|
|
||||||||
Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
-chain, Y497F, which is unable to recruit these adaptors. The mutant
hIL-4R
, as well as the wild-type (WT) hIL-4R
, was introduced into
naive CD4 T cells. Upon hIL-4 stimulation, Y497F worked as well as the
WT hIL-4R
in driving Th2 differentiation, as measured by Gata3
up-regulation and IL-4 production. Furthermore, IL-4-driven cell
expansion was also normal in the cells infected with Y497F, although
cells infected with Y497F were not capable of phosphorylating insulin
receptor substrate 2. These results suggest that the signal pathway
mediated by Y497 is dispensable for both IL-4-driven Th2
differentiation and cell expansion. Both WT and Y497F hIL-4R
lose
the ability to drive Th2 differentiation and cell expansion in
Stat6-knockout CD4 T cells. A constitutively activated form of Stat6
introduced into CD4 T cells resulted in both Th2 differentiation and
enhanced cell expansion. Thus, activated Stat6 is necessary and
sufficient to mediate both IL-4-driven Th2 differentiation and cell
expansion in CD4 T cells. | Introduction |
|---|
|
|
|---|
-chain
(3) and the IL-2R
-chain (4), which is
also shared by cytokine receptors for IL-2, IL-7, IL-9, and IL-15, are
heterodimerized. The nonreceptor tyrosine Janus kinases 1 and 3,
constitutively associated with IL-4R
-chain (IL-4R
) and IL-2R
-chain, respectively (5, 6, 7), become activated and
phosphorylate some or all of the conserved tyrosines of IL-4R
. These
phosphotyrosines and the immediately surrounding amino acids within
IL-4R
provide docking sites for the phosphotyrosine binding-domain
(PTBD)2
proteins insulin receptor substrate (IRS)1/2 (8, 9, 10), Shc
(11), IL-4R interacting protein (FRIP) (12),
and dok (13, 14), as well as for Stat6
(15, 16, 17, 18). Within the intracellular domain of human
(h)IL-4R
, the PTBD adapters interact with the first conserved
tyrosine (Y497), and Stat6 interacts with the second, third, and fourth
conserved tyrosines (Y575, Y603, and Y631).
Two major IL-4 signaling pathways are mediated by the PTBD proteins and
Stat6, respectively (18, 19). After PTBD proteins bind to
IL-4R
, they become tyrosyl phosphorylated and provide further
docking sites for other downstream molecules such as p85 of
phosphatidylinositol-3-kinase (PI-3K) and Grb2, leading to the
activation of PI-3K and, in some instances, of the
Ras/mitogen-activated protein kinase cascades, respectively. In the
promyeloid cell line 32D, transfection studies have shown that IRS1 and
2 are important in IL-4-mediated cell proliferation and resistance to
apoptosis (20, 21, 22). The latter was mediated through the
activation of PI-3K.
Stat6 is recruited to the IL-4R complex by binding to any of three
phosphotyrosines in IL-4R
. It becomes tyrosyl phosphorylated at its
C terminus through the action of Janus kinase(s) 1 and/or 3.
Phosphorylated Stat6 dimerizes, migrates to the nucleus, binds to
specific DNA elements, and, together with other transcription factors,
activates transcription of some IL-4-induced genes
(23, 24, 25, 26, 27).
The differentiation of naive T cells into Th2 cells requires both TCR-
and IL-4-mediated signals (28, 29, 30). IL-4 activation of
Stat6 has been shown to be a critical step in driving Th2
differentiation (31, 32, 33); the role of IRS2 and other PTBD
proteins during Th2 differentiation is unclear. To examine a role for
the PTBD proteins in IL-4-mediated Th2 differentiation and IL-4-driven
proliferation in CD4 cells, we used a retrovirus (RV) system to
introduce h wild-type (WT) and mutant IL-4R
into CD4 T cells. It was
found that Y497, the binding site for PTBD protein, is dispensable for
both IL-4-driven Th2 differentiation and for cell expansion. Using
Stat6-knockout CD4 T cells, we found that Stat6 is necessary for both
of these IL-4-induced functions in CD4 T cells. Moreover, using a RV
containing constitutively activated Stat6, it was found that Stat6 is
not only necessary but also sufficient for the IL-4 effects in Th2
differentiation and cell expansion.
| Materials and Methods |
|---|
|
|
|---|
Eight- to 12-wk-old BALB/c mice were obtained from Frederick Cancer Research Center (Frederick, MD).
Stat6-/- BALB/c mice were originally obtained
from Dr. M. Grusby (Harvard School of Public Health, Boston, MA)
(33). Naive CD4+ T cells were
prepared as follows: Lymph node cells were depleted of
CD8+ cells, B220+ cells,
and IAd+ cells by negative selection using
FITC-labeled anti-CD8, anti-B220, and
anti-IAd (BD PharMingen, San Diego, CA) plus
anti-fluorescein-conjugated magnetic beads (PerSeptive Diagnostics,
Cambridge, MA). Purified CD4+ T cells were then
centrifuged on a discontinuous 50, 60, and 70% Percoll gradient. Cells
with a density of >60% were collected and used for priming. The
purity of CD4+ T cells was usually
98%.
CD44lowCD62 ligandhigh
cells constituted
90% of the purified CD4 cells. T cell-depleted
APCs were prepared by incubating spleen cells with anti-Thy1.2 and
rabbit complement (Cedarlane Laboratories, Hornby, Ontario, Canada) at
37°C for 45 min and then irradiated at 3000 rad.
A total of 106 naive CD4+ T
cells were cocultured with 107 irradiated T
cell-depleted spleen cells in the presence of anti-CD3 (3 µg/ml;
2C11, Harlan Laboratories, Haslett, MI), anti-CD28 (3 µg/ml;
Harlan Laboratories), IL-2 (10 U/ml), and different combinations of Abs
and cytokines for 4 days (for null Th cell (ThN) conditions,
anti-IL-4 (10 µg/ml), anti-IFN-
(10 µg/ml), and
anti-IL-12 (10 µg/ml); for Th1 conditions, anti-IL-4 (11B11;
10 µg/ml) plus IL-12 (10 ng/ml); for Th2 conditions, IL-4 (1000
U/ml), anti-IFN-
(10 µg/ml), and anti-IL-12 (10 µg/ml)).
After incubation in IL-2 for 3 additional days, cells were either
analyzed by intracellular staining for IL-4 expression or further
primed under various conditions.
Preparation of retroviral constructs
A retroviral vector containing an internal ribosomal entry
sequence and humanized green fluorescence protein (GFP) cDNA (GFP-RV),
was provided by Dr. K. M. Murphy (Washington University, St. Louis, MO)
(34). The plasmid pcDNA3-Stat6VT containing a
constitutively activated Stat6 (Stat6VT) was provided by Dr. U.
Schindler (Tularik, South San Francisco, CA) (35). The
IL-4R
mutant, Y497F, has been described previously
(20). The XhoI fragment of WT or mutant
IL-4R
was cut from pEPS vector, cloned into the XhoI site
of GFP-RV, and the orientation was verified. The Stat6VT was cut from
pcDNA3-Stat6VT by partial digestion with XhoI and
BamHI and cloned into GFP-RV between the BglII
and XhoI sites.
Preparation of RVs and infection
The Phoenix-Eco packaging cell line (kindly provided by Dr. G. Nolan, Stanford University, Stanford, CA) was transfected using FuGENE 6 transfection reagent (Roche Diagnostic Systems, Somerville, NJ) according to the manufacturers protocol. Purified naive CD4 T cells (5 x 105) were activated with anti-CD3 and APCs under ThN conditions in 5 ml of medium as described above. At 40 h, 4 ml of supernatant was removed, and 2 ml of virus-containing supernatant and polybrene (Sigma, St. Louis, MO) at 5 µg/ml was added. The mixture was centrifuged at 2500 rpm for 45 min at room temperature and incubated at 37°C for 24 h, after which 5 ml of fresh ThN medium was added. Cells were washed and cultured in IL-2 (10 U/ml) medium 3 days later for 3 additional days and then restimulated under various conditions. For some experiments, GFP-positive cells were sorted after restimulation.
Flow cytometry analysis and intracellular staining
The percentage of GFP-positive cells was determined at various times after infection. Cells were cultured with plate-bound anti-CD3 and anti-CD28 for 6 h in the presence of monensin (2 µM) during last 4 h. Harvested samples were fixed with 4% formaldehyde, washed, and permeabilized in 0.5% saponin-1% BSA in PBS before staining with anti-IL-4-PE or anti-IL-4-APC. Samples were analyzed on a FACScan (BD Biosciences, San Jose, CA).
Semiquantitative RT-PCR
After infection and further priming, CD4 T cells expressing GFP
were sorted by FACS. Total RNA was isolated using TRIzol (Life
Technologies, Rockville, MD), and first strand cDNAs were made
using the SuperScript preamplification system (Life Technologies)
according to the manufacturers protocol. Semiquantitative PCR was
conducted in a GeneAmp PCR system 9700 (Perkin-Elmer, Norwalk, CT)
using Platinum PCR SuperMix (Life Technologies) by a serial dilution of
the cDNA templates. The primers for Gata3 were (from 5' to 3')
CTGACTATGAAGAAAGAAGGCATCCAG and AAGTAGAAGGGGTCGGAGGAACTCT. The
primers for
-actin were (from 5' to 3') GATGACGATATCGCTGCGCTG and
TACGACCAGAGGCATACAGG.
Immunoprecipitation and Western blotting
Cytokine-treated cells (107/sample) were harvested and lysed with 1 ml lysis buffer (50 mM HEPES (pH 7.0), 0.5% Nonidet P-40, 5 mM EDTA, 50 mM NaCl, 10 mM sodium pyrophosphate, and 50 mM NaF) freshly supplemented with inhibitors (1 mM sodium orthovanadate, 1 mM PMSF, and 10 µg/ml aprotinin, leupeptin, and pepstatin) on ice for 20 min. After centrifugation at 12,000 rpm for 15 min, supernatants were incubated with 23 µg Ab for 1 h on ice and precipitated with protein G-agarose (Pierce, Rockford, IL) at 4°C overnight on a rocker. The complexes were then washed three times with lysis buffer and eluted with 2x SDS-PAGE loading buffer. The eluted samples were separated into 8% premade acrylamide gels (NOVEX, San Diego, CA) and transferred onto Immobilon-P membranes (Millipore, Bedford, MA). Membranes were then probed with specific Abs followed by HRP-labeled secondary Abs (Amersham, Arlington Heights, IL) and visualized with SuperSignal West Dura Extended Duration Substrate (Pierce). For some experiments, the probed membranes were stripped with stripping buffer (2% SDS, 62.5 mM Tris-HCl (pH 6.8), 100 mM 2-ME) at 60°C for 30 min and then reprobed with a second Ab. Anti-Stat6 was purchased from R&D Systems (Minneapolis, MN); anti-phosphorylated tyrosine (4G10) and anti-IRS2 were obtained from Upstate Biotechnology(Lake Placid, NY).
| Results |
|---|
|
|
|---|
Within the intracellular domain of the hIL-4R
-chain
(hIL-4R
), Y497 recruits PTBD-containing adaptors, such as IRS1/2
(20), Shc (11), and FRIP (12),
when it is phosphorylated as a result of IL-4 stimulation. The Y497F
mutant of IL-4R
was previously shown to be unable to mediate
phosphorylation of IRS1/2, Shc, and FRIP but was still capable of
activating Stat6 (20). Thus, we used this mutant to study
the roles of the PTBD-containing adaptors in Th2 differentiation.
BALB/c naive CD4 T cells were purified and activated in the presence of
T cell-depleted APCs with anti-CD3, anti-CD28, IL-2,
anti-IL-4, anti-IFN-
, and anti-IL-12 (ThN conditions)
for 40 h. The activated cells were then infected with RVs
containing either WT hIL-4R
or Y497F or with the empty vector as a
control. Cells were maintained under ThN conditions for 3 additional
days and then washed and placed in IL-2 medium for 3 days. The
percentage of GFP-positive cells was checked by FACS. The infected
cells were then split into three populations and further primed under
ThN, Th2, or ThN plus hIL-4 (10 ng/ml) conditions for 4 days. The
percentage of IL-4-producing cells was measured by intracellular
staining after an additional 3-day culture in IL-2. Under the ThN
conditions, the GFP-positive and GFP-negative cells from each of the
infected groups made little IL-4 (1.14.9%; Fig. 1
). Under Th2 conditions, the
GFP-positive and GFP-negative cells from each of the infected groups
developed IL-4-producing capacity to a similar degree and had
indistinguishable percentages of IL-4 producers (13.6 vs 14.2%, 14.3
vs 14.5%, and 19.4 vs 18.8%). Under the ThN plus hIL-4 condition,
23.8% of the GFP-positive cells expressing WT hIL-4R
were capable
of making IL-4, whereas only 2.9% of GFP-negative cells from the same
culture could produce IL-4. Interestingly, 23.7% of the GFP cells from
the group infected with theY497F RV could produce IL-4, a percentage
that was essentially the same as those that had been infected with the
WT receptor RV. GFP-positive cells from the group infected with empty
vector developed very few (1.9%) IL-4 producers. The results indicate
that Y497 is not required for IL-4 stimulation of CD4 T cells to become
IL-4 producers.
|
-chain (Fig. 2
10-fold higher than
expression levels in conventionally primed ThN cells.
|
is dispensable for IL-4-mediated Th2 differentiation. Y497 is dispensable for IL-4-mediated cell expansion
Cells being primed under Th2 conditions expand to a greater degree
than those stimulated under ThN or Th1 conditions, and the addition of
IL-4 to cultures of naive CD4 T cells stimulated with anti-CD3,
anti-CD28, and IL-2 markedly enhances cell yield (38).
By infecting naive CD4 T cells with hIL-4R
RV, we could
compare the relative IL-4-mediated expansion of GFP-positive and
GFP-negative cells. Relative
GFP+/GFP- expansion was
defined as (percentage of GFP+ cells after
priming) x (percentage of GFP- cells
after infection)/(percentage of GFP+ cells after
infection)/(percentage of GFP- cells after
priming). Under Th2 priming conditions, both GFP+
and GFP- cells from the groups infected with any
of the vectors expanded equally, resulting in relative expansions of
1.11.3 (Fig. 3
). This would be
anticipated because all the cells can respond to the mouse IL-4
that is present. Under ThN plus hIL-4 or Th1 plus hIL-4 conditions, the
GFP+ cells from the culture infected with the
empty vector lacking hIL-4R could not respond to hIL-4. Thus, the
percentage of GFP+ cells remained the same after
priming. However, under ThN plus hIL-4 or Th1 plus hIL-4 conditions,
the GFP+ cells from the culture infected with WT
hIL-4R
grew much better than the GFP- cells
in the same culture. The relative expansions were 4.0 and 4.7,
respectively, in experiment 1 and 4.2 and 4.5 in experiment 2.
Interestingly, the similar results were observed in the cells infected
with Y497F hIL-4R
mutant. The relative expansion in the ThN plus
hIL-4 and the Th1 plus hIL-4 stimulated cells were 3.9 and 5.7,
respectively, in experiment 1 and 4.5 and 5.0 in experiment 2. Thus,
Y497 was not only dispensable for Th2 differentiation, it was also not
essential for IL-4-induced T cell expansion.
|
IRS2 phosphorylation can be dramatically induced by IL-4 in either
naive or activated CD4 T cells (39). Although it has been
shown that IL-4-induced IRS1/2 phosphorylation was greatly diminished
in the promyeloid cell line 32D-IRS1 transfected with Y497F compared
with those transfected with WT IL-4R
(20), we wished to
determine whether that is also the case in CD4 T cells.
GFP+ cells were purified, by cell sorting, from
CD4 T cell populations infected with either WT IL-4R
RV or the Y497F
RV. To obtain sufficient cells for analysis and to increase expression
of IRS2 in these cells, the sorted cells were subjected to two further
rounds of priming under Th2 conditions. Upon mouse IL-4 stimulation,
IRS2 and Stat6 were well phosphorylated in both cell populations (Fig. 4
). In the cells expressing WT hIL-4R
,
IRS2 and Stat6 became phosphorylated upon hIL-4 stimulation. However,
in cells expressing the Y497F mutant, although Stat6 phosphorylation
remained normal, IRS2 phosphorylation was greatly diminished in
response to hIL-4. Because cells expressing the mutant hIL-4R
-chain, Y497F, showed normal IL-4-mediated Th2 differentiation and
cell expansion, the activation of IRS2 appears not to be required for
mediating either of these two IL-4 functions in CD4 T cells.
|
It has been shown that Stat6 is crucial for Th2 differentiation
(31, 32, 33), but its function in IL-4-driven T cell
proliferation is not clear. We infected CD4 T cells from Stat6-knockout
mice with the hIL-4R
, the Y497F, and "empty" RVs and measured
relative expansion. Under ThN conditions with added hIL-4, the relative
expansions were 0.91.3 (Fig. 5
). In the
same experiments, the relative expansions taken from BALB/c cells
infected with hIL-4R
were 4.4 and 3.8. The
Stat6-/- cells also underwent little or no
differentiation to IL-4-producing cells (data not shown). Thus, Stat6
is required for both IL-4-driven Th2 differentiation and for CD4 T cell
expansion.
|
Recently, a constitutively active Stat6 mutant (Stat6VT) has been
derived (35). We used this mutant to test whether Stat6
activation is sufficient in combination with anti-CD3/anti-CD28
to drive Th2 differentiation and cell expansion. After cloning this
mutant into our retroviral vector, we infected
anti-CD3/anti-CD28-activated T cells with WT hIL-4R
RV,
Stat6VT RV, or empty vector RV. After infection, the cells infected
with IL-4R
RV were primed under ThN conditions with hIL-4; cells
infected with empty vector RV and Stat6VT RV were primed under ThN
conditions in the absence of hIL-4. As shown in Fig. 6
, in two independent experiments, the
GFP- and GFP+ cells
infected with empty vector RV made little IL-4 (0.9 and 0.4% and 0.2
and 0.2%). The GFP- and
GFP+ cells from cultures infected with hIL-4R
RV had very different percentages of IL-4-producing cells (1.4 vs
11.4% and 0.6 vs 24.5%). The cells infected with Stat6VT RV and
primed in the absence of IL-4 showed a similar pattern. In the two
experiments presented, 1.4 and 0.1% of the GFP-
cells produced IL-4 compared with 16.2 and 28.7% of the
GFP+ cells. All the cells cultured under Th2
conditions with mouse IL-4 developed a substantial proportion of
IL-4-producing cells (data not shown).
|
(5.5- and 4.1-fold, respectively; similar
results were obtained in a second experiment in which we
observed 5.1- and 4.4-fold relative expansion) (Fig. 7
|
| Discussion |
|---|
|
|
|---|
-chain (Y497) in IL-4-mediated cell
proliferation and survival (20, 21, 22). This tyrosine is in a
docking site for PTBD proteins; 32D cells lack IRS1 and IRS2, two of
the major PTBD proteins that normally interact with the Y497 site.
Mouse IL-4 fails to stimulate the growth of WT 32D cells but does
stimulate the growth of such cells transfected with cDNAs for IRS1 or
IRS2. Moreover, most 32D-IRS1 cell lines expressing the hIL-4R
mutant Y497F fail to grow in response to hIL-4. Thus, it was concluded
that in this promeyloid cell line, PTBD proteins docking to
phosphorylated Y497 play a major role in cell growth and resistance to
apoptosis. The applicability of these findings to normal cells and to
naive T cells in particular was uncertain.
The combination of two signals mediated by TCR and IL-4R leads to Th2
differentiation. Recently, it has been shown that Th2 differentiation
can occur independently of IL-4-IL-4R-Stat6 in vivo (40, 41). Indeed, even in in vitro culture, a small portion of cells
may undergo Th2 differentiation independently of the IL-4-IL-4R-Stat6
pathway (37). It is likely that any set of signals that
leads to Gata3 expression results in Th2 differentiation. However, it
is clear from studies using cells from Stat6-deficient mice that Stat6
plays a dominant role in IL-4-mediated Th2 differentiation
(31, 32, 33) and in the T cell expansion over a 3- to 5-day
period that occurred under Th2 culture conditions. Stat6 interacts with
the second, third, and fourth conserved tyrosines (Y575, Y603, and
Y631) of IL-4R
(2, 17, 18). The role of the PTBD
adapters that interact with Y497 in T cell responses to IL-4 was
uncertain.
Here we have shown that Stat6 appears to be both necessary and
sufficient to mediate the IL-4 component of Th2 differentiation. The
finding that T cells expressing a mutant hIL-4R
-chain (Y497F) that
cannot interact with PTBDs are nonetheless fully competent to
differentiate into IL-4-producing cells under the influence of hIL-4
establishes this point. What was more surprising was the finding that
the PTBD proteins did not appear to play a major role in the expansion
of CD4 T cells stimulated under Th2-inducing conditions. CD4 T cells
expressing the Y497F mutant hIL-4R
-chain were as competent as those
expressing WT receptors in such expansion.
Not only were the PTBD proteins not important in this expansion or in
Th2 differentiation, Stat6 was required for both. CD4 T cells from
Stat6-deficient mice failed to polarize to IL-4 production or to show
IL-4-dependent expansion when cultured under Th2 conditions. Arai and
colleagues had previously infected CD4 cells stimulated under Th1
conditions with a RV containing a cDNA for a Stat6-estrogen receptor
fusion protein. Dimerizing the fusion protein with the estrogen analog
4-hydroxytamoxifen activated Stat6, resulting in the induction
of Th2 cytokines in the developing cells and an increase in their
uptake of [3H]thymidine (42). Our
experiments using Stat6VT (35), a constitutively active
Stat-6 mutant, showed that Th2 differentiation and cell expansion in
the absence of IL-4 were equivalent to the IL-4-driven differentiation
and expansion of cells expressing the WT hIL-4R
. Thus, activated
Stat6 appears to be fully responsible for mediating the IL-4-induced
Th2 polarization and cell expansion.
The failure to observe any difference in the behavior of CD4 T cells
expressing the WT or the Y497F mutant hIL-4R
-chains is not likely
to be accounted for by over-expression of the hIL-4R in such cells.
Immunoblotting studies failed to show more receptors on these cells
than on Jurkat cells (data not shown). In addition, we saw no
difference in the relative induction of IL-4-producing cells among
those that expressed large amounts of GFP and those that expressed
small amounts of GFP. Because relative GFP expression levels should
correlate with relative IL-4R expression levels using a RV containing
both cDNAs, there does not appear to be a correlation between the
number of expressed receptors and the magnitude of the response.
The role that PTBD proteins such as IRS2 play in T cell responses needs
to be further clarified. We did show that cells expressing the Y497F
mutant failed to phosphorylate IRS2 in response to IL-4, whereas cells
expressing the WT hIL-4R
-chain showed quite clear phosphorylation
of this adaptor. Whether the PTBD proteins play an important role in
controlling resistance to apoptosis early in their response to IL-4 is
an interesting possibility. However, this was quite difficult to test
in the retroviral infection system, because truly naive T cells are
resistant to infection (activation is required for successful T cell
infection in the retroviral system). Furthermore, primed CD4 T cells
tend to survive quite well. It is possible that IL-4 sparing of T cell
apoptosis before new gene activation is dependent on PTBD proteins, but
determining whether this is true will require additional study. Other
potential IL-4R-mediated functions, such as cell adhesion, cell
migration, and cell-cell interactions, will need to be studied for the
relative importance of PTBD proteins.
The Stat6-dependent induction and activation of Gata3 in response to IL-4 is well established as playing a central role in Th2 differentiation (31, 32, 33, 34, 36, 37). Because activated Stat6 is sufficient to mediate both IL-4-driven Th2 differentiation and cell expansion, it will be interesting to determine whether Gata3 also contributes to IL-4-driven cell proliferation or whether this Stat6 effect is Gata3 independent.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: PTBD, phosphotyrosine binding domain; IRS, insulin receptor substrate; FRIP, IL-4R interacting protein; h, human; PI-3K, phosphatidylinositol 3-kinase; WT, wild type; RV, retrovirus; ThN, null Th cell; GFP, green fluorescence protein; GFP-RV, retroviral vector containing an internal ribosomal entry sequence and humanized GFP cDNA; Stat6VT, the plasmid pcDNA3-Stat6VT containing a constitutively activated Stat6. ![]()
Received for publication February 1, 2001. Accepted for publication April 13, 2001.
| References |
|---|
|
|
|---|
chain: its role in the multiple cytokine receptor complexes and T cell development in XSCID. Annu. Rev. Immunol. 14:179.[Medline]
: Y497 and Y713, but not the STAT6-docking tyrosines, signal protection from apoptosis. J. Immunol. 161:859.
receptors (CD23) on normal human B lymphocytes. J. Exp. Med. 165:1459.
. J. Immunol. 161:1822.
B: direct association and synergistic activation of interleukin-4-induced transcription. Mol. Cell. Biol. 18:3395.This article has been cited by other articles:
![]() |
Y. Y. Wan and R. A. Flavell How Diverse--CD4 Effector T Cells and their Functions J Mol Cell Biol, October 1, 2009; 1(1): 20 - 36. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Guo, G. Wei, J. Zhu, W. Liao, W. J. Leonard, K. Zhao, and W. Paul IL-1 family members and STAT activators induce cytokine production by Th2, Th17, and Th1 cells PNAS, August 11, 2009; 106(32): 13463 - 13468. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. L. Pillemer, Z. Qi, B. Melgert, T. B. Oriss, P. Ray, and A. Ray STAT6 Activation Confers upon T Helper Cells Resistance to Suppression by Regulatory T Cells J. Immunol., July 1, 2009; 183(1): 155 - 163. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhu, T. S. Davidson, G. Wei, D. Jankovic, K. Cui, D. E. Schones, L. Guo, K. Zhao, E. M. Shevach, and W. E. Paul Down-regulation of Gfi-1 expression by TGF-{beta} is important for differentiation of Th17 and CD103+ inducible regulatory T cells J. Exp. Med., February 16, 2009; 206(2): 329 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Quirion, G. D. Gregory, S. E. Umetsu, S. Winandy, and M. A. Brown Cutting Edge: Ikaros Is a Regulator of Th2 Cell Differentiation J. Immunol., January 15, 2009; 182(2): 741 - 745. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Heller, X. Qi, I. S. Junttila, K. A. Shirey, S. N. Vogel, W. E. Paul, and A. D. Keegan Type I IL-4Rs Selectively Activate IRS-2 to Induce Target Gene Expression in Macrophages Sci. Signal., December 23, 2008; 1(51): ra17 - ra17. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhu and W. E. Paul CD4 T cells: fates, functions, and faults Blood, September 1, 2008; 112(5): 1557 - 1569. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. van Panhuys, S.-C. Tang, M. Prout, M. Camberis, D. Scarlett, J. Roberts, J. Hu-Li, W. E. Paul, and G. Le Gros In vivo studies fail to reveal a role for IL-4 or STAT6 signaling in Th2 lymphocyte differentiation PNAS, August 26, 2008; 105(34): 12423 - 12428. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Acacia de Sa Pinheiro, A. Morrot, S. Chakravarty, M. Overstreet, J. H. Bream, P. M. Irusta, and F. Zavala IL-4 induces a wide-spectrum intracellular signaling cascade in CD8+ T cells J. Leukoc. Biol., April 1, 2007; 81(4): 1102 - 1110. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhu, D. Jankovic, A. Grinberg, L. Guo, and W. E. Paul Gfi-1 plays an important role in IL-2-mediated Th2 cell expansion PNAS, November 28, 2006; 103(48): 18214 - 18219. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. L. Tamma, K. W. Chung, T. Patel, S. P. Balan, and S. Pahwa p38 MAPK plays a role in IL-4 synthesis in jacalin plus CD28-stimulated CD4+ T cells--II J. Leukoc. Biol., June 1, 2006; 79(6): 1339 - 1347. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro T-helper cell type-2 regulation in allergic disease Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Woszczek, R. Pawliczak, H.-Y. Qi, S. Nagineni, S. Alsaaty, C. Logun, and J. H. Shelhamer Functional Characterization of Human Cysteinyl Leukotriene 1 Receptor Gene Structure J. Immunol., October 15, 2005; 175(8): 5152 - 5159. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Jenks, B. J. Eisfelder, and J. Miller LFA-1 co-stimulation inhibits Th2 differentiation by down-modulating IL-4 responsiveness Int. Immunol., March 1, 2005; 17(3): 315 - 323. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yang, J. Ochando, A. Yopp, J. S. Bromberg, and Y. Ding IL-6 Plays a Unique Role in Initiating c-Maf Expression during Early Stage of CD4 T Cell Activation J. Immunol., March 1, 2005; 174(5): 2720 - 2729. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Sanchez-Guajardo, J. A. M. Borghans, M.-E. Marquez, S. Garcia, and A. A. Freitas Different Competitive Capacities of Stat4- and Stat6-Deficient CD4+ T Cells during Lymphophenia-Driven Proliferation J. Immunol., February 1, 2005; 174(3): 1178 - 1187. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Oriss, M. Ostroukhova, C. Seguin-Devaux, B. Dixon-McCarthy, D. B. Stolz, S. C. Watkins, B. Pillemer, P. Ray, and A. Ray Dynamics of Dendritic Cell Phenotype and Interactions with CD4+ T Cells in Airway Inflammation and Tolerance J. Immunol., January 15, 2005; 174(2): 854 - 863. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. T. Hart, D. J. Shaffer, S. Akilesh, A. C. Brown, L. Moran, D. C. Roopenian, and P. J. Baker Quantitative Gene Expression Profiling Implicates Genes for Susceptibility and Resistance to Alveolar Bone Loss Infect. Immun., August 1, 2004; 72(8): 4471 - 4479. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Bunting, W.-M. Yu, H. L. Bradley, E. Haviernikova, A. E. Kelly-Welch, A. D. Keegan, and C.-K. Qu Increased numbers of committed myeloid progenitors but not primitive hematopoietic stem/progenitors in mice lacking STAT6 expression J. Leukoc. Biol., August 1, 2004; 76(2): 484 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-R. Yu, R. M. Mahdi, S. Ebong, B. P. Vistica, J. Chen, Y. Guo, I. Gery, and C. E. Egwuagu Cell Proliferation and STAT6 Pathways Are Negatively Regulated in T Cells by STAT1 and Suppressors of Cytokine Signaling J. Immunol., July 15, 2004; 173(2): 737 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cote-Sierra, G. Foucras, L. Guo, L. Chiodetti, H. A. Young, J. Hu-Li, J. Zhu, and W. E. Paul Interleukin 2 plays a central role in Th2 differentiation PNAS, March 16, 2004; 101(11): 3880 - 3885. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Gillespie, R. R. DeMartino, J. Zhu, H. J. Chong, C. Ramirez, C. P. Shelburne, L. A. Bouton, D. P. Bailey, A. Gharse, P. Mirmonsef, et al. IL-10 Inhibits Fc{epsilon}RI Expression in Mouse Mast Cells J. Immunol., March 1, 2004; 172(5): 3181 - 3188. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Monick, L. Samavati, N. S. Butler, M. Mohning, L. S. Powers, T. Yarovinsky, D. R. Spitz, and G. W. Hunninghake Intracellular Thiols Contribute to Th2 Function via a Positive Role in IL-4 Production J. Immunol., November 15, 2003; 171(10): 5107 - 5115. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Blaeser, P. J. Bryce, N. Ho, V. Raman, F. Dedeoglu, D. D. Donaldson, R. S. Geha, H. C. Oettgen, and T. A. Chatila Targeted Inactivation of the IL-4 Receptor {alpha} Chain I4R Motif Promotes Allergic Airway Inflammation J. Exp. Med., October 20, 2003; 198(8): 1189 - 1200. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lohning, A. Richter, T. Stamm, J. Hu-Li, M. Assenmacher, W. E. Paul, and A. Radbruch Establishment of memory for IL-10 expression in developing T helper 2 cells requires repetitive IL-4 costimulation and does not impair proliferation PNAS, October 14, 2003; 100(21): 12307 - 12312. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Mora, L. M. Stephenson, B. Enerson, J. Youn, A. D. Keegan, and M. Boothby New Programming of IL-4 Receptor Signal Transduction in Activated T Cells: Stat6 Induction and Th2 Differentiation Mediated by IL-4R{alpha} Lacking Cytoplasmic Tyrosines J. Immunol., August 15, 2003; 171(4): 1891 - 1900. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Bruns, U. Schindler, and M. H. Kaplan Expression of a Constitutively Active Stat6 In Vivo Alters Lymphocyte Homeostasis with Distinct Effects in T and B Cells J. Immunol., April 1, 2003; 170(7): 3478 - 3487. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Okuda, I. Takahashi, J.-K. Kim, N. Ohta, K. Iwatani, H. Iijima, Y. Kai, H. Tamagawa, T. Hiroi, M.-N. Kweon, et al. Development of Colitis in Signal Transducers and Activators of Transcription 6-Deficient T-Cell Receptor {alpha}-Deficient Mice: A Potential Role of Signal Transducers and Activators of Transcription 6-Independent Interleukin-4 Signaling for the Generation of Th2-Biased Pathological CD4+{beta}{beta}T Cells Am. J. Pathol., January 1, 2003; 162(1): 263 - 271. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dimitrova, A. Skapenko, M. L. Herrmann, R. Schleyerbach, J. R. Kalden, and H. Schulze-Koops Restriction of De Novo Pyrimidine Biosynthesis Inhibits Th1 Cell Activation and Promotes Th2 Cell Differentiation J. Immunol., September 15, 2002; 169(6): 3392 - 3399. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Guo, J. Hu-Li, J. Zhu, C. J. Watson, M. J. Difilippantonio, C. Pannetier, and W. E. Paul In TH2 cells the Il4 gene has a series of accessibility states associated with distinctive probabilities of IL-4 production PNAS, August 6, 2002; 99(16): 10623 - 10628. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rodriguez-Sosa, J. R. David, R. Bojalil, A. R. Satoskar, and L. I. Terrazas Cutting Edge: Susceptibility to the Larval Stage of the Helminth Parasite Taenia crassiceps Is Mediated by Th2 Response Induced Via STAT6 Signaling J. Immunol., April 1, 2002; 168(7): 3135 - 3139. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Grunstein, H. Hakonarson, J. Leiter, M. Chen, R. Whelan, J. S. Grunstein, and S. Chuang IL-13-dependent autocrine signaling mediates altered responsiveness of IgE-sensitized airway smooth muscle Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L520 - L528. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |