| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Pediatric Oncology Branch, Division of Clinical Sciences, National Cancer Institute, Bethesda, MD 20892;
Laboratory of Experimental Immunology, Division of Basic Sciences, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD 21702;
Laboratory of Chemoprevention, Division of Basic Sciences, National Cancer Institute, Bethesda, MD 20892;
Intramural Research Support Program, Science Applications International Corp.-Frederick, Frederick, MD 21702;
¶ Department of Oncology, Hoffmann-La Roche, Inc., Nutley, NJ 07110;
||
Department of Internal Medicine, University of Michigan Medical School, Ann Arbor, MI 48109; and
#
National Cancer Institute Veterinary and Tumor Pathology Section, Office of Laboratory Animal Science, Division of Basic Sciences, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD 21702
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
- and TNF-
-inducible antiangiogenic
chemokines IFN-inducible protein 10 and monokine induced by IFN-. In
contrast to untreated juvenile C3(1)TAg mice in which histologically
normal mammary epithelium predictably undergoes progressive
hyperplasia, atypical changes, and ultimately transition to overt
carcinoma, the current studies also demonstrate a unique preventative
therapeutic role for IL-12/pulse IL-2. In juvenile mice, early
administration of IL-12/pulse IL-2 markedly limits the expected
genetically programmed neoplastic transition within the mammary
epithelium and does so in conjunction with enhancement of constitutive
Fas and pronounced induction of local Fas ligand gene expression, T
cell infiltration, and induction of apoptosis within the mammary
epithelium. These events occur in the absence of a durable Ag-specific
memory response. Thus, this novel model system demonstrates that the
potent therapeutic activity of the IL-12/pulse IL-2 combination rapidly
engages potent apoptotic and antiangiogenic mechanisms that remain
active during the delivery of IL-12/pulse IL-2. The results also
demonstrate that these mechanisms are active against established tumor
as well as developing preneoplastic lesions. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have reported that repeated systemic administration of IL-12 in
combination with intermittent, weekly doses of IL-2 (pulse IL-2) is not
only well tolerated, but can induce rapid and complete regression of
well-established transplantable primary and/or metastatic murine renal
carcinoma in up to 100% of treated mice (16). Given its
striking antitumor activity, the IL-12/pulse IL-2 regimen may provide a
unique model for the elucidation of key mechanisms in successful
cytokine-induced eradication of established tumor. To investigate the
antitumor activity in a setting where the host, as occurs in human
patients with malignancy, has been physiologically conditioned by the
entire dynamic process of genetically programmed neoplastic progression
and tumorigenesis, we have studied this combination in a transgenic
mouse model of spontaneous mammary carcinoma. In this unique model,
tissue-specific targeted expression of the early region of the SV40
large tumor Ag (TAg)4
gene was achieved by introduction of a fusion gene consisting of TAg
and the 5'-flanking region of the rat prostatic steroid binding protein
gene (C3(l)) (17). As a consequence, male mice of this
transgenic strain experience progressive prostatic hyperplasia leading
to the development of overt carcinoma by 
7 mo of age. Female mice
uniformly develop mammary hyperplasia with progressive atypia and
ultimately transition to overt carcinoma with multifocal mammary tumors
by 6 mo of age. Such an autochthonous model may afford the advantage
of more closely reflecting the physiologic interplay of tumor-promoting
genetic lesions and conditioning of the host immune system during the
processes of neoplastic progression and tumorigenesis, in contrast to
the rapid exposure of normal mice to large numbers of tumor cells as
occurs in transplantable models. The present studies were undertaken to
investigate the therapeutic activity of IL-12/pulse IL-2 against
established autochthonous murine mammary tumors, to assess the ability
of this regimen to delay and/or prevent the neoplastic transition
observed in this model, and to gain insight into antineoplastic
mechanisms engaged by this combination.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Female FVB/N-transgenic mice bearing the C3(l)-TAg fusion transgene produced as previously described (17) were used in all experiments. They were maintained in a dedicated pathogen-free environment and used at various ages as specified below. Animal care was provided in accordance with procedures outlined in the Guide for the Care and Use of Laboratory Animals (National Institutes of Health Publication 86-23, 1985).
Reagents
Recombinant murine IL-12 (sp. act., 7 x 106 U/mg) was provided by Hoffmann-La Roche (Nutley, NJ) and Genetics Institute (Cambridge, MA). Stock solutions prepared in Dulbecco’s PBS were stored at -70°C until use. For in vivo administration, the stock solutions were diluted as necessary with PBS containing 0.1% (v/v) sterile-filtered homologous mouse serum. Highly purified, recombinant human IL-2 (from Escherichia coli) was provided by Chiron (Emeryville, CA) (18, 19). After reconstitution with sterile water, IL-2 was diluted with HBSS containing 0.1% sterile-filtered homologous mouse serum for in vivo administration.
Treatment regimens
Based on our previous experience using the Renca murine renal carcinoma model, we initially evaluated the influence of IL-12/pulse IL-2 on the growth of established mammary carcinoma. Mice were ear-tagged to facilitate monitoring of the kinetics of tumor growth at each site in each mouse. Using a group of 10 mice, we monitored for the initial emergence of tumor. When the estimated cumulative tumor volume in a given mouse reached 500 mm3 (range, 512-1100 mm3), therapy was initiated with IL-12/pulse IL-2. Based on the timing of initiation of therapy, mice were treated in one of four cohorts. Cohort 1 included two mice that received IL-2 (300,000 IU/dose) administered i.p. twice daily on days 0, 8, 14, 21, 28, 35, and 42. IL-12 (0.5 µg/dose) was given i.p. on days 0–4, 8–11, 14–18, 21–25, 28–32, 35–39, and 42–46. Cohort 2 included four mice that received IL-2 on days 0, 6, 13, 20, 27, and 34 and IL-12 on days 0–3, 6–10, 13–17, 20–24, 27–31, and 34–38. Cohort 3 included two mice that received IL-2 as described above on days 0, 7, 14, and 21 and IL-12 on days 0–4, 7–11, 14–18, and 21–25. Cohort 4 included two mice that received IL-2 on days 0, 6, 13, and 20 and IL-12 on days 0–3, 6–10, 13–17, and 20–24 of therapy. Mice were monitored daily for evidence of toxicity, tumor dimensions at each mammary site were measured one or two times per week, and the estimated cumulative tumor volume for each mouse was calculated as outlined below.
Serum IFN- and TNF- concentrations were measured in tumor-bearing
mice that had been treated with IL-2 or vehicle alone i.p. on days 0
and 7 and IL-12 or vehicle alone on days 0–4 and 7–9. On day 10 mice
were euthanized via CO2 asphyxiation and/or
cervical dislocation, and serum samples were obtained as outlined
below.
To evaluate the influence of IL-12/pulse IL-2 administration on tumor neovascularization and local expression of the genes encoding various modulators of angiogenesis within established mammary carcinoma, mice bearing established tumors were assigned to treatment with IL-12/pulse IL-2 or vehicle alone. An attempt was made to match the distribution of ages and/or baseline tumor volumes in the respective groups. Mice received IL-2 or vehicle alone twice daily on days 1 and 7, and IL-12 or vehicle alone daily on days 1–4 and 7–9. On day 10, mice were euthanized, and tumors were resected cleanly, snap-frozen, and processed for analysis of gene expression as outlined below. Tumors from mice treated with IL-12/pulse IL-2 or vehicle alone also were resected, fixed in formalin, and assessed for vascularity after staining with hematoxylin and eosin as noted below. To investigate the impact of IL-12/pulse IL-2 administration on local expression of the genes encoding Fas and Fas ligand (FasL) within established mammary carcinoma, we randomly assigned mice bearing established tumors to receive treatment with either IL-12/pulse IL-2 or vehicle alone. Mice received IL-2 or vehicle alone daily on days 0–4, 7–11, and 14–16. On day 17 mice were euthanized, and all involved tumor sites were cleanly resected, snap-frozen, and processed as outlined below.
We also assessed the therapeutic activity of IL-12/pulse IL-2 in mice bearing advanced disease characterized by multiple tumors at baseline. In a study to compare the antitumor activities of IL-12/pulse IL-2 vs IL-12 or pulse IL-2 alone in the setting of advanced multifocal disease, five mice per group were assigned to therapy with IL-12 with or without IL-2 or vehicles alone. Mice received IL-2 or vehicle alone twice daily on days 1, 7, 14, and 21 and IL-12 or vehicle alone daily on days 1–4, 7–11, and 14–18. In a subsequent study using a cohort of 11 mice, mice were randomly assigned to receive therapy with IL-12/pulse IL-2 (six mice) or vehicle alone (five mice). Mice received IL-2 or vehicle alone twice daily on days 0, 7, 14, and 21 and IL-12 or vehicle alone daily on days 0–4, 7–11, 14–17, 19, and 21–25. The number of mammary sites with measurable tumor and the respective dimensions were monitored at baseline and throughout the course of therapy, and cumulative estimated tumor volumes were calculated as outlined below.
To assess the impact of IL-12/pulse IL-2 on the progressive hyperplasia, atypia, and emergence of overt carcinoma that occur in this model, we used early chronic administration of this regimen to juvenile C3(l)-TAg mice. A cohort of 11 age-matched 2-mo-old mice was randomly assigned to therapy with IL-12/pulse IL-2 or vehicle alone. Five mice were assigned to treatment with IL-12/pulse IL-2, and six were given vehicles alone. The mice received IL-2 or vehicle alone twice daily on days 0, 7, 14, 21, 28. 35, 42, and 49, and IL-12 or vehicle alone on days 0–4, 7–11, 14–18, 21–25, 28–32, 35–39, 42–46, and 49–51 and were then monitored for emergence of tumor. To further characterize the influence of IL-12/pulse IL-2 on the neoplastic progression observed in this model, three mice per group were euthanized on day 53 (the completion of therapy), and all mammary sites were resected. Individual sites were either snap-frozen for subsequent evaluation of local gene expression by RT-PCR or placed in 10% neutral buffered formalin for fixation and subsequent histology studies as outlined below. In a subsequent study to help clarify the cell populations undergoing apoptosis, cohorts of age-matched mice were treated with IL-2 or vehicle alone twice daily on days 0, 7, and 14 and with IL-12 or vehicle alone on days 0–4, 7–11, and 14–17. On day 18, mice were euthanized, and individual mammary sites were resected and placed in 10% neutral buffered formalin for fixation and assessment of apoptosis as noted below.
To investigate the impact of IL-12/pulse IL-2 administration on the ultrastructural histology of the mammary epithelium and the occurrence of apoptosis in these cells, a cohort of eight juvenile mice was randomly assigned to treatment with IL-12/pulse IL-2 or vehicle alone. Mice were treated with IL-2 or vehicle alone twice daily on days 0 and 7, and with IL-12 or vehicle alone on days 0–4 and 7–8. On day 9 mice were euthanized, and individual mammary sites were resected and prepared as outlined below for subsequent examination using electron microscopy.
Serum cytokine measurements
Whole blood was collected via cardiac puncture from individual
mice treated with IL-12/pulse IL-2 or vehicle alone as described above
and placed into glass red-top tubes to facilitate clot formation. After
clot formation, the tubes were centrifuged at 3000 rpm, and serum was
removed and stored at -20°C until further use. Serum IFN- and
TNF- concentrations were determined according to the manufacturer’s
instructions using the Quantikine-M immunoassay kits for murine TNF-
and IFN- (R&D Systems, Minneapolis, MN).
Tissue processing histology studies
Tumors or mammary sites, as indicated, were resected after mice were euthanized using CO2 asphyxiation and/or cervical dislocation. Specimens for routine histologic examination were fixed in formalin and embedded in paraffin. Sections were then cut at 5-µm thickness and stained with hematoxylin and eosin. Where indicated, tumor vascularity was assessed by identifying hypervascular zones in tumor sections scanned at x100 magnification. Microvessel count within hypervascular areas, or so-called hot zones, has been widely reported as an index of tumor vascularity. Using such approaches, increased tumor vascularity has been found to reflect the presence of more aggressive disease in a wide variety of human tumors. Hypervascular zones were defined in the present studies as focal aggregates of vessel lumina with >10 visible vessel lumina per field at x100 magnification. Intact vessel lumina were defined by characteristic morphology with identifiable lining endothelial cells and the presence of intact RBC and/or leukocytes within the vessel lumen. Branching vascular structures were counted as one lumen. Vessel densities in hypervascular zones were assessed at x100 with confirmation of morphology and vessel counts at x200 as appropriate.
For immunohistochemical evaluation of local T cell infiltration, 5-µm-thick tissue sections of formalin-fixed paraffin-embedded mammary sites were warmed in a 600°C oven for 10 min, deparaffinized, and hydrated with deionized water. Sections were then digested with 0.5% protease VIII for 3 min at 37°C. Slides were rinsed in deionized water, and endogenous peroxidase activity was quenched by incubation at room temperature in 3% hydrogen peroxide for 10 min, followed by rinsing with 0.5% Tween 20/PBS. Nonspecific binding of reagents was blocked by incubation of sections for 20 min in a solution consisting of 1% BSA and 1.5% normal goat serum. Sections were then incubated with rabbit anti-human CD3 (Dako, Carpinteria, CA) primary Ab or rabbit anti-human chloramphenicol acetyltransferase as an irrelevant isotype control Ab (5'3', Boulder, CO). Sections were subsequently incubated for 30 min with a biotinylated goat anti-rabbit IgG secondary Ab (Vector, Burlingame, CA) and then with ABC Elite reagent (Vector) for 30 min. Diaminobenzidene (Sigma, St. Louis, MO) was then applied for 4 min as a substrate for the peroxidase reaction. Slides were counterstained with hematoxylin, dehydrated, and coverslipped with Permount for light microscopic evaluation. Apoptotic cells in mammary sites were detected using the in situ end-labeling technique (ApopTag, Oncor, Gaithersburg, MD) performed on formalin-fixed paraffin-embedded 5-µm-thick tissue sections.
Electron microscopy
Tissue preparation for electron microscopic ultrastructural
studies was described previously (27). Individual mammary
sites were initially fixed in 4% paraformaldehyde and 2%
glutaraldehyde in PBS (Tousimis, Rockville, MD). Fixed tissues were
rinsed thoroughly in sodium cacodylate buffer (0.1 M, pH 7.4; Electron
Microscopy Sciences, Fort Washington, PA), trimmed into 3- to
4-mm3 pieces with a single-edged razor blade, and
postfixed in 1% osmium (Stevens Metallurigical Corp., New York, NY) in
the same buffer overnight at 4°C. Dehydration, infiltration, and
embedding of the tissues were conducted in a series of graded ethanol
(e.g., 25, 50, 75, 95, and 100%), 100% propylene oxide (Electron
Microscopy Sciences), epoxy resin LX-110 (Ladd Research, Burlington,
VT), and finally in the pure epoxy resin. The epoxy resin was cured at
60°C for 48 h. The cured blocks were then sectioned to 50–60
nm with an ultramicrotome (Leica, Deerfield, IL) using a diamond knife
(Diatome U.S., Fort Washington, PA), and mounted on a copper mesh grid.
The thin sections were stained in uranyl acetate and lead citrate
solution to enhance the contrast. Thin sections were stabilized by
carbon evaporation in a vacuum evaporator (Denton, Cherry Hill, NJ).
Tissue sections were examined and photographed with an H7000 electron
microscope (Hitachi, Tokyo, Japan).
RT-PCR
Specimens to be used for analysis of local gene expression were snap-frozen immediately after resection and stored at -70°C until further use. For the analysis of gene expression in mammary sites and/or established tumors, total cellular RNA was isolated from snap-frozen tissue specimens by the TRIzol method. Reverse transcription was performed in a 50-µl reaction mixture containing 50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 250 µM dATP, 250 µM dCTP, 250 µM dTTP, 250 µM dGTP, RNase inhibitor (0.75 U/µl), Moloney murine leukemia virus reverse transcriptase (5 U/µl), 2.5 µM oligo(dT) primer, and 10 µg denatured RNA. The reverse transcription reaction mixture was incubated at 42°C for 60 min and at 95°C for 5 min, then stored at -20°C until further use.
The PCR was performed in a 25-µl reaction mixture containing 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 200 µM dATP, 200 µM dTTP, 200 µM dCTP, 200 µM dTTP, 0.6 U of Taq DNA polymerase, 0.5 µM sense primer, 0.5 µM antisense primer, and 2.5 µl of the products of the reverse transcription reaction. Amplification was performed in a thermocycler (Gene Amp PCR System 2400, Perkin-Elmer/Cetus) as follows: 94°C for 3 min (one cycle), 94°C for 30 s/56–57°C for 1 min/72°C for 45 s (optimized at between 21–32 cycles depending on the primer pair and tissue source used), and 72°C for 5 min (one cycle). PCR products were then separated on 1% agarose gels impregnated with 0. 5 µg/ml ethidium bromide or stored at -20°C until further use.
The PCR primer sequences and predicted product sizes for the genes
evaluated in the present studies were as follows: G3PDH: sense,
GCCACCCAGAAGACTGTGGATGGC; antisense, CATGTAGGCCATGAGGTCCACCAC (product
= 446 bp); Fas: sense,
CTTCTACTGCGATTCTCCTGGCT; antisense, TCTCCTCTCTTCATGGCTGGAAC (product = 635
bp); FasL: sense, CAGCTCTTCCACCTGCAGAAGG; antisense,
AGATTCCTCAAAATTGATCAGAGAGAG (product = 510 bp); IFN-inducible
protein 10 (IP-10; CRG-2): sense, ACCATGAACCAAGTGCTGCCGTC;
antisense, GCTTCACTCCAGTTAAGGAGCCCT (product = 312 bp); monokine
induced by IFN- (MIG): sense, GATCAAACCTGCCTAGATCC;
antisense, GGCTGTGTAGAACACAGAGT (product = 399 bp); vascular
endothelial growth factor-B (VEGFB): sense,
AGTGGTGCCATGGATAGACG; antisense, TGGCTTCACAGCACTCTCCT (product =
304 bp).
Statistical analysis calculations
Tumor number data were analyzed untransformed using parametric methods. The mean number of tumors per mouse in control vs IL-12/pulse IL-2-treated groups were compared in pairwise fashion at day 0 (baseline) and day 27 (end of therapy) time points using Student’s t test. The rate of change in tumor number in the respective groups was compared by calculating the result (number of tumors at day 27 - number of tumors at day 0) for each mouse. Mean values for the respective control and IL-12/pulse IL-2-treated groups were then calculated and compared using Student’s t test.
Tumor volumes were estimated by measuring the smallest and largest dimensions of each tumor and calculating the product of the square of the smallest dimension multiplied by the largest dimension. Cumulative tumor volumes for each mouse were determined by summing the estimated values calculated for each site of tumor involvement. Tumor volumes were transformed to square roots or cube roots before analysis to achieve variance stability and were analyzed using parametric methods. The mean estimated cumulative tumor volume in control vs IL-12/pulse IL-2-treated groups was compared in pairwise fashion at the indicated time points using Student’s t test. Where indicated, the rate of change in tumor volume in the respective groups was compared by calculating the result (cumulative tumor volume at day 27 - cumulative tumor volume at day 0) for each mouse. Mean values for the respective control and IL-12/pulse IL-2-treated groups were then calculated and compared using Student’s t test. The presence of tumor hypervascular zones in the respective treatment groups were compared using Fisher’s exact test.
Comparisons of tumor number and volume data using the nonparametric Jonckheere test for trend and pairwise Wilcoxon rank-sum tests yielded generally the same conclusions. All p values were obtained from two-tailed tests of statistical significance and were considered significant when p < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Several previous studies in transplantable tumor models have
documented the therapeutic advantages of IL-12 plus IL-2 over IL-2 or
IL-12 alone (15, 16). To assess the antitumor effects of
the IL-12/pulse IL-2 regimen in a setting where the host has been
subjected to the full spectrum of physiologic pressures associated with
genetically programmed neoplastic progression and tumorigenesis, we
investigated its activity in the C3(l)TAg-transgenic mouse model of
spontaneous mammary carcinoma. Using a cohort of 10 mice, all
presenting with single established mammary tumors, complete responses
were induced in 5 of 10 (50%) treated mice (Fig. 1
, A–C). An additional 2 of
10 (20%) treated mice experienced a partial response (defined here as
less than complete response, but >50% reduction in estimated tumor
volume), while 1 of 10 (10%) mice had progressive disease (defined
here as >25% increase in established tumor volume) despite therapy.
One of 10 (10%) mice died due to apparent mechanical trauma from i.p.
drug administration after having undergone a partial response 21 days
into therapy, and 1 of 10 (10%) mice died for unknown reasons
(presumed to be drug-related toxicity) with stable disease (defined as
<50% reduction and no greater than 25% increase in tumor volume) 11
days into therapy. We also found here that IL-12/pulse IL-2 induced
very rapid tumor regression, with three of five mice (60%) that would
ultimately undergo a complete response having done so after only two
cycles of therapy, and four of five (80%) mice undergoing a complete
response after three cycles of therapy. Thus, overall, 7 of 10 mice
(70%) bearing established tumors underwent complete or partial
responses, which is in stark contrast to the inevitable tumor
development progressive growth and death that occur in 100% of
untreated C3(l)TAg mice (17). Follow-up of treated mice
demonstrated recurrence of tumors beginning several weeks after
cessation of therapy. Interestingly, new tumors generally did not recur
at sites of complete response, but, rather, occurred at different
mammary sites. These results show that although potent antitumor
mechanisms were engaged by IL-12/pulse IL-2, an adaptive memory immune
response capable of overcoming the chronic oncogenic stimulus provided
by the TAg was not achieved.
|
plus
TNF-, up-regulates IFN--inducible antiangiogenic chemokines, and
inhibits neovascularization
To investigate mechanisms accounting for the rapidly induced
antitumor activity of IL-12/pulse IL-2, we have evaluated its
immunomodulatory and antiangiogenic activity in C3(l)-TAg mice bearing
established tumors. Administration of IL-12/pulse IL-2 induced
substantial increases in circulating serum concentrations of both
IFN- and TNF- compared with control mice treated with vehicle
alone. Serum IFN- levels were greater than 1200 pg/ml in mice
treated with IL-12/pulse IL-2 vs 4 pg/ml in control mice treated with
vehicle alone (not shown). Serum TNF- levels were 116 pg/ml in mice
treated with IL-12/pulse IL-2 compared with <1 pg/ml in control mice
treated with vehicle alone (not shown).
Because several IFN--inducible genes have been previously associated
with anti-neovascular effects, we investigated the expression of
several of these genes. As assessed by RT-PCR, the IL-12/pulse IL-2
regimen potently up-regulated expression of genes encoding the IFN-
and TNF--inducible, antiangiogenic chemokines IP-10 and MIG within
the local tumor site, while expression of the gene encoding the
proangiogenic mediator, VEGF-B, was unaltered by treatment of mice with
IL-12/pulse IL-2 (Fig. 2). Further,
hematoxylin- and eosin-stained sections of established tumors from mice
treated with IL-12/pulse IL-2 or vehicles alone revealed substantial
differences in vascularity (Fig. 3A).
Although tumors from control mice were highly vascularized, those from
mice treated with IL-12/pulse IL-2 were poorly vascularized and
revealed large areas of focal apoptosis/necrosis. The number of tumors
with associated hypervascular zones was significantly less in mice
treated with IL-12/pulse IL-2 vs control mice treated with vehicle
alone (p = 0.0247; Fig. 3B). Nine of
13 (69%) tumors from control mice had hypervascular zones compared
with only 4 of 17 (23.5%) tumors from mice treated with
IL-12/pulse IL2.
|
|
The ability of IL-12/pulse IL-2 to treat advanced disease as
defined by the existence of multiple mammary tumors at the time of
initiation of therapy was tested in two separate experiments. In the
first experiment we compared the antitumor abilities of IL-2 and IL-12
as single agents with the combination of IL-12 plus IL-2 in a setting
of very advanced disease (Fig. 4). In
this study mice were randomized to therapy at about 20 wk of age when
they were all presenting with multiple tumors and had a mean total
tumor burden of >1200 mm3. These results showed
that the combination of IL-12/pulse IL-2 blocked the progression of
tumors as determined by total tumor burden compared with groups treated
with IL-2, IL-12, or vehicle, such that by day 18 of therapy the mean
total tumor volume in all these groups was significantly greater than
that in mice treated with IL-12/pulse IL-2 (p
< 0.05). In this transgenic model of spontaneous tumor, these results
confirm previous observations in transplantable tumor models (15, 16), which demonstrate enhanced therapeutic efficacy by
IL-12/pulse IL-2 vs IL-2 or IL-12 alone. Based on these results we
performed a second experiment with the goal of confirming the antitumor
effects of IL-12/pulse IL-2 in the setting of advanced, multifocal
disease (Fig. 5) and to investigate the
impact of therapy on neoplastic progression and the development of new
tumors. In this study although IL-12/pulse IL-2 was unable to induce
complete tumor regression, as expected it did effectively inhibit the
growth of tumors compared with control mice treated with vehicle alone
(not shown). At baseline, the mean cumulative tumor volume was 192
mm3 for mice assigned to the control group and
393 mm3 for mice assigned to treatment with
IL-12/pulse IL-2 (p = 0.32, not significant).
At the end of therapy (day 27), the mean cumulative tumor volume in
control mice was 4,658 mm3 (a 24-fold increase
from baseline) compared with 1659 mm3 (a 4-fold
increase from baseline) in mice treated with IL-12/pulse IL-2. The rate
of increase in tumor volume was significantly slower in mice treated
with IL-12/pulse IL-2 than in control mice treated with vehicle alone
(p = 0.0178), and the mean cumulative tumor
volume on day 27 was significantly smaller in mice treated with
IL-12/pulse IL-2 than in control mice (p =
0.034). Of most interest in this study, administration of IL-12/pulse
IL-2 also suppressed the emergence of new sites of tumor involvement,
in contrast to the progressive multifocal mammary carcinoma that
developed in control mice (Fig. 5). At baseline, control mice had a
mean of 2.0 tumors/mouse, compared with a mean of 2.7 tumors/mouse in
mice treated with IL-12/IL-2 (p = 0.51, NS). On
day 27, the mean number of tumors per mouse was 7.8 in control mice (a
3.9-fold (390%) increase from baseline) compared with 4.5 tumors/mouse
in mice treated with IL-12/pulse IL-2 (an 1.7-fold (70%) increase from
baseline). The rate of emergence of new tumors was significantly slower
in mice treated with IL-12/pulse IL-2 than in control mice treated with
vehicle alone (p = 0.00077), and the mean
number of tumors per mouse was significantly less in mice treated with
IL-12/pulse IL-2 than in control mice on day 27
(p = 0.0055). Although the administration of
IL-12/pulse IL-2 effectively limited tumor progression over a period of
4 wk, tumor growth does accelerate within several weeks of cessation of
therapy. This result suggests that the operative tumor mechanisms
induced by IL-12/pulse IL-2 do not result in effective immunologic
memory.
|
|
The ability of IL-12/pulse IL-2 to prevent the emergence of new
tumor in this model suggested that this regimen might delay or prevent
the genetically programmed neoplastic transition and progressive
hyperplasia, atypia, and overt multi focal carcinoma that develop in
the mammary epithelium of female C3(l)-TAg mice (17), a
process associated with loss of p53 function, dysregulation of
endogenous apoptosis, and disruption of normal epithelial cell turnover
(20). Specifically, TAg expression becomes evident in the
mammary gland between 14 and 21 days of age (20, 67).
Early administration of IL-12/pulse IL-2 to juvenile C3(l)-TAg mice,
initiated before the expected development of severe hyperplasia,
atypia, and/or carcinoma, delayed the initial emergence of tumor by up
to 4 wk compared with that in age-matched control mice treated with
vehicle alone (Fig. 6). Further,
hematoxylin- and eosin-stained sections of mammary sites obtained from
mice after the completion of therapy with IL-12/pulse IL-2 revealed
marked attenuation of the expected hyperplasia, atypia, and overt
carcinoma noted in sections from mammary sites of age-matched control
mice treated with vehicle alone (Fig. 7).
Further, the mammary stroma of mice treated with IL-12/pulse IL-2 was
extensively infiltrated with mononuclear cells (Fig. 7, C
and D), in contrast to the characteristic fatty stroma with
infrequent leukocytes observed in sections from control mice treated
with vehicle alone (Fig. 7, A and B).
Administration of IL-12/pulse IL-2 also enhanced the constitutive
expression of Fas and potently induced detectable FasL gene expression
in the mammary sites of treated mice compared with that observed in
control mice treated with vehicle alone (Fig. 8), a finding later also confirmed by
RNase protection assay (data not shown). Of note, similar enhancement
of Fas and FasL gene expression has been observed within established
tumors of mice that have been treated with IL-12/pulse IL-2 vs vehicle
alone (not shown).
|
|
|
Immunohistochemical staining of mammary sites resected from
control transgenic mice revealed a paucity of
CD3+ T cells with no clear preference for
localization to ductal epithelium (Fig. 9, A–C), while in mice
treated with IL-12/pulse IL-2 there were large numbers of infiltrating
CD3-positive T lymphocytes compared with those in control mice, with a
substantial portion of the infiltrating T lymphocyte population
localized at the basement membrane of the mammary epithelium and/or
infiltrating the epithelium itself (Fig. 9, D–F). Large
numbers of T lymphocytes also were observed throughout the stroma of
mice treated with IL-12/pulse IL-2. Further, using a peroxidase-based
end-labeling in situ detection technique, tissue sections of mammary
sites resected from mice immediately after the completion of chronic
therapy with IL-12/pulse IL-2 revealed marked increases in the
proportion of apoptotic cells compared with sites resected from control
mice treated with vehicle alone (not shown). To further delineate the
cell populations undergoing apoptosis within the local mammary site,
sections were obtained from juvenile mice treated with a shorter course
of IL-12/pulse IL-2 (i.e., 3 wk). These sections demonstrate that there
is a substantial increase in cells undergoing apoptosis within the
mammary epithelium itself in mice treated with IL-12/pulse IL-12 (Fig. 10, D–F) vs control mice
(Fig. 10, A–C). To clearly document the nature of the cells
undergoing apoptosis, a detailed electron micrographic analysis of
mammary tumor site resected from control vs IL-12/pulse IL-2-treated
mice was performed. In sections from control mice, characteristic
hyperplastic epithelium is noted in a mammary duct (Fig. 11A), with normal
ultrastructural histology apparent on higher magnification images (Fig. 11B). In sections from mice treated with IL-12/pulse IL-2,
attenuation of the expected hyperplasia is again noted (Fig. 11C). Loss of cell-cell contact, extensive cytoplasmic
vacuolization, as well as cellular degeneration and separation of the
epithelium from underlying basement membrane are readily observed (Fig. 11, C and D). In other sections, ultrastructural
changes consistent with apoptosis, including nuclear condensation and
fragmentation, cytoplasmic vacuolization, and overt cellular
degeneration with apoptotic bodies and cellular ghosts, are noted (Fig. 11, E and F).
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We are actively investigating mechanisms that may account for the
antineoplastic activity of this combination in the autochthonous
mammary carcinoma model used for these studies as well as a
transplantable model of primary and/or metastatic murine renal
carcinoma. These studies support a role for IFN- and/or TNF- in
the antineoplastic activity of IL-12/pulse IL-2. We have shown here
that this regimen induces high circulating serum levels of both IFN-
and TNF-. IL-12 and IL-2 also potently enhance serum IFN- and
TNF- levels and ex vivo IFN- production by activated splenocytes
from mice bearing established renal carcinoma (J. M. Wigginton and
R. H. Wiltrout, unpublished observations). Further, the antitumor
activity of this combination against murine renal carcinoma is
abrogated in mice with targeted disruption of the IFN- gene (J.
M. Wigginton et al., manuscript in preparation). We have shown here
that administration of IL- 12/pulse IL-2 inhibits tumor
neovascularization and potently enhances the expression of the genes
encoding the IFN-- and TNF--inducible, antiangiogenic chemokines
IP-10 and MIG within established mammary tumors. Production of IP-10
and/or MIG by various cell types is very potently enhanced by IFN-
(27, 28) or TNF- alone (29, 30), and the
combination of IFN- and TNF- can synergistically enhance the
production of IP-10 and/or MIG by various cell types
(31, 32, 33). These studies suggest that the ability of
IL-12/pulse IL-2 to enhance IP-10 and MIG gene expression may be
accounted for at least partially by the potent induction of IFN-
and/or TNF- production by this combination. IP-10 and MIG both
possess antiangiogenic activity (34, 35, 36), as does IL-12
(37). IL-12 administration induces IP-10 gene expression
within established murine (38) and human (39)
renal carcinoma, and in a human tumor xenograft immunodeficient host
model, the antiangiogenic activity of IL-12 appears to be accounted for
largely by the induction of IP-10 production by IL-12
(40). In the Renca murine renal carcinoma model, we have
found that administration of IL-12 and pulse IL-2 can additively
enhance ex vivo production of IP-10 protein by activated splenocytes
and induce local expression of the genes encoding IP-10 and MIG within
s.c. tumor implants via an IFN--dependent mechanism (J. M.
Wigginton, D. Taub, J. Farber, P. Strieter, and R. H. Wiltrout,
unpublished observations). Further, concurrent administration of
neutralizing polyclonal antisera directed against IP-10 may partially
attenuate the antitumor activity of IL-12/pulse IL-2 in Renca-bearing
mice. These studies suggest a role for IFN- with or without TNF-
and the chemokines IP-10 and/or MIG in the antitumor activity of
IL-12/pulse IL-2. We propose a model in which administration of
IL-12/pulse IL-2 markedly enhances IFN- and TNF- production,
leading indirectly to induction of IP-10 and/or MIG gene expression,
inhibition of tumor neovascularization, and delay of tumor growth as a
component of the overall antitumor activity of this regimen.
In mice bearing advanced mammary carcinoma with multiple tumors at baseline, we found that IL-12/pulse IL-2 yielded enhanced antitumor effects compared with IL-12 or IL-2 alone, and that treatment with IL-12/pulse IL-2 not only delayed the growth of established tumor, but also prevented the emergence of new tumors at other mammary sites. These findings led us to hypothesize that early administration of this regimen to juvenile C3(l)TAg mice might delay or prevent the progressive hyperplasia, atypia, and carcinoma that occur in this model (17). IL-12 alone has been shown to delay the emergence of tumors induced by exogenous administration of the tumorigenic agent, 3-methylcholanthrene (41). We found that administration of IL-12/pulse IL-2 delayed the emergence of tumor by up to 4 wk compared with age-matched control mice. Further, histologic evaluation of mammary sites resected from mice treated with IL-12/pulse IL-2 revealed marked attenuation of the genetically programmed hyperplasia, atypia, and overt carcinoma noted in sections obtained from age-matched control mice and extensive infiltration of the mammary stroma with mononuclear cells.
Previous studies in this model have demonstrated that a loss of p53 function and endogenous apoptosis occur in conjunction with neoplastic progression (20) in the mammary epithelium. In light of these findings, and the ability of IL-12/pulse IL-2 administration to delay neoplastic transition in juvenile mice, we investigated the impact of this regimen on local expression of genes encoding potential mediators of apoptosis, in particular Fas and FasL. Fas expression has been observed in a range of cell types (42, 43), including nontransformed (44) and preneoplastic (45) mammary epithelial cell lines, and a wide variety of tumors or tumor cell lines (42, 46, 47). FasL expression has been demonstrated in the eye and testis (48, 49) as well as the small intestine, lung, and various lymphoid organs (43). More specifically, FasL gene expression is up-regulated in activated CD8+, but not CD4+ murine splenocytes, and is detected in cytotoxic T cell clones (43) and NK cells (50). The Fas /FasL apoptosis pathway has been implicated in modulation of T cell homeostasis (51, 52) and maintenance of local immune privilege (48, 49), and is a key effector mechanism in the cytolytic activity of T and/or NK cells (50, 53, 54). More recently, increasing attention has focused on the role of this pathway in the interaction between tumors and the host immune system. A loss or reduction in Fas expression is associated with transition of some cells from a normal to a malignant phenotype (44, 55, 56). Further, some tumors express high levels of FasL, and evidence suggests that these tumors may defend themselves via the induction of apoptosis of tumor-infiltrating Fas-positive effector cells (56, 57, 58). In contrast, a number of other studies have shown that cross-linkage of Fas on tumor and/or preneoplastic cell lines with anti-Fas Abs or ligation with soluble FasL may induce apoptosis in vitro (44, 45, 46, 59, 60, 61) and in vivo (60, 61, 62), suggesting that activation of the Fas /FasL pathway and induction of tumor apoptosis could serve a useful role in cancer treatment.
Existing literature suggests that administration of IL-12/pulse IL-2
and secondary induction of IFN- and TNF- production may provide a
unique array of signals leading to activation of the Fas/FasL apoptosis
pathway. As noted above, administration of IL-12/pulse IL-2 potently
enhances circulating serum levels of both IFN- and TNF-. We also
have recently found that IFN- and TNF- rapidly up-regulated the
expression of Fas on the transplantable M6 cell line derived from a
spontaneous mammary tumor from C3(l)TAg-transgenic mice (J. M.
Wigginton et al., unpublished observation). Several previous reports
have shown that IFN- and/or TNF- enhance tumor cell expression of
Fas- and Fas/FasL-mediated tumor cell apoptosis (42, 44, 46). Although neither IFN- nor TNF- directly modulates the
expression of FasL (43), IL-2 induces FasL expression by
murine splenocytes (43) and human T cells
(63), and enhances FasL-mediated cytotoxicity by human
CD8+ T cells (63). In fact, we also
have recently shown that CD8+ T cells from BALB/c
mice up-regulate FasL protein in response to IL-12 and IL-2 (J. M.
Wigginton et al., unpublished observation). Further, IL-12 itself
enhances FasL-mediated cytotoxicity by murine Th1 clones in vitro
(64).
We have found that administration of IL-12/pulse IL-2 not only delayed
neoplastic progression in the mammary epithelium of treated mice, but
also potently up-regulated the production of IFN- and TNF- and
the expression of the genes encoding Fas and FasL within the local
mammary site. Further, a large portion of the mononuclear cells
observed infiltrating the local mammary site in mice treated with
IL-12/pulse IL-2 are CD3+ T cells, and
IL-12/pulse IL-2 treatment induces apoptosis of mammary epithelial
cells as evidenced by in situ end-labeling techniques (ApopTag) as well
as direct examination of the ultrastructural histology of the mammary
epithelium using electron microscopy. More recently, in our
transplantable murine renal carcinoma model (Renca), we have shown that
administration of IL-12/pulse IL-2 enhances local Fas/FasL gene
expression in an IFN--dependent manner within established tumors,
and using FasL mutant GLD mice, that the overall antitumor activity of
this regimen is critically dependent on FasL (J. M. Wigginton and
R. H. Wiltrout, unpublished observations). We propose a model in
which the combination of IL-12 and IL-2 directly and/or indirectly, via
induction of IFN- and TNF- production, enhance local constitutive
expression of Fas on mammary epithelial cells and FasL expression on
infiltrating activated T cells. In this setting we propose that
infiltrating FasL-positive effector cells induce apoptosis of
Fas-bearing target cells in the mammary epithelium and in so doing
reverse the dysregulation of endogenous apoptosis and cell turnover
that occurs in this model and limit neoplastic progression.
Administration of IL-12/pulse IL-2 also up-regulates the expression of
both Fas and FasL within established mammary tumors, although its
potential role in mediating tumor regression in that setting remains to
be defined in future studies. Previous attempts to activate
Fas-mediated apoptosis in vivo using systemic administration of
anti-Fas Abs or soluble FasL have been limited by the occurrence of
severe toxicity (60, 65). In the present studies we have
demonstrated the induction of local Fas/FasL gene expression within
preneoplastic lesions and/or established tumors in vivo, using an
approach that is not only well tolerated, but delays transition of
preneoplastic lesions and induces complete tumor regression in a large
percentage of treated mice. Further, the current studies represent the
first report of successful application of IL-12/pulse IL-2 as a
preventative strategy to limit spontaneous, genetically programmed
neoplastic progression and the use of immunotherapy to induce Fas/FasL
gene expression and enhance apoptosis within preneoplastic tissue.
The potential role of SV40 TAg in these observations remains to be elucidated. Although the kinetics of TAg expression have been established in this transgenic model (17), it is not completely clear whether C3(l)-TAg mice are completely or only partially tolerant to TAg. It does appear that the antitumor effects of IL-12/pulse IL-2 in this model are not dependent on breaking tolerance to SV40 TAg. Our results demonstrate the engagement of nonadaptive immunophysiologic mechanisms that then mediate rapid antitumor effects that occur in conjunction with T cell infiltration, inhibition of neovascularization, and induction of epithelial apoptosis. Previous studies have shown that although specific immunization of mice that carry the SV40 TAg transgene can induce CTL responses against T Ag and delay tumor growth, the ability to do so is highly sensitive to the timing of onset for the expression of the transgene in developing mice (66). More specifically, immunization of mice after the onset of T Ag expression was ineffective in inducing such responses. We have performed several experiments to investigate whether TAg-specific T cells can be detected in mice after treatment with IL-12/pulse IL-2. Specifically, we have challenged spleen and lymph node T cells from control and IL-12/pulse IL-2-treated mice with syngeneic TAg-pulsed dendritic cells or TAg-expressing M6 syngeneic tumor cells in vitro and have been unable to detect TAg-specific proliferative or cytotoxic responses. These results suggest the initial potent tumor regression induced by IL-12/pulse IL-2 is independent of a T cell memory response, but that this inability to generate a TAg-specific adaptive response renders the mice susceptible to the appearance of new tumors because of the constant oncogenic stimulus provided by the continued expression of TAg.
The current investigations provide further evidence of the potent antitumor activity of the IL-12/pulse IL-2 combination and demonstrate successful treatment of established tumor in a setting where the host immune system has been conditioned by the complete process of neoplastic progression and tumorigenesis. The present studies also provide conceptual support for a novel application of immunotherapy, using IL-12/pulse IL-2 to limit neoplastic progression, a process shown here to occur in conjunction with potent local activation of Fas/FasL gene expression, T cell infiltration, and the induction of apoptosis within preneoplastic mammary lesions. These studies suggest that IL-12/pulse IL-2 might be used to therapeutically induce apoptosis in preneoplastic mammary lesions and/or overt carcinoma, and in so doing not only induce regression of established tumor, but also limit or prevent progression of preneoplastic lesions to overt carcinoma. In that autochthonous tumor models may more closely reflect the spontaneous occurrence of malignancies in humans and the complexity of interactions between an evolving tumor and the host immune system, the efficacy of IL-12/pulse IL-2 in this model provides further supportive rationale for investigation of its potential clinical utility in the treatment of human malignancy, studies that are now being initiated.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government. The publisher or recipient acknowledges the right of the U.S. Government to retain a nonexclusive, royalty-free license in and to any copyright covering the article.
3 Address correspondence and reprint requests to Dr. Robert Wiltrout, National Cancer Institute-Frederick Cancer Research and Development Center, Building 560, Room 31-93, Frederick, MD 21702-1201.
4 Abbreviations used in this paper: TAg, large tumor Ag; FasL, Fas ligand; IP-10, IFN-inducible protein 10; MIG, monokine induced by IFN-; VEGF-B, vascular endothelial growth factor B.
Received for publication September 8, 1999. Accepted for publication October 13, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production. J. Immunol. 153:1697.[Abstract]
production by natural killer cell stimulatory factor: characterization of the responder cells and synergy with other inducers. J. Exp. Med. 173:869.
+, TCR-
+ T lymphocytes and NK cells. J. Immunol. 149:3495.[Abstract]
-interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature 315:672.[Medline]
-inducible protein, in murine mesangial cells in culture. Am. J. Pathol. 142:433.[Abstract]
induces cell type and tissue-specific expression of chemoattractant cytokines in vivo. Am. J. Pathol. 142:861.[Abstract]
B site mediate synergistic induction of murine IP-10 gene transcription by IFN- and TNF-. J. Immunol. 154:5235.[Abstract]
-inducible protein-10 (IP-10) chemokine by human neutrophils. Eur. J. Immunol. 27:111.[Medline]
-inducible protein 10 (IP-10), a member of the C-X-C chemokine family, is an inhibitor of angiogenesis. Biochem. Biophys. Res. Commun. 210:51.[Medline]
inducing factor, a novel cytokine, enhances Fas ligand-mediated cytotoxicity of murine T helper 1 cells. Cell. Immunol. 173:230.[Medline]
expression during tumor development. Cancer Res. In
press.This article has been cited by other articles:
|
|
 |
|
  X.-c. Chen, R. Wang, X. Zhao, Y.-q. Wei, M. Hu, Y.-s. Wang, X.-w. Zhang, R. Zhang, L. Zhang, B. Yao, et al. Prophylaxis against carcinogenesis in three kinds of unestablished tumor models via IL12-gene-engineered MSCs Carcinogenesis, December 1, 2006; 27(12): 2434 - 2441. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Nelson and R. Ganss Tumor growth or regression: powered by inflammation J. Leukoc. Biol., October 1, 2006; 80(4): 685 - 690. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Khan, J. A. Hixon, J. K. Stauffer, E. Lincoln, T. C. Back, J. Brenner, S. Lockett, K. Nagashima, D. Powell, and J. M. Wigginton Therapeutic Modulation of Akt Activity and Antitumor Efficacy of Interleukin-12 Against Orthotopic Murine Neuroblastoma J Natl Cancer Inst, February 1, 2006; 98(3): 190 - 202. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Gupta, J. L. Carey, H. Kawakubo, A. Muzikansky, J. E. Green, P. K. Donahoe, D. T. MacLaughlin, and S. Maheswaran Mullerian inhibiting substance suppresses tumor growth in the C3(1)T antigen transgenic mouse mammary carcinoma model PNAS, March 1, 2005; 102(9): 3219 - 3224. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Liu, S. Varghese, and S. D. Rabkin Oncolytic Herpes Simplex Virus Vector Therapy of Breast Cancer in C3(1)/SV40 T-antigen Transgenic Mice Cancer Res., February 15, 2005; 65(4): 1532 - 1540. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Hoshiya, V. Gupta, H. Kawakubo, E. Brachtel, J. L. Carey, L. Sasur, A. Scott, P. K. Donahoe, and S. Maheswaran Mullerian Inhibiting Substance Promotes Interferon {gamma}-induced Gene Expression and Apoptosis in Breast Cancer Cells J. Biol. Chem., December 19, 2003; 278(51): 51703 - 51712. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Gorlick, P. Anderson, I. Andrulis, C. Arndt, G. P. Beardsley, M. Bernstein, J. Bridge, N.-K. Cheung, J. S. Dome, D. Ebb, et al. Biology of Childhood Osteogenic Sarcoma and Potential Targets for Therapeutic Development: Meeting Summary Clin. Cancer Res., November 15, 2003; 9(15): 5442 - 5453. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Greil, G. Anether, K. Johrer, and I. Tinhofer Tracking death dealing by Fas and TRAIL in lymphatic neoplastic disorders: pathways, targets, and therapeutic tools J. Leukoc. Biol., September 1, 2003; 74(3): 311 - 330. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Halin, V. Gafner, M. E. Villani, L. Borsi, A. Berndt, H. Kosmehl, L. Zardi, and D. Neri Synergistic Therapeutic Effects of a Tumor Targeting Antibody Fragment, Fused to Interleukin 12 and to Tumor Necrosis Factor {alpha} Cancer Res., June 15, 2003; 63(12): 3202 - 3210. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. C. Hill, T. F. Conway Jr., M. S. Sabel, Y. S. Jong, E. Mathiowitz, R. B. Bankert, and N. K. Egilmez Cancer Immunotherapy with Interleukin 12 and Granulocyte-Macrophage Colony-stimulating Factor-encapsulated Microspheres: Coinduction of Innate and Adaptive Antitumor Immunity and Cure of Disseminated Disease Cancer Res., December 15, 2002; 62(24): 7254 - 7263. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-W. Park, M. E. Gruys, K. McCormick, J.-K. Lee, J. Subleski, J. M. Wigginton, R. G. Fenton, J.-M. Wang, and R. H. Wiltrout Primary Hepatocytes from Mice Treated with IL-2/IL-12 Produce T Cell Chemoattractant Activity that Is Dependent on Monokine Induced by IFN-{{gamma}} (Mig) and Chemokine Responsive to {{gamma}}-2 (Crg-2) J. Immunol., March 15, 2001; 166(6): 3763 - 3770. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
