| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Thomas E. Starzl Transplantation Institute and Departments of Surgery and
Molecular Genetics and Biochemistry, University of Pittsburgh, Pittsburgh, PA 15213; and
Department of Molecular Preventive Medicine, School of Medicine, and
Department of Surgery and Bioengineering, Institute of Medical Science, University of Tokyo, Tokyo, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and 1
, while in vivo
homing of DC from peripheral s.c. sites to secondary lymphoid tissue of
syngeneic or allogeneic recipients was significantly impaired.
Anti-mIL-10R mAb reversed the effects of mIL-10 on CCR expression and
restored DC homing ability. Retroviral transduction of mIL-10- and
vIL-10-treated DC to overexpress transgenic CCR7 partially restored the
cells’ lymphoid tissue homing ability in allogeneic recipients.
However, CCR7 gene transfer did not reinstate the capacity of
IL-10-treated DC to prime host naive T cells for ex vivo proliferative
responses or Th1 cytokine (IFN-
) production in response to
rechallenge with (donor) alloantigen. These findings suggest that in
addition to their capacity to subvert DC maturation/function and confer
tolerogenic potential on these cells, mIL-10 and vIL-10 regulate DC
migratory responses via modulation of CCR
expression. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mammalian IL-10 is mainly produced by activated lymphocytes, monocytes/macrophages, and other cell types (10). IL-10 down-regulates MHC class II Ag and costimulatory molecule expression (11, 12, 13), IL-12 and proinflammatory cytokine secretion (14, 15), and T cell stimulatory function of several APC (i.e., monocytes, macrophages, and DC). It confers tolerogenic properties on DC (16), induces long-term, Ag-specific anergy in human CD4+ T cells (17), and drives the generation of mouse CD4+ T regulatory 1 cells (18). IL-10 can also exhibit T cell stimulatory properties, including enhancement of thymocyte proliferation and generation of CD8+ T cells (19, 20), exacerbation of organ allograft rejection (21), and graft-vs-host disease (22).
Viral IL-10 (vIL-10), encoded by EBV, is highly homologous to mammalian IL-10 and shares many of its anti-inflammatory properties (23). In addition, it may act directly on T cells to inhibit costimulatory signals mediated via CD28 or CTLA4 (24). It lacks the immunostimulatory properties ascribed to mammalian IL-10, such as augmentation of CTL proliferation and B cell expansion, and can induce local anergy to syngeneic or allogeneic tumors (10). Cardiac allografts transduced with vIL-10 show prolonged survival (25). Recently, we demonstrated that exposure of myeloid DC to vIL-10 protein or retroviral transduction of DC to overexpress the vIL-10 gene impaired their T cell stimulatory capacity and promoted Ag-specific T cell anergy (26). Although there are reports that IL-10 modulates leukocyte migration in vivo, e.g., to suppress leukocyte infiltration into specific tissues (27) or heart allografts (28), there is little information on the influence of IL-10 on chemokine receptor expression by DC or on the migratory capacity of DC either in vitro or in vivo (29).
Chemokines are a group of structurally related polypeptides that have been recognized recently to have critical roles in the selective recruitment of leukocyte subsets to secondary lymphoid organs and to sites of inflammation (30). There are two major groups: the CXC chemokines, in which the two N-terminal cysteines are separated by a single amino acid, and the CC chemokines, in which the two terminal cysteines are adjacent (30). All chemokines exert their activity by binding to single-chain, seven-helix transmembrane G-protein-coupled receptors that are expressed on a variety of leukocytes. Five of the receptors are specific for CXC chemokines (CXCR1–5), 11 are specific for CC chemokines (CCR1–11), and the Duffy Ag receptor binds both CXC and CC chemokines (30, 31, 32). Numerous chemokine receptors have been demonstrated on DC and their progenitors at the transcriptional level in mice and humans and at the protein level in humans (33, 34, 35, 36, 37, 38). Upon maturation, DC undergo a chemokine receptor switch, with down-regulation of inflammatory chemokine receptors (such as CCR1, CCR2, and CCR5), followed by induction of CCR7 (29, 39).
In this study we assessed the impact of mouse IL-10 (mIL-10) and vIL-10 on myeloid DC CCR1, CCR5, and CCR7 expression and on the chemotactic responses of these cells to specific CC chemokines. In addition, we determined the influence of CCR7 expression and IL-10 on the in vivo migratory and T cell stimulatory ability of the DC. We report that exposure of myeloid DC to mIL-10 enhances CCR1 and CCR5, but down-regulates CCR7 gene expression, with consequent effects on chemotactic responses to appropriate agonist ligands; in addition, mIL-10 and vIL-10 inhibit the homing ability of these DC in vivo. vIL-10 exerted similar effects, but its overall activity was less pronounced. Studies conducted with CCR7-transduced DC revealed that overexpression of CCR7 could reverse IL-10-induced inhibition of migration, but not impairment of the capacity of the cells to prime host T cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C57BL10 (H2b; B10) and C3H/HeJ (H2k C3H) mice were purchased from The Jackson Laboratory (Bar Harbor, ME). They were housed in the specific pathogen-free facility of the University of Pittsburgh Central Animal Facility, received standard laboratory chow and tap water ad libitum, and were used for all experiments at 8–12 wk of age.
Propagation and purification of DC
BM-derived DC were propagated using procedures similar to those reported initially by Inaba et al. (5), with some modifications. In brief, freshly isolated BM cells from femurs and tibias of normal B10 mice were depleted of T and B lymphocytes and granulocytes with an mAb mixture comprising rat IgG anti-B220 (RA3-3A1/6.1), anti-Lyt 2 (2.43), and anti-L3T4 (GK1.5; all generated from hybridomas provided by American Type Culture Collection, Manassas, VA) and anti-mouse Gr-1 mAb (PharMingen, San Diego, CA), plus rabbit complement (Accurate Chemical and Scientific, Westbury, NY). The mixture-depleted BM cells were then cultured overnight in RPMI 1640 (Life Technologies, Gaithersburg, MD) supplemented with antibiotics, and 10% (v/v) heat-inactivated FCS. Twenty-four hours later (day 1), nonadherent cells were removed carefully and replated at 5 x 105/ml with 1000 U/ml recombinant mouse GM-CSF and 1000 U/ml recombinant murine IL-4 (gifts from Schering Plough, Kenilworth, NJ) together with 1–500 ng/ml either recombinant mIL-10 or recombinant vIL-10 (provided by K. W. Moore, DNAX Research Institute, Palo Alto, CA). The cells were harvested on day 6. CD11c+ cells were immunobead-sorted by labeling with a bead-conjugated anti-mouse CD11c mAb (Miltenyi Biotec, Auburn, CA) followed by passage through a positive selection paramagnetic column (Miltenyi Biotec).
Endocytosis assay
To determine their endocytic activity, untreated DC or DC exposed to IL-10 were cultured for 2 h at 37°C with FITC-dextran (Sigma, St. Louis, MO) at a final concentration of 1 mg/ml. After incubation the cells were washed three times with ice-cold PBS, then analyzed immediately by flow cytometry.
Mixed leukocyte reaction
The ability of IL-10-exposed DC to stimulate freshly isolated,
naive, allogeneic T cells was determined in primary MLR. Normal C3H
splenic T lymphocytes were purified by passage through nylon wool
columns (30 min, 37°C), then cultured with -irradiated DC
that had been pre-exposed to different concentrations of mIL-10 or
vIL-10 protein in 96-well microculture plates for 72 h. For the
final 18 h of culture, 1 µCi [3H]TdR was
added to each well. The cultures were harvested onto glass-fiber filter
disks using a multiple cell harvester, and thymidine incorporation was
quantified using a liquid scintillation counter. The ability of CCR7
gene-transduced DC (see below) to stimulate freshly isolated,
naïve, allogeneic T cells in primary MLR was determined in the
same manner.
Flow cytometry
B10 DC were characterized by cytofluorography, as previously described (40, 41), using a panel of mAb including those directed against the mouse DC-restricted Ag CD11c, MHC class II (IAb), CD80, or CD86 (all mAbs were from PharMingen and were used at saturating concentrations). Two-color analysis was performed on gated CD11c+ cells, using a Coulter EPICS Elite (Coulter, Hialeah, FL) (38).
Chemotaxis assay
In vitro chemotaxis analysis was performed as described
previously (42). Recombinant macrophage inflammatory
protein (MIP)-1, MIP-1, or MIP-3 (R&D Systems, Minneapolis,
MN) were diluted in assay medium without FCS, and 600-µl aliquots
were placed in 24-well culture plates (Costar, Cambridge, MA).
Transwell culture inserts of 6.5-mm diameter and 5-µm pore size
(Costar) were placed in each well, and 5 x
105 DC in 100 µl were added to the upper
chamber. After incubation at 37°C in 5% CO2
for 2 h, the cells that had migrated to the bottom chamber were
harvested and counted by light microscopy.
RT-PCR
Total RNA was isolated from cultured, immunobead-sorted
CD11c+ DC using RNAzol (Life Technologies, Grand
Island, NY) and used for cDNA synthesis. The cDNAs were
used as templates for PCR (94°C for 1 min, 57°C for 1
min, and 74°C for 1 min), and 26 cycles were performed using primers
specific for mCCR1 (forward, 5'-TCTAGTGTTCATCATTGGAGTGGTG;
reverse, 5'-GACGCACGGCTTTGACCTTCTTCTC), mCCR5 (forward, 5'-
ACTTGGGTGGTGGCTGTGTTT; reverse, 5'-TTGTCTTGCTGGAAAATTGAA), and
mCCR7 (forward, 5'-ACAGCGGCCTCCAGAAGAAGAGCGC; reverse,
5'-TGACGTCATAGGCAATGTTGAGCTG). To ensure the quality of the procedure,
RT-PCR was also performed using primers specific for -actin.
In vivo DC migration
Immediately before their injection, DC were labeled with the red fluorescence marker PKH-26 Red (Sigma) according to the manufacturer’s instructions. In brief, the DC were incubated with 10-6 M PKH-26 at room temperature for 5 min, then rinsed extensively with HBSS. Viability was determined by trypan blue exclusion. Mice were injected s.c. in the hind footpad with 106 PKH-26-labeled DC. After 48 h, animals were killed, and the draining popliteal lymph nodes were removed. The nodes were gently disrupted, and 2 x 106 cells/ml were suspended in PBS and 1% paraformaldehyde. Aliquots (200 µ1) of this suspension were centrifuged onto glass slides at 800 rpm for 3 min using a cytocentrifuge (Shandon, Pittsburgh, PA). The slides were then examined by fluorescence microscopy (Olympus BH-2 and Olympus Provis AX-70; Tokyo, Japan), and the number of PKH-26-labeled cells was determined. The total number of migrated cells was determined as the product of fluorescent cells per ml and the total volume (in ml) of cell suspension.
Blocking of the mIL-10R
Binding of mIL-10 to its cognate receptor was inhibited using blocking rat anti-mIL-10R mAb (1 µg/ml) (43) provided by Kevin W. Moore (DNAX). The mAb was added to the DC culture medium in the presence or the absence of mIL-10 protein on day 1. On day 6 the cells were harvested, and CD11c cells were sorted as described above.
CCR7 gene transfer
MFG-Zeo and MFG-CCR7 plasmid vectors were transfected into the BOSC 23 ecotropic packaging cell line to obtain supernatant containing recombinant retrovirus encoding Zeo and CCR7, respectively (44). Transduction efficiency was determined by flow cytometry using MFG-enhanced green fluorescent protein. Retroviral transduction of DC was performed by the centrifugal enhancement method (45). Briefly, BM-derived cells were harvested on day 2; 106 cells were suspended in 1 ml retroviral supernatant with 1000 U/ml GM-CSF, 1000 U/ml IL-4, either mIL-10 (100 ng/ml) or vIL-10 (100 ng/ml), and 8 mg/ml Polybrene (Sigma), then centrifuged at 2500 x g for 2 h. The transduction process was repeated on days 3 and 4. During this treatment period the DC were exposed continuously to either mIL-10 or vIL-10. The cells were harvested for study on day 6.
Ex vivo analysis of the influence of gene-modified DC on allogeneic T cell function
The influence of CCR7-transduced DC on host anti-donor
T cell responses was determined ex vivo by MLR. CCR7 gene-modified DC
(1 x 106) were injected s.c. into one hind
footpad of allogeneic C3H (H2k) mice. The animals
were killed 7 days later. Popliteal lymph node lymphocytes were
isolated and restimulated in secondary MLR with various numbers of
-irradiated B10 splenocytes for 72 h. For the final 18 h
of culture, 1 µCi of [3H]TdR was added to
each well. The cultures were harvested, and thymidine incorporation was
quantified as described above. Cytokine levels in 48-h cultures
(stimulator-responder ratio = 1:10) were also determined.
ELISA
ELISA for mouse IFN-, IL-4, and IL-10 in culture
supernatants of restimulated T cells was performed using reagents
purchased from PharMingen and following the recommended procedures.
The limit of sensitivity for detection of each cytokine was 19
pg/ml.
Statistics
Comparisons were made using the two-tailed unpaired Student’s t test and ANOVA, as appropriate. Values of p < 0.05 were regarded as significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
MHC class II Ag and costimulatory molecule (CD40, CD80, and CD86)
expression was examined on mIL-10- or vIL-10-treated,
CD11c+-gated DC by two-color staining as
described in Materials and Methods. Exposure to either
mIL-10 (100 ng/ml) or vIL-10 (100 ng/ml) from day 1 of culture reduced
the percentage of CD11c+ DC positive for MHC
class II molecules (IAb), CD40, CD80, and CD86
compared with untreated DC (Fig. 1
A). These data showed that
the phenotypic maturation of the DC was inhibited by exposure to mIL-10
or vIL-10 early during culture. When mIL-10 or vIL-10 was added from
day 4 of culture (instead of day 1), no inhibitory effect on phenotypic
maturation was observed. Thus, as reported for human DC
(16), more mature mouse DC appear to be refractory to
IL-10.
|
Exposure to IL-10 markedly impairs DC allostimulatory activity
To ascertain whether the reduction in surface MHC and
costimulatory molecule expression and the increase in endocytic
activity were associated with impaired T cell stimulatory activity, the
capacity of IL-10-treated, immunobead-sorted DC to induce proliferation
of naive allogeneic T cells was determined. Compared with control DC,
DC pre-exposed to mIL-10 or vIL-10 exhibited significantly reduced
allostimulatory activity in primary MLR. Significant inhibition
(p < 0.01) was achieved with as little as 1
ng/ml, whereas maximal inhibition was achieved for each protein at 100
ng/ml (Fig. 1
B). This latter concentration of IL-10 was used
in all subsequent experiments.
Exposure to IL-10 differentially affects the chemotactic responses of DC to specific CC chemokines
We next evaluated the chemotactic responses of mIL-10- or
vIL-10-treated DC to MIP-1 (ligand for CCR1 and CCR5), MIP-1
(ligand for CCR5), and MIP-3 (ligand for CCR7; Fig. 2A). These CC chemokines were
chosen because there is evidence that IL-10 inhibits MIP-1 and
MIP-3 expression by human monocytes/macrophages and DC (29, 46). It has also been reported that IL-10 selectively
up-regulates the expression of CCR1, -2, and -5 in human monocytes
(47), and that CCR1, -5, and -7 play critical roles in DC
migration in mice (48). Untreated DC exhibited the most
marked migratory responses to MIP-3 and responded to a lesser
extent to MIP-1 and MIP-1. Both IL-10 proteins enhanced the
cells’ migratory capacity in response to MIP-1, but reduced their
chemotactic response to MIP-3. IL-10-treated DC exhibited a more
pronounced enhancement of migration in response to MIP-1. Given
that, unlike MIP-3, MIP-1 binds to both CCR1 and CCR5, the effect
of IL-10 on DC chemotaxis may have been caused through the
up-regulation/activation of either CCR1 or CCR5.
|
and almost no
migration in response to MIP-1 and MIP-1 (Fig. 2B).
LPS- stimulated DC exposed to IL-10 showed strikingly diminished
chemotactic responses to MIP-3. In the case of mIL-10, migration was
almost totally inhibited. These findings are consistent with a
suppressive effect of both IL-10 molecules on DC maturation. mIL-10 enhances CCR5, but down-regulates CCR7, expression on DC
Chemokine receptor (CCR5/CCR7) expression on murine DC has been
shown previously to correlate with the cells’ state of maturation and
in vivo homing ability (38). To assess the impact of
exposure to mIL-10 or vIL-10 on CCR expression by DC, we performed
RT-PCR to evaluate the transcription of mRNA encoding the MIP-1
ligands CCR1 and CCR5 and the MIP-3 ligand CCR7 (Fig. 3). Messenger RNA was extracted from
immunobead-sorted CD11c+ DC that had been
cultured in the absence or the presence of mIL-10 or vIL-10 for 6 or 9
days as described above. RT-PCR analysis revealed that expression of
CCR1 and CCR5 mRNA was up-regulated by mIL-10 at both time points,
whereas CCR7 mRNA expression was inhibited compared with that in
untreated DC. These changes were also evident in DC exposed to mIL-10
from days 1–6 of culture, then stimulated for 6 h with LPS (10
µg/ml) in the continued presence of mIL-10. vIL-10 showed similar,
but less pronounced, effects (Fig. 3). The absence of migration of LPS-
plus IL-10-treated DC in response to MIP-1 or MIP-1 (Fig. 2B) despite the increased levels of CCR1 and CCR5 mRNA (Fig. 3) appears contradictory. However, the observation is in agreement with
the recent finding that mIL-10 generates functional CCR1, CCR2, and
CCR5 decoy receptors on the surface of DC exposed to microbial Ag (LPS)
or to an inflammatory environment (29).
|
We next addressed the impact of exposure to IL-10 on the
subsequent capacity of DC to migrate in vivo from the periphery to
secondary lymphoid tissue. We determined the capacity of IL-10-treated
unstimulated or LPS-stimulated immunobead-sorted
CD11c+ DC labeled with PKH-26 and inoculated s.c.
in the hind footpad to migrate to the draining popliteal lymph node.
Migrated cells were counted by fluorescence microscopy in cytospin
preparations of lymph node cell suspensions. Both mIL-10- and
vIL-10-treated DC showed significantly diminished capacity to migrate
to the draining lymph node in syngeneic (p <
0.05) and allogeneic recipients (p < 0.01;
Fig. 4). In vitro stimulation of
untreated DC with LPS (as described above) enhanced their migration in
syngeneic hosts, but this augmented activity was also inhibited by
exposure to IL-10, in particular mIL-10, during their propagation
(Fig. 4).
|
To confirm the specificity of the effects of mIL-10, we blocked
the IL-10R on cultured DC before their exposure to IL-10 using
anti-mIL-10R mAb (1 µg/ml). Blocking of the IL-10R not only prevented
the effects of mIL-10 on CCR5 and CCR7 gene expression by DC (Fig. 5A), but also substantially
restored the capacity of these cells to home to secondary lymphoid
tissue of both syngeneic and allogeneic recipients (Fig. 5B).
|
and the in vivo homing capacity of IL-10-treated DC
We next determined the influence of CCR7 expression on the in
vitro chemotaxis and in vivo trafficking of IL-10-treated DC. DC were
retrovirally transduced to express CCR7 by the centrifugal transduction
method, then were exposed to mIL-10 or vIL-10 as described above. As
shown in Fig. 6A, CCR7 was
successfully transduced to both untreated and IL-10-treated DC. The
transduction efficiency was the same (43%) for IL-10-treated and
control DC, as determined using the MFG-enhanced green fluorescent
protein vector and flow cytometric analysis. CCR7 transduction did not
alter MHC or costimulatory molecule expression (data not shown) or the
allostimulatory capacity of DC in primary MLR (Fig. 7A). Due to the fact that on
day 6 of culture BM-derived DC generated with GM-CSF and IL-4 were
composed of a mixed population of immature
(MHC-IIlow, CD86low; Fig. 1A) and mature (MHC-IIhigh,
CD86high; Fig. 1A) DC, it was not
surprising that a subpopulation of control (nontreated) DC migrated in
response to MIP-3 (Fig. 6B). Treatment of DC with mIL-10
or vIL-10 diminished their chemotactic response to MIP-3, a result
that agrees with the observation that both cytokines reduce the
expression of CCR7 mRNA in DC (Fig. 3). The phenomenon was more
pronounced with mIL-10. Retroviral CCR7 transduction partially restored
the response of mIL-10 treated-DC to MIP-3 and fully restored the
chemotatic response of vIL-10-treated DC (Fig. 6B).
|
|
C). The number of donor DC detected in recipient lymphoid
tissue was fewer when DC generated in the presence of mIL-10 or vIL-10
were administered (Fig. 6C). Compared with nontransduced
control DC, CCR7 gene transfer partially restored the homing ability of
mIL-10-treated DC and fully restored that of vIL-10-transduced DC (Fig. 6C). As expected, and as a control for CCR7 transduction
efficiency, CCR7-transduced control DC exhibited an increased homing
capacity to the popliteal lymph node in relation to nontransduced
control DC (data not shown). CCR7 gene transfer indirectly augments the in vivo allostimulatory ability of normal, but not IL-10-treated, DC
To evaluate the influence of CCR7 overexpression on the in vivo
allostimulatory activity of control or IL-10-treated DC, sorted B10
CD11c+ control or gene-transduced DC pre-exposed
to IL-10 were injected s.c. (106) into the hind
footpad of C3H recipients. Ex vivo responses of draining lymph node
cells to rechallenge with donor Ag were determined 7 days later. CCR7
transduction of control DC significantly increased their capacity to
prime host T cells for ex vivo responsiveness to donor alloantigen
(Fig. 7B). mIL-10- or vIL-10-treated, CCR7-transduced DC
failed to induce enhanced responses, even though transgene expression
significantly increased the migration of these cells to host lymphoid
tissue (Fig. 6C). IFN- production by draining lymph node
cells restimulated with allogeneic B10 splenocytes in vitro was
markedly increased in response to that by CCR7-transduced control DC
(Fig. 7C). By contrast, CCR7 transduction of IL-10-treated
DC only slightly increased their capacity to prime host cells for
subsequent IFN- responses (Fig. 7C). Neither IL-4 nor
IL-10 secretion by restimulated splenocytes was detected (data not
shown).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
,
TNF-, or CD40 cross-linking) DC down-regulate inflammatory chemokine
receptors (CCR1, CCR2, and CCR5) followed by induction of CCR7. The
purpose of this study was to evaluate and compare the influence of
mIL-10 and vIL-10, cytokines known to inhibit DC maturation and
function, on chemotaxis and tissue homing of murine BM-derived myeloid
DC generated in vitro in response to GM-CSF and IL-4. In parallel
studies we sought to ascertain how exposure to IL-10 might affect CCR5
and CCR7 expression, shown previously to be modulated during DC
maturation, and the chemotactic responses of the DC to appropriate
agonist ligands (MIP-1 and MIP-3). Our investigations revealed
that both m- and vIL-10 differentially affected the expression of
transcripts for CCR5 and CCR7. Whereas CCR5 mRNA expression was
increased, CCR7 mRNA levels were decreased by exposure of BM-derived DC
to either IL-10 molecule. This was associated with augmentation and
inhibition, respectively, of chemotactic responses to their respective
agonists, MIP-1 and MIP-3. These results suggest that the
IL-10-induced modulation of chemotactic responses of murine myeloid DC
to CC chemokines may be mediated by changes in the expression of their
respective receptors.
The findings are in keeping with the well-recognized ability of IL-10
to inhibit the maturation of myeloid DC, as reported in this and
previous studies (10, 11, 12, 13). They are also consistent with
reports of selective CCR expression and polarized responses to
chemokines by immature compared with mature DC of different species
(48, 49, 50). Thus, others have observed recently that
immature monkey DC express CCR5 and migrate in response to MIP-1,
whereas CD40 ligand-matured DC switch expression to CCR7 and respond
exclusively to MIP-3 and 6-Ckine (49). In the
mouse, mature or cytokine-activated, but not quiescent, skin,
Langerhans cells express CCR7 mRNA (50), whereas
maturation stimuli, such as TNF-, down-regulate CCR1, CCR2, and CCR5
and up-regulate CCR7 mRNA in BM-derived DC (48). The CCR7
ligands, MIP-3 and 6-Ckine, are potent and selective
chemoattractants of mature murine BM-derived DC (51) and
may play an important role in homing of DC to lymphoid tissues.
The present observations are also consistent with recent reports that
IL-10 increases CCR5 expression in human monocytes by increasing the
half-life of the mRNA (37). Another immunosuppressive
cytokine, TGF-1, that, like IL-10, suppresses DC maturation and
function (8) inhibits the expression of CCR7 transcripts
in DC and their precursors derived from mouse hemopoietic progenitor
cells (52). In addition, the migration of these cells in
response to MIP-3 is suppressed. Furthermore, TGF1 enhances CCR5
expression by human monocyte-derived DC, concomitant with enhanced
chemotactic migratory responses to its inflammatory ligand, RANTES
(53). In keeping with the present findings concerning the
capacity of IL-10 to down-modulate LPS-induced expression of CCR7 and
chemotatic activity in response to MIP-3, TGF-1 has been shown to
exert similar effects on TNF--stimulated human DC
(52).
Our findings clearly show that in vivo homing to secondary lymphoid
tissue of myeloid DC pre-exposed to IL-10 and thus retaining an
immature phenotype was markedly inhibited compared with that of
untreated DC. Although the role of IL-10 in leukocyte trafficking in
vivo remains unclear, insights provided by IL-10 knockout mice suggest
that it suppresses T cell and macrophage accumulation in transplanted
tissue and, therefore, may confer protection against rejection
(28). Immature DC may be converted in vivo into mature DC
by extracellular stimuli, including TNF-, LPS, and CD40 ligation in
sites of inflammation, such as skin, and may lose their responsiveness
to proinflammatory chemokines (39). In turn, CCR7 may be
induced in mature DC, and these cells may acquire responsiveness to
MIP-3, which is specifically expressed in T cell-rich areas of
secondary lymphoid tissue where DC home to become interdigitating DC
(38, 51). These properties may account for the
accumulation of Ag-loaded mature DC in T-dependent areas of secondary
lymphoid tissue. We showed that IL-10 enhanced MIP-1-mediated
chemotaxis via up-regulation of CCR5 in DC, while the chemotactic
migratory activity of DC for MIP-3 was inhibited by IL-10 via
down-regulation of CCR7 expression. Collectively, these observations
suggest that IL-10 is involved in the trafficking behavior of immature
and mature DC via regulating chemotaxis to CC (and probably other)
chemokines.
To directly examine the influence of CCR7 expression on control and
IL-10-treated DC migration in vivo, we examined the functions of DC
genetically modified to express high levels of CCR7. Our results show
that CCR7 transduction enhanced the ability of the control and, to a
lesser extent, the IL-10-treated DC to migrate to draining lymph nodes
within 24 h of injection. Its expression appeared to play an
important role in promoting the migration of these cells from
peripheral sites to secondary lymphoid tissue. Moreover, we were able
to demonstrate that enhanced migration of CCR7-transduced control DC,
but not CCR7-transduced IL-10-treated DC, was associated with enhanced
priming of recipient T cells manifested by augmented ex vivo
proliferative and IFN- responses upon rechallenge with alloantigen.
Because retroviral transduction did not affect the expression of
maturation markers on the DC, it is possible that CCR7-transduced,
IL-10-treated DC retained an immature APC phenotype (low levels of
surface costimulatory molecules) after homing to T cell areas of
lymphoid tissue. This may explain the lack of T cell allostimulatory
potential of these APC.
We and others have demonstrated previously that exposure of myeloid DC to m- or vIL-10 impairs their maturation and T cell stimulatory capacity (14, 26) and that either treatment of DC with IL-10 or retroviral delivery of vIL-10 to DC induces allospecific T cell hyporesponsiveness (16, 26). In the present study we have extended these observations to show that inhibition of DC maturation by v- or mIL-10 is associated with up-regulation of mRNA-encoding receptors for inflammatory chemokines (CCR1, CCR5) and down-regulation of CCR7 mRNA expression. The impaired homing capacity of IL-10-treated DC to secondary lymphoid tissue, probably linked to decreased CCR7 expression, may be another component of the immunosuppressive effect of IL-10.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Angus W. Thomson, Department of Surgery, University of Pittsburgh Medical Center, W1544 Biomedical Science Tower, 200 Lothrop Street, Pittsburgh, PA 15213. E-mail address: thomsonaw{at}msx.upmc.edu
3 Abbreviations used in this paper: DC, dendritic cells; BM, bone marrow; vIL-10, viral IL-10; mIL-10, mouse IL-10; MIP, macrophage-inflammatory protein; MFI, mean fluorescence intensity.
Received for publication October 2, 2000. Accepted for publication April 5, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
cooperate in the generation of dendritic Langerhans cells. Nature 360:258.[Medline]
. J. Exp. Med. 179:1109.1 and TNF- on the development of dendritic cells from progenitors in mouse bone marrow. Stem Cells 15:144.[Medline]
and is highly expressed in human dendritic cells. J. Exp. Med. 186:837. production is induced by bacterial lipopolysaccharide and interaction with allogeneic T cells. Transplant. Immunol. 8:17.[Medline]
expression by IL-10: differential sensitivities in human blood monocytes and alveolar macrophages. J. Immunol. 155:4412.[Abstract]
are potent chemoattractants for in vitro- and in vivo-derived dendritic cells. J. Immunol. 162:3859.1 of murine bone marrow hematopoietic progenitor cell-derived different subset of dendritic cells. Blood 93:3225.1 reciprocally controls chemotaxis of human peripheral blood monocyte-derived dendritic cells via chemokine receptors. J. Immunol. 164:2285.This article has been cited by other articles:
|
|
 |
|
  A. Mancino, T. Schioppa, P. Larghi, F. Pasqualini, M. Nebuloni, I-H. Chen, S. Sozzani, J. M. Austyn, A. Mantovani, and A. Sica Divergent effects of hypoxia on dendritic cell functions Blood, November 1, 2008; 112(9): 3723 - 3734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. L. Tilley, M. Jaradat, C. Stapleton, D. Dixon, X. Hua, C. J. Erikson, J. G. McCaskill, K. D. Chason, G. Liao, L. Jania, et al. Retinoid-Related Orphan Receptor {gamma} Controls Immunoglobulin Production and Th1/Th2 Cytokine Balance in the Adaptive Immune Response to Allergen J. Immunol., March 1, 2007; 178(5): 3208 - 3218. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Oikawa, Y. Kamimura, H. Akiba, H. Yagita, K. Okumura, H. Takahashi, M. Zeniya, H. Tajiri, and M. Azuma Preferential Involvement of Tim-3 in the Regulation of Hepatic CD8+ T Cells in Murine Acute Graft-versus-Host Disease J. Immunol., October 1, 2006; 177(7): 4281 - 4287. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. R. Garrod, C. K. Chang, F.-C. Liu, T. V. Brennan, R. D. Foster, and S.-M. Kang Targeted Lymphoid Homing of Dendritic Cells Is Required for Prolongation of Allograft Survival J. Immunol., July 15, 2006; 177(2): 863 - 868. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. D. de Gruijl, C. C. Sombroek, S. M. Lougheed, D. Oosterhoff, J. Buter, A. J. M. van den Eertwegh, R. J. Scheper, and H. M. Pinedo A Postmigrational Switch among Skin-Derived Dendritic Cells to a Macrophage-Like Phenotype Is Predetermined by the Intracutaneous Cytokine Balance. J. Immunol., June 15, 2006; 176(12): 7232 - 7242. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Cumberbatch, K. Clelland, R. J. Dearman, and I. Kimber Impact of Cutaneous IL-10 on Resident Epidermal Langerhans' Cells and the Development of Polarized Immune Responses J. Immunol., July 1, 2005; 175(1): 43 - 50. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. B. Gurney, J. Elliott, H. Nassanian, C. Song, E. Soilleux, I. McGowan, P. A. Anton, and B. Lee Binding and Transfer of Human Immunodeficiency Virus by DC-SIGN+ Cells in Human Rectal Mucosa J. Virol., May 1, 2005; 79(9): 5762 - 5773. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Beckebaum, X. Zhang, X. Chen, Z. Yu, A. Frilling, G. Dworacki, H. Grosse-Wilde, C. E. Broelsch, G. Gerken, and V. R. Cicinnati Increased Levels of Interleukin-10 in Serum from Patients with Hepatocellular Carcinoma Correlate with Profound Numerical Deficiencies and Immature Phenotype of Circulating Dendritic Cell Subsets Clin. Cancer Res., November 1, 2004; 10(21): 7260 - 7269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bhattacharyya, P. Sen, M. Wallet, B. Long, A. S. Baldwin Jr, and R. Tisch Immunoregulation of dendritic cells by IL-10 is mediated through suppression of the PI3K/Akt pathway and of I{kappa}B kinase activity Blood, August 15, 2004; 104(4): 1100 - 1109. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. F. Nolan, V. Strong, D. Soler, P. J. Fairchild, S. P. Cobbold, R. Croxton, J.-A. Gonzalo, A. Rubio, M. Wells, and H. Waldmann IL-10-Conditioned Dendritic Cells, Decommissioned for Recruitment of Adaptive Immunity, Elicit Innate Inflammatory Gene Products in Response to Danger Signals J. Immunol., February 15, 2004; 172(4): 2201 - 2209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Fernandez, P. Jose, M. G. Avdiushko, A. M. Kaplan, and D. A. Cohen Inhibition of IL-10 Receptor Function in Alveolar Macrophages by Toll-Like Receptor Agonists J. Immunol., February 15, 2004; 172(4): 2613 - 2620. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. L. Colvin, A. E. Morelli, A. J. Logar, A. H. Lau, and A. W. Thomson Comparative evaluation of CC chemokine-induced migration of murine CD8{alpha}+ and CD8{alpha}- dendritic cells and their in vivo trafficking J. Leukoc. Biol., February 1, 2004; 75(2): 275 - 285. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Brandt, S. Bulfone-Paus, D. C. Foster, and R. Ruckert Interleukin-21 inhibits dendritic cell activation and maturation Blood, December 1, 2003; 102(12): 4090 - 4098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A H Lau, A de Creus, L Lu, and A W Thomson Liver tolerance mediated by antigen presenting cells: fact or fiction? Gut, August 1, 2003; 52(8): 1075 - 1078. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Seifarth, S. Pop, B. Liu, C. P. Wong, and R. Tisch More Stringent Conditions of Plasmid DNA Vaccination Are Required to Protect Grafted Versus Endogenous Islets in Nonobese Diabetic Mice J. Immunol., July 1, 2003; 171(1): 469 - 476. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Lateef, S. Fleming, G. Halliday, L. Faulkner, A. Mercer, and M. Baird Orf virus-encoded interleukin-10 inhibits maturation, antigen presentation and migration of murine dendritic cells J. Gen. Virol., May 1, 2003; 84(5): 1101 - 1109. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Kobie, R. S. Wu, R. A. Kurt, S. Lou, M. K. Adelman, L. J. Whitesell, L. V. Ramanathapuram, C. L. Arteaga, and E. T. Akporiaye Transforming Growth Factor {beta} Inhibits the Antigen-Presenting Functions and Antitumor Activity of Dendritic Cell Vaccines Cancer Res., April 15, 2003; 63(8): 1860 - 1864. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Woltman and C. van Kooten Functional modulation of dendritic cells to suppress adaptive immune responses J. Leukoc. Biol., April 1, 2003; 73(4): 428 - 441. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Hou, Y. Wu, S. Sun, M. Shi, Y. Sun, C. Yang, G. Pei, Y. Gu, C. Zhong, and B. Sun Pertussis Toxin Enhances Th1 Responses by Stimulation of Dendritic Cells J. Immunol., February 15, 2003; 170(4): 1728 - 1736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Gao, X.-Y. Zhou, Y. Yashiro-Ohtani, Y.-F. Yang, N. Sugimoto, S. Ono, T. Nakanishi, S. Obika, T. Imanishi, T. Egawa, et al. The unique target specificity of a nonpeptide chemokine receptor antagonist: selective blockade of two Th1 chemokine receptors CCR5 and CXCR3 J. Leukoc. Biol., February 1, 2003; 73(2): 273 - 280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. J. M. de Vries, D. J. E. B. Krooshoop, N. M. Scharenborg, W. J. Lesterhuis, J. H. S. Diepstra, G. N. P. van Muijen, S. P. Strijk, T. J. Ruers, O. C. Boerman, W. J. G. Oyen, et al. Effective Migration of Antigen-pulsed Dendritic Cells to Lymph Nodes in Melanoma Patients Is Determined by Their Maturation State Cancer Res., January 1, 2003; 63(1): 12 - 17. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. G. Brinker, H. Garner, and J. R. Wright Surfactant protein A modulates the differentiation of murine bone marrow-derived dendritic cells Am J Physiol Lung Cell Mol Physiol, January 1, 2003; 284(1): L232 - L241. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Martin, G. M. del Hoyo, F. Anjuere, C. F. Arias, H. H. Vargas, A. Fernandez-L, V. Parrillas, and C. Ardavin Characterization of a new subpopulation of mouse CD8alpha + B220+ dendritic cells endowed with type 1 interferon production capacity and tolerogenic potential Blood, June 28, 2002; 100(2): 383 - 390. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Yang, M. Chen, R. Wu, L. B. Fialkow, J. S. Bromberg, M. McDuffie, A. Naji, and J. L. Nadler Suppression of Autoimmune Diabetes by Viral IL-10 Gene Transfer J. Immunol., June 15, 2002; 168(12): 6479 - 6485. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Oberholzer, C. Oberholzer, K. S. Bahjat, R. Ungaro, C. L. Tannahill, M. Murday, F. R. Bahjat, Z. Abouhamze, V. Tsai, D. LaFace, et al. Increased Survival in Sepsis by In Vivo Adenovirus-Induced Expression of IL-10 in Dendritic Cells J. Immunol., April 1, 2002; 168(7): 3412 - 3418. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
