reactivity from the adoptive tg host posttransfer
(data not shown). This further confirms our previously published data
(9). It seems that the
H-2b-restricted, HBsAg-specific CTL that were
transferred in these experiments were rapidly silenced in the tg
recipients. This is in contrast to the observation that transplantation
of large numbers of H-2d-restricted,
HBsAg-specific CTL were detectable for 2–4 wk posttransfer in adoptive
tg hosts (reviewed in Ref. 27).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We primed CTL with non-cross-reactive specificity to epitopes of the HBV S Ag by DNA vaccines encoding wt or chimeric Ag. The approach allowed us to confirm the presence of an N-terminal Ld- and two C-terminal Kb-restricted CTL epitopes on the S Ag of HBV. Different (DNA- or protein-based) vaccination techniques have not revealed additional (subdominant or cryptic) CTL epitopes of HBsAg in B6 mice. These data generated in H-2d and H-2b mice make it unlikely that additional immunodominant or subdominant epitopes of the HBV S Ag will be discovered in these strains and confirm the absence of H-2d and H-2b CTL-defined epitopes in the HBV pre-S2 domain (11). This was independently confirmed in vaccination experiments with chimeric DNA vaccines expressing 80- to 100-aa fragments of HBsAg fused to heterologous viral Ags (data not shown). This was unexpected because different computer screening programs indicated a multitude of Kb- and Db-binding 8-mer and 9-mer motifs in the HBsAg molecule. The two Kb-restricted epitopes of HBsAg we defined in B6 mice are unusual. The Kb/S208–215 epitope is only generated by cells processing exogenous HBsAg (19). Processing and presentation of this epitope is TAP and brefeldin A independent but blocked by NH4Cl or selected acid-protease inhibitors. In contrast, the Kb/S172–191 epitope is generated by endogenous processing of HBsAg. Fine mapping of this epitope is difficult because the sequence is extremely hydrophobic. Within 12 h posttransfer, the adoptively transferred, Kb-restricted CTL immunity was lost in HBs-tg hosts. The mechanism that silences these CD8+ T cells in HBs-tg mice is unknown. Therefore, in the HBs-tg host, the maintenance of the Th1 CD4+ T cell-dependent humoral immunity to HBsAg in vivo seems independent of the immunoregulatory control of CD8+ T cells (29). The experimental approach of priming humoral or cellular immune responses to selected determinants of a complex viral Ag is thus an efficient technique for defining the biological role of individual components of anti-viral immune responses.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Reinhold Schirmbeck, Institute for Medical Microbiology and Immunology, University of Ulm, Albert Einstein Allee 11, D-89081 Ulm, Germany.
3 Abbreviations used in this paper: VLP, virus-like particle; MHC-I, MHC class I; MHC-II, MHC class II; HBsAg, hepatitis B surface Ag; WHsAg, woodchuck hepatitis surface Ag; S, small-surface HBsAg; MS, middle-surface (pre-S2/S) HBsAg; LS, large-surface (pre-S1/pre-S2/S) HBsAg; HBV, hepatitis B virus; WHV, woodchuck hepatitis virus; wt, wild type; B6, C57BL/6J; tg, transgenic; HBs-tg, tg line B6-TgN(Alb1HBV)44Bri expressing in the liver LS, MS, and S; CHO, Chinese hamster ovary.
Received for publication July 28, 2000. Accepted for publication October 25, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  X. Li, X. Yang, Y. Jiang, and J. Liu A novel HBV DNA vaccine based on T cell epitopes and its potential therapeutic effect in HBV transgenic mice Int. Immunol., October 1, 2005; 17(10): 1293 - 1302. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Thermet, M. Robaczewska, C. Rollier, O. Hantz, C. Trepo, G. Deleage, and L. Cova Identification of Antigenic Regions of Duck Hepatitis B Virus Core Protein with Antibodies Elicited by DNA Immunization and Chronic Infection J. Virol., February 15, 2004; 78(4): 1945 - 1953. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Chun, J. Lee, H. S. Cheong, and K.-Y. Lee Tumor Eradication by Hepatitis B Virus X Antigen-Specific CD8+ T Cells in Xenografted Nude Mice J. Immunol., February 1, 2003; 170(3): 1183 - 1190. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Riedl, S. El Kholy, J. Reimann, and R. Schirmbeck Priming Biologically Active Antibody Responses Against an Isolated, Conformational Viral Epitope by DNA Vaccination J. Immunol., August 1, 2002; 169(3): 1251 - 1260. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) of
treated HBs-tg mice using a commercial AXSYM HBsAg (V2) kit
(A–I). Mean anti-HBV S Ab titers (•) were tested
in mouse sera using the commercial IMxAUSAB test. Ab titers
(mIU/ml) ± SEM of three transplanted mice/group measured at
different time points postinjection are shown (A–K). We
further quantitatively determined serum pre-S2 Ab titers (*) in
HBs-tg hosts adoptively transferred with construct I-primed spleen
cells using HBV LS Ag (containing LS, MS, and S Ag of HBV) for
detection (B).