The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hahn, C. S.
Right arrow Articles by Taylor, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hahn, C. S.
Right arrow Articles by Taylor, R. P.
The Journal of Immunology, 2001, 166: 1057-1065.
Copyright © 2001 by The American Association of Immunologists

Bispecific Monoclonal Antibodies Mediate Binding of Dengue Virus to Erythrocytes in a Monkey Model of Passive Viremia1

Chang S. Hahn2,*,{dagger}, Olivia G. French*, Patricia Foley{ddagger}, Edward N. Martin§ and Ronald P. Taylor*,§

* Beirne B. Carter Center for Immunology Research, {dagger} Departments of Microbiology, {ddagger} Comparative Medicine, and § Biochemistry and Molecular Genetics, University of Virginia School of Medicine, Charlottesville, VA 22908


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Dengue viruses (DEN), causative agents of dengue fever (DF) and more severe dengue hemorrhagic fever (DHF)/dengue shock syndrome, infect over 100 million people every year. Among those infected, up to one-half million people develop DHF, which requires an extensive hospital stay. Recent reports indicate that there is a significant correlation between virus titer in the bloodstream of infected individuals and the severity of the disease, especially the development of DHF. This suggests that if there is a procedure to reduce viremia in infected subjects, then the severity of the disease may be controlled during the critical early stages of the disease before it progresses to DHF. We have generated bispecific mAb complexes (heteropolymer(s), HP), which contain a mAb specific for the DEN envelope glycoprotein cross-linked with a second mAb specific for the primate E complement receptor 1. These HP facilitate rapid binding of DEN to human and monkey E in vitro, with ~90% bound within 5 min. Furthermore, in a passive viremia monkey model established by continuous steady state infusion of DEN, injection of HP during the steady state promoted rapid binding of DEN to the E, followed by subsequent clearance from the vascular system. Moreover, HP previously infused into the circulation is capable of efficiently capturing a subsequent challenge dose of DEN and binding it to E. These data suggest that HP potentially can be useful for alleviating DEN infection-associated symptoms by reducing titers of free virus in the vascular system.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Dengue fever (DF)3 and dengue hemorrhagic fever (DHF) are caused by one of four closely related, but antigenically distinct, dengue virus (DEN) serotypes (DEN-1, DEN-2, DEN-3, and DEN-4) of the genus flavivirus family Flaviviridae (1, 2, 3, 4). Infection with one of these serotypes does not provide lasting cross-protective immunity. In addition, preexisting Ab titers against different DEN serotypes can enhance the severity of the disease during subsequent exposure to different serotypes (5, 6, 7). Dengue is primarily an urban disease of the tropics, and the viruses that cause it are mainly maintained in a cycle that involves humans and mosquito vectors, Aedes aegypti and Aedes albopictus, domestic day-biting mosquitos that prefer to feed on humans (8, 9, 10). Infection with DEN can produce a spectrum of clinical illness, ranging from a nonspecific viral syndrome to severe and fatal hemorrhagic disease. Important risk factors for DHF include the strain and serotype of the virus involved, as well as the age, immune status, and genetic predisposition of the patient (4, 11, 12).

Currently, DF/DHF is the most important mosquito-borne viral disease affecting humans; its global distribution is comparable with that of malaria, and an estimated 2.5 billion people are living in areas at risk for epidemic transmission (3, 13, 14, 15, 16, 17). Each year, tens of millions of cases of DF occur along with hundreds of thousands of cases of DHF. The case-fatality rate of DHF in most countries is about 5%: most fatal cases are among children. Furthermore, the southern part of the United States is experiencing increased numbers of DEN infections in recent years, especially in Texas and Florida (18). In 1999, the Texas Department of Health confirmed 51 cases of DF with one fatality due to the DHF (19, 20).

Recent clinical investigations involving a prospective study in Thailand found that increased dengue disease severity correlated with high levels of viremia, secondary DEN infection, and the DEN-2 virus type (21). This study reported that the maximum virus titer increased 9-fold from DF to DHF in DEN-2 infection and another 7-fold from DHF to more severe grade 3 DHF (dengue shock syndrome). Furthermore, the disease severity correlated not only with the maximum titer of virus in the bloodstream, but also with the duration of high titer viremia during disease progression. These data suggest that if DEN infection can be diagnosed rapidly and the viral load subsequently reduced, then it should be possible to alleviate disease severity before an individual develops DHF.

In previous investigations, we have reported that it is possible to use cross-linked bispecific mAb complexes (heteropolymer(s), HP) to bind prototype pathogens to primate E and to facilitate the clearance of these substrates from the circulation in monkey models without E destruction (22, 23, 24). The HP are composed of a mAb, specific for the primate E complement receptor 1 (CR1), which is covalently linked to a second mAb specific for the target pathogen (22, 25, 26). In this study, we report that HP specific for the envelope glycoprotein of DEN-2 (anti-CR1 x anti-DEN-2) can effectively bind this virus to primate E in vitro and can substantially increase the amount of virus bound to E in the circulation of cynomolgus monkeys (n = 6) in a passive model of DEN-2 viremia. After DEN-2 is bound to E via HP, the majority of the E-bound virus (>=90%) is cleared from the circulation in 2 h or less.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cells, virus, and Abs

A. albopictus larva cell line C6/36, CV-1, Baby Chinese hamster kidney fibroblast (BHK-21, clone 13), African green monkey kidney fibroblast (CV-1), and hybridoma lines 3H5 (IgG1) and 4G2 (IgG2a), specific for DEN-2 (27, 28, 29), were obtained from American Type Culture Collection (ATCC, Manassas, VA) and maintained according to the ATCC specification. Anti DEN-2 mAb 9D12 was kindly provided by Dr. Alan King (U.S. Army Medical Research Institute of Infectious Diseases) (29). Anti-CR1 mAbs 7G9 (IgG2a), HB8592 (IgG1), and 9H3 (IgG1) have been previously reported (30, 31), and the irrelevant control mAbs (7B7, anti-{phi}X174, IgG2a (22); 7C12, anti-C3b, IgG1; 23D1, anti-DNP, IgG1 (32)) have been described previously. DEN (type 2) live attenuated virus strain PR-159 (S1), taken directly from Lot 1 of the vaccine prepared by the Department of Biologics Research, Walter Reed Army Institute of Research, and dated January 1976 (33), was kindly provided by Dr. J. Strauss (Cal Tech, Pasadena, CA). The virus was passed twice in C6/36 cells at low multiplicity of infection of <0.1 PFU/cell and served as the infectious inoculum for all virion propagation (34). For generation of large quantities of viruses, 10–20 150-cm2 flasks of subconfluent C6/36 cells were infected at low multiplicity of infection (0.01 PFU/cell), and culture fluids were harvested following 5 days of incubation at 27°C with two media changes and one culture dilution. Selected cultures were radiolabeled by adding [35S]methionine (1 µCi/ml; ICN, Irvine, CA) at 3 days postinfection. Infected culture fluids were clarified by centrifugation at 3000 x g for 30 min, and virus was concentrated by precipitation using polyethylene glycol and additional NaCl. 35S-labeled virions were further purified by potassium tartarate-glycerol density step gradient centrifugation, and virus fractions were pelleted by high speed centrifugation (35). Virus preparations were titered in CV-1 or BHK monolayers for infectious units, and total viral particles were measured by competitive RT-PCR (see below), thus allowing determination of the particle to infectious unit ratio.

Preliminary in vitro binding experiments were performed with the 35S-labeled DEN preparation after it was purified by gradient centrifugation and titered. We used this reagent because it allowed for a relatively simple initial screen for mAb binding (immunoprecipitation with mAb-coupled Sepharose) and for HP-mediated binding of DEN to E. However, the particle to infectious unit ratio of the 35S-labeled DEN was higher than the ratio determined for nonradioactive samples that were simply purified from culture supernatants by removal of cell debris and precipitation with polyethylene glycol. In addition, approximately one-third of the radioactive counts in this preparation could not be immunoprecipitated by specific mAbs (see below). This fraction may represent denatured protein or adsorbed radioactive impurities. Therefore, most in vitro binding assays as well as the passive infusion experiments in monkeys used a less pure but highly infectious nonradioactive DEN preparation that was isolated by low speed clarification and concentration by polyethylene glycol. This preparation had a particle to infectious unit ratio of ~3.

Generation of anti-DEN x anti-CR1 HP

HP were prepared using chemical cross-linking procedures, as previously reported (23, 36, 37). In all cases, the HP were purified by FPLC to eliminate high m.w. material. All mAbs and HPs used are described in Table IGo.


View this table:
[in this window]
[in a new window]
  		Table I. mAbs and HPs used in this study

 
In vitro binding of DEN to Sepharose 4B-conjugated mAbs

mAbs 9D12, 3H5, 7B7, and 23D1 were covalently coupled to cyanogen bromide-activated Sepharose 4B following the manufacturer’s instructions (Pharmacia, Piscataway, NJ) The Sepharose-conjugated mAbs were washed with PBS several times, diluted to a mAb concentration of 100 µg/ml, and mixed with 2.5–5 x 106 particles of 35S DEN (~500–1000 cpm) in a 100-µl vol. Samples were incubated at 37°C for 5–20 min in the presence of either 10% plasma or 1% BSA, and supernatants and pellets were separated by centrifugation at 1000 x g for 5 min. Pellets were washed twice with PBS. Both supernatants and pellets were assayed for 35S using scintillation counting.

In vitro binding of DEN to E via HPs

The in vitro HP-mediated binding of DEN to E via HP was studied using two different protocols. First, E were charged with HP before exposure to DEN ("franked" (38)). Charging was performed by adding a 5-fold molar excess of HP to the E (calculated based on the number of CR1 epitopes per E), followed by a 15-min incubation and two washes with PBS. Subsequently, ~1 x 107 franked E resuspended in homologous plasma (containing EDTA) were incubated with 2–5 x 106 particles of DEN in a final volume of 30 µl for a period of 5–20 min at 37°C. The sample was then pelleted, and both the supernatant and cell pellet were examined for DEN particles by competitive RT-PCR (see below), or in some cases, the amount of 35S in the supernatants was determined by scintillation counting. In a second pass protocol, the resulting supernatant was incubated with fresh franked E, and the sample was processed again. Alternatively, to measure solution phase binding, ~1 x 107 E were mixed with 2–5 x 106 particles of DEN in a final volume of 30 µl and then 0.2- to 0.5-fold molar ratio of HP to E epitopes was added, and the samples were similarly processed.

Ex vivo whole blood cell fractionation after DEN binding to cells via HP

Fresh whole blood was obtained from a monkey (~2500 CR1/E, see below) and after anticoagulation in EDTA, 90 µl were incubated with 3 x 106 particles of DEN and 174 ng of the 7G9 x 9D12 HP to give a HP to E CR1 molar ratio of ~1/2. After a 15-min incubation at 37°C, the samples were chilled to 4°C and overlayed on 400 µl of 60% Percoll (Amersham Pharmacia Biotech, Piscataway, NJ) in PBS (d = 1.090) and centrifuged for 10 min at 700 x g. Under these conditions (32, 39, 40, 41), more than 99.9% of E were pelleted through the Percoll, and almost all of the leukocytes were retained at the interphase. Alternatively, the whole blood sample was simply pelleted at 1000 x g for 5 min. The whole blood pellet as well as the isolated leukocyte and E fractions were collected and washed with PBS, and then RNA was prepared and used for DEN quantitation by RT-PCR.

Generation of competitor DEN RNA for quantitative RT-PCR

A fragment of 255 nt in the NS5 coding sequence of DEN S1 RNA was amplified using RT-PCR with forward primer 5'-9348GTAGTGGACAAGTTGGTACCT9364-3' and reverse primer 5'-9598CCATGTCATTTAGAGCTGTTAG9577-3' using purified DEN S1 RNA as template and RT-PCR kit (Perkin-Elmer, Foster City, CA), following the manufacturer’s recommendation. The resulting DNA fragment was cloned into the pCR2.1 vector using TA cloning kit (Strategene, San Diego, CA), and colonies containing DEN inserts were identified (called pCR2.1-DEN). To generate a template for competitor DEN RNA that used the same primer set for RT-PCR, a linker-inserted DEN fragment was generated by cutting pCR2.1-DEN with NheI (nt position 9483–9488) and inserting 83 bp of XbaI- and SpeI-digested irrelevant DNA sequence. XbaI, SpeI, and NheI generate identical 4 base 5' overhang cohesive ends, but are not cut with any of these enzymes upon ligation. The resulting plasmid contains a 225-bp DEN insert with extra 83 bp of foreign DNA in the middle under the control of bacteriophage T7 RNA promoter. DEN competitor RNA can be transcribed in vitro by T7 RNA polymerase. Runoff RNA transcription was performed in the presence of defined molar amounts of [32P]ATP and ATP to generate 418 nt competitor RNA with 308-bp dengue competitor sequence in the middle. The concentration of competitor RNA was quantitated by DEAE filter-binding assay of 32P incorporation into RNA. The RNA transcript, when examined by denaturing gel electrophoresis, was mostly full-length (over 95%).

Virus particle quantitation by RT-PCR

DEN RNAs were isolated from samples (both in vitro and in vivo) containing DEN particles using RNA-STAT (Tel-Test, Friendswood, TX) solution, followed by ethanol precipitation in the presence of 20 µg carrier tRNA, and resuspended in 20–50 µl RNase-free Tris-EDTA buffer. RT-PCR of DEN RNA was performed in the presence of defined amounts of DEN RNA samples (usually 1–2 µl) and exact copy numbers (50 to 5 x 105 copies) of competitor RNA in the same tube. For each RNA sample, at least three to four RT-PCR were performed in the presence of different amounts of competitor RNAs varying over a 100-fold range. The PCR condition was 95°C for 30 s, 58°C for 45 s, and 72°C for 30 s for 40 cycles, followed by 10-min extension at 72°C. This is an optimized condition for the primer set we used (see above for sequences), and the detection limit for this condition was 25 RNA copies per reaction. Resulting RT-PCR products were separated by agarose gel electrophoresis using an agarose gel containing a mixture of 2% biogel (Bio 101, Vista, CA) and 0.5% LE agarose (FMC Bioproducts, Rockland, ME) to maximize separation between 225 and 308 bp. DNA bands were visualized by ethidium bromide staining, and the ratio between PCR product bands of competitor and viral RNA was examined visually as well as by using a densitometer.

In vivo reduction of passive DEN viremia by HP injection

Experiments were performed in cynomolgus macaques (Macaca fascicularis) having E CR1 levels (defined by RIA with mAb 7G9) in the range of 1600–5000 epitopes per E. E CR1 levels are relatively stable in healthy humans and nonhuman primates (37, 42, 43), and E CR1 was determined on each monkey within less than 1 mo of the experiment. In most cases, we measured E CR1 levels on separate blood samples taken from a monkey two or more times over a period of 4 mo or more, and the value remained constant. All monkeys were tested for seroconversion when they arrived and were first quarantined at the University of Virginia animal facility. All monkeys were seronegative for SIV, seropositive for rhesus CMV, all except Cy-2 were seronegative for simian retroviruses, and all except Cy-6 were seropositive for monkey herpes B virus. Important details of each experiment and pertinent information about each animal are listed in Table IIGo. On the day of the experiment, the monkey was anesthetized with ketamine 10 mg/kg i.m., administered atropine 0.05 mg/kg, and intubated under sodium pentothal i.v. as needed. Anesthesia was maintained using isoflurane and oxygen. Both i.v. and intraarterial catheters were placed. Blood pressure, heart rate, respiratory rate, body temperature, and oxygen saturation were monitored continuously, and stability was established for at least 15 min before any reagents were infused. Lactated Ringers Solution was infused i.v. at a rate of 10 ml/kg/h to maintain hydration. A high titer DEN stock was diluted in saline solution containing 10% monkey plasma and infused i.v. at a rate of 5–6 ml/h, and HP was infused at defined time point(s), as described in Table IIGo. All infusion experiments used aliquots (stored frozen at -80°C) of a single DEN preparation. At designated time points (marked with symbols in each figure, including two independent samples taken before each experiment as controls), blood was drawn and placed into tubes (anticoagulated with a final concentration of 10 mM EDTA) and immediately placed on ice. At the end of the experiments, all animals were humanely euthanized under anesthesia. All animal experiments were supervised by a qualified veterinarian and in accordance with approved protocols by both the University of Virginia Animal Care and Use Committee and the Institutional Biosafety Committee.


View this table:
[in this window]
[in a new window]
  		Table II. Summary of experimental protocols used for each monkey

 
DEN RNA preparation and quantitation from blood samples

Blood samples were processed by centrifugation at 1000 x g for 5 min, and the plasma was separated and aliquoted and used for RNA isolation, as described above. Cell pellets were washed three times with PBS containing 1 mM EDTA and aliquoted and also used for RNA isolation. In some experiments (see Fig. 4GoA below), after three washes, the cell pellets were treated with 0.15 M ammonium chloride to lyse the E, and after centrifugation the supernatants were collected to obtain virion particles associated with E (44). All samples were stored at -70°C until quantitation by competitive RT-PCR. Each time point sample (plasma, total cells, E) was examined in the presence of at least three different defined copy numbers of competitor RNA ranging over a range of 100- to 1000-fold. Each sample was examined (as a set) at least twice with RT-PCR independently, and two or three independent RNA isolations followed by quantitative RT-PCR were performed for each time point sample (both plasma and cells). The lowest copy number of competitor RNA without addition of viral RNA as the RNA source for RT-PCR was used as a control to detect potential viral RNA contamination in each set of RT-PCR. A typical monkey experiment contains data collected from between 1000 and 1500 RT-PCR.



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 4. Effect of HP infusion on the levels of cell-associated and plasma-associated DEN in three separate monkeys (A–C; Cy-1, Cy-2, and Cy-3, respectively) with DEN passive viremia. DEN was infused continuously for 4 h at a rate of 1–2 x 109 DEN particles/kg/h. Two hours after initiation of infusion, a bolus of HP (~200 µg/kg) was injected. DEN particles in the plasma (B and C) or E-associated (A) and total blood cell-associated (Cell; A–C) DEN particles were determined at regular time intervals (30 min) shown in the figures, as described in Materials and Methods. The horizontal bar denotes the duration of DEN infusion, and the arrow shows HP injection. Time zero represents pre-DEN infusion blood samples that denote the detection limit of each experiment. Each point represents a mean value and SD from at least four independent RT-PCR quantitation reactions from three independent RNA isolations.

 

   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Binding of 35S-labeled DEN to anti-DEN Abs or HPs in vitro

We first sought to examine the ability of the anti-DEN mAbs to bind the virus. DEN virion particles were prepared from infected C6/36 cells that were continuously labeled with 35S during the last 2 days of infection. Radiolabeled enriched virion particles free of cell debris were further purified by a tartarate/glycerol step gradient centrifugation followed by high speed centrifugation to precipitate virion particles. Aliquots of fractions isolated from the gradient were titered by plaque assay and RT-PCR, and the active fraction was used to identify DEN.

We used the radiolabeled virions to measure the ability of Sepharose 4B-conjugated anti-DEN mAbs 9D12 and 3H5 to bind to DEN-2. DEN-2 in 35% plasma was incubated with the Sepharose 4B-conjugated mAbs for 5 min and then pelleted at 1000 x g for 5 min. Both supernatants and pellets were measured for radioactivity to determine the efficiency of binding of DEN-2 to Sepharose 4B-conjugated anti-DEN mAbs. As shown in Fig. 1GoA, conjugates specific for DEN showed higher radioactivity in the pellet when compared with Sepharose 4B alone or an irrelevant mAb (7B7) conjugate. A similar result was obtained when the experiment was conducted with another irrelevant mAb (23D1) conjugate (data not shown). However, there was some nonspecific binding to the Sepharose beads and, in addition, up to one-third of the total label remained in the supernatant. Additional incubation with DEN-specific Sepharose-mAb conjugates failed to increase specific binding. This suggests that up to one-third of the total counts may not be recognized by the specific anti-DEN mAb, and such counts may represent either partially denatured DEN particles (e.g., containing altered epitopes) or perhaps non-DEN radiolabeled contamination. Despite these uncertainties, the data suggest that both anti-DEN mAbs can efficiently form immune complexes with DEN particles sufficient to bind and immunoprecipitate DEN from the plasma.



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 1. Binding of 35S-labeled DEN to DEN-specific mAbs or HP. A, Plasma containing 1000 cpm of partially purified DEN (~5 x 106 particles) was incubated for 5 min with Sepharose 4B conjugated with DEN-specific mAbs (3H5, 9D12), or an irrelevant mAb (7B7), or with naive Sepharose. The samples were pelleted, and then both pellets and supernatants were counted for 35S by scintillation counting. B and C, Binding of 35S-labeled DEN to E via HP. Both franked E with designated HP and solution phase binding (S) were measured. A total of 500 cpm of partially purified DEN (~3 x 106 particles) was incubated with E for 5 min (B) or 5, 10, or 20 min (C). When no E were added, counts of supernatants averaged 410. Mean values and SD are shown.

 
We next examined the ability of E to bind DEN in the plasma via HPs. For these experiments, we either preincubated HP with E (franked; see Materials and Methods) or coincubated HP, E, and DEN together (solution phase) in plasma for 5 min. Due to the E quenching of scintillation counting, we cannot measure radioactive counts accurately in E pellets. As shown in Fig. 1GoB, DEN-specific HP can clear DEN more efficiently from the plasma when compared with E without HP or E charged with an irrelevant HP. When the incubation time was increased to 10 or 20 min, binding did not increase significantly, suggesting that equilibrium is reached within 5 min (Fig. 1GoC).

DEN RNA quantitation by competitive RT-PCR

Although the above data showed that DEN-specific HP potentially can be effective reagents for promoting binding of DEN to E in plasma, the method we used for measuring the efficacy of binding was clearly suboptimal due to nonspecific binding and also probably due to contamination of the DEN by antigenically unrelated material. To overcome this problem, we have developed an RT-PCR-based DEN quantitation method. This method is based on the presence of defined amounts of competitor RNA that use the same primer set for amplification in the same tube with sample RNA. For each given experimental RNA sample, at least three different competitor RNA input concentrations were used in side by side RT-PCR. By comparing the band intensity between competitor and viral origin DNA bands, we can calculate the absolute RNA copy number in the tube within a factor of 2. Our detection limit using this method is 25 RNA copies per RNA sample in RT-PCR.

Binding efficacy of DEN to E via HPs in vitro: determination by RT-PCR

We examined three anti-DEN/CR1 HP for their ability to remove DEN from the plasma and bind it to E. DEN binding to E was performed using E from 11 different monkeys (2 rhesus and 9 cynomolgus monkeys) whose E CR1 epitope levels (defined by mAb 7G9) varied between 1600 and 5000. As described above, nonspecific binding of DEN to E franked with an irrelevant HP (7G9 x 7B7) or to E alone was 35–50% of the input virus. However, compared with these controls, specific binding of DEN to E franked with HP in plasma averaged 80% for a single pass binding experiment, and averaged ~90% for a double pass in which the unbound supernatant was added to fresh HP-franked E (Fig. 2GoA). Moreover, when solution phase binding in plasma was measured, specific binding, after correction for background, averaged 75% for a single pass and 85% for a double pass experiment (Fig. 2GoB). In all of these measurements, specific binding is calculated based on the amount of material removed from the plasma and transferred to E compared with the baseline values observed for either naive E or E treated with irrelevant HP.



View larger version (51K):
[in this window]
[in a new window]
  		FIGURE 2. In vitro DEN clearance from plasma by HP and monkey E. Plasma containing 2.5 x 106 particles of DEN was incubated for 5 min with ~7.5 x 106 E that are either franked with HP (A, Franked) or incubated with ~0.5 of a molar equivalence of HP, based on CR1 epitopes (B, solution phase). Experiments were performed as either single pass (left side bars, 10) or double pass (right side bars, 20), as described in the text. Mean values and SD for a given number of independent experiments (denoted as n on top of each bar) are shown.

 
We performed similar experiments to measure the specific HP-mediated binding of DEN to human E in the presence of plasma (350–500 CR1 epitopes per E). Although there was less binding compared with the results with monkey E (which have more CR1), the data clearly demonstrate that a relatively high level of binding of DEN to human E in plasma, especially with HP 7G9 x 9D12, can be achieved in the presence of HP for both franked and solution phase binding conditions (Fig. 3Go, A and B). In addition, when E were franked with E that recognize two different CR1 epitopes (7G9 x 9D12 and HB8592 x 9D12), a significant increase in specific binding was observed, suggesting that by increasing the number of HP bound per E, binding of DEN may be enhanced (Fig. 3GoA). The in vitro binding studies were conducted in plasma containing EDTA, and thus clearly demonstrate that HP-mediated binding of DEN to E does not require complement activation.



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 3. In vitro DEN binding to human E in plasma promoted by HP. Plasma containing 2.5 x 106 particles of DEN was incubated for 5 min with ~7.5 x 106 E either franked with HP (A, Franked) or incubated with ~0.5 of a molar equivalence of HP, based on CR1 epitopes (B, solution phase). Experiments were performed as either single pass (left side bars, 10) or double pass (right side bars for Franked only, 20), as described in the text. Mean values and SD for a given number of independent experiments (denoted as n on top of each bar) are shown.

 
Clearance of monkey DEN passive viremia by HP infusion

We next examined the efficacy of E/HP-dependent clearance of passive DEN viremia in a cynomolgus monkey model system. A passive viremia model was chosen with the following rationale: 1) It is relatively straightforward to establish a steady state viremia by continuous infusion; 2) this paradigm will allow examination of several different DEN-HP/E models. These conditions include the binding to E of preexisting vascular DEN, the interaction of newly introduced DEN in the presence of the HP/E complex, and clearance of the DEN-HP complex from the vascular system. Based on the above in vitro binding data, we chose HP 7G9 x 9D12 for these experiments.

In the first series of experiments, conducted on three cynomolgus monkeys, DEN was i.v. infused continuously for 4 h at an input of ~1–2 x 109 virion particles/kg/h. Two hours after initiation of infusion, over 1 min, a bolus of HP (200 µg/kg) was injected into a vein different from that used for DEN. Throughout the procedure, blood samples were periodically collected and immediately placed on ice. Competitive RT-PCR was used to measure DEN particles in the plasma- and blood cell-associated virion particles, as described in Materials and Methods.

As is demonstrated in Fig. 4Go, both plasma- and cell-associated virion particles remain relatively constant during the first 2 h of infusion. Based on the rate of infusion of DEN and the estimated blood volume of the monkeys (~60 ml/kg), only a fraction (less than ~10%) of the infused DEN was recoverable in the circulation. However, upon injection of a bolus of HP, cell-associated DEN increases by 5- to 20-fold even though the rate of DEN infusion is held constant before and after HP injection. Moreover, DEN particles in the plasma either remain constant or gradually decrease during the remaining 2 h of DEN infusion. When DEN infusion is terminated, both plasma DEN and cell-associated DEN decreased. Interestingly, we find the kinetics of disappearance of DEN from blood samples (both cell associated and in the plasma) upon termination of DEN infusion varies substantially between individual monkeys even though the same HP (7G9 x 9D12) is used at similar concentrations in all three monkeys. Finally, in one experiment, E-associated DEN was compared with total cell-associated DEN (see Materials and Methods), and after HP infusion these values, which represent a substantial increase in cell-bound DEN, were approximately equal (Fig. 4GoA).

We also developed an in vitro protocol in whole blood to confirm that HP-mediated cellular binding was indeed to E (see Materials and Methods). HP and DEN were added to whole blood, and then the amount of cell-bound DEN was determined by RT-PCR. Binding to a complete cell pellet (simple centrifugation) gave 1.1 ± 0.5 x 106 bound DEN particles per 90 µl of whole blood. When the blood was separated into leukocyte and E fractions, the respective cellular binding was 4 ± 2 x 103 bound DEN (leukocytes) and 2 ± 1 x 105 bound DEN (E). Thus, after Percoll separation, more than 99% of the recoverable cellular bound DEN is E associated, and this finding is in agreement with our previous reports that HP principally facilitate binding to E, and not white cells, in whole blood (32, 41). The reduction, after Percoll separation, of net E-bound DEN compared with the whole cell pellet is most likely due to problems associated with processing and recovery of the sample as well as a potential effect of small amounts of residual Percoll on the RT-PCR assay.

Three findings from these experiments are worth noting. First, there is a significant increase of viremia (total DEN particles in the bloodstream) upon injection of HP compared with the level before HP injection. Second, upon injection of HP, the vast majority of circulating DEN particles become associated with blood cells, which are most likely E. The ratio between cell-associated DEN and free DEN upon injection of HP varies between 15 and 50 to 1. These data demonstrate that HP can efficiently promote binding of DEN to E in vivo. Third, the results obtained before HP injection, when recoverable virus is quite low, strongly suggest that the majority of infused DEN is either rapidly cleared from the blood by specific organs or can still be recovered in the bloodstream because it may be at least partially associated with other cell types in the vascular system such as endothelial cells.

In the next series of experiments conducted on three cynomolgus monkeys, DEN was infused continuously for 1 h at a rate of ~2–4 x 109 virion particles/kg/h. One hour after termination of DEN infusion, a bolus of HP (200 µg/kg) was injected. Between 1.5 and 2 h later, a second DEN infusion was performed for 1 h using the same dose as in the first infusion. As described above, DEN particles in the plasma and blood cell-associated DEN particles were determined at regular time intervals throughout the experiment.

The results of these experiments, illustrated in Fig. 5Go, indicate that upon termination of the first virus infusion after 1 h, both cell-associated and DEN particles in the plasma decrease substantially. In addition, after HP injection, there is large increase in cell-associated DEN particles (approximately a 20-fold increase compared with that before HP injection), but there is no change, or a slight decrease in plasma-associated particles. The quantitative changes and the associated kinetics vary between the monkeys, but the overall trend, that is, recovery of DEN virus as cell associated upon HP infusion, followed by a variable rate of clearance, is evident in all three experiments (Fig. 5Go).



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 5. Effect of HP infusion and the HP-E complex on the levels of cell-associated and plasma-associated DEN in three monkeys (A–C; Cy-4, Cy-5, and Cy-6, respectively) with DEN passive viremia. DEN was infused for 1 h at a rate of 2–4 x 109 DEN particles/kg/h, and 1 h after termination of DEN infusion, a bolus of HP (~200 µg/kg) was injected. Ninety minutes to two hours after HP injection, a second DEN infusion was performed for 1 h using the same dose of DEN. DEN particles in plasma and blood cell-associated (Cell) DEN particles were determined at regular time intervals shown in the figures, as described in Materials and Methods. The horizontal bars denote the duration of DEN infusion, and the arrow shows HP injection. Time zero represents pre-DEN infusion blood samples that denote the detection limit of each experiment. Each point represents a mean value and SD from at least four independent RT-PCR quantitation reactions from three independent RNA isolations. In C, HP was injected one more time (101 µg/kg) at the 325-min mark (see Table IIGo).

 
The second infusion of DEN (initiated between 210 and 240 min) leads up to a 100-fold increase in cell-associated DEN particles. Similar to the first set of experiments, upon termination of this second DEN infusion in the presence of HP, there is a gradual decrease of cell-associated DEN, and the rate of decrease of cell-associated virus varies between the monkeys. However, the decrease in plasma DEN levels is rapid. Injection of a second bolus of HP during this time period did not significantly alter the kinetics of decrease of cell- associated DEN particles (Fig. 5GoC).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Although development of a live attenuated vaccine might be the best approach to controlling DEN epidemics, a number of factors may limit broad applications of a vaccine. These include: 1) protective Abs against all four serotypes must be generated simultaneously so that the vaccine does not serve to introduce a primary mild infection that can be followed by DEN infection with a different serotype, thus promoting a high probability of DHF/dengue shock syndrome; 2) poor understanding of massive T cell and macrophage activation upon secondary infection that can be potentially mimicked by either vaccination or DEN infection after vaccination. This led us to focus on a therapeutic modality which can attenuate viremia by HP injection. There are available mAbs that recognize all four DEN serotypes, and so in principle it may be possible to generate a HP with broad application for treating DEN infections. In this study, we first tested mAbs specific for DEN envelope protein that are, respectively, type specific (3H5), DEN subcomplex specific (9D12), and flavivirus group specific (4G2) (27). For in vivo passive viremia clearance studies, we used HP containing 9D12 because this mAb and the corresponding HP gave the highest level of E binding. In addition, as mAb 9D12 is subcomplex specific, it has the potential for targeting all four DEN types in the circulation.

Our results indicate that HP have the potential to redirect DEN in the bloodstream by binding it to E ( Figs. 2–5GoGoGoGo). As reported previously (25, 41, 45), HP-mediated binding of substrates to E reaches equilibrium within 5 min both in vitro and in vivo, and this is clearly the case with DEN (Fig. 1GoC). In fact there is more than a 5-fold increase of cell-associated DEN within 5 min of HP injection (see Figs. 4Go and 5Go), and under conditions in which DEN was not continuously infused, within 5 min of HP injection the ratio between cell-associated and plasma DEN reached a value of over 20 to 1. That is, at least 95% of virus recoverable in the blood vessel is in association with cells (most likely E) within 5 min of HP injection (see Fig. 5Go, B and C, at times shortly after 120 min).

Clearance of DEN from the plasma in vitro was also efficient; within 5 min of incubation, when monkey E were used, E franked with HP could bind ~80% of DEN compared with naive E or to E charged with an irrelevant HP, and solution phase binding was only slightly lower. When human E were used for in vitro binding under similar conditions, the efficiency of clearance was lower than that seen with monkey E. This may be partly due to a lower number of available CR1 epitopes on human E (~350–500/E) when compared with monkey E (~1700–5000/E). In fact, when human E are franked with two different HP that recognize different CR1 epitopes (7G9 and HB8592), the binding efficacy of DEN is almost as high as that of a double pass experiment with human E franked with a single HP. The combination of two different HP that bind to different sites on CR1 (7G9 x 9D12 and HB8592 x 9D12) should allow for loading of a larger number of HP per E, which would be expected to increase the net efficiency of binding of DEN to E. This enhancement of binding was not observed in solution phase studies, but in these experiments less HP was added per E than in the franking experiments in which excess HP was used to saturate available CR1 binding sites. Therefore, in the solution phase experiments, the local concentration of the two different HP on individual CR1 clusters may not have been sufficiently high to allow for enhanced ligation of DEN.

In the absence of HP, during passive DEN viremia established by continuous infusion of DEN, the turnover of circulating DEN was rapid. Less than 10% of the infused virus can be recovered from blood samples, based on the amount of virus infused and a presumed blood volume of 60 ml/kg (Fig. 4Go, 30–120 min, and Fig. 5Go, 30–60 min). Furthermore, upon termination of DEN infusion, there is a rapid decrease of DEN in the blood sample. These data are consistent with findings with Langat virus, another member of the flavivirus genus, for passive viremia in cynomolgus and spider monkeys (46) and for SIV clearance studies in rhesus monkeys (47). In fact, passive viremias investigated in mouse models also are manifest by rapid clearance kinetics (48, 49, 50, 51, 52). Interestingly, {phi}X174 bacteriophage infused into experimental animals is cleared very slowly from the circulation (36, 53).

During passive viremia, 30–75% of DEN particles recovered from blood samples were associated with cells. These data are consistent with the in vitro binding studies of DEN to E, as described in Results. This is different from a previous report using Langat virus, in which in a spider monkey model ~5–10% of recovered virus was in association with cell fractions (46). However, in the present system, we find that upon infusion of HP, between 95 and 99% of DEN particles are associated with cells in the blood samples. In addition, infusion of HP led to a large increase in DEN that could be recovered from the blood sample during continuous DEN infusion. We found that between 5 and 30 times more DEN particles can be recovered in the bloodstream after infusion of HP (Table IIIGo), under conditions of constant virus infusion.


View this table:
[in this window]
[in a new window]
  		Table III. Total recoverable DEN particles from blood sample before and after HP infusion

 
When virus infusion was terminated after injection of HP, a large fraction of both plasma-associated and cell-bound DEN was cleared from the circulation. Plasma-associated virus appeared to clear faster than cell-bound DEN, but because there is much more cell-associated DEN in the presence of HP (up to 30-fold higher), it is difficult to compare these two fractions directly. In addition, it is likely that plasma-associated DEN continued to reequilibrate and bind to E after DEN infusion was terminated, and this reaction would be manifest in apparently a more rapid clearance of plasma-associated virus. Moreover, as noted above, cell-associated virus was also cleared rapidly in the absence of HP, and the results suggest that the kinetics of clearance of DEN virus bound to E via HP were slower than the clearance of cell-bound DEN in the absence of HP.

The fact that much more DEN was demonstrable in the circulation after HP infusion, and that putatively cleared virus could be recovered after HP infusion (Fig. 5Go) is particularly interesting. Several reports suggest that DEN may bind directly to endothelial cells (1, 54, 55, 56, 57, 58), and it is certainly possible that the E-HP complex can retrieve DEN initially bound to endothelial cells in the vasculature. Therefore, the specific organs and tissues that take up DEN may be different in the presence and absence of HP. Based on a substantial literature, it is certainly reasonable to anticipate that a substantial fraction of DEN is taken up by the liver and spleen even in the absence of HP (1, 54). However, the fact that some of the cleared virus is recoverable upon injection of HP suggests that it is either deposited in other sites (endothelial cells) or is perhaps handled in a very different fashion when its clearance is mediated by HP. Based on our previous studies, it is reasonable to suggest that the rate-determining step that presumably slows down the clearance of the E-bound DEN-HP complex is the proteolysis of E CR1 after recognition by Fc receptors on fixed tissue macrophages (59, 60). After this step, the complex of DEN, HP, and released CR1 should be phagocytosed by the macrophages. It is obviously of critical importance that this phagocytosed material be destroyed when it is taken up by a macrophage, and that the internalized DEN does not mediate infection. We intend to test this question in future in vitro and in vivo studies.

It is also of interest that among individual monkeys, the rate of HP-mediated clearance of E-bound DEN was dramatically different. For instance, two monkeys (Figs. 4GoC and 5A) showed extremely rapid clearance of cell-associated DEN-HP when compared with the other monkeys. This is intriguing because in all six monkeys, the same HP (7G9 x 9D12) was used. Furthermore, injection of an additional bolus of HP did not accelerate clearance in the monkey in the experiment illustrated in Fig. 7C. The nature of this discrepancy is not clear, but might be related to polymorphisms in FcR in the monkeys. It should also be possible to investigate this question by preparing HP with a variety of IgG isotypes (61, 62, 63, 64, 65).

Many additional questions must be addressed, including the potential impact of secondary infections on HP effectiveness. However, our results suggest that with further development, HP may be effective in decreasing the DEN burden in the vascular system, which could in turn potentially decrease the severity of the disease associated with secondary DEN infection.


   Acknowledgments
 
We thank Dr. Margaret A. Lindorfer for generously preparing the HP. We also thank Dr. Alan King and the Office of Research and Technology Applications of the Walter Reed Army Institute of Research for making available to us mAb 9D12 (DAMD 17-96-0123).


   Footnotes
 
1 This work was supported by the Defense Advanced Research Projects Agency, Order MDA972-96-K-0001 under Contract MDA972-96-K-003, and a grant from EluSys Therapeutics. Back

2 Address correspondence and reprint requests to Dr. Chang S. Hahn, Beirne B. Carter Center for Immunology Research, Box 801386 HS, University of Virginia Health System, Charlottesville, VA 22908. Back

3 Abbreviations used in this paper: DF, dengue fever; CR1, complement receptor 1; DEN, dengue virus; DHF, dengue hemorrhagic fever; HP, heteropolymer (mAb complex consisting of an anti-CR1 mAb cross-linked with a pathogen-specific second mAb). Back

Received for publication July 7, 2000. Accepted for publication October 11, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Halstead, S. B.. 1988. Pathogenesis of dengue: challenges to molecular biology. Science 239:476.[Abstract/Free Full Text]
  2. Monath, T. P.. 1994. Dengue: the risk to developed and developing countries. Proc. Natl. Acad. Sci. USA 91:2395.[Abstract/Free Full Text]
  3. Gubler, D. J., G. G. Clark. 1995. Dengue/dengue hemorrhagic fever: the emergence of a global health problem. Emerg. Infect. Dis. 1:55.[Medline]
  4. Gubler, D. J.. 1998. Dengue and dengue hemorrhagic fever. Clin. Microbiol. Rev. 11:480.[Abstract/Free Full Text]
  5. Halstead, S. B., J. S. Chow, N. J. Marchette. 1973. Immunological enhancement of dengue virus replication. Nature (New Biol.) 243:24.[Medline]
  6. Halstead, S. B., E. J. O’Rourke. 1977. Dengue viruses and mononuclear phagocytes. I. Infection enhancement by non-neutralizing antibody. J. Exp. Med. 146:201.[Abstract/Free Full Text]
  7. Halstead, S. B.. 1979. In vivo enhancement of dengue virus infection in rhesus monkeys by passively transferred antibody. J. Infect. Dis. 140:527.[Medline]
  8. Kuno, G.. 1995. Review of the factors modulating dengue transmission. Epidemiol. Rev. 17:321.[Free Full Text]
  9. Knudsen, A. B.. 1995. Global distribution and continuing spread of Aedes albopictus. Parassitologia 37:91.[Medline]
  10. Schwarz, T. F.. 1996. Imported vector- and rodent-borne virus infections: an introduction. Arch. Virol. Suppl. 11:3.[Medline]
  11. Bielefeldt-Ohmann, H.. 1997. Pathogenesis of dengue virus diseases: missing pieces in the jigsaw. Trends Microbiol. 5:409.[Medline]
  12. Kautner, I., M. J. Robinson, U. Kuhnle. 1997. Dengue virus infection: epidemiology, pathogenesis, clinical presentation, diagnosis, and prevention. J. Pediatr. 131:516.[Medline]
  13. Aviles, G., G. Rangeon, V. Vorndam, A. Briones, P. Baroni, D. Enria, M. S. Sabattini. 1999. Dengue reemergence in Argentina. Emerg. Infect. Dis. 5:575.[Medline]
  14. Brandling-Bennett, A. D., F. Penheiro. 1996. Infectious diseases in Latin America and the Caribbean: are they really emerging and increasing?. Emerg. Infect. Dis. 2:59.[Medline]
  15. Dar, L., S. Broor, S. Sengupta, I. Xess, P. Seth. 1999. The first major outbreak of dengue hemorrhagic fever in Delhi, India. Emerg. Infect. Dis. 5:589.[Medline]
  16. Kouri, G., M. G. Guzman, L. Valdes, I. Carbonel, D. del Rosario, S. Vazquez, J. Laferte, J. Delgado, M. V. Cabrera. 1998. Reemergence of dengue in Cuba: a 1997 epidemic in Santiago de Cuba. Emerg. Infect. Dis. 4:89.[Medline]
  17. Lam, S. K.. 1998. Emerging infectious diseases: Southeast Asia. Emerg. Infect. Dis. 4:145.[Medline]
  18. Gill, J., L. M. Stark, G. G. Clark. 2000. Dengue surveillance in Florida, 1997–98. Emerg. Infect. Dis. 6:30.[Medline]
  19. MaBride, D. 1999. Texas Records Dengue Fever Death. Texas Department of Health, Austin.
  20. Archer, W. R. III. 1999. Texas Department of Health—Commissioner’s Commentary. Texas Department of Health, Austin.
  21. Vaughn, D. W., S. Green, S. Kalayanarooj, B. L. Innis, S. Nimmannitya, S. Suntayakorn, T. P. Endy, B. Raengsakulrach, A. L. Rothman, F. A. Ennis, A. Nisalak. 2000. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. J. Infect. Dis. 181:2.[Medline]
  22. Taylor, R. P., W. M. Sutherland, E. N. Martin, P. J. Ferguson, M. L. Reinagel, E. Gilbert, K. Lopez, N. L. Incardona, H. D. Ochs. 1997. Bispecific monoclonal antibody complexes bound to primate erythrocyte complement receptor 1 facilitate virus clearance in a monkey model. J. Immunol. 158:842.[Abstract]
  23. Taylor, R. P., E. N. Martin, M. L. Reinagel, A. Nardin, M. Craig, Q. Choice, R. Schlimgen, S. Greenbaum, N. L. Incardona, H. D. Ochs. 1997. Bispecific monoclonal antibody complexes facilitate erythrocyte binding and liver clearance of a prototype particulate pathogen in a monkey model. J. Immunol. 159:4035.[Abstract]
  24. Reinagel, M. L., M. Gezen, P. J. Ferguson, S. Kuhn, E. N. Martin, R. P. Taylor. 1997. The primate erythrocyte complement receptor (CR1) as a privileged site: binding of immunoglobulin G to erythrocyte CR1 does not target erythrocytes for phagocytosis. Blood 89:1068.[Abstract/Free Full Text]
  25. Taylor, R. P., P. J. Ferguson. 1995. Primate erythrocyte (E) complement receptor (CR1) as an anchor site for bispecific-based therapies to clear pathogens or autoantibodies safely from the circulation. J. Hematother. 4:357.[Medline]
  26. Nardin, A., R. Schlimgen, V. M. Holers, R. P. Taylor. 1999. A prototype pathogen bound ex vivo to human erythrocyte complement receptor 1 via bispecific monoclonal antibody complexes is cleared to the liver in a mouse model. Eur. J. Immunol. 29:1581.[Medline]
  27. Henchal, E. A., J. M. McCown, D. S. Burke, M. C. Seguin, W. E. Brandt. 1985. Epitopic analysis of antigenic determinants on the surface of dengue-2 virions using monoclonal antibodies. Am. J. Trop. Med. Hyg. 34:162.
  28. Henchal, E. A., M. K. Gentry, J. M. McCown, W. E. Brandt. 1982. Dengue virus-specific and flavivirus group determinants identified with monoclonal antibodies by indirect immunofluorescence. Am. J. Trop. Med. Hyg. 31:830.
  29. Gentry, M. K., E. A. Henchal, J. M. McCown, W. E. Brandt, J. M. Dalrymple. 1982. Identification of distinct antigenic determinants on dengue-2 virus using monoclonal antibodies. Am. J. Trop. Med. Hyg. 31:548.
  30. Tausk, F. A., A. McCutchan, P. Spechko, R. D. Schreiber, I. Gigli. 1986. Altered erythrocyte C3b receptor expression, immune complexes, and complement activation in homosexual men in varying risk groups for acquired immune deficiency syndrome. J. Clin. Invest. 78:977.
  31. Ferguson, P. J., C. J. Reist, E. N. Martin, C. Johnson, K. L. Greene, S. Kuhn, J. Niebur, W. Emlen, R. P. Taylor. 1995. Antigen-based heteropolymers: a potential therapy for binding and clearing autoantibodies via erythrocyte CR1. Arthritis Rheum. 38:190.[Medline]
  32. Taylor, R. P., C. J. Reist, W. M. Sutherland, A. Otto, R. H. Labuguen, E. L. Wright. 1992. In vivo binding and clearance of circulating antigen by bispecific heteropolymer-mediated binding to primate erythrocyte complement receptor. J. Immunol. 148:2462.[Abstract]
  33. Eckels, K. H., V. R. Harrison, P. L. Summers, P. K. Russell. 1980. Dengue-2 vaccine: preparation from a small-plaque virus clone. Infect. Immun. 27:175.[Abstract/Free Full Text]
  34. Hahn, Y. S., R. Galler, T. Hunkapiller, J. M. Dalrymple, J. H. Strauss, E. G. Strauss. 1988. Nucleotide sequence of dengue 2 RNA and comparison of the encoded proteins with those of other flaviviruses. Virology 162:167.[Medline]
  35. Rice, C. M., R. Aebersold, D. B. Teplow, J. Pata, J. R. Bell, A. V. Vorndam, D. W. Trent, M. W. Brandriss, J. J. Schlesinger, J. H. Strauss. 1986. Partial N-terminal amino acid sequences of three nonstructural proteins of two flaviviruses. Virology 151:1.[Medline]
  36. Taylor, R. P., A. Nardin, W. M. Sutherland. 1997. Clearance of blood-borne pathogens mediated through bispecific monoclonal antibodies bound to the primate erythrocyte complement receptor. Cancer Immunol. Immunother. 45:152.[Medline]
  37. Craig, M. L., M. L. Reinagel, E. N. Martin, R. Schlimgen, A. Nardin, R. P. Taylor. 1999. Infusion of bispecific monoclonal antibody complexes into monkeys provides immunologic protection against later challenge with a model pathogen. Clin. Immunol. 92:170.[Medline]
  38. Titus, J. A., M. A. Garrido, T. T. Hecht, D. F. Winkler, J. R. Wunderlich, D. M. Segal. 1987. Human T cells targeted with anti-T3 cross-linked to antitumor antibody prevent tumor growth in nude mice. J. Immunol. 138:4018.[Abstract]
  39. Cornacoff, J. B., L. A. Hebert, D. J. Birmingham, F. J. Waxman. 1984. Factors influencing the binding of large immune complexes to the primate erythrocyte CR1 receptor. Clin. Immunol. Immunopathol. 30:255.[Medline]
  40. Edberg, J. C., E. Wright, R. P. Taylor. 1987. Quantitative analyses of the binding of soluble complement-fixing antibody/dsDNA immune complexes to CR1 on human red blood cells. J. Immunol. 139:3739.[Abstract]
  41. Reist, C. J., H. Y. Liang, D. Denny, E. N. Martin, W. M. Scheld, R. P. Taylor. 1994. Cross-linked bispecific monoclonal antibody heteropolymers facilitate the clearance of human IgM from the circulation of squirrel monkeys. Eur. J. Immunol. 24:2018.[Medline]
  42. Ross, G. D., W. J. Yount, M. J. Walport, J. B. Winfield, C. J. Parker, C. R. Fuller, R. P. Taylor, B. L. Myones, P. J. Lachmann. 1985. Disease-associated loss of erythrocyte complement receptors (CR1, C3b receptors) in patients with systemic lupus erythematosus and other diseases involving autoantibodies and/or complement activation. J. Immunol. 135:2005.[Abstract]
  43. Cohen, J. H., H. U. Lutz, J. L. Pennaforte, A. Bouchard, M. D. Kazatchkine. 1992. Peripheral catabolism of CR1 (the C3b receptor, CD35) on erythrocytes from healthy individuals and patients with systemic lupus erythematosus (SLE). Clin. Exp. Immunol. 87:422.[Medline]
  44. Mishell, B. B., S. M. Shiigi. 1980. Selected Methods in Cellular Immunology W. H. Freeman and Company, San Francisco.
  45. Taylor, R. P., F. Pocanic, C. Reist, E. L. Wright. 1991. Complement-opsonized IgG antibody/dsDNA immune complexes bind to CR1 clusters on isolated human erythrocytes. Clin. Immunol. Immunopathol. 61:143.[Medline]
  46. Nathanson, N., B. Harrington. 1967. Experimental infection of monkeys with Langat virus. II. Turnover of circulating virus. Am. J. Epidemiol. 85:494.[Free Full Text]
  47. Zhang, L., P. J. Dailey, T. He, A. Gettie, S. Bonhoeffer, A. S. Perelson, D. D. Ho. 1999. Rapid clearance of simian immunodeficiency virus particles from plasma of rhesus macaques. J. Virol. 73:855.[Abstract/Free Full Text]
  48. Mims, C. A.. 1956. Rift Valley Fever virus in mice. I. General feature of the infection. Br. J. Exp. Pathol. 37:99.[Medline]
  49. Mims, C. A.. 1956. Rift Valley Fever virus in mice. III. Further quantitative features of the infectious process. Br. J. Exp. Pathol. 37:120.[Medline]
  50. Mims, C. A.. 1956. Rift Valley Fever virus in mice. II. Adsorption and multiplication of virus. Br. J. Exp. Pathol. 37:110.[Medline]
  51. Mims, C. A.. 1959. The response of mice to large intravenous injections of ectromelia virus. I. The fate of injected virus. Br. J. Exp. Pathol. 40:533.[Medline]
  52. Brunner, K. T., D. Hurez, R. T. McCluskey, B. Benacerraf. 1960. Blood clearance of P-32 labeled vesicular stomatitis and Newcastle disease viruses by the reticuloendothelial system in mice. J. Immunol. 85:99.
  53. Ochs, H. D., S. Nonoyama, Q. Zhu, M. Farrington, R. J. Wedgwood. 1993. Regulation of antibody responses: the role of complement and adhesion molecules. Clin. Immunol. Immunopathol. 67:S33.[Medline]
  54. Halstead, S. B.. 1989. Antibody, macrophages, dengue virus infection, shock, and hemorrhage: a pathogenetic cascade. Rev. Infect. Dis. 11:S830.
  55. Butthep, P., A. Bunyaratvej, N. Bhamarapravati. 1993. Dengue virus and endothelial cell: a related phenomenon to thrombocytopenia and granulocytopenia in dengue hemorrhagic fever. Southeast Asian J. Trop. Med. Public Health 24:246.
  56. Bunyaratvej, A., P. Butthep, S. Yoksan, N. Bhamarapravati. 1997. Dengue viruses induce cell proliferation and morphological changes of endothelial cells. Southeast Asian J. Trop. Med. Public Health 28:32.[Medline]
  57. Chen, Y., T. Maguire, R. E. Hileman, J. R. Fromm, J. D. Esko, R. J. Linhardt, R. M. Marks. 1997. Dengue virus infectivity depends on envelope protein binding to target cell heparan sulfate. Nat. Med. 3:866.[Medline]
  58. Avirutnan, P., P. Malasit, B. Seliger, S. Bhakdi, M. Husmann. 1998. Dengue virus infection of human endothelial cells leads to chemokine production, complement activation, and apoptosis. J. Immunol. 161:6338.[Abstract/Free Full Text]
  59. Nardin, A., M. A. Lindorfer, R. P. Taylor. 1999. How are immune complexes bound to the primate erythrocyte complement receptor transferred to acceptor phagocytic cells?. Mol. Immunol. 36:827.[Medline]
  60. Reinagel, M. L., R. P. Taylor. 2000. Transfer of immune complexes from erythrocyte CR1 to mouse macrophages. J. Immunol. 164:1977.[Abstract/Free Full Text]
  61. Anderson, C. L., D. H. Ryan, R. J. Looney, P. C. Leary. 1987. Structural polymorphism of the human monocyte 40 kilodalton Fc receptor for IgG. J. Immunol. 138:2254.[Abstract]
  62. Salmon, J. E., J. C. Edberg, R. P. Kimberly. 1990. Fc{gamma} receptor III on human neutrophils: allelic variants have functionally distinct capacities. J. Clin. Invest. 85:1287.
  63. Reilly, A. F., C. F. Norris, S. Surrey, F. J. Bruchak, E. F. Rappaport, E. Schwartz, S. E. McKenzie. 1994. Genetic diversity in human Fc receptor II for immunoglobulin G: Fc{gamma} receptor IIA ligand-binding polymorphism. Clin. Diagn. Lab. Immunol. 1:640.[Abstract/Free Full Text]
  64. Rascu, A., R. Repp, N. A. Westerdaal, J. R. Kalden, J. G. van de Winkel. 1997. Clinical relevance of Fc{gamma} receptor polymorphisms. Ann. NY Acad. Sci. 815:282.[Medline]
  65. Van der Pol, W., J. G. van de Winkel. 1998. IgG receptor polymorphisms: risk factors for disease. Immunogenetics 48:222.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
K. A. Rogers, L. Jayashankar, F. Scinicariello, and R. Attanasio
Nonhuman Primate IgA: Genetic Heterogeneity and Interactions with CD89
J. Immunol., April 1, 2008; 180(7): 4816 - 4824.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. A. Rogers, F. Scinicariello, and R. Attanasio
IgG Fc Receptor III Homologues in Nonhuman Primate Species: Genetic Characterization and Ligand Interactions
J. Immunol., September 15, 2006; 177(6): 3848 - 3856.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
I. Renard, D. Mezzanzanica, S. Canevari, S. Ferrini, J. Boniver, P. Delvenne, and N. Jacobs
Anti-CD3/Anti-Epidermal Growth Factor Receptor-Bispecific Antibody Retargeting of Lymphocytes against Human Neoplastic Keratinocytes in an Autologous Organotypic Culture Model
Am. J. Pathol., January 1, 2002; 160(1): 113 - 122.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. A. Lindorfer, A. Nardin, P. L. Foley, M. D. Solga, A. J. Bankovich, E. N. Martin, A. L. Henderson, C. W. Price, E. Gyimesi, C. P. Wozencraft, et al.
Targeting of Pseudomonas aeruginosa in the Bloodstream with Bispecific Monoclonal Antibodies
J. Immunol., August 15, 2001; 167(4): 2240 - 2249.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hahn, C. S.
Right arrow Articles by Taylor, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hahn, C. S.
Right arrow Articles by Taylor, R. P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS