The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, J.
Right arrow Articles by Paul, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, J.
Right arrow Articles by Paul, W. E.
The Journal of Immunology, 2001, 166: 7276-7281.
Copyright © 2001 by The American Association of Immunologists

Stat6 Is Necessary and Sufficient for IL-4’s Role in Th2 Differentiation and Cell Expansion

Jinfang Zhu, Liying Guo, Cynthia J. Watson, Jane Hu-Li and William E. Paul1

Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-4 plays a critical role in the differentiation of TCR-stimulated naive CD4 T cells to the Th2 phenotype. In response to IL-4, the IL-4R activates a set of phosphotyrosine binding domain-containing proteins, including insulin receptor substrate 1/2, Shc, and IL-4R interacting protein, as well as Stat6. Stat6 has been shown to be required for Th2 differentiation. To determine the roles of the phosphotyrosine binding adaptors in Th2 differentiation, we prepared a retrovirus containing a mutant of the human (h)IL-4R {alpha}-chain, Y497F, which is unable to recruit these adaptors. The mutant hIL-4R{alpha}, as well as the wild-type (WT) hIL-4R{alpha}, was introduced into naive CD4 T cells. Upon hIL-4 stimulation, Y497F worked as well as the WT hIL-4R{alpha} in driving Th2 differentiation, as measured by Gata3 up-regulation and IL-4 production. Furthermore, IL-4-driven cell expansion was also normal in the cells infected with Y497F, although cells infected with Y497F were not capable of phosphorylating insulin receptor substrate 2. These results suggest that the signal pathway mediated by Y497 is dispensable for both IL-4-driven Th2 differentiation and cell expansion. Both WT and Y497F hIL-4R{alpha} lose the ability to drive Th2 differentiation and cell expansion in Stat6-knockout CD4 T cells. A constitutively activated form of Stat6 introduced into CD4 T cells resulted in both Th2 differentiation and enhanced cell expansion. Thus, activated Stat6 is necessary and sufficient to mediate both IL-4-driven Th2 differentiation and cell expansion in CD4 T cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-4 plays a central role in regulating the behavior of hematopoietic cells (1). In T cells, it controls Th2 polarization and acts as a costimulant of cell growth. These functions of IL-4 are achieved through IL-4R-mediated signal transduction followed by specific gene expression (2). Upon IL-4 stimulation, the IL-4R {alpha}-chain (3) and the IL-2R {gamma}-chain (4), which is also shared by cytokine receptors for IL-2, IL-7, IL-9, and IL-15, are heterodimerized. The nonreceptor tyrosine Janus kinases 1 and 3, constitutively associated with IL-4R {alpha}-chain (IL-4R{alpha}) and IL-2R {gamma}-chain, respectively (5, 6, 7), become activated and phosphorylate some or all of the conserved tyrosines of IL-4R{alpha}. These phosphotyrosines and the immediately surrounding amino acids within IL-4R{alpha} provide docking sites for the phosphotyrosine binding-domain (PTBD)2 proteins insulin receptor substrate (IRS)1/2 (8, 9, 10), Shc (11), IL-4R interacting protein (FRIP) (12), and dok (13, 14), as well as for Stat6 (15, 16, 17, 18). Within the intracellular domain of human (h)IL-4R{alpha}, the PTBD adapters interact with the first conserved tyrosine (Y497), and Stat6 interacts with the second, third, and fourth conserved tyrosines (Y575, Y603, and Y631).

Two major IL-4 signaling pathways are mediated by the PTBD proteins and Stat6, respectively (18, 19). After PTBD proteins bind to IL-4R{alpha}, they become tyrosyl phosphorylated and provide further docking sites for other downstream molecules such as p85 of phosphatidylinositol-3-kinase (PI-3K) and Grb2, leading to the activation of PI-3K and, in some instances, of the Ras/mitogen-activated protein kinase cascades, respectively. In the promyeloid cell line 32D, transfection studies have shown that IRS1 and 2 are important in IL-4-mediated cell proliferation and resistance to apoptosis (20, 21, 22). The latter was mediated through the activation of PI-3K.

Stat6 is recruited to the IL-4R complex by binding to any of three phosphotyrosines in IL-4R{alpha}. It becomes tyrosyl phosphorylated at its C terminus through the action of Janus kinase(s) 1 and/or 3. Phosphorylated Stat6 dimerizes, migrates to the nucleus, binds to specific DNA elements, and, together with other transcription factors, activates transcription of some IL-4-induced genes (23, 24, 25, 26, 27).

The differentiation of naive T cells into Th2 cells requires both TCR- and IL-4-mediated signals (28, 29, 30). IL-4 activation of Stat6 has been shown to be a critical step in driving Th2 differentiation (31, 32, 33); the role of IRS2 and other PTBD proteins during Th2 differentiation is unclear. To examine a role for the PTBD proteins in IL-4-mediated Th2 differentiation and IL-4-driven proliferation in CD4 cells, we used a retrovirus (RV) system to introduce h wild-type (WT) and mutant IL-4R{alpha} into CD4 T cells. It was found that Y497, the binding site for PTBD protein, is dispensable for both IL-4-driven Th2 differentiation and for cell expansion. Using Stat6-knockout CD4 T cells, we found that Stat6 is necessary for both of these IL-4-induced functions in CD4 T cells. Moreover, using a RV containing constitutively activated Stat6, it was found that Stat6 is not only necessary but also sufficient for the IL-4 effects in Th2 differentiation and cell expansion.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice and cell culture

Eight- to 12-wk-old BALB/c mice were obtained from Frederick Cancer Research Center (Frederick, MD).

Stat6-/- BALB/c mice were originally obtained from Dr. M. Grusby (Harvard School of Public Health, Boston, MA) (33). Naive CD4+ T cells were prepared as follows: Lymph node cells were depleted of CD8+ cells, B220+ cells, and IAd+ cells by negative selection using FITC-labeled anti-CD8, anti-B220, and anti-IAd (BD PharMingen, San Diego, CA) plus anti-fluorescein-conjugated magnetic beads (PerSeptive Diagnostics, Cambridge, MA). Purified CD4+ T cells were then centrifuged on a discontinuous 50, 60, and 70% Percoll gradient. Cells with a density of >60% were collected and used for priming. The purity of CD4+ T cells was usually ~98%. CD44lowCD62 ligandhigh cells constituted ~90% of the purified CD4 cells. T cell-depleted APCs were prepared by incubating spleen cells with anti-Thy1.2 and rabbit complement (Cedarlane Laboratories, Hornby, Ontario, Canada) at 37°C for 45 min and then irradiated at 3000 rad.

A total of 106 naive CD4+ T cells were cocultured with 107 irradiated T cell-depleted spleen cells in the presence of anti-CD3 (3 µg/ml; 2C11, Harlan Laboratories, Haslett, MI), anti-CD28 (3 µg/ml; Harlan Laboratories), IL-2 (10 U/ml), and different combinations of Abs and cytokines for 4 days (for null Th cell (ThN) conditions, anti-IL-4 (10 µg/ml), anti-IFN-{gamma} (10 µg/ml), and anti-IL-12 (10 µg/ml); for Th1 conditions, anti-IL-4 (11B11; 10 µg/ml) plus IL-12 (10 ng/ml); for Th2 conditions, IL-4 (1000 U/ml), anti-IFN-{gamma} (10 µg/ml), and anti-IL-12 (10 µg/ml)). After incubation in IL-2 for 3 additional days, cells were either analyzed by intracellular staining for IL-4 expression or further primed under various conditions.

Preparation of retroviral constructs

A retroviral vector containing an internal ribosomal entry sequence and humanized green fluorescence protein (GFP) cDNA (GFP-RV), was provided by Dr. K. M. Murphy (Washington University, St. Louis, MO) (34). The plasmid pcDNA3-Stat6VT containing a constitutively activated Stat6 (Stat6VT) was provided by Dr. U. Schindler (Tularik, South San Francisco, CA) (35). The IL-4R{alpha} mutant, Y497F, has been described previously (20). The XhoI fragment of WT or mutant IL-4R{alpha} was cut from pEPS vector, cloned into the XhoI site of GFP-RV, and the orientation was verified. The Stat6VT was cut from pcDNA3-Stat6VT by partial digestion with XhoI and BamHI and cloned into GFP-RV between the BglII and XhoI sites.

Preparation of RVs and infection

The Phoenix-Eco packaging cell line (kindly provided by Dr. G. Nolan, Stanford University, Stanford, CA) was transfected using FuGENE 6 transfection reagent (Roche Diagnostic Systems, Somerville, NJ) according to the manufacturer’s protocol. Purified naive CD4 T cells (5 x 105) were activated with anti-CD3 and APCs under ThN conditions in 5 ml of medium as described above. At 40 h, 4 ml of supernatant was removed, and 2 ml of virus-containing supernatant and polybrene (Sigma, St. Louis, MO) at 5 µg/ml was added. The mixture was centrifuged at 2500 rpm for 45 min at room temperature and incubated at 37°C for 24 h, after which 5 ml of fresh ThN medium was added. Cells were washed and cultured in IL-2 (10 U/ml) medium 3 days later for 3 additional days and then restimulated under various conditions. For some experiments, GFP-positive cells were sorted after restimulation.

Flow cytometry analysis and intracellular staining

The percentage of GFP-positive cells was determined at various times after infection. Cells were cultured with plate-bound anti-CD3 and anti-CD28 for 6 h in the presence of monensin (2 µM) during last 4 h. Harvested samples were fixed with 4% formaldehyde, washed, and permeabilized in 0.5% saponin-1% BSA in PBS before staining with anti-IL-4-PE or anti-IL-4-APC. Samples were analyzed on a FACScan (BD Biosciences, San Jose, CA).

Semiquantitative RT-PCR

After infection and further priming, CD4 T cells expressing GFP were sorted by FACS. Total RNA was isolated using TRIzol (Life Technologies, Rockville, MD), and first strand cDNAs were made using the SuperScript preamplification system (Life Technologies) according to the manufacturer’s protocol. Semiquantitative PCR was conducted in a GeneAmp PCR system 9700 (Perkin-Elmer, Norwalk, CT) using Platinum PCR SuperMix (Life Technologies) by a serial dilution of the cDNA templates. The primers for Gata3 were (from 5' to 3') CTGACTATGAAGAAAGAAGGCATCCAG and AAGTAGAAGGGGTCGGAGGAACTCT. The primers for {beta}-actin were (from 5' to 3') GATGACGATATCGCTGCGCTG and TACGACCAGAGGCATACAGG.

Immunoprecipitation and Western blotting

Cytokine-treated cells (107/sample) were harvested and lysed with 1 ml lysis buffer (50 mM HEPES (pH 7.0), 0.5% Nonidet P-40, 5 mM EDTA, 50 mM NaCl, 10 mM sodium pyrophosphate, and 50 mM NaF) freshly supplemented with inhibitors (1 mM sodium orthovanadate, 1 mM PMSF, and 10 µg/ml aprotinin, leupeptin, and pepstatin) on ice for 20 min. After centrifugation at 12,000 rpm for 15 min, supernatants were incubated with 2–3 µg Ab for 1 h on ice and precipitated with protein G-agarose (Pierce, Rockford, IL) at 4°C overnight on a rocker. The complexes were then washed three times with lysis buffer and eluted with 2x SDS-PAGE loading buffer. The eluted samples were separated into 8% premade acrylamide gels (NOVEX, San Diego, CA) and transferred onto Immobilon-P membranes (Millipore, Bedford, MA). Membranes were then probed with specific Abs followed by HRP-labeled secondary Abs (Amersham, Arlington Heights, IL) and visualized with SuperSignal West Dura Extended Duration Substrate (Pierce). For some experiments, the probed membranes were stripped with stripping buffer (2% SDS, 62.5 mM Tris-HCl (pH 6.8), 100 mM 2-ME) at 60°C for 30 min and then reprobed with a second Ab. Anti-Stat6 was purchased from R&D Systems (Minneapolis, MN); anti-phosphorylated tyrosine (4G10) and anti-IRS2 were obtained from Upstate Biotechnology(Lake Placid, NY).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Y497 is dispensable for Th2 differentiation

Within the intracellular domain of the hIL-4R {alpha}-chain (hIL-4R{alpha}), Y497 recruits PTBD-containing adaptors, such as IRS1/2 (20), Shc (11), and FRIP (12), when it is phosphorylated as a result of IL-4 stimulation. The Y497F mutant of IL-4R{alpha} was previously shown to be unable to mediate phosphorylation of IRS1/2, Shc, and FRIP but was still capable of activating Stat6 (20). Thus, we used this mutant to study the roles of the PTBD-containing adaptors in Th2 differentiation.

BALB/c naive CD4 T cells were purified and activated in the presence of T cell-depleted APCs with anti-CD3, anti-CD28, IL-2, anti-IL-4, anti-IFN-{gamma}, and anti-IL-12 (ThN conditions) for 40 h. The activated cells were then infected with RVs containing either WT hIL-4R{alpha} or Y497F or with the empty vector as a control. Cells were maintained under ThN conditions for 3 additional days and then washed and placed in IL-2 medium for 3 days. The percentage of GFP-positive cells was checked by FACS. The infected cells were then split into three populations and further primed under ThN, Th2, or ThN plus hIL-4 (10 ng/ml) conditions for 4 days. The percentage of IL-4-producing cells was measured by intracellular staining after an additional 3-day culture in IL-2. Under the ThN conditions, the GFP-positive and GFP-negative cells from each of the infected groups made little IL-4 (1.1–4.9%; Fig. 1Go). Under Th2 conditions, the GFP-positive and GFP-negative cells from each of the infected groups developed IL-4-producing capacity to a similar degree and had indistinguishable percentages of IL-4 producers (13.6 vs 14.2%, 14.3 vs 14.5%, and 19.4 vs 18.8%). Under the ThN plus hIL-4 condition, 23.8% of the GFP-positive cells expressing WT hIL-4R{alpha} were capable of making IL-4, whereas only 2.9% of GFP-negative cells from the same culture could produce IL-4. Interestingly, 23.7% of the GFP cells from the group infected with theY497F RV could produce IL-4, a percentage that was essentially the same as those that had been infected with the WT receptor RV. GFP-positive cells from the group infected with empty vector developed very few (1.9%) IL-4 producers. The results indicate that Y497 is not required for IL-4 stimulation of CD4 T cells to become IL-4 producers.



View larger version (65K):
[in this window]
[in a new window]
 
FIGURE 1. Y497 is dispensable for IL-4-mediated development of IL-4-producing capacity. BALB/c naive CD4 T cells were purified and activated in the presence of T cell-depleted APCs with anti-CD3, anti-CD28, IL-2, anti-IL-4, anti-IFN-{gamma}, and anti-IL-12 (ThN conditions) for 40 h. The activated cells were then infected with RVs containing either WT hIL-4R{alpha} or Y497F or with the empty vector as a control. Cells were maintained under ThN conditions for 3 additional days and then washed and placed in IL-2 medium for 3 days. The infected cells were then split into three populations and further primed under ThN, Th2, or ThN plus hIL-4 (10 ng/ml) conditions for 4 days. The percentage of GFP+ and GFP- IL-4-producing CD4 cells was measured by intracellular staining after 3 additional days of culture in IL-2.

 
Because Gata3 is a key transcription factor in the Th2 differentiation of CD4 T cells (36), and infection with a Gata3 RV has been reported to replace the need for IL-4 in Th2 differentiation (37), we checked the expression level of Gata3 in our primed cells. The GFP-positive cells from the groups infected with either WT or Y497F RVs that had been stimulated under ThN plus hIL-4 conditions were purified by cell sorting. The expression levels of Gata3, measured by RT-PCR, were the same in the groups expressing the WT and the Y497F hIL-4R {alpha}-chain (Fig. 2Go). They were similar to expression levels in conventionally primed Th2 cells and ~10-fold higher than expression levels in conventionally primed ThN cells.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 2. Y497 is dispensable for IL-4-mediated induction of Gata3 expression. The GFP+ cells that developed as a result of ThN plus hIL-4-priming of cells from the groups infected with either WT or Y497F RVs (as shown in the right panels of Fig. 1Go) were purified by cell sorting. The expression levels of Gata3 and {beta}-actin were measured by semiquantitative RT-PCR. Conventionally primed ThN and Th2 cells were used as negative and positive controls.

 
These results strongly support the conclusions that Y497 of hIL-4R{alpha} is dispensable for IL-4-mediated Th2 differentiation.

Y497 is dispensable for IL-4-mediated cell expansion

Cells being primed under Th2 conditions expand to a greater degree than those stimulated under ThN or Th1 conditions, and the addition of IL-4 to cultures of naive CD4 T cells stimulated with anti-CD3, anti-CD28, and IL-2 markedly enhances cell yield (38). By infecting naive CD4 T cells with hIL-4R{alpha} RV, we could compare the relative IL-4-mediated expansion of GFP-positive and GFP-negative cells. Relative GFP+/GFP- expansion was defined as (percentage of GFP+ cells after priming) x (percentage of GFP- cells after infection)/(percentage of GFP+ cells after infection)/(percentage of GFP- cells after priming). Under Th2 priming conditions, both GFP+ and GFP- cells from the groups infected with any of the vectors expanded equally, resulting in relative expansions of 1.1–1.3 (Fig. 3Go). This would be anticipated because all the cells can respond to the mouse IL-4 that is present. Under ThN plus hIL-4 or Th1 plus hIL-4 conditions, the GFP+ cells from the culture infected with the empty vector lacking hIL-4R could not respond to hIL-4. Thus, the percentage of GFP+ cells remained the same after priming. However, under ThN plus hIL-4 or Th1 plus hIL-4 conditions, the GFP+ cells from the culture infected with WT hIL-4R{alpha} grew much better than the GFP- cells in the same culture. The relative expansions were 4.0 and 4.7, respectively, in experiment 1 and 4.2 and 4.5 in experiment 2. Interestingly, the similar results were observed in the cells infected with Y497F hIL-4R{alpha} mutant. The relative expansion in the ThN plus hIL-4 and the Th1 plus hIL-4 stimulated cells were 3.9 and 5.7, respectively, in experiment 1 and 4.5 and 5.0 in experiment 2. Thus, Y497 was not only dispensable for Th2 differentiation, it was also not essential for IL-4-induced T cell expansion.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 3. Y497 is dispensable for IL-4-mediated CD4 T cell expansion. BALB/c naive CD4 T cells were activated in the presence of T cell-depleted APCs and infected with RVs containing either WT hIL-4R{alpha} or Y497F or with the empty vector as in Fig. 1Go. The infected cells were then split into three populations and further primed under ThN, Th1, and Th2 conditions in the presence of hIL-4 for an additional one or two rounds. The percentage of GFP+ cells was checked by FACS after priming and a 3-day culture in IL-2. The relative GFP+/GFP- expansion was defined as (percentage of GFP+ cells after priming) x (percentage of GFP- cells after infection)/(percentage of GFP+ cells after infection)/(percentage of GFP- cells after priming). The results from two independent experiments for one round of priming and one experiment for two rounds of priming are shown.

 
Y497 is important for IRS2 phosphorylation in CD4 T cells

IRS2 phosphorylation can be dramatically induced by IL-4 in either naive or activated CD4 T cells (39). Although it has been shown that IL-4-induced IRS1/2 phosphorylation was greatly diminished in the promyeloid cell line 32D-IRS1 transfected with Y497F compared with those transfected with WT IL-4R{alpha} (20), we wished to determine whether that is also the case in CD4 T cells. GFP+ cells were purified, by cell sorting, from CD4 T cell populations infected with either WT IL-4R{alpha} RV or the Y497F RV. To obtain sufficient cells for analysis and to increase expression of IRS2 in these cells, the sorted cells were subjected to two further rounds of priming under Th2 conditions. Upon mouse IL-4 stimulation, IRS2 and Stat6 were well phosphorylated in both cell populations (Fig. 4Go). In the cells expressing WT hIL-4R{alpha}, IRS2 and Stat6 became phosphorylated upon hIL-4 stimulation. However, in cells expressing the Y497F mutant, although Stat6 phosphorylation remained normal, IRS2 phosphorylation was greatly diminished in response to hIL-4. Because cells expressing the mutant hIL-4R {alpha}-chain, Y497F, showed normal IL-4-mediated Th2 differentiation and cell expansion, the activation of IRS2 appears not to be required for mediating either of these two IL-4 functions in CD4 T cells.



View larger version (65K):
[in this window]
[in a new window]
 
FIGURE 4. Y497 is important for IL-4-mediated IRS2 phosphorylation in CD4 T cells. GFP+ cells were purified by cell sorting from populations of CD4 T cells that had been infected with either the WT IL-4R{alpha} or the Y497F mutant RV. They were further primed under Th2 conditions for two additional rounds. Cells were washed, cultured in serum-free medium for 4 h, and then stimulated with mouse IL-4, hIL-4, or nothing for 20 min. Cell lysates were immunoprecipitated with either anti-IRS2 or anti-Stat6. SDS-PAGE was performed and immunobotting with anti-phosphorylated tyrosine (4G10) or anti-IRS2 was conducted. The blot was stripped and reprobed with anti-Stat6.

 
Stat6 is required for both IL-4-driven Th2 differentiation and cell expansion

It has been shown that Stat6 is crucial for Th2 differentiation (31, 32, 33), but its function in IL-4-driven T cell proliferation is not clear. We infected CD4 T cells from Stat6-knockout mice with the hIL-4R{alpha}, the Y497F, and "empty" RVs and measured relative expansion. Under ThN conditions with added hIL-4, the relative expansions were 0.9–1.3 (Fig. 5Go). In the same experiments, the relative expansions taken from BALB/c cells infected with hIL-4R{alpha} were 4.4 and 3.8. The Stat6-/- cells also underwent little or no differentiation to IL-4-producing cells (data not shown). Thus, Stat6 is required for both IL-4-driven Th2 differentiation and for CD4 T cell expansion.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 5. Stat6 is required for IL-4-mediated CD4 T cell expansion. Stat6-/- or BALB/c naive CD4 T cells were activated in the presence of T cell-depleted APCs and infected with RVs containing either WT hIL-4R{alpha} or Y497F or with the empty vector as in Fig. 1Go. The infected cells were then stimulated for 4 additional days under ThN conditions in the presence of hIL-4. The percentage of GFP+ cells was measured by FACS after 3 days of culture in IL-2. The results of two independent experiments are shown.

 
Stat6 activation is sufficient for anti-CD3-stimulated Th2 differentiation and cell expansion

Recently, a constitutively active Stat6 mutant (Stat6VT) has been derived (35). We used this mutant to test whether Stat6 activation is sufficient in combination with anti-CD3/anti-CD28 to drive Th2 differentiation and cell expansion. After cloning this mutant into our retroviral vector, we infected anti-CD3/anti-CD28-activated T cells with WT hIL-4R{alpha} RV, Stat6VT RV, or empty vector RV. After infection, the cells infected with IL-4R{alpha} RV were primed under ThN conditions with hIL-4; cells infected with empty vector RV and Stat6VT RV were primed under ThN conditions in the absence of hIL-4. As shown in Fig. 6Go, in two independent experiments, the GFP- and GFP+ cells infected with empty vector RV made little IL-4 (0.9 and 0.4% and 0.2 and 0.2%). The GFP- and GFP+ cells from cultures infected with hIL-4R{alpha} RV had very different percentages of IL-4-producing cells (1.4 vs 11.4% and 0.6 vs 24.5%). The cells infected with Stat6VT RV and primed in the absence of IL-4 showed a similar pattern. In the two experiments presented, 1.4 and 0.1% of the GFP- cells produced IL-4 compared with 16.2 and 28.7% of the GFP+ cells. All the cells cultured under Th2 conditions with mouse IL-4 developed a substantial proportion of IL-4-producing cells (data not shown).



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 6. Stat6 activation is sufficient for anti-CD3-stimulated Th2 differentiation. BALB/c naive CD4 T cells were purified and activated in the presence of T cell-depleted APCs and infected with RVs containing either WT hIL-4R{alpha} or Stat6-VT or with the empty vector as in Fig. 1Go. The infected cells were then further primed under ThN conditions (vector and Stat6-VT groups) or ThN plus hIL-4 conditions (hIL-4R{alpha} group) for 4 days. The percentage of IL-4 producers was measured by intracellular staining after 3 additional days of culture in IL-2. The results of two independent experiments are shown (A and B).

 
Furthermore, cells expressing Stat6VT showed an IL-4-independent relative expansion similar to the IL-4-dependent relative expansion of those expressing hIL-4R{alpha} (5.5- and 4.1-fold, respectively; similar results were obtained in a second experiment in which we observed 5.1- and 4.4-fold relative expansion) (Fig. 7Go). These results strongly support the conclusion that Stat6 is not only necessary but also sufficient to drive IL-4-mediated Th2 differentiation and cell expansion in naive CD4 T cells.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 7. Stat6 activation is sufficient for IL-4-driven CD4 T cell expansion. BALB/c naive CD4 T cells were purified and activated in the presence of T cell-depleted APCs and infected with RVs containing either WT hIL-4R{alpha} or Stat6-VT or with the empty vector as in Fig. 1Go. The infected cells were then further primed under ThN conditions (vector and Stat6-VT groups) or ThN plus hIL-4 conditions (hIL-4R{alpha} group) for 4 days. The percentage of GFP+ cells was measured by FACS after an additional 3 days of culture in IL-2 medium. The results of two independent experiments are shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prior transfection studies in the promyeloid cell line 32D indicated a major role for the first conserved tyrosine in the cytosolic domain of the IL-4R {alpha}-chain (Y497) in IL-4-mediated cell proliferation and survival (20, 21, 22). This tyrosine is in a docking site for PTBD proteins; 32D cells lack IRS1 and IRS2, two of the major PTBD proteins that normally interact with the Y497 site. Mouse IL-4 fails to stimulate the growth of WT 32D cells but does stimulate the growth of such cells transfected with cDNAs for IRS1 or IRS2. Moreover, most 32D-IRS1 cell lines expressing the hIL-4R{alpha} mutant Y497F fail to grow in response to hIL-4. Thus, it was concluded that in this promeyloid cell line, PTBD proteins docking to phosphorylated Y497 play a major role in cell growth and resistance to apoptosis. The applicability of these findings to normal cells and to naive T cells in particular was uncertain.

The combination of two signals mediated by TCR and IL-4R leads to Th2 differentiation. Recently, it has been shown that Th2 differentiation can occur independently of IL-4-IL-4R-Stat6 in vivo (40, 41). Indeed, even in in vitro culture, a small portion of cells may undergo Th2 differentiation independently of the IL-4-IL-4R-Stat6 pathway (37). It is likely that any set of signals that leads to Gata3 expression results in Th2 differentiation. However, it is clear from studies using cells from Stat6-deficient mice that Stat6 plays a dominant role in IL-4-mediated Th2 differentiation (31, 32, 33) and in the T cell expansion over a 3- to 5-day period that occurred under Th2 culture conditions. Stat6 interacts with the second, third, and fourth conserved tyrosines (Y575, Y603, and Y631) of IL-4R{alpha} (2, 17, 18). The role of the PTBD adapters that interact with Y497 in T cell responses to IL-4 was uncertain.

Here we have shown that Stat6 appears to be both necessary and sufficient to mediate the IL-4 component of Th2 differentiation. The finding that T cells expressing a mutant hIL-4R {alpha}-chain (Y497F) that cannot interact with PTBDs are nonetheless fully competent to differentiate into IL-4-producing cells under the influence of hIL-4 establishes this point. What was more surprising was the finding that the PTBD proteins did not appear to play a major role in the expansion of CD4 T cells stimulated under Th2-inducing conditions. CD4 T cells expressing the Y497F mutant hIL-4R {alpha}-chain were as competent as those expressing WT receptors in such expansion.

Not only were the PTBD proteins not important in this expansion or in Th2 differentiation, Stat6 was required for both. CD4 T cells from Stat6-deficient mice failed to polarize to IL-4 production or to show IL-4-dependent expansion when cultured under Th2 conditions. Arai and colleagues had previously infected CD4 cells stimulated under Th1 conditions with a RV containing a cDNA for a Stat6-estrogen receptor fusion protein. Dimerizing the fusion protein with the estrogen analog 4-hydroxytamoxifen activated Stat6, resulting in the induction of Th2 cytokines in the developing cells and an increase in their uptake of [3H]thymidine (42). Our experiments using Stat6VT (35), a constitutively active Stat-6 mutant, showed that Th2 differentiation and cell expansion in the absence of IL-4 were equivalent to the IL-4-driven differentiation and expansion of cells expressing the WT hIL-4R{alpha}. Thus, activated Stat6 appears to be fully responsible for mediating the IL-4-induced Th2 polarization and cell expansion.

The failure to observe any difference in the behavior of CD4 T cells expressing the WT or the Y497F mutant hIL-4R {alpha}-chains is not likely to be accounted for by over-expression of the hIL-4R in such cells. Immunoblotting studies failed to show more receptors on these cells than on Jurkat cells (data not shown). In addition, we saw no difference in the relative induction of IL-4-producing cells among those that expressed large amounts of GFP and those that expressed small amounts of GFP. Because relative GFP expression levels should correlate with relative IL-4R expression levels using a RV containing both cDNAs, there does not appear to be a correlation between the number of expressed receptors and the magnitude of the response.

The role that PTBD proteins such as IRS2 play in T cell responses needs to be further clarified. We did show that cells expressing the Y497F mutant failed to phosphorylate IRS2 in response to IL-4, whereas cells expressing the WT hIL-4R {alpha}-chain showed quite clear phosphorylation of this adaptor. Whether the PTBD proteins play an important role in controlling resistance to apoptosis early in their response to IL-4 is an interesting possibility. However, this was quite difficult to test in the retroviral infection system, because truly naive T cells are resistant to infection (activation is required for successful T cell infection in the retroviral system). Furthermore, primed CD4 T cells tend to survive quite well. It is possible that IL-4 sparing of T cell apoptosis before new gene activation is dependent on PTBD proteins, but determining whether this is true will require additional study. Other potential IL-4R-mediated functions, such as cell adhesion, cell migration, and cell-cell interactions, will need to be studied for the relative importance of PTBD proteins.

The Stat6-dependent induction and activation of Gata3 in response to IL-4 is well established as playing a central role in Th2 differentiation (31, 32, 33, 34, 36, 37). Because activated Stat6 is sufficient to mediate both IL-4-driven Th2 differentiation and cell expansion, it will be interesting to determine whether Gata3 also contributes to IL-4-driven cell proliferation or whether this Stat6 effect is Gata3 independent.


    Acknowledgments
 
We thank K. M. Murphy for providing GFP-RV, U. Schindler for providing pcDNA3-Stat6VT, G. Nolan for providing Phoenix-Eco packaging cell line. and C. Eigsti for excellent cell sorting.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. William E. Paul, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, 10 Center Drive MSC 1892, Building 10, Room 11N311, Bethesda, MD 20892. E-mail address: wepaul{at}nih.gov Back

2 Abbreviations used in this paper: PTBD, phosphotyrosine binding domain; IRS, insulin receptor substrate; FRIP, IL-4R interacting protein; h, human; PI-3K, phosphatidylinositol 3-kinase; WT, wild type; RV, retrovirus; ThN, null Th cell; GFP, green fluorescence protein; GFP-RV, retroviral vector containing an internal ribosomal entry sequence and humanized GFP cDNA; Stat6VT, the plasmid pcDNA3-Stat6VT containing a constitutively activated Stat6. Back

Received for publication February 1, 2001. Accepted for publication April 13, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Medline]
  2. Nelms, K., A. D. Keegan, J. Zamorano, J. J. Ryan, W. E. Paul. 1999. The IL-4 receptor: signaling mechanisms and biologic functions. Annu. Rev. Immunol. 17:701.[Medline]
  3. Ohara, J., W. E. Paul. 1987. Receptors for B-cell stimulatory factor-1 expressed on cells of haematopoietic lineage. Nature 325:537.[Medline]
  4. Sugamura, K., H. Asao, M. Kondo, N. Tanaka, N. Ishii, K. Ohbo, M. Nakamura, T. Takeshita. 1996. The interleukin-2 receptor {gamma} chain: its role in the multiple cytokine receptor complexes and T cell development in XSCID. Annu. Rev. Immunol. 14:179.[Medline]
  5. Witthuhn, B. A., O. Silvennoinen, O. Miura, K. S. Lai, C. Cwik, E. T. Liu, J. N. Ihle. 1994. Involvement of the Jak-3 Janus kinase in signalling by interleukins 2 and 4 in lymphoid and myeloid cells. Nature 370:153.[Medline]
  6. Yin, T., M. L. Tsang, Y. C. Yang. 1994. JAK1 kinase forms complexes with interleukin-4 receptor and 4PS/insulin receptor substrate-1-like protein and is activated by interleukin-4 and interleukin-9 in T lymphocytes. J. Biol. Chem. 269:26614.[Abstract/Free Full Text]
  7. Chen, X. H., B. K. R. Patel, L. M. Wang, M. Frankel, N. Ellmore, R. A. Flavell, W. J. LaRochelle, J. H. Pierce. 1997. Jak1 expression is required for mediating interleukin-4-induced tyrosine phosphorylation of insulin receptor substrate and state signaling molecules. J. Biol. Chem. 272:6556.[Abstract/Free Full Text]
  8. Wang, L. M., A. D. Keegan, W. Li, G. E. Lienhard, S. Pacini, J. S. Gutkind, Jr M. G. Myers, X. J. Sun, M. F. White, S. A. Aaronson, et al 1993. Common elements in interleukin 4 and insulin signaling pathways in factor-dependent hematopoietic cells. Proc. Natl. Acad. Sci. USA 90:4032.[Abstract/Free Full Text]
  9. Wang, L. M., Jr M. G. Myers, X. J. Sun, S. A. Aaronson, M. F. White, J. H. Pierce. 1993. IRS-1: essential for insulin- and IL-4-stimulated mitogenesis in hematopoietic cells. Science 261:1591.[Abstract/Free Full Text]
  10. Sun, X. J., L. M. Wang, Y. Zhang, L. Yenush, Jr M. G. Myers, E. Glasheen, W. S. Lane, J. H. Pierce, M. F. White. 1995. Role of IRS-2 in insulin and cytokine signalling. Nature 377:173.[Medline]
  11. Wery, S., M. Letourneur, J. Bertoglio, J. Pierre. 1996. Interleukin-4 induces activation of mitogen-activated protein kinase and phosphorylation of shc in human keratinocytes. J. Biol. Chem. 271:8529.[Abstract/Free Full Text]
  12. Nelms, K., A. L. Snow, J. Hu-Li, W. E. Paul. 1998. FRIP, a hematopoietic cell-specific rasGAP-interacting protein phosphorylated in response to cytokine stimulation. Immunity 9:13.[Medline]
  13. Carpino, N., D. Wisniewski, A. Strife, D. Marshak, R. Kobayashi, B. Stillman, B. Clarkson. 1997. p62dok: a constitutively tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells. Cell 88:197.[Medline]
  14. Yamanashi, Y., D. Baltimore. 1997. Identification of the Abl- and rasGAP-associated 62 kDa protein as a docking protein, Dok. Cell 88:205.[Medline]
  15. Hou, J., U. Schindler, W. J. Henzel, T. C. Ho, M. Brasseur, S. L. McKnight. 1994. An interleukin-4-induced transcription factor: IL-4 Stat. Science 265:1701.[Abstract/Free Full Text]
  16. Quelle, F. W., K. Shimoda, W. Thierfelder, C. Fischer, A. Kim, S. M. Ruben, J. L. Cleveland, J. H. Pierce, A. D. Keegan, K. Nelms, et al 1995. Cloning of murine Stat6 and human Stat6, Stat proteins that are tyrosine phosphorylated in responses to IL-4 and IL-3 but are not required for mitogenesis. Mol. Cell. Biol. 15:3336.[Abstract/Free Full Text]
  17. Ryan, J. J., L. J. McReynolds, H. Huang, K. Nelms, W. E. Paul. 1998. Characterization of a mobile Stat6 activation motif in the human IL-4 receptor. J. Immunol. 161:1811.[Abstract/Free Full Text]
  18. Ryan, J. J., L. J. McReynolds, A. D. Keegan, L. H. Wang, E. Garfein, P. Rothman, K. Nelms, W. E. Paul. 1996. Growth and gene expression are predominantly controlled by distinct regions of the human IL-4 receptor. Immunity 4:123.[Medline]
  19. Pernis, A., B. Witthuhn, A. D. Keegan, K. Nelms, E. Garfein, J. N. Ihle, W. E. Paul, J. H. Pierce, P. Rothman. 1995. Interleukin 4 signals through two related pathways. Proc. Natl. Acad. Sci. USA 92:7971.[Abstract/Free Full Text]
  20. Keegan, A. D., K. Nelms, M. White, L. M. Wang, J. H. Pierce, W. E. Paul. 1994. An IL-4 receptor region containing an insulin receptor motif is important for IL-4-mediated IRS-1 phosphorylation and cell growth. Cell 76:811.[Medline]
  21. Zamorano, J., H. Y. Wang, L. M. Wang, J. H. Pierce, A. D. Keegan. 1996. IL-4 protects cells from apoptosis via the insulin receptor substrate pathway and a second independent signaling pathway. J. Immunol. 157:4926.[Abstract]
  22. Zamorano, J., A. D. Keegan. 1998. Regulation of apoptosis by tyrosine-containing domains of IL-4R{alpha}: Y497 and Y713, but not the STAT6-docking tyrosines, signal protection from apoptosis. J. Immunol. 161:859.[Abstract/Free Full Text]
  23. Defrance, T., J. P. Aubry, F. Rousset, B. Vanbervliet, J. Y. Bonnefoy, N. Arai, Y. Takebe, T. Yokota, F. Lee, K. Arai, et al 1987. Human recombinant interleukin 4 induces Fc{epsilon} receptors (CD23) on normal human B lymphocytes. J. Exp. Med. 165:1459.[Abstract/Free Full Text]
  24. Mikita, T., M. Kurama, U. Schindler. 1998. Synergistic activation of the germline epsilon promoter mediated by Stat6 and C/EBP{beta}. J. Immunol. 161:1822.[Abstract/Free Full Text]
  25. Shen, C. H., J. Stavnezer. 1998. Interaction of stat6 and NF-{kappa}B: direct association and synergistic activation of interleukin-4-induced transcription. Mol. Cell. Biol. 18:3395.[Abstract/Free Full Text]
  26. Linehan, L. A. W. D., P. A. Warren, M. J. Grusby Thompson, M. T. Berton. 1998. STAT6 is required for IL-4-induced germline Ig gene transcription and switch recombination. J. Immunol. 161:302.[Abstract/Free Full Text]
  27. Kotanides, H., N. C. Reich. 1996. Interleukin-4-induced STAT6 recognizes and activates a target site in the promoter of the interleukin-4 receptor gene. J. Biol. Chem. 271:25555.[Abstract/Free Full Text]
  28. Qian, D., A. Weiss. 1997. T cells antigen receptor signal transduction. Curr. Opin. Cell Biol. 9:205.[Medline]
  29. Avni, O., A. Rao. 2000. T cell differentiation: a mechanistic view. Curr. Opin. Immunol. 12:654.[Medline]
  30. O’Garra, A., N. Arai. 2000. The molecular basis of T helper 1 and T helper 2 cell differentiation. Trends Cell Biol. 10:542.[Medline]
  31. Shimoda, K., J. van Deursen, M. Y. Sangster, S. R. Sarawar, R. T. Carson, R. A. Tripp, C. Chu, F. W. Quelle, T. Nosaka, D. A. A. Vignali, et al 1996. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 380:630.[Medline]
  32. Takeda, K., T. Tanaka, W. Shi, M. Matsumoto, M. Minami, S. Kashiwamura, K. Nakanishi, N. Yoshida, T. Kishimoto, S. Akira. 1996. Essential role of Stat6 in IL-4 signalling. Nature 380:627.[Medline]
  33. Kaplan, M. H., U. Schindler, S. T. Smiley, M. J. Grusby. 1996. Stat6 is required for mediating responses to IL-4 and for the development of Th2 cells. Immunity 4:313.[Medline]
  34. Ouyang, W., S. H. Ranganath, K. Weindel, D. Bhattacharya, T. L. Murphy, W. C. Sha, K. M. Murphy. 1998. Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism. Immunity 9:745.[Medline]
  35. Daniel, C., A. Salvekar, U. Schindler. 2000. A gain-of-function mutation in STAT6. J. Biol. Chem. 275:14255.[Abstract/Free Full Text]
  36. Zheng, W., R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89:587.[Medline]
  37. Ouyang, W. J., M. Lohning, Z. G. Gao, M. Assenmacher, S. Ranganath, A. Radbruch, K. M. Murphy. 2000. Stat6-independent GATA-3 autoactivation directs IL-4-independent Th2 development and commitment. Immunity 12:27.[Medline]
  38. Ben-Sasson, S. Z., K. Makedonski, J. Hu-Li, W. E. Paul. 2000. Survival and cytokine polarization of naive CD4+ T cells in vitro is largely dependent on exogenous cytokines. Eur. J. Immunol. 30:1308.[Medline]
  39. Zhu, J., H. Huang, L. Guo, T. Stonehouse, C. J. Watson, J. Hu-Li, W. E. Paul. 2000. Transient inhibition of interleukin 4 signaling by T cell receptor ligation. J. Exp. Med. 192:1125.[Abstract/Free Full Text]
  40. Dent, A. L., J. Hu-Li, W. E. Paul, L. M. Staudt. 1998. T helper type 2 inflammatory disease in the absence of interleukin 4 and transcription factor STAT6. Proc. Natl. Acad. Sci. USA 95:13823.[Abstract/Free Full Text]
  41. Jankovic, D., M. C. Kullberg, N. Noben-Trauth, P. Caspar, W. E. Paul, A. Sher. 2000. Single cell analysis reveals that IL-4 receptor/Stat6 signaling is not required for the in vivo or in vitro development of CD4+ lymphocytes with a Th2 cytokine profile. J. Immunol. 164:3047.[Abstract/Free Full Text]
  42. Kurata, H., H. J. Lee, A. O’Garra, N. Arai. 1999. Ectopic expression of activated Stat6 induces the expression of Th2-specific cytokines and transcription factors in developing Th1 cells. Immunity 11:677.[Medline]



This article has been cited by other articles:


Home page
J Mol Cell BiolHome page
Y. Y. Wan and R. A. Flavell
How Diverse--CD4 Effector T Cells and their Functions
J Mol Cell Biol, October 1, 2009; 1(1): 20 - 36.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Guo, G. Wei, J. Zhu, W. Liao, W. J. Leonard, K. Zhao, and W. Paul
IL-1 family members and STAT activators induce cytokine production by Th2, Th17, and Th1 cells
PNAS, August 11, 2009; 106(32): 13463 - 13468.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. B. L. Pillemer, Z. Qi, B. Melgert, T. B. Oriss, P. Ray, and A. Ray
STAT6 Activation Confers upon T Helper Cells Resistance to Suppression by Regulatory T Cells
J. Immunol., July 1, 2009; 183(1): 155 - 163.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. Zhu, T. S. Davidson, G. Wei, D. Jankovic, K. Cui, D. E. Schones, L. Guo, K. Zhao, E. M. Shevach, and W. E. Paul
Down-regulation of Gfi-1 expression by TGF-{beta} is important for differentiation of Th17 and CD103+ inducible regulatory T cells
J. Exp. Med., February 16, 2009; 206(2): 329 - 341.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. R. Quirion, G. D. Gregory, S. E. Umetsu, S. Winandy, and M. A. Brown
Cutting Edge: Ikaros Is a Regulator of Th2 Cell Differentiation
J. Immunol., January 15, 2009; 182(2): 741 - 745.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
N. M. Heller, X. Qi, I. S. Junttila, K. A. Shirey, S. N. Vogel, W. E. Paul, and A. D. Keegan
Type I IL-4Rs Selectively Activate IRS-2 to Induce Target Gene Expression in Macrophages
Sci. Signal., December 23, 2008; 1(51): ra17 - ra17.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Zhu and W. E. Paul
CD4 T cells: fates, functions, and faults
Blood, September 1, 2008; 112(5): 1557 - 1569.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. van Panhuys, S.-C. Tang, M. Prout, M. Camberis, D. Scarlett, J. Roberts, J. Hu-Li, W. E. Paul, and G. Le Gros
In vivo studies fail to reveal a role for IL-4 or STAT6 signaling in Th2 lymphocyte differentiation
PNAS, August 26, 2008; 105(34): 12423 - 12428.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Acacia de Sa Pinheiro, A. Morrot, S. Chakravarty, M. Overstreet, J. H. Bream, P. M. Irusta, and F. Zavala
IL-4 induces a wide-spectrum intracellular signaling cascade in CD8+ T cells
J. Leukoc. Biol., April 1, 2007; 81(4): 1102 - 1110.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Zhu, D. Jankovic, A. Grinberg, L. Guo, and W. E. Paul
Gfi-1 plays an important role in IL-2-mediated Th2 cell expansion
PNAS, November 28, 2006; 103(48): 18214 - 18219.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. M. L. Tamma, K. W. Chung, T. Patel, S. P. Balan, and S. Pahwa
p38 MAPK plays a role in IL-4 synthesis in jacalin plus CD28-stimulated CD4+ T cells--II
J. Leukoc. Biol., June 1, 2006; 79(6): 1339 - 1347.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro
T-helper cell type-2 regulation in allergic disease
Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Woszczek, R. Pawliczak, H.-Y. Qi, S. Nagineni, S. Alsaaty, C. Logun, and J. H. Shelhamer
Functional Characterization of Human Cysteinyl Leukotriene 1 Receptor Gene Structure
J. Immunol., October 15, 2005; 175(8): 5152 - 5159.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. A. Jenks, B. J. Eisfelder, and J. Miller
LFA-1 co-stimulation inhibits Th2 differentiation by down-modulating IL-4 responsiveness
Int. Immunol., March 1, 2005; 17(3): 315 - 323.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Yang, J. Ochando, A. Yopp, J. S. Bromberg, and Y. Ding
IL-6 Plays a Unique Role in Initiating c-Maf Expression during Early Stage of CD4 T Cell Activation
J. Immunol., March 1, 2005; 174(5): 2720 - 2729.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Sanchez-Guajardo, J. A. M. Borghans, M.-E. Marquez, S. Garcia, and A. A. Freitas
Different Competitive Capacities of Stat4- and Stat6-Deficient CD4+ T Cells during Lymphophenia-Driven Proliferation
J. Immunol., February 1, 2005; 174(3): 1178 - 1187.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. B. Oriss, M. Ostroukhova, C. Seguin-Devaux, B. Dixon-McCarthy, D. B. Stolz, S. C. Watkins, B. Pillemer, P. Ray, and A. Ray
Dynamics of Dendritic Cell Phenotype and Interactions with CD4+ T Cells in Airway Inflammation and Tolerance
J. Immunol., January 15, 2005; 174(2): 854 - 863.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
G. T. Hart, D. J. Shaffer, S. Akilesh, A. C. Brown, L. Moran, D. C. Roopenian, and P. J. Baker
Quantitative Gene Expression Profiling Implicates Genes for Susceptibility and Resistance to Alveolar Bone Loss
Infect. Immun., August 1, 2004; 72(8): 4471 - 4479.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. D. Bunting, W.-M. Yu, H. L. Bradley, E. Haviernikova, A. E. Kelly-Welch, A. D. Keegan, and C.-K. Qu
Increased numbers of committed myeloid progenitors but not primitive hematopoietic stem/progenitors in mice lacking STAT6 expression
J. Leukoc. Biol., August 1, 2004; 76(2): 484 - 490.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C.-R. Yu, R. M. Mahdi, S. Ebong, B. P. Vistica, J. Chen, Y. Guo, I. Gery, and C. E. Egwuagu
Cell Proliferation and STAT6 Pathways Are Negatively Regulated in T Cells by STAT1 and Suppressors of Cytokine Signaling
J. Immunol., July 15, 2004; 173(2): 737 - 746.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Cote-Sierra, G. Foucras, L. Guo, L. Chiodetti, H. A. Young, J. Hu-Li, J. Zhu, and W. E. Paul
Interleukin 2 plays a central role in Th2 differentiation
PNAS, March 16, 2004; 101(11): 3880 - 3885.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. Gillespie, R. R. DeMartino, J. Zhu, H. J. Chong, C. Ramirez, C. P. Shelburne, L. A. Bouton, D. P. Bailey, A. Gharse, P. Mirmonsef, et al.
IL-10 Inhibits Fc{epsilon}RI Expression in Mouse Mast Cells
J. Immunol., March 1, 2004; 172(5): 3181 - 3188.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. M. Monick, L. Samavati, N. S. Butler, M. Mohning, L. S. Powers, T. Yarovinsky, D. R. Spitz, and G. W. Hunninghake
Intracellular Thiols Contribute to Th2 Function via a Positive Role in IL-4 Production
J. Immunol., November 15, 2003; 171(10): 5107 - 5115.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
F. Blaeser, P. J. Bryce, N. Ho, V. Raman, F. Dedeoglu, D. D. Donaldson, R. S. Geha, H. C. Oettgen, and T. A. Chatila
Targeted Inactivation of the IL-4 Receptor {alpha} Chain I4R Motif Promotes Allergic Airway Inflammation
J. Exp. Med., October 20, 2003; 198(8): 1189 - 1200.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Lohning, A. Richter, T. Stamm, J. Hu-Li, M. Assenmacher, W. E. Paul, and A. Radbruch
Establishment of memory for IL-10 expression in developing T helper 2 cells requires repetitive IL-4 costimulation and does not impair proliferation
PNAS, October 14, 2003; 100(21): 12307 - 12312.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. L. Mora, L. M. Stephenson, B. Enerson, J. Youn, A. D. Keegan, and M. Boothby
New Programming of IL-4 Receptor Signal Transduction in Activated T Cells: Stat6 Induction and Th2 Differentiation Mediated by IL-4R{alpha} Lacking Cytoplasmic Tyrosines
J. Immunol., August 15, 2003; 171(4): 1891 - 1900.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. A. Bruns, U. Schindler, and M. H. Kaplan
Expression of a Constitutively Active Stat6 In Vivo Alters Lymphocyte Homeostasis with Distinct Effects in T and B Cells
J. Immunol., April 1, 2003; 170(7): 3478 - 3487.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Okuda, I. Takahashi, J.-K. Kim, N. Ohta, K. Iwatani, H. Iijima, Y. Kai, H. Tamagawa, T. Hiroi, M.-N. Kweon, et al.
Development of Colitis in Signal Transducers and Activators of Transcription 6-Deficient T-Cell Receptor {alpha}-Deficient Mice: A Potential Role of Signal Transducers and Activators of Transcription 6-Independent Interleukin-4 Signaling for the Generation of Th2-Biased Pathological CD4+{beta}{beta}T Cells
Am. J. Pathol., January 1, 2003; 162(1): 263 - 271.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Dimitrova, A. Skapenko, M. L. Herrmann, R. Schleyerbach, J. R. Kalden, and H. Schulze-Koops
Restriction of De Novo Pyrimidine Biosynthesis Inhibits Th1 Cell Activation and Promotes Th2 Cell Differentiation
J. Immunol., September 15, 2002; 169(6): 3392 - 3399.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Guo, J. Hu-Li, J. Zhu, C. J. Watson, M. J. Difilippantonio, C. Pannetier, and W. E. Paul
In TH2 cells the Il4 gene has a series of accessibility states associated with distinctive probabilities of IL-4 production
PNAS, August 6, 2002; 99(16): 10623 - 10628.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Rodriguez-Sosa, J. R. David, R. Bojalil, A. R. Satoskar, and L. I. Terrazas
Cutting Edge: Susceptibility to the Larval Stage of the Helminth Parasite Taenia crassiceps Is Mediated by Th2 Response Induced Via STAT6 Signaling
J. Immunol., April 1, 2002; 168(7): 3135 - 3139.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. M. Grunstein, H. Hakonarson, J. Leiter, M. Chen, R. Whelan, J. S. Grunstein, and S. Chuang
IL-13-dependent autocrine signaling mediates altered responsiveness of IgE-sensitized airway smooth muscle
Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L520 - L528.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, J.
Right arrow Articles by Paul, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, J.
Right arrow Articles by Paul, W. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS