|
|
||||||||


*
Division of Molecular Medicine and
School of Biological Sciences, University of Auckland, Auckland, New Zealand
| Abstract |
|---|
|
|
|---|
-chain in a zinc-dependent mode but not to the generic MHC class
II
-chain. The results from analysis by light scattering indicate
that SPE-J exists as a dimer in solution above concentrations of 4.0
mg/ml. Moreover, SPE-J induced a rapid homotypic aggregation of
LG-2 cells, suggesting that this toxin might cross-link MHC class II
molecules on the cell surface by building tetramers of the type
HLA-DR
SPE-JSPE-JHLA-DR
. SPE-I preferably stimulates T cells
bearing the V
18.1 TCR, which is not targeted by any other known SAg.
SPE-J almost exclusively stimulates V
2.1 T cells, a V
that is
targeted by several other streptococcal SAgs, suggesting a specific
role for this T cell subpopulation in immune defense. Despite a primary
sequence diversity of 51%, SPE-J is functionally indistinguishable
from SPE-C and might play a role in streptococcal disease, which has
previously been addressed to SPE-C. | Introduction |
|---|
|
|
|---|
regions (15, 16). This
trimolecular complex subsequently cross-links a large number of APCs
and T cells resulting in the production of high systemic levels
of the cytokines TNF-
and IL-1
and of T cell mediators, such as
IL-2 and IFN-
(8, 17, 18, 19). Thus far, four streptococcal SAgs have been identified after purification from cell culture supernatants. These are SPE-A (20), SPE-C (21), streptococcal mitogenic exotoxin Z (SMEZ) (22), and streptococcal SAg (SSA) (23). Recently, two novel sag genes (spe-g and spe-h) and one incomplete sag gene (spe-j) have been identified by screening the incomplete S. pyogenes M1 genome database at Oklahoma University (24, 25). The predicted superantigenic properties of SPE-G and SPE-H have been confirmed by biochemical and immunological analysis of the corresponding recombinant proteins (24).
SPE-B and SPE-F were originally added to the list of streptococcal SAgs, but this has been controversial. Both proteins are genetically unrelated to the streptococcal and staphylococcal SAgs, and the superantigenic properties of SPE-B (streptococcal cysteine protease) were shown to be due to contamination (15).
There are now crystal structures for 11 SAgs: SPE-A (26),
SPE-C (27), SPE-H (28), SMEZ-2
(28), and SSA (29), and the staphylococcal
toxins SEA (30), SEB (31), SEC2
(32), SED (33), SEH (34), and
TSST (35). Despite the limited primary sequence homology
(sometimes <25%), all structures show a conserved folding pattern,
comprising a NH2-terminal
-barrel globular
domain and a COOH-terminal globular domain based on a
-grasp
motif.
All examined staphylococcal SAgs, as well as the streptococcal SSA and
SPE-A, have a generic binding site for the invariant
-chain of MHC
class II located in the NH2-terminal domain
(10, 19). In contrast, SPE-C, SPE-G, SPE-H, and all SMEZ
variants bind the polymorphic MHC class II
-chain, probably mediated
by a zinc coordination complex between three SAg residues and the
highly conserved His81 of the HLA-DR1
-chain (24, 27, 36). SEA and SEE combine both binding modes to cross-link MHC
class II molecules. This appears to be a requirement for inflammatory
cytokine production (37, 38). SPE-C possesses an
alternative mechanism for cross-linking MHC class II by forming
homodimers via the NH2-terminal domains
(27, 36).
Recently, the S. pyogenes M1 genome sequencing project was completed. A repeated screen of this database identified the missing 5' end of the spe-j gene and another novel sag gene that is identical with spe-i. Spe-i was first described by McLaughlin et al., who mapped this gene location to a position just 5' of the spe-h gene (39). Here, we report the cloning and expression of the spe-i and spe-j genes and the functional analysis of their recombinant proteins.
| Materials and Methods |
|---|
|
|
|---|
SPE-I and SPE-J were identified by searching the S. pyogenes M1 genome database at the University of Oklahoma (http://www.genome.ou.edu/strep.html) as described previously (24).
The open reading frames were defined by translating the DNA sequences around the matching regions and aligning the protein sequences to known SAgs using the computer program Gap. The leader sequences were predicted using the SP Scan program. Gap and SP Scan are part of the Genetic Computer Group (GCG) package (version 8). Multiple alignments and dendrograms were performed with ClustalW (40) and TreeView 1.5.3 (41).
Cloning of spe-i and spe-j
Fifty nanograms of S. pyogenes M1 strain SF 370 (700294; Americation Type Culture Collection, Manassas, VA) genomic DNA was used as a template to amplify the spe-i DNA by PCR using the primers spe-i-fw (GGATCCATGAGTAGTGTGGGAGTTATTAA) and spe-i-rev (AAGCTTTTATTTATTAAATTTAACTAAG) and Taq Polymerase (Promega, Madison, WI). The primers contain a terminal tag with the restriction enzyme recognition sequences BamHI and HindIII, respectively. The amplified DNA fragment encoding the mature protein without the predicted leader sequence was cloned into a T-tailed pBlueScript SKII vector (Stratagene, La Jolla, CA).
Spe-j was cloned in a similar approach, using the primers spe-j-fw (GGATCCGATAGTGAAAATATTAAAGCG) and spe-j-rev (GAATTCGCTCCTATCTTATTTAGTCC), which contain a terminal tag with the restriction enzymes BamHI and EcoRI. The DNA sequences of the subcloned toxin genes were confirmed by the dideoxy chain termination method using a Licor automated DNA sequencer. As the DNA sequences from the genomic database are all unedited raw data, three subclones of every cloning experiment were analyzed to insure that no Taq polymerase-related mutations were introduced.
Expression and purification of rSPE-I and rSPE-J
Subcloned spe-i and spe-j fragments were cut from pBlueScript SKII vectors using restriction enzymes BamHI/HindIII and BamHI/EcoRI, respectively (Life Technologies, Grand Island, NY) and cloned into pGEX-3c expression vectors. This vector is a modified version of pGEX-2T (Pharmacia, Piscataway, NJ) that expresses the highly specific protease 3C cleavage site (EVLFQ/GP) from a picornavirus just upstream of the inserted DNA (42).
Recombinant SPE-I and rSPE-J were expressed in Escherichia
coli DH5
cells as GST fusion proteins. Cultures were grown at
30°C and induced for 34 h after adding 0.2 mM
isopropyl-
-D-thiogalactopyranoside (IPTG).
The GST fusion proteins were purified on glutathione agarose as described previously (24). The mature toxins were cleaved off from GST using protease 3c (provided by Keith Hudson, University of Oxford, Oxford, U.K.) overnight at room temperature. The recombinant toxins were further purified by two rounds of cation exchange chromatography using carboxy methyl Sepharose (Pharmacia).
Gel electrophoresis
All purified recombinant toxins were tested on a 12.5% SDS-polyacrylamide gel according the procedure of Laemmli. The isoelectric point (pI) of the recombinant toxins was determined by isoelectric focusing on a 5.5% polyacrylamide gel using ampholine, pH 310 (Pharmacia Biotech, Uppsala, Sweden). The gel was run for 90 min at 1 W constant power.
Toxin proliferation assay
Human PBLs were purified from the blood of a healthy donor by Histopaque Ficoll (Amersham, Arlington Heights, IL) fractionation. The PBL were incubated in 96-well round-bottom microtiter plates at 105 cells per well with RPMI-10 (RPMI 1640 with 10% FCS) containing varying dilutions of recombinant toxins. After 3 days, 0.1 µCi [3H]thymidine was added to each well, and cells were incubated for another 24 h. Cells were harvested and counted on a scintillation counter.
TCR V
analysis
V
enrichment analysis was performed by anchored multiprimer
amplification (16). Human PBLs were incubated with 20
pg/ml of recombinant toxin at 106 cells/ml for 3
days. A 2-fold volume expansion of the culture followed with medium
containing 20 ng/ml IL-2. After another 24 h, stimulated and
resting cells were harvested, and RNA was prepared using Trizol reagent
(Life Technologies). A 500 bp
-chain DNA probe was obtained by
anchored multiprimer PCR, radiolabeled, and hybridized to individual
V
s, and a C
DNA region was dot blotted on a nylon membrane. The
membrane was analyzed on a Molecular Dynamics (Sunnyvale, CA) Storm
Phosphor imager using ImageQuant software. Individual V
s were
expressed as a percentage of all the V
s determined by hybridization
to the C
probe.
Computer-aided modeling of protein structures
The protein structures of SPE-I and SPE-J were created on a Silicon Graphics computer using InsightII/Homology software. The SAgs SMEZ-2 and SPE-C were used as reference proteins to determine structurally conserved regions (SCRs) for the SPE-J model. SPE-I was modeled onto the SPE-H structure. Coordinate files for SMEZ-2 (1ET6), SPE-C (1AN8), and SPE-H (1ET9) were downloaded from the Brookhaven Protein Database. The primary amino acid sequences of the reference proteins and SPE-I or SPE-J were aligned, and coordinates from superimposed SCRs were assigned to the model proteins. The loop regions between the SCRs were generated by random choice. Swiss-PdbViewer software (43) was used for displaying the computer-generated image.
Radiolabeling and LG-2 binding experiments
Recombinant toxin was radioiodinated by the chloramine T method as previously described (36). Labeled toxin was separated from free iodine by size exclusion chromatography using Sephadex G25 (Pharmacia). LG2 cells were used for cell binding experiments, as described (36). Briefly, cells were harvested, resuspended in RPMI-10, mixed at 106 cells/ml with 125I-tracer toxin (1 ng) and 0.000110 µg of unlabeled toxin, incubated at 37°C for 1 h. After washing with ice-cold RPMI 1640 the pelleted cells were analyzed in a gamma counter.
For zinc binding assays the toxins were incubated in RPMI-10 alone, in RPMI-10 with 1 mM EDTA, or in RPMI-10 with 1 mM EDTA 2 mM ZnCl2. For competitive binding studies, 1 ng of 125I-tracer toxin (rSPE-I, rSPE-J, or rSEA) was incubated with 0.000110 µg of unlabeled toxin (rSPE-I, rSPE-J, rSPE-C, rSEA, rSEB, and rTSST) for 1 h.
LG-2 cell aggregation assay
LG-2 cells were washed, vigorously resuspended in RPMI-10 at 5 x 105 cells/ml, and aliquoted as a single cell suspension to a 96-well flat-bottom plate in a final volume of 100 µl, as described previously (36). Cells in duplicate wells were stimulated by the addition of 2 µg of toxin. Aggregation was scored at various time points after incubation at 37°C as the percentage of LG-2 cells in aggregates, and was determined by light microscopy. Percent aggregation was determined by counting the number of cells not bound to an aggregate.
Light scattering analysis
Dynamic light scattering was performed using a Protein Solutions (Charlottesville, VA) DynaPro molecular sizing instrument fitted with a microsampler (44). Typically, 14 µl of protein solution was used and 40 measurements were taken for each sample. Samples ranged in concentration from 0.4 to 11.2 mg/ml. Dynamic light scattering enables the determination of the translational diffusion coefficient (Dt) from which the hydrodynamic radius (RH) of the particles in solution can be calculated using the Stokes-Einstein equation. Relative molecular masses for the molecules in solution can then be calculated from RH using an empirical standard curve which gives the equation: Mr = (1.549RH)2.246.
| Results |
|---|
|
|
|---|
Recently we reported the identification of an incomplete novel sag gene, called spe-j, from the unfinished S. pyogenes genome database at Oklahoma University (24). The recent completion of the sequencing project allowed us to locate the complete spe-j gene. This database search also revealed another sag gene that is identical with spe-i, described by McLaughlin et al. (39).
The extracellular form of the SPE-I protein is predicted to comprise
227 aa residues, corresponding to a calculated molecular mass of 25.96
kDa and a pI of 8.37. SPE-I is most closely related to SEI (39.7%
identity and 51.9% similarity; Ref. 45) and to SPE-H
(30.5%/40.4%). This builds a separate subgroup in the SAg family tree
(Fig. 1
). The amino acid sequence of the
mature SPE-J was predicted to comprise 209 residues, and the molecular
mass was calculated to be 24.56 kDa with a theoretical pI of 7.54.
SPE-J builds a subgroup with SPE-C, SMEZ, and SPE-G and is most closely
related to SPE-C (48.8%/56.5%) (Fig. 1
).
|
4,
5,
4, and
5 regions (Fig. 2
-chain in a similar mode as SPE-C by forming a zinc coordination
complex (27).
|
To produce recombinant protein of SPE-I and SPE-J, individual genes (coding for the mature toxins without leader peptide) were amplified by PCR from S. pyogenes M1 genomic DNA and subcloned for DNA sequencing. DNA inserts with confirmed DNA sequence were then transferred into pGEX-3c expression vector and expressed as GST fusion proteins. GST-SPE-I and GST-SPE-J were completely soluble and gave yields of 2530 mg/liter E. coli culture. The toxins were released from GST by cleaving with 3c protease and separated by two rounds of cation exchange chromatography. The recombinant proteins differ from their native counterparts by four additional N-terminal residues (Gly-Pro-Gly-Ser) introduced by the BamHI restriction site and the protease 3c recognition site. However, a potential influence on the function of the recombinant proteins seems rather unlikely, as the crystal structures of the most closely related SAgs (SMEZ-2, SPE-C, and SPE-H) show that the N terminus is facing away from both the TCR and the MHC class II binding site (27, 28).
The purified toxins were analyzed by SDS-PAGE and isoelectric focusing
(Fig. 3
). Both toxins ran as single
protein bands on the SDS-PAGE gel confirming the purity of the
preparation. The isoelectric focusing gel (Fig. 3
B) revealed
a pI of approximately 9 for rSPE-I, which is the most basic pI of all
known SPEs. The pI of SPE-J was estimated at 77.5 and is similar to
SPE-H.
|
T cell proliferation and TCR V
specificity
A standard [3H]thymidine incorporation assay was performed to test for the potency of rSPE-I and rSPE-J to stimulate PBLs. Both toxins gave half maximum responses (P50 value) of 0.1 pg/ml and were still active at concentrations <1 fg/ml. Together with SPE-C, which also gives a half maximum response at 0.1 pg/ml, SPE-I and SPE-J belong to the group of the most potent streptococcal SAgs. Only SMEZ-2 with a P50 value of 0.02 pg/ml is more potent, whereas SPE-G and SPE-H are less potent with P50 values of 2 and 50 pg/ml, respectively (24).
The human TCR V
specificity of rSPE-I and rSPE-J was determined by
multiprimer anchored PCR and dot-blot analysis using a panel of 21
human V
DNA regions. The V
enrichment after stimulation with
toxin was compared with the V
profile of unstimulated PBLs (Table I
). Recombinant SPE-I almost
exclusively targeted V
18.1 TCR, which was enriched 14.2-fold over
the unstimulated PBLs. Minor enrichment of V
5.3, V
9.1, and V
22a (2.7-, 2.5-, and 2.8-fold, respectively) was also observed.
Stimulation of PBLs with rSPE-J resulted in significant proliferation
of T cells carrying the V
2.1 TCR (7.9-fold enrichment) and minor
enrichment of V
8.1 TCR (2.1-fold). The total of all V
s stimulated
by rSPE-I and rSPE-J was
100%, suggesting that all targeted V
regions were included in the panel.
|
Structural and biochemical data suggest that SPE-C, SPE-H, and
SMEZ-2 bind MHC class II exclusively at the polymorphic
-chain
(24, 36). This binding is characterized by a zinc
coordination complex, in which three zinc ligands are provided by the
COOH-terminal domain of the toxins; the fourth residue is believed to
be H81 of the HLA-DR1
-chain.
The region homologous to the
-chain binding face of SEA and SEB
(
1-
2 loop) shows major structural differences in these toxins
(27, 28). The hydrophobic residues in the
1-
2 loop
(F44, L45, and Y46 in SEB) that are important for MHC
-chain binding
are substituted by less hydrophobic residues (T33, T34, and H35 in
SPE-C; K28 and T29 in SMEZ-2; V34, T35, and S36 in SPE-H).
To compare the protein structure of SPE-I with known SAg
structures SPE-I was modeled onto the SPE-H crystal structure and SPE-J
was modeled on the SCRs of both SPE-C and SMEZ-2 (Fig. 4
).
|
9
strand corresponding to D160 in SPE-H, whereas the third ligand in
SPE-J is provided by the
10 strand, similar to H167 in SPE-C.
A comparison of the
1-
2 loop region of SPE-I and SPE-J revealed
significant differences between the two toxins. In the SPE-I model,
this loop region consists of the hydrophobic residues L35, F36, and
Y37, which correspond to F44, L45, and Y46 of the MHC class II
-chain binding region in SEB. In contrast, the
1-
2 loop of
SPE-J consists of the less hydrophobic residues T32, T33, and H34 and
is identical with the equivalent region in SPE-C (T33, T34, and
H35).
The similarity of the
1-
2 region of SPE-I in the computer-modeled
protein structure to SEB suggests that it might have two binding
sites for MHC class II, similar to SEA (38), whereas SPE-J
might only bind to the MHC class II
-chain, similar to SPE-C
(27, 36).
The predicted requirement for zinc was confirmed by a binding assay
using LG-2 cells, a MHC class II expressing cell line homozygous for
HLA-DR1. Direct binding of 125I-labeled SPE-I or
SPE-J was completely abolished in the presence of 1 mM EDTA, but could
be restored after adding an excess of 2 mM ZnCl2
(Fig. 5
). These results show that both
toxins bind to MHC class II in a zinc-dependent mode, most likely
targeting the H81 of the MHC class II
-chain. However, this does not
exclude the possibility of an additional binding site for the MHC class
II
-chain. It has been shown that SEA binds to the generic
-chain
with
100 times lower affinity compared with the zinc-dependent
-chain binding site, and cooperative effects might also play an
important role (38).
|
-chain (19, 35), whereas SEA binds to
both
- and
-chain (37). In a reciprocal experiment,
SPE-J only partially inhibited binding of
125I-SEA to LG-2 cells (Fig. 6
-chain, but not for the
-chain.
|
|
SPE-J forms homodimers
The rapid homotypic aggregation of LG-2 cells suggests that SPE-J
is capable of cross-linking MHC class II molecules. However, it seems
unlikely that SPE-J, like SEA, simultaneously binds to both MHC class
II chains as the
-chain binding toxins SEB and TSST could not
prevent SPE-J from binding to LG-2 cells in competition studies. SPE-C
has surrendered its generic
-chain binding site in favor of a
dimerization interface, thereby creating a novel mode of MHC class II
cross-linking (27). The computer-generated model of SPE-J
shows a strong conservation within this region suggesting a similar
mode of action for this toxin. Dynamic light scattering was used to
determine whether SPE-J forms dimers in solution (Table II
). Results from light scattering
indicate that both SPE-J and SPE-C form dimers in a
concentration-dependent manner. Both SAgs are dimeric at high protein
concentrations (>5 mg/ml for SPE-J and >10 mg/ml for SPE-C).
Conversely, at low concentrations the light scattering data suggest
that these SAgs are monomeric. SMEZ-2 was used as a control and shows a
monomer in solution over the concentration range 0.49.3 mg/ml.
Concentration-dependent dimerization may facilitate MHC-II
cross-linking at the cell surface where the local concentration of SAg
greatly exceeds that in the surrounding milieu.
|
| Discussion |
|---|
|
|
|---|
The novel proteins are clearly related to SPEs and the SEs, which are
part of the SAg family. Although the overall amino acid sequence
identity to their nearest homolog is not particularly high (39.7%
between SPE-I and SEI and 48.8% between SPE-J and SPE-C) the regions
that are important for the characteristic SAg fold are highly
conserved. These regions are
4,
5,
4, and
5. Recombinant
forms of both SPE-I and SPE-J are extremely potent stimulators of human
PBL at nanomolar concentrations, confirming their role as
SAgs.
The data presented in this paper suggest that both SPE-I and SPE-J bind
to the MHC class II
-chain but not to the
-chain. Evidence that
supports this assumption comes from computer-generated protein models,
zinc-dependent binding to LG-2 cells, competition experiments with
other well characterized toxins, and cell aggregation assays.
A putative zinc binding motif for both SPE-I and SPE-J was identified
from structural modeling, and this was confirmed by the results showing
that binding of SPE-I and SPE-J to MHC class II on LG-2 cells was
completely inhibited by EDTA and restored with an excess of
ZnCl2. The similarity of these putative sites to
those identified in the crystal structures of SEA and SPE-C strongly
suggest that Zn2+-dependent binding to the
conserved H81 in the MHC class II
-chain is the most likely mode of
binding for SPE-I and SPE-J.
The protein model of SPE-J also predicted a strong similarity to SPE-C
in the
1-
2 loop region to the opposing face to the zinc site. In
SEA and SEB, hydrophobic residues on this loop project into a
hydrophobic depression in the MHC class II
1 domain
(19). These hydrophobic residues are absent in SPE-C
(27) and SPE-J suggesting that, like SPE-C, SPE-J also
lacks a binding site for the MHC class II
-chain. Further evidence
for this was provided by the results showing that neither SEB nor TSST
inhibited binding of SPE-J to LG-2 cells, whereas SEA and SPE-C were
strongly competitive. SPE-C was as effective as SPE-J, suggesting
similar binding affinities. In a reciprocal experiment, SPE-J inhibited
SEA binding by
5060%, suggesting that competition only occurred
at the MHC class II
-chain but not at the
-chain.
The hydrophobic
1-
2 loop in SPE-I was sufficiently similar to the
same region in SEB to suggest that this SAg possesses a MHC class II
-chain binding site. However, cell aggregation studies, which are a
measure of MHC class II cross-linking, did not confirm this. SEA
induced rapid aggregation of LG-2 cells, whereas SPE-I was negative in
this assay. The results from competition studies also suggest that
SPE-I does not bind to the MHC class II
-chain. SPE-I prevented SEA
and SPE-C binding but did not inhibit SEB and only partially inhibited
TSST. This might be due to interference between the two proteins across
the top of the MHC class II molecule rather than competition for the
same MHC class II site. Although TSST binds exclusively to the MHC
class II
-chain, its binding position is shifted over the top of the
MHC class II molecule toward the
-chain (10).
SPE-J induced rapid homotypic aggregation of LG-2 cells, suggesting a
binding mode that results in cross-linking of MHC class II molecules on
the cell surface. MHC cross-linking can be caused by toxins with
binding sites for both MHC class II chains such as SEA
(38), or by homodimerization of toxins like SPE-C, where
the generic MHC class II
-chain binding site is transformed into a
dimer interface (27). Due to the strong conservation
between SPE-C and SPE-J within this region and the lack of suitable
residues in the
1-
2 loop region to provide an effective MHC class
II
-chain binding site, it is assumed that SPE-J instead forms
homodimers. This hypothesis is supported by the results from dynamic
light scattering analysis for purified rSPE-J, which shows that this
SAg forms dimers in solution at concentrations above 5 mg/ml.
This suggests that SPE-J may form tetramers of the type
HLA-DR
SPE-JSPE-JHLA-DR
, similar to that proposed for SPE-C
(27, 36).
The completion of the S. pyogenes type M1 strain SF370
genome project allows for the first time to define the complete
repertoire of SAgs from a particular organism. This strain carries
seven spe genes coding for SPE-C, SPE-G, SPE-H, SPE-I,
SPE-J, SSA, and SMEZ. The total number of streptococcal exotoxins in
all strains is likely to be much higher, as several spe
genes are located on mobile DNA elements such as phage or insertion
element, which allows them to be transferred horizontally between
different strains (7). The reason for the high diversity
of sag genes is still unclear. The most significant
difference between individual SAgs is their specificity in targeting T
cell subpopulations carrying particular TCR V
regions. This V
specificity is often overlapping, and some V
s are targeted more
frequently than others. Our data show that SPE-I mainly stimulates T
cells carrying the V
18.1 TCR. This TCR is not targeted by any other
known SAg, which might indicate a specific role for SPE-I in activation
of an immune response. In contrast, SPE-J almost exclusively targets
the V
2.1 TCR, which is also triggered by SPE-A, SPE-C, SPE-G, SPE-H,
and SMEZ, making it the most frequently targeted TCR by streptococcal
SAgs (1, 24, 36). This selective targeting of one
particular V
region is very intriguing and may suggest a specific
role for V
2.1-bearing T cells in streptococcal induced immune
response.
Another intriguing finding is the functional similarity between SPE-C
and SPE-J. Despite their 51% diversity in the primary amino acid
sequence, both toxins share a common MHC class II
-chain binding
site, a dimerization interface, and a V
2.1-specific TCR binding
site. This indicates the extraordinary dynamic in the evolution of SAgs
and the potential to create a large number of different functional
SAgs. As shown in comparative studies of SAg crystal structures, only
relative small core regions are necessary to maintain the typical
overall SAg fold (28). Moreover, only minor differences in
the primary amino acid sequence can create multiple antigenic variants,
like SMEZ (up to 8% diversity; Ref. 46), or functional
different toxins, which target different TCR V
regions like SEA and
SEE (15% diversity; Ref. 16). The existence of two
functionally indistinguishable SPEs suggests an important role in their
modus operandi and their TCR specificity. This is also supported by the
fact that V
2 is the most frequently targeted TCR by SPEs. But why
should a bacterial isolate carry two different genes that code for
functionally identical proteins? If antigenic variation alone were the
driving force, then multiple alleles should be expected, as it has been
shown for SMEZ (46). Genotyping of different S.
pyogenes strains for spe-c and spe-j and
possible allelic forms is currently underway to investigate this
possibility.
One explanation might be that SPE-C and SPE-J differ in a function yet
to be discovered. Until today, it is not fully understood how bacteria
benefit from the secretion of SAgs. Recent studies suggest that SAgs
possess other functions in addition to the well known TCR V
-specific
T cell mitogenicity. For example, cross-linking of MHC class II on the
surface of APC by certain SAgs, like SEA, triggers the release of
cytokines such as IL-1
and TNF-
(38). Sriskandan et
al. showed a local dose-dependent increase of neutrophils after
injecting mice with rSPE-A, suggesting that SPE-A might be involved in
the recruitment of neutrophils to the site of infection
(47).
SPE-I and SPE-J might play a crucial role in streptococcal toxic shock
syndrome and other severe streptococcal diseases. Several
epidemiological studies showed a strong correlation between severe
invasive disease and streptococcal isolates carrying genes for SPE-A
and/or SPE-C (48, 49). However, several of these isolates
lack the spe-a and spe-c genes, suggesting that
they produce other SAgs that might be involved in disease. A selective
expansion of T cells carrying the V
2.1 and V
8.1 TCR has been
reported in patients with Kawasaki disease, an acute multisystem
vasculitis of young children (50). The causative agent for
this disease is unknown, but SAgs have been implicated, in particular
SPE-C and TSST, which both target the V
2 TCR.
A screening for the novel sag genes in clinical isolates from patients with severe invasive disease is currently underway to determine a possible correlation between novel SAgs and disease.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Prof. John D. Fraser, Division of Molecular Medicine, School of Medicine, University of Auckland, Private Bag 92019, Auckland, New Zealand. E-mail address: jd.fraser{at}auckland.ac.nz ![]()
3 Abbreviations used in this paper: SPE, streptococcal pyrogenic exotoxin; SE, staphylococcal enterotoxin; TSST, toxic shock syndrome toxin; SAg, superantigen; SMEZ, streptococcal mitogenic exotoxin Z; SSA, streptococcal SAg; RPMI-10, RPMI 1640 with 10% FCS; SCRs, structurally conserved regions; pI, isoelectric point. ![]()
Received for publication January 10, 2001. Accepted for publication March 27, 2001.
| References |
|---|
|
|
|---|
gene segments with staphylococcal and streptococcal superantigens. Infect. Immun. 64:987.[Abstract]
specificity. J. Exp. Med. 177:175.
2 and V
8 in Kawasaki disease. Proc. Nall. Acad. Sci. USA 89:4066.This article has been cited by other articles:
![]() |
R. Commons, S. Rogers, T. Gooding, M. Danchin, J. Carapetis, R. Robins-Browne, and N. Curtis Superantigen genes in group A streptococcal isolates and their relationship with emm types J. Med. Microbiol., October 1, 2008; 57(10): 1238 - 1246. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rivera, M. Rebollo, E. Miro, M. Mateo, F. Navarro, M. Gurgui, B. Mirelis, and P. Coll Superantigen gene profile, emm type and antibiotic resistance genes among group A streptococcal isolates from Barcelona, Spain. J. Med. Microbiol., August 1, 2006; 55(Pt 8): 1115 - 1123. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Pless, G. Ruthel, E. K. Reinke, R. G. Ulrich, and S. Bavari Persistence of Zinc-Binding Bacterial Superantigens at the Surface of Antigen-Presenting Cells Contributes to the Extreme Potency of These Superantigens as T-Cell Activators Infect. Immun., September 1, 2005; 73(9): 5358 - 5366. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ekelund, J. Darenberg, A. Norrby-Teglund, S. Hoffmann, D. Bang, P. Skinhoj, and H. B. Konradsen Variations in emm Type among Group A Streptococcal Isolates Causing Invasive or Noninvasive Infections in a Nationwide Study J. Clin. Microbiol., July 1, 2005; 43(7): 3101 - 3109. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ekelund, P. Skinhoj, J. Madsen, and H. B. Konradsen Reemergence of emm1 and a Changed Superantigen Profile for Group A Streptococci Causing Invasive Infections: Results from a Nationwide Study J. Clin. Microbiol., April 1, 2005; 43(4): 1789 - 1796. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Baker, T. Proft, P. D. Webb, V. L. Arcus, J. D. Fraser, and E. N. Baker Crystallographic and Mutational Data Show That the Streptococcal Pyrogenic Exotoxin J Can Use a Common Binding Surface for T-cell Receptor Binding and Dimerization J. Biol. Chem., September 10, 2004; 279(37): 38571 - 38576. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hashikawa, Y. Iinuma, M. Furushita, T. Ohkura, T. Nada, K. Torii, T. Hasegawa, and M. Ohta Characterization of Group C and G Streptococcal Strains That Cause Streptococcal Toxic Shock Syndrome J. Clin. Microbiol., January 1, 2004; 42(1): 186 - 192. [Abstract] [Full Text] [PDF] |
||||
![]() |
|