|
|
||||||||




*
Beirne B. Carter Center for Immunology Research,
Departments of Microbiology,
Comparative Medicine, and
Biochemistry and Molecular Genetics, University of Virginia School of Medicine, Charlottesville, VA 22908
| Abstract |
|---|
|
|
|---|
90% bound within 5 min. Furthermore, in a
passive viremia monkey model established by continuous steady state
infusion of DEN, injection of HP during the steady state promoted rapid
binding of DEN to the E, followed by subsequent clearance from the
vascular system. Moreover, HP previously infused into the circulation
is capable of efficiently capturing a subsequent challenge dose of DEN
and binding it to E. These data suggest that HP potentially can be
useful for alleviating DEN infection-associated symptoms by reducing
titers of free virus in the vascular system. | Introduction |
|---|
|
|
|---|
Currently, DF/DHF is the most important mosquito-borne viral disease affecting humans; its global distribution is comparable with that of malaria, and an estimated 2.5 billion people are living in areas at risk for epidemic transmission (3, 13, 14, 15, 16, 17). Each year, tens of millions of cases of DF occur along with hundreds of thousands of cases of DHF. The case-fatality rate of DHF in most countries is about 5%: most fatal cases are among children. Furthermore, the southern part of the United States is experiencing increased numbers of DEN infections in recent years, especially in Texas and Florida (18). In 1999, the Texas Department of Health confirmed 51 cases of DF with one fatality due to the DHF (19, 20).
Recent clinical investigations involving a prospective study in Thailand found that increased dengue disease severity correlated with high levels of viremia, secondary DEN infection, and the DEN-2 virus type (21). This study reported that the maximum virus titer increased 9-fold from DF to DHF in DEN-2 infection and another 7-fold from DHF to more severe grade 3 DHF (dengue shock syndrome). Furthermore, the disease severity correlated not only with the maximum titer of virus in the bloodstream, but also with the duration of high titer viremia during disease progression. These data suggest that if DEN infection can be diagnosed rapidly and the viral load subsequently reduced, then it should be possible to alleviate disease severity before an individual develops DHF.
In previous investigations, we have reported that it is possible
to use cross-linked bispecific mAb complexes (heteropolymer(s), HP) to
bind prototype pathogens to primate E and to facilitate the clearance
of these substrates from the circulation in monkey models without E
destruction (22, 23, 24). The HP are composed of a mAb,
specific for the primate E complement receptor 1 (CR1), which is
covalently linked to a second mAb specific for the target pathogen
(22, 25, 26). In this study, we report that HP specific
for the envelope glycoprotein of DEN-2 (anti-CR1 x anti-DEN-2)
can effectively bind this virus to primate E in vitro and can
substantially increase the amount of virus bound to E in the
circulation of cynomolgus monkeys (n = 6) in a passive
model of DEN-2 viremia. After DEN-2 is bound to E via HP, the majority
of the E-bound virus (
90%) is cleared from the circulation in 2
h or less.
| Materials and Methods |
|---|
|
|
|---|
A. albopictus larva cell line C6/36, CV-1, Baby
Chinese hamster kidney fibroblast (BHK-21, clone 13), African green
monkey kidney fibroblast (CV-1), and hybridoma lines 3H5 (IgG1) and 4G2
(IgG2a), specific for DEN-2 (27, 28, 29), were obtained from
American Type Culture Collection (ATCC, Manassas, VA) and maintained
according to the ATCC specification. Anti DEN-2 mAb 9D12 was kindly
provided by Dr. Alan King (U.S. Army Medical Research Institute of
Infectious Diseases) (29). Anti-CR1 mAbs 7G9 (IgG2a),
HB8592 (IgG1), and 9H3 (IgG1) have been previously reported (30, 31), and the irrelevant control mAbs (7B7, anti-
X174,
IgG2a (22); 7C12, anti-C3b, IgG1; 23D1, anti-DNP,
IgG1 (32)) have been described previously. DEN (type 2)
live attenuated virus strain PR-159 (S1), taken directly from Lot 1 of
the vaccine prepared by the Department of Biologics Research, Walter
Reed Army Institute of Research, and dated January 1976
(33), was kindly provided by Dr. J. Strauss (Cal Tech,
Pasadena, CA). The virus was passed twice in C6/36 cells at low
multiplicity of infection of <0.1 PFU/cell and served as the
infectious inoculum for all virion propagation (34). For
generation of large quantities of viruses, 1020
150-cm2 flasks of subconfluent C6/36 cells were
infected at low multiplicity of infection (0.01 PFU/cell), and culture
fluids were harvested following 5 days of incubation at 27°C with two
media changes and one culture dilution. Selected cultures were
radiolabeled by adding [35S]methionine (1
µCi/ml; ICN, Irvine, CA) at 3 days postinfection. Infected culture
fluids were clarified by centrifugation at 3000 x g
for 30 min, and virus was concentrated by precipitation using
polyethylene glycol and additional NaCl.
35S-labeled virions were further purified by
potassium tartarate-glycerol density step gradient centrifugation, and
virus fractions were pelleted by high speed centrifugation
(35). Virus preparations were titered in CV-1 or BHK
monolayers for infectious units, and total viral particles were
measured by competitive RT-PCR (see below), thus allowing determination
of the particle to infectious unit ratio.
Preliminary in vitro binding experiments were performed with the
35S-labeled DEN preparation after it was purified
by gradient centrifugation and titered. We used this reagent because it
allowed for a relatively simple initial screen for mAb binding
(immunoprecipitation with mAb-coupled Sepharose) and for HP-mediated
binding of DEN to E. However, the particle to infectious unit ratio of
the 35S-labeled DEN was higher than the ratio
determined for nonradioactive samples that were simply purified from
culture supernatants by removal of cell debris and precipitation with
polyethylene glycol. In addition, approximately one-third of the
radioactive counts in this preparation could not be immunoprecipitated
by specific mAbs (see below). This fraction may represent denatured
protein or adsorbed radioactive impurities. Therefore, most in vitro
binding assays as well as the passive infusion experiments in monkeys
used a less pure but highly infectious nonradioactive DEN preparation
that was isolated by low speed clarification and concentration by
polyethylene glycol. This preparation had a particle to infectious unit
ratio of
3.
Generation of anti-DEN x anti-CR1 HP
HP were prepared using chemical cross-linking procedures, as
previously reported (23, 36, 37). In all cases, the HP
were purified by FPLC to eliminate high m.w. material. All mAbs and HPs
used are described in Table I
.
|
mAbs 9D12, 3H5, 7B7, and 23D1 were covalently coupled to
cyanogen bromide-activated Sepharose 4B following the manufacturers
instructions (Pharmacia, Piscataway, NJ) The Sepharose-conjugated mAbs
were washed with PBS several times, diluted to a mAb concentration of
100 µg/ml, and mixed with 2.55 x 106
particles of 35S DEN (
5001000 cpm) in a
100-µl vol. Samples were incubated at 37°C for 520 min in the
presence of either 10% plasma or 1% BSA, and supernatants and pellets
were separated by centrifugation at 1000 x g for 5
min. Pellets were washed twice with PBS. Both supernatants and pellets
were assayed for 35S using scintillation
counting.
In vitro binding of DEN to E via HPs
The in vitro HP-mediated binding of DEN to E via HP was studied
using two different protocols. First, E were charged with HP before
exposure to DEN ("franked" (38)). Charging was
performed by adding a 5-fold molar excess of HP to the E (calculated
based on the number of CR1 epitopes per E), followed by a 15-min
incubation and two washes with PBS. Subsequently,
1 x
107 franked E resuspended in homologous plasma
(containing EDTA) were incubated with 25 x
106 particles of DEN in a final volume of 30 µl
for a period of 520 min at 37°C. The sample was then pelleted, and
both the supernatant and cell pellet were examined for DEN particles by
competitive RT-PCR (see below), or in some cases, the amount of
35S in the supernatants was determined by
scintillation counting. In a second pass protocol, the resulting
supernatant was incubated with fresh franked E, and the sample was
processed again. Alternatively, to measure solution phase binding,
1 x 107 E were mixed with 25 x
106 particles of DEN in a final volume of 30 µl
and then 0.2- to 0.5-fold molar ratio of HP to E epitopes was added,
and the samples were similarly processed.
Ex vivo whole blood cell fractionation after DEN binding to cells via HP
Fresh whole blood was obtained from a monkey (
2500 CR1/E, see
below) and after anticoagulation in EDTA, 90 µl were incubated with
3 x 106 particles of DEN and 174 ng of the
7G9 x 9D12 HP to give a HP to E CR1 molar ratio of
1/2. After a
15-min incubation at 37°C, the samples were chilled to 4°C and
overlayed on 400 µl of 60% Percoll (Amersham Pharmacia Biotech,
Piscataway, NJ) in PBS (d = 1.090) and centrifuged for 10
min at 700 x g. Under these conditions (32, 39, 40, 41), more than 99.9% of E were pelleted through the
Percoll, and almost all of the leukocytes were retained at the
interphase. Alternatively, the whole blood sample was simply pelleted
at 1000 x g for 5 min. The whole blood pellet as well
as the isolated leukocyte and E fractions were collected and washed
with PBS, and then RNA was prepared and used for DEN quantitation by
RT-PCR.
Generation of competitor DEN RNA for quantitative RT-PCR
A fragment of 255 nt in the NS5 coding sequence of DEN S1 RNA was amplified using RT-PCR with forward primer 5'-9348GTAGTGGACAAGTTGGTACCT9364-3' and reverse primer 5'-9598CCATGTCATTTAGAGCTGTTAG9577-3' using purified DEN S1 RNA as template and RT-PCR kit (Perkin-Elmer, Foster City, CA), following the manufacturers recommendation. The resulting DNA fragment was cloned into the pCR2.1 vector using TA cloning kit (Strategene, San Diego, CA), and colonies containing DEN inserts were identified (called pCR2.1-DEN). To generate a template for competitor DEN RNA that used the same primer set for RT-PCR, a linker-inserted DEN fragment was generated by cutting pCR2.1-DEN with NheI (nt position 94839488) and inserting 83 bp of XbaI- and SpeI-digested irrelevant DNA sequence. XbaI, SpeI, and NheI generate identical 4 base 5' overhang cohesive ends, but are not cut with any of these enzymes upon ligation. The resulting plasmid contains a 225-bp DEN insert with extra 83 bp of foreign DNA in the middle under the control of bacteriophage T7 RNA promoter. DEN competitor RNA can be transcribed in vitro by T7 RNA polymerase. Runoff RNA transcription was performed in the presence of defined molar amounts of [32P]ATP and ATP to generate 418 nt competitor RNA with 308-bp dengue competitor sequence in the middle. The concentration of competitor RNA was quantitated by DEAE filter-binding assay of 32P incorporation into RNA. The RNA transcript, when examined by denaturing gel electrophoresis, was mostly full-length (over 95%).
Virus particle quantitation by RT-PCR
DEN RNAs were isolated from samples (both in vitro and in vivo) containing DEN particles using RNA-STAT (Tel-Test, Friendswood, TX) solution, followed by ethanol precipitation in the presence of 20 µg carrier tRNA, and resuspended in 2050 µl RNase-free Tris-EDTA buffer. RT-PCR of DEN RNA was performed in the presence of defined amounts of DEN RNA samples (usually 12 µl) and exact copy numbers (50 to 5 x 105 copies) of competitor RNA in the same tube. For each RNA sample, at least three to four RT-PCR were performed in the presence of different amounts of competitor RNAs varying over a 100-fold range. The PCR condition was 95°C for 30 s, 58°C for 45 s, and 72°C for 30 s for 40 cycles, followed by 10-min extension at 72°C. This is an optimized condition for the primer set we used (see above for sequences), and the detection limit for this condition was 25 RNA copies per reaction. Resulting RT-PCR products were separated by agarose gel electrophoresis using an agarose gel containing a mixture of 2% biogel (Bio 101, Vista, CA) and 0.5% LE agarose (FMC Bioproducts, Rockland, ME) to maximize separation between 225 and 308 bp. DNA bands were visualized by ethidium bromide staining, and the ratio between PCR product bands of competitor and viral RNA was examined visually as well as by using a densitometer.
In vivo reduction of passive DEN viremia by HP injection
Experiments were performed in cynomolgus macaques (Macaca
fascicularis) having E CR1 levels (defined by RIA with mAb 7G9) in
the range of 16005000 epitopes per E. E CR1 levels are relatively
stable in healthy humans and nonhuman primates (37, 42, 43), and E CR1 was determined on each monkey within less than 1
mo of the experiment. In most cases, we measured E CR1 levels on
separate blood samples taken from a monkey two or more times over a
period of 4 mo or more, and the value remained constant. All monkeys
were tested for seroconversion when they arrived and were first
quarantined at the University of Virginia animal facility. All monkeys
were seronegative for SIV, seropositive for rhesus CMV, all except Cy-2
were seronegative for simian retroviruses, and all except Cy-6 were
seropositive for monkey herpes B virus. Important details of each
experiment and pertinent information about each animal are listed in
Table II
. On the day of the experiment,
the monkey was anesthetized with ketamine 10 mg/kg i.m., administered
atropine 0.05 mg/kg, and intubated under sodium pentothal i.v. as
needed. Anesthesia was maintained using isoflurane and oxygen. Both
i.v. and intraarterial catheters were placed. Blood pressure, heart
rate, respiratory rate, body temperature, and oxygen saturation were
monitored continuously, and stability was established for at least 15
min before any reagents were infused. Lactated Ringers Solution was
infused i.v. at a rate of 10 ml/kg/h to maintain hydration. A high
titer DEN stock was diluted in saline solution containing 10% monkey
plasma and infused i.v. at a rate of 56 ml/h, and HP was infused at
defined time point(s), as described in Table II
. All infusion
experiments used aliquots (stored frozen at -80°C) of a single DEN
preparation. At designated time points (marked with symbols in each
figure, including two independent samples taken before each experiment
as controls), blood was drawn and placed into tubes (anticoagulated
with a final concentration of 10 mM EDTA) and immediately placed on
ice. At the end of the experiments, all animals were humanely
euthanized under anesthesia. All animal experiments were supervised by
a qualified veterinarian and in accordance with approved protocols by
both the University of Virginia Animal Care and Use Committee and the
Institutional Biosafety Committee.
|
Blood samples were processed by centrifugation at 1000 x
g for 5 min, and the plasma was separated and aliquoted and
used for RNA isolation, as described above. Cell pellets were washed
three times with PBS containing 1 mM EDTA and aliquoted and also used
for RNA isolation. In some experiments (see Fig. 4
A below),
after three washes, the cell pellets were treated with 0.15 M ammonium
chloride to lyse the E, and after centrifugation the supernatants were
collected to obtain virion particles associated with E
(44). All samples were stored at -70°C until
quantitation by competitive RT-PCR. Each time point sample (plasma,
total cells, E) was examined in the presence of at least three
different defined copy numbers of competitor RNA ranging over a range
of 100- to 1000-fold. Each sample was examined (as a set) at least
twice with RT-PCR independently, and two or three independent RNA
isolations followed by quantitative RT-PCR were performed for each time
point sample (both plasma and cells). The lowest copy number of
competitor RNA without addition of viral RNA as the RNA source for
RT-PCR was used as a control to detect potential viral RNA
contamination in each set of RT-PCR. A typical monkey experiment
contains data collected from between 1000 and 1500 RT-PCR.
|
| Results |
|---|
|
|
|---|
We first sought to examine the ability of the anti-DEN mAbs to bind the virus. DEN virion particles were prepared from infected C6/36 cells that were continuously labeled with 35S during the last 2 days of infection. Radiolabeled enriched virion particles free of cell debris were further purified by a tartarate/glycerol step gradient centrifugation followed by high speed centrifugation to precipitate virion particles. Aliquots of fractions isolated from the gradient were titered by plaque assay and RT-PCR, and the active fraction was used to identify DEN.
We used the radiolabeled virions to measure the ability of Sepharose
4B-conjugated anti-DEN mAbs 9D12 and 3H5 to bind to DEN-2. DEN-2 in
35% plasma was incubated with the Sepharose 4B-conjugated mAbs for 5
min and then pelleted at 1000 x g for 5 min. Both
supernatants and pellets were measured for radioactivity to determine
the efficiency of binding of DEN-2 to Sepharose 4B-conjugated
anti-DEN mAbs. As shown in Fig. 1
A, conjugates specific for
DEN showed higher radioactivity in the pellet when compared with
Sepharose 4B alone or an irrelevant mAb (7B7) conjugate. A similar
result was obtained when the experiment was conducted with another
irrelevant mAb (23D1) conjugate (data not shown). However, there was
some nonspecific binding to the Sepharose beads and, in addition, up to
one-third of the total label remained in the supernatant. Additional
incubation with DEN-specific Sepharose-mAb conjugates failed to
increase specific binding. This suggests that up to one-third of the
total counts may not be recognized by the specific anti-DEN mAb,
and such counts may represent either partially denatured DEN particles
(e.g., containing altered epitopes) or perhaps non-DEN radiolabeled
contamination. Despite these uncertainties, the data suggest that both
anti-DEN mAbs can efficiently form immune complexes with DEN
particles sufficient to bind and immunoprecipitate DEN from the
plasma.
|
DEN RNA quantitation by competitive RT-PCR
Although the above data showed that DEN-specific HP potentially can be effective reagents for promoting binding of DEN to E in plasma, the method we used for measuring the efficacy of binding was clearly suboptimal due to nonspecific binding and also probably due to contamination of the DEN by antigenically unrelated material. To overcome this problem, we have developed an RT-PCR-based DEN quantitation method. This method is based on the presence of defined amounts of competitor RNA that use the same primer set for amplification in the same tube with sample RNA. For each given experimental RNA sample, at least three different competitor RNA input concentrations were used in side by side RT-PCR. By comparing the band intensity between competitor and viral origin DNA bands, we can calculate the absolute RNA copy number in the tube within a factor of 2. Our detection limit using this method is 25 RNA copies per RNA sample in RT-PCR.
Binding efficacy of DEN to E via HPs in vitro: determination by RT-PCR
We examined three anti-DEN/CR1 HP for their ability to remove
DEN from the plasma and bind it to E. DEN binding to E was performed
using E from 11 different monkeys (2 rhesus and 9 cynomolgus monkeys)
whose E CR1 epitope levels (defined by mAb 7G9) varied between 1600 and
5000. As described above, nonspecific binding of DEN to E franked with
an irrelevant HP (7G9 x 7B7) or to E alone was 3550% of the
input virus. However, compared with these controls, specific binding of
DEN to E franked with HP in plasma averaged 80% for a single pass
binding experiment, and averaged
90% for a double pass in which the
unbound supernatant was added to fresh HP-franked E (Fig. 2
A). Moreover, when solution
phase binding in plasma was measured, specific binding, after
correction for background, averaged 75% for a single pass and 85% for
a double pass experiment (Fig. 2
B). In all of these
measurements, specific binding is calculated based on the amount of
material removed from the plasma and transferred to E compared with the
baseline values observed for either naive E or E treated with
irrelevant HP.
|
|
We next examined the efficacy of E/HP-dependent clearance of passive DEN viremia in a cynomolgus monkey model system. A passive viremia model was chosen with the following rationale: 1) It is relatively straightforward to establish a steady state viremia by continuous infusion; 2) this paradigm will allow examination of several different DEN-HP/E models. These conditions include the binding to E of preexisting vascular DEN, the interaction of newly introduced DEN in the presence of the HP/E complex, and clearance of the DEN-HP complex from the vascular system. Based on the above in vitro binding data, we chose HP 7G9 x 9D12 for these experiments.
In the first series of experiments, conducted on three cynomolgus
monkeys, DEN was i.v. infused continuously for 4 h at an input of
12 x 109 virion particles/kg/h. Two
hours after initiation of infusion, over 1 min, a bolus of HP (200
µg/kg) was injected into a vein different from that used for DEN.
Throughout the procedure, blood samples were periodically collected and
immediately placed on ice. Competitive RT-PCR was used to measure DEN
particles in the plasma- and blood cell-associated virion particles, as
described in Materials and Methods.
As is demonstrated in Fig. 4
, both
plasma- and cell-associated virion particles remain relatively constant
during the first 2 h of infusion. Based on the rate of infusion of
DEN and the estimated blood volume of the monkeys (
60 ml/kg), only a
fraction (less than
10%) of the infused DEN was recoverable in the
circulation. However, upon injection of a bolus of HP, cell-associated
DEN increases by 5- to 20-fold even though the rate of DEN infusion is
held constant before and after HP injection. Moreover, DEN particles in
the plasma either remain constant or gradually decrease during the
remaining 2 h of DEN infusion. When DEN infusion is terminated,
both plasma DEN and cell-associated DEN decreased. Interestingly, we
find the kinetics of disappearance of DEN from blood samples (both cell
associated and in the plasma) upon termination of DEN infusion varies
substantially between individual monkeys even though the same HP
(7G9 x 9D12) is used at similar concentrations in all three
monkeys. Finally, in one experiment, E-associated DEN was compared with
total cell-associated DEN (see Materials and Methods), and
after HP infusion these values, which represent a substantial increase
in cell-bound DEN, were approximately equal (Fig. 4
A).
We also developed an in vitro protocol in whole blood to confirm that HP-mediated cellular binding was indeed to E (see Materials and Methods). HP and DEN were added to whole blood, and then the amount of cell-bound DEN was determined by RT-PCR. Binding to a complete cell pellet (simple centrifugation) gave 1.1 ± 0.5 x 106 bound DEN particles per 90 µl of whole blood. When the blood was separated into leukocyte and E fractions, the respective cellular binding was 4 ± 2 x 103 bound DEN (leukocytes) and 2 ± 1 x 105 bound DEN (E). Thus, after Percoll separation, more than 99% of the recoverable cellular bound DEN is E associated, and this finding is in agreement with our previous reports that HP principally facilitate binding to E, and not white cells, in whole blood (32, 41). The reduction, after Percoll separation, of net E-bound DEN compared with the whole cell pellet is most likely due to problems associated with processing and recovery of the sample as well as a potential effect of small amounts of residual Percoll on the RT-PCR assay.
Three findings from these experiments are worth noting. First, there is a significant increase of viremia (total DEN particles in the bloodstream) upon injection of HP compared with the level before HP injection. Second, upon injection of HP, the vast majority of circulating DEN particles become associated with blood cells, which are most likely E. The ratio between cell-associated DEN and free DEN upon injection of HP varies between 15 and 50 to 1. These data demonstrate that HP can efficiently promote binding of DEN to E in vivo. Third, the results obtained before HP injection, when recoverable virus is quite low, strongly suggest that the majority of infused DEN is either rapidly cleared from the blood by specific organs or can still be recovered in the bloodstream because it may be at least partially associated with other cell types in the vascular system such as endothelial cells.
In the next series of experiments conducted on three cynomolgus
monkeys, DEN was infused continuously for 1 h at a rate of
24 x 109 virion particles/kg/h. One
hour after termination of DEN infusion, a bolus of HP (200 µg/kg) was
injected. Between 1.5 and 2 h later, a second DEN infusion was
performed for 1 h using the same dose as in the first infusion. As
described above, DEN particles in the plasma and blood cell-associated
DEN particles were determined at regular time intervals throughout the
experiment.
The results of these experiments, illustrated in Fig. 5
, indicate that upon termination of the
first virus infusion after 1 h, both cell-associated and DEN
particles in the plasma decrease substantially. In addition, after HP
injection, there is large increase in cell-associated DEN particles
(approximately a 20-fold increase compared with that before HP
injection), but there is no change, or a slight decrease in
plasma-associated particles. The quantitative changes and the
associated kinetics vary between the monkeys, but the overall trend,
that is, recovery of DEN virus as cell associated upon HP infusion,
followed by a variable rate of clearance, is evident in all three
experiments (Fig. 5
).
|
| Discussion |
|---|
|
|
|---|
Our results indicate that HP have the potential to redirect DEN in the
bloodstream by binding it to E (
Figs. 25![]()
![]()
![]()
). As reported previously
(25, 41, 45), HP-mediated binding of substrates to E
reaches equilibrium within 5 min both in vitro and in vivo, and this is
clearly the case with DEN (Fig. 1
C). In fact there is more
than a 5-fold increase of cell-associated DEN within 5 min of HP
injection (see Figs. 4
and 5
), and under conditions in which DEN was
not continuously infused, within 5 min of HP injection the ratio
between cell-associated and plasma DEN reached a value of over 20 to 1.
That is, at least 95% of virus recoverable in the blood vessel is in
association with cells (most likely E) within 5 min of HP injection
(see Fig. 5
, B and C, at times shortly after
120 min).
Clearance of DEN from the plasma in vitro was also efficient; within 5
min of incubation, when monkey E were used, E franked with HP could
bind
80% of DEN compared with naive E or to E charged with an
irrelevant HP, and solution phase binding was only slightly lower. When
human E were used for in vitro binding under similar conditions, the
efficiency of clearance was lower than that seen with monkey E. This
may be partly due to a lower number of available CR1 epitopes on human
E (
350500/E) when compared with monkey E (
17005000/E). In
fact, when human E are franked with two different HP that recognize
different CR1 epitopes (7G9 and HB8592), the binding efficacy of DEN is
almost as high as that of a double pass experiment with human E franked
with a single HP. The combination of two different HP that bind to
different sites on CR1 (7G9 x 9D12 and HB8592 x 9D12)
should allow for loading of a larger number of HP per E, which would be
expected to increase the net efficiency of binding of DEN to E. This
enhancement of binding was not observed in solution phase studies, but
in these experiments less HP was added per E than in the franking
experiments in which excess HP was used to saturate available CR1
binding sites. Therefore, in the solution phase experiments, the local
concentration of the two different HP on individual CR1 clusters may
not have been sufficiently high to allow for enhanced ligation of
DEN.
In the absence of HP, during passive DEN viremia established by
continuous infusion of DEN, the turnover of circulating DEN was rapid.
Less than 10% of the infused virus can be recovered from blood
samples, based on the amount of virus infused and a presumed blood
volume of 60 ml/kg (Fig. 4
, 30120 min, and Fig. 5
, 3060 min).
Furthermore, upon termination of DEN infusion, there is a rapid
decrease of DEN in the blood sample. These data are consistent with
findings with Langat virus, another member of the flavivirus genus, for
passive viremia in cynomolgus and spider monkeys (46) and
for SIV clearance studies in rhesus monkeys (47). In fact,
passive viremias investigated in mouse models also are manifest by
rapid clearance kinetics (48, 49, 50, 51, 52). Interestingly,
X174
bacteriophage infused into experimental animals is cleared very slowly
from the circulation (36, 53).
During passive viremia, 3075% of DEN particles recovered from blood
samples were associated with cells. These data are consistent with the
in vitro binding studies of DEN to E, as described in
Results. This is different from a previous report using
Langat virus, in which in a spider monkey model
510% of recovered
virus was in association with cell fractions (46).
However, in the present system, we find that upon infusion of HP,
between 95 and 99% of DEN particles are associated with cells in the
blood samples. In addition, infusion of HP led to a large increase in
DEN that could be recovered from the blood sample during continuous DEN
infusion. We found that between 5 and 30 times more DEN particles can
be recovered in the bloodstream after infusion of HP (Table III
), under conditions of constant virus
infusion.
|
The fact that much more DEN was demonstrable in the circulation
after HP infusion, and that putatively cleared virus could be recovered
after HP infusion (Fig. 5
) is particularly interesting. Several reports
suggest that DEN may bind directly to endothelial cells (1, 54, 55, 56, 57, 58), and it is certainly possible that the E-HP complex can
retrieve DEN initially bound to endothelial cells in the vasculature.
Therefore, the specific organs and tissues that take up DEN may be
different in the presence and absence of HP. Based on a substantial
literature, it is certainly reasonable to anticipate that a substantial
fraction of DEN is taken up by the liver and spleen even in the absence
of HP (1, 54). However, the fact that some of the cleared
virus is recoverable upon injection of HP suggests that it is either
deposited in other sites (endothelial cells) or is perhaps handled in a
very different fashion when its clearance is mediated by HP. Based on
our previous studies, it is reasonable to suggest that the
rate-determining step that presumably slows down the clearance of the
E-bound DEN-HP complex is the proteolysis of E CR1 after recognition by
Fc receptors on fixed tissue macrophages (59, 60). After
this step, the complex of DEN, HP, and released CR1 should be
phagocytosed by the macrophages. It is obviously of critical importance
that this phagocytosed material be destroyed when it is taken up by a
macrophage, and that the internalized DEN does not mediate infection.
We intend to test this question in future in vitro and in vivo
studies.
It is also of interest that among individual monkeys, the rate of
HP-mediated clearance of E-bound DEN was dramatically different. For
instance, two monkeys (Figs. 4
C and 5A) showed
extremely rapid clearance of cell-associated DEN-HP when compared with
the other monkeys. This is intriguing because in all six monkeys, the
same HP (7G9 x 9D12) was used. Furthermore, injection of an
additional bolus of HP did not accelerate clearance in the monkey in
the experiment illustrated in Fig. 7C. The nature of this
discrepancy is not clear, but might be related to polymorphisms in FcR
in the monkeys. It should also be possible to investigate this question
by preparing HP with a variety of IgG isotypes
(61, 62, 63, 64, 65).
Many additional questions must be addressed, including the potential impact of secondary infections on HP effectiveness. However, our results suggest that with further development, HP may be effective in decreasing the DEN burden in the vascular system, which could in turn potentially decrease the severity of the disease associated with secondary DEN infection.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Chang S. Hahn, Beirne B. Carter Center for Immunology Research, Box 801386 HS, University of Virginia Health System, Charlottesville, VA 22908. ![]()
3 Abbreviations used in this paper: DF, dengue fever; CR1, complement receptor 1; DEN, dengue virus; DHF, dengue hemorrhagic fever; HP, heteropolymer (mAb complex consisting of an anti-CR1 mAb cross-linked with a pathogen-specific second mAb). ![]()
Received for publication July 7, 2000. Accepted for publication October 11, 2000.
| References |
|---|
|
|
|---|
receptor III on human neutrophils: allelic variants have functionally distinct capacities. J. Clin. Invest. 85:1287.
receptor IIA ligand-binding polymorphism. Clin. Diagn. Lab. Immunol. 1:640.
receptor polymorphisms. Ann. NY Acad. Sci. 815:282.[Medline]
This article has been cited by other articles:
![]() |
K. A. Rogers, L. Jayashankar, F. Scinicariello, and R. Attanasio Nonhuman Primate IgA: Genetic Heterogeneity and Interactions with CD89 J. Immunol., April 1, 2008; 180(7): 4816 - 4824. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Rogers, F. Scinicariello, and R. Attanasio IgG Fc Receptor III Homologues in Nonhuman Primate Species: Genetic Characterization and Ligand Interactions J. Immunol., September 15, 2006; 177(6): 3848 - 3856. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Renard, D. Mezzanzanica, S. Canevari, S. Ferrini, J. Boniver, P. Delvenne, and N. Jacobs Anti-CD3/Anti-Epidermal Growth Factor Receptor-Bispecific Antibody Retargeting of Lymphocytes against Human Neoplastic Keratinocytes in an Autologous Organotypic Culture Model Am. J. Pathol., January 1, 2002; 160(1): 113 - 122. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Lindorfer, A. Nardin, P. L. Foley, M. D. Solga, A. J. Bankovich, E. N. Martin, A. L. Henderson, C. W. Price, E. Gyimesi, C. P. Wozencraft, et al. Targeting of Pseudomonas aeruginosa in the Bloodstream with Bispecific Monoclonal Antibodies J. Immunol., August 15, 2001; 167(4): 2240 - 2249. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |