The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mebius, R. E.
Right arrow Articles by Akashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mebius, R. E.
Right arrow Articles by Akashi, K.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Stem Cells
The Journal of Immunology, 2001, 166: 6593-6601.
Copyright © 2001 by The American Association of Immunologists

The Fetal Liver Counterpart of Adult Common Lymphoid Progenitors Gives Rise to All Lymphoid Lineages, CD45+CD4+CD3- Cells, As Well As Macrophages1

Reina E. Mebius2,*, Toshihiro Miyamoto{dagger}, Julie Christensen{dagger}, Jos Domen{dagger}, Tom Cupedo*, Irving L. Weissman{dagger} and Koichi Akashi3,{dagger}

* Department of Cell Biology and Immunology, Faculty of Medicine, Vrije Universiteit, Amsterdam, The Netherlands; and {dagger} Departments of Pathology and Developmental Biology, Stanford University School of Medicine, Stanford, CA 94305


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We identified an IL-7R{alpha}+Sca-1lowc-Kitlow population in E14 fetal liver, which is the phenotypical analog of common lymphoid progenitors (CLP) in adult bone marrow. After transfer into newborn mice, the IL-7R{alpha}+Sca-1lowc-Kitlow population rapidly differentiated into CD45+CD4+CD3- cells, which are candidate cells for initiating lymph node and Peyer’s patch formation. In addition, this population also gave rise to B, T, NK, and CD8{alpha}+ and CD8{alpha}- dendritic cells. The fetal liver precursors expressed a significantly lower level of the myeloid-suppressing transcription factor Pax-5, than adult CLP, and retained differentiation activity for macrophages in vitro. We propose that the transition from fetal liver IL-7R{alpha}+Sca-1lowc-Kitlow cells to adult CLP involves a regulated restriction of their developmental potential, controlled, at least in part, by Pax-5 expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The development of the immune system is a well orchestrated process involving selective and temporally regulated expression of a chorus of obligatory genes. For the proper development of lymph nodes (LNs)4 and Peyer’s patches, lymphotoxin (LT){alpha}, LT{beta}, and LT{beta}R are required (1, 2, 3, 4, 5, 6). In addition, it is now clear that many other genes, including the ones encoding IL-7, IL-7R, relB, transcription factor Ikaros, CXC chemokine receptor (CXCR)5, Id-2, retinoic acid receptor-related orphan receptor-{gamma} (ROR{gamma}), and osteoprotegerin ligand/TNF-induced cytokine are involved in lymphoid organ development (7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17). However, the cellular requirements and sequence of events involving these gene products are unknown. What we know so far is that before birth the developing LNs are colonized selectively by TCR{gamma}{delta} T cells and CD45+CD4+CD3- cells in a mucosal addressin cell adhesion molecule-1 (MAdCAM-1)/{alpha}4{beta}7-dependent manner (18). The earliest cells that colonize the LNs and that have cell surface expression of LT{alpha}1{beta}2 are{alpha}4{beta}7+CD45+CD4+CD3-CD62L- cells (19). A similar population of cells has been reported to be present in the organizing centers for intestinal Peyer’s patches in both humans and mice (20, 21). These cells were shown to be specifically missing in fetal mesentery and/or in fetal intestines of ROR{gamma} and Id2 knock-out mice, respectively. Both mutant mouse strains have a complete lack of LNs and Peyer’s patches (15, 17). Therefore, CD45+CD4+CD3- cells are likely candidates for delivering some of the required signals for LN (and perhaps Peyer’s patch) induction during embryogenesis.

We have reported that the {alpha}4{beta}7+CD45+CD4+CD3- cells in newborn LNs express IL-7R{alpha} (19) that transduces indispensable signals for adult T and B lymphopoiesis. The IL-7R{alpha} is also expressed on the surface of B cell- and T cell-committed progenitors; the IL-7R{alpha}+ fraction of adult bone marrow does not contain cells that can differentiate into myeloid cells (22). We have identified common lymphoid-restricted progenitors (CLP) in the IL-7R{alpha}-expressing fraction in the adult mouse bone marrow. The adult CLP can be purified with a FACS, and give rise to B, T, NK (22), and both CD8{alpha}+ and CD8{alpha}- dendritic cells (23, 24) when injected into irradiated hosts. The levels of c-Kit and Sca-1 are considerably lower on adult CLP, compared with adult hemopoietic stem cells (HSC), suggesting a partial down-regulation of these molecules upon lymphoid differentiation (22). In contrast, we have recently reported that the ectopic signals from human GM-CSFR or human IL-2R {beta}-chain in adult CLP can reprogram the cells to transdifferentiate into myelomonocytic cells in the presence of human GM-CSF or IL-2 (25). Therefore, it is suggested that adult CLP possess plasticity for myelomonocytic differentiation, but the differentiation programs are not accessible in physiological condition at the level of CLP.

These data prompted us to search for counterpart fetal liver precursors for adult CLP within the IL-7R{alpha}+ fraction of fetal liver cells, to clarify the lymphoid differentiation pathways in fetal liver, and to identify the origin of CD45+CD4+CD3- cells. We found that IL-7R{alpha}+Sca-1lowc-Kitlow cells, which are phenotypically similar to adult CLP, are present as a distinct population in fetal liver at E12.5-E14.5. The in vivo differentiation potential of this population included the CD45+CD4+CD3- cells, which colonize LNs early in development, in addition to B cells, T cells, NK cells, and both CD8{alpha}+ and CD8{alpha}- dendritic cells. Thus, the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells might be the fetal equivalent of adult CLP, and are the earliest precursors for CD45+CD4+CD3- cells and other accessory cells that may be crucial for the formation of secondary lymphoid organs. However, the fetal phenotypic analog of adult CLP, the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells possess differentiation capacity for macrophages that was only detectable in vitro. We show that the fetal liver IL-7R{alpha}+Sca-1lowc-Kitlow cells expressed a decreased level of Pax-5, a myeloid-suppressing transcription factor, when compared with adult CLP. Therefore, it is suggested that the regulation of Pax-5 expression may play an important role in restriction of differentiation during the transition from fetal liver IL-7R{alpha}+Sca-1lowc-Kitlow cells to adult CLP.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

C57BL/Ka-Ly5.1 and C57BL/Ka-Ly5.2 mice were maintained in the laboratory animal colony at Stanford University School of Medicine (Stanford, CA) and the Vrije Universiteit Faculty of Medicine (Amsterdam, The Netherlands).

Abs and cell sorting

The following Abs were used for sorting of fetal liver precursors: 6B2 (anti B220), M1/70 (anti Mac-1), 2B8 (anti c-Kit, CD117), E13 (anti Sca-1), A7R34 (anti IL-7R{alpha}, CD127, a gift of S. Nishikawa, Kyoto University, Kyoto, Japan). In addition to these Abs, the following Abs were used for analysis of reconstituted mice: KT-31 (anti CD3), 8C5 (anti Gr-1), NK1.1 (anti NK cell marker) (PharMingen, San Diego, CA), N418 (anti CD11c) (PharMingen), 25-9-17 (anti Iab,d) (PharMingen), AL1-4A2 (anti Ly-5.1), A20.1.7 (anti Ly-5.2) (mAb 6B2, M1/70, 2B8, E13, KT-31, 8C5, AL1-4A2, and A20.1.7 were purified from culture supernatant from hybridoma cells with protein G-Sepharose (Pharmacia, Uppsala, Sweden) and labeled in our laboratory). Stained cells were sorted or analyzed using a highly modified triple laser (488-nm argon laser, 599-nm dye laser, and UV laser) FACS (FACSVantage; BD Immunocytometry Systems, Mountain View, CA). Progenitors were purified by sorting and then resorted to obtain precise numbers of cells that were essentially pure for the indicated surface marker phenotype. In the limiting dilution assays and single cell clonogenic assays, the resort was performed by using a carefully calibrated automatic cell deposition unit system (BD Immunocytometry Systems). This system deposited a specific number of purified cells onto methylcellulose medium, S17 stromal cell cultures, or HBSS in 96-well plates. In most cases, we reconfirmed the specific number of cells sorted in each well under an inverted microscope. The detailed protocols for sorting has been published elsewhere (22, 26).

Reconstitution of newborn animals

Newborn mice (days 0–2) were used for analysis of the progeny of fetal liver precursors and adult CLP. We used the congenic strains C57BL/Ka-Ly5.1 and C57BL/Ka-Ly5.2, which only differ at the Ly5 locus, allowing us to trace donor-derived cells generated from the injected fetal liver precursors. Newborn mice (from day 0 to day 2) were sublethally irradiated with 400 rad using an x-ray source operated at 200 kV, delivering 85 rad/min. Mice were irradiated in two doses, of 200 rad each, 3 h apart. Sorted cells, derived from E14.5 fetal livers or adult bone marrow, were injected into the liver of congenic newborn mice. The presence of donor-derived cells, at several time points after reconstitution, was determined by gating for donor Ly5.2+ as well as host Ly5.1- cells, to omit Ly5.1+Ly5.2+ artificial doublets from the analysis.

In vitro differentiation assays

To analyze the potential of precursors to generate myeloid colonies, cells were cultured in an {alpha}-MEM-based methyl cellulose medium (Methocult M3100; StemCell Technologies, Vancouver, Canada) containing 30% FBS (Gemini Bio-Products, Woodland, CA), 1% BSA, 2 mM L-glutamine, and 50 µM 2-ME and the following cytokines: IL-3 (30 ng/ml; R&D Systems, Minneapolis, MN), IL-6 (10 ng/ml; R&D Systems), mouse GM-CSF (10 ng/ml; R&D Systems), Steel factor (SLF, 10 ng/ml; R&D Systems), human M-CSF (25 U/ml; R&D Systems), and human erythropoietin (2 U/ml; Kirin, Tokyo, Japan). To analyze the frequency of cells that could give rise to B cell or macrophage colonies in liquid cultures, precursors were sorted, at one cell per well, onto irradiated (4000 rad) S17 stromal cell layers in 96-well plates with RPMI 1640 medium containing 10% FBS, SLF (100 ng/ml; R&D Systems), and mouse IL-7 (10 ng/ml; R&D Systems). IL-7 was supplied in sufficient amounts because 10-fold higher concentrations did not alter the results. All cultures were incubated at 37°C in a humidified chamber under 7% CO2. For differentiation of fetal liver or adult bone marrow precursors toward dendritic or CD45+CD4+CD3- cells, precursors were placed in liquid culture with addition of IL-1{beta}, IL-3, IL-7, SLF, Flt-3 ligands (R&D Systems), and TNF-{alpha}, or IL-7 alone, respectively.

CD45+CD4+CD3- and the remaining CD45+ cells from day 0 mesenteric LNs (MLNs), were double-sorted and placed in IL-1{beta}, IL-3, IL-7, TNF-{alpha}, and SLF to let them differentiate into dendritic cells, according to the method described earlier (27).

PCR analysis

Total RNA was isolated from double-sorted CD45+CD4+CD3- cells taken from MLN at the day of birth using Trizol reagent (Life Technologies, Grand Island, NY) and reverse transcribed using M-MLV Reverse Transcriptase (Life Technologies). cDNA was analyzed for the presence of EBV-induced molecule-1 ligand chemokine (ELC) by amplification of an equivalent of 1200, 600, and 300 cells with the following primers: ELC-forward GGTGCTAATGATGCGGAAGAC and ELC-reverse AGACACAGGGCTCCTTCTGGT for 40 cycles (annealing temperature (Tanneal): 58°C). Primers were provided by Jason Cyster (University of California, San Francisco, CA).

To evaluate the differential expression profiles of lineage-related genes, total RNA was purified from 1000 double-sorted cells from each population, diluted, and was amplified by RT-PCR as previously described (26). Quantitation of expression of each gene was done by a relative determination, comparing the level of any subject sequence in target samples to that in control cDNA prepared from 2 x 105 whole bone marrow cells or thymocytes, using the Integrated Image analysis system (Bio-Rad, Hercules, CA). The PCR cycles for each target gene were at a point where the reaction is in the exponential phase, to obtain linear correlation between pixel density units of the PCR products and the amount of control cDNA applied (28). After PCR amplification, each product was visualized by the Gel Doc 1000 Video Gel Documentation System (Bio-Rad), and pixel density units of each product were read by Molecular Analyst Software (Bio-Rad). The following primers were used: Pax5-forward: CTA CAG GCT CCG TGA CGC AG, Pax5-reverse: TCT CGG CCT GTG ACA ATA GG (Tanneal: 65°C) (29); VpreB-forward: GTC TGA ATT CCT CCA GAG CCT AAG ATC CC, VpreB-reverse: CAG GTC TAG AGC CAT GGC CTG GAC GTC TG (Tanneal: 60°C) (30); Lambda5-forward: GGG TCT AGT GGA TGG TGT CC, Lambda5-reverse: CAA AAC TGG GGC TTA GAT GG (Tanneal: 60°C) (31); GATA-3 forward: TCG GCC ATT CGT ACA TGG AA, GATA-3 reverse: GAG AGC CGT GGT GGA TGG AC (Tanneal: 55°C) (32); Aiolos forward: GTG TGC GGG TTA TCC TGC ATT AGC, Aiolos reverse: ATC GAA GCA GTG CCG CTT CTC ACC (Tanneal: 65°C) (33); M-CSFR forward: TCA TTC AGA GCC AGC TGC CCA T, M-CSFR reverse; ACA GGC TCC CAA GAG GTT GAC T (Tanneal: 60°C); hypoxanthine phosphoribosyltransferase forward: CAC AGG ACT AGA ACA CCT GC, hypoxanthine phosphoribosyltransferase reverse: GCT GGT GAA AAG GAC CTC T (Tanneal: 65°C).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of IL-7R{alpha}+Sca-1lowc-Kitlow cells in fetal liver

To find the fetal liver counterpart of the adult bone marrow CLP, fetal liver cells from E12.5-E15.5 embryos were analyzed for IL-7R{alpha} expression in combination with several lineage markers and anti-c-Kit and Sca-1 Abs. As in adult bone marrow, fetal liver HSC (34) are present in the IL-7R{alpha}- fraction (Fig. 1Go). The IL-7R{alpha}+ population expressed negative to high levels of B220 at E14.5 (Fig. 1Go), whereas lower levels of B220 were observed on IL-7R{alpha}+ cells at E12.5 (data not shown). IL-7R{alpha}+ cells were divided into B220+ and B220-/low populations; the IL-7R{alpha}+B220+ cells do not express IgM but express CD19 and CD43, indicating that they are mainly at the proB stage (35). In contrast, IL-7R{alpha}+B220-/low cells are CD19- and, like adult CLP, contain cells expressing c-Kit and Sca-1 at lower levels than fetal liver HSC (Fig. 1Go).



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 1. Characterization of IL-7R{alpha}+ fetal liver precursors. Fetal livers from E14.5 embryos were subdivided into IL-7R{alpha}+ and IL-7R{alpha}- cells, and expression of Sca-1 and c-Kit were analyzed on both fractions. In analogy with adult CLP and HSC, IL-7R{alpha}+Sca-1lowc-Kitlow, and IL-7R{alpha}-Sca-1highc-Kithigh cells were gated, respectively. The fetal liver IL-7R{alpha}+Sca-1lowc-Kitlow cells were B220-/low. In the fetal liver, ~0.9% of the cells are IL-7R{alpha}+B220-/lowSca-1lowc-Kitlow, whereas 0.5% were IL-7R{alpha}-B220-Sca-1highc-Kithigh HSC. The IL-7R{alpha}+B220+ cells express CD19 and CD43, indicative of their proB stage.

 
Because fetal liver precursors, defined by expression of AA4.1 and Fc{gamma}RII/III, have been reported to be enriched for B and T lymphoid precursors relative to myeloid and erythroid precursors, we analyzed the expression of these two Ags on IL-7R{alpha}+ fetal liver cells as well (36). All IL-7R{alpha}+ cells in the E14 fetal liver expressed high levels of AA4.1 but were negative for 2.4G2 (Fc{gamma}RII/III) (Fig. 2Go). Conversely, the AA4.1+Fc{gamma}RII/III+ subset does not express IL-7R{alpha} (Fig. 2Go), indicating that the IL-7R{alpha}+ population does not overlap with the precursor population reported by Lacaud et al. (36).



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 2. Phenotypic analysis of IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells. All IL-7R{alpha}+ fetal liver (E14.5) cells were analyzed for expression of AA4.1 Ag and CD16/32, as recognized by mAb 2.4G2. The sorted IL-7R{alpha}+ express the AA4.1 Ag and lack expression of CD16/32 (A), and the sorted AA4.1+CD16/32+ cells were all completely negative for IL-7R{alpha} (B).

 
IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells reconstitute all lymphoid lineages, dendritic cells, and CD45+CD4+CD3- cells in newborn mice

To test their developmental potential, 3–5 x 103 IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells from Ly5.2 mice were injected into the liver of sublethally irradiated Ly5.1 newborn mice. In this assay system, hemopoietic reconstitution of all lineages was observed in ~60% of newborn mice injected with 20 HSC, and in >90% of those injected with 100 HSC (our unpublished data). At 6–8 days after injection, analysis of LN revealed a pronounced population of donor-derived B220+IgM- pre-B cells and B220+IgM+ mature B cells (Fig. 3GoA). The transient appearance of pre-B cells in the LN could be due to homing of injected progenitors and/or their early descendants to LN in an early reconstitution period. No donor-derived Mac-1- or Gr-1-expressing cells were observed. In the thymus, the majority of donor-derived cells were developing thymocytes such as immature CD4-CD8- double-negative and CD4+CD8+ double-positive cells. At 16 days after injection, mature B cells, mature T cells, but no pre-B cells were found in the LN and spleen (Fig. 3GoB). The donor-derived cells in the thymus consisted only of mature CD4+CD8- and CD4-CD8+ single-positive cells. These data indicate that both T and B cell differentiation from the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells is completed by ~3 wk; therefore, these cells have limited self-renewal activity. At 24 days after injection, in addition to T and B cells, CD3-NK1.1+ NK cells and MHC class II+(I-Ab+)CD11c+ dendritic cells were found in the spleen as progeny from the injected cells (Fig. 3GoC). These MHC class II+CD11c+ cells consisted of CD8{alpha}+ as well as CD8{alpha}- cells. Cells positive for Mac-1 and/or Gr-1 were not found throughout these experiments. We have found that adult CLP as well as myeloid-restricted common myeloid progenitors (26) can give rise to both types of dendritic cells; therefore, CD8{alpha} expression is not a marker for their lymphoid origin (24). Thus, as is the case for adult CLP, the IL-7R{alpha}+Sca-1lowc-Kitlow cells possess a rapid and transient in vivo differentiation activity for lymphoid and dendritic cells.



View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 3. Analysis of reconstituted newborn mice at various time points after reconstitution with IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors. Newborn mice were sublethally irradiated and injected with 5000 IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells and analyzed for the presence of (Ly5.1-Ly5.2+) donor cells in thymus, LNs, and/or spleen at 8 (A), 16 (B), or 24 (C) days after reconstitution. A, In the thymus, the majority of donor-derived (Ly5.1-Ly5.2+) cells were developing thymocytes such as CD4-CD8- double-negative cells and CD4+CD8+ double-positive cells. Only a small portion (<1%) of the cells had reached the CD4 or CD8 single-positive mature thymocyte stage. In LNs and spleen, >90% of donor-derived cells consisted of B220+IgM- pre-B, B220+IgM+ mature B cells, and below 3% of mature T cells. Donor-derived Mac-1/Gr-1+ myeloid cells were undetectable in the spleen. B, In the thymus, donor-derived cells are mostly CD4 or CD8 single-positive mature thymocytes, indicating that the T cell differentiation potential of the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors is self-limited. In spleen and LNs, donor-derived cells were composed of mature B and T cells. No donor-derived myeloid cells could be detected. C, At 24 days after birth, a significant population of donor-derived NK1.1+CD3- NK cells and CD11c+MHC class II+ dendritic cells were present in the spleen. The dendritic cell population was composed of both CD8{alpha}+ and CD8{alpha}- dendritic cells. All panels in B and C are surface phenotypes of donor-derived (Ly5.1-Ly5.2+) cells.

 
In addition to these progenies of blood components, the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors also gave rise to a significant population of CD45+CD4+CD3- cells in LN, as well as in spleen at 7, 14, and 21 days after reconstitution (Fig. 4Go). The CD45+CD4+CD3- cells were negative for B220 (data not shown) as we reported previously (19). In contrast, 3 x 103 adult CLP did not give rise to a significant CD45+CD4+CD3- population after intrahepatic injection into newborn mice (data not shown). Thus, the phenotypic counterpart of adult CLP in fetal liver also possesses unique differentiation activity for CD45+CD4+CD3- precursors.



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 4. Development of CD45+CD4+CD3- cells from the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors. Mice were reconstituted with the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors as in Fig. 3Go, and analyzed at 7, 14, and 21 days after reconstitution. Donor-derived CD45+CD4+CD3- cells were found in both LN (A) and spleen (B). The IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells gave rise to CD45+CD4+CD3- cells after a 7-day suspension culture in the presence of IL-7 (C). The majority of the remaining CD4-CD3- cells expressed CD19 but not IgM, indicating that the cells differentiated into proB cells (data not shown).

 
IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells can differentiate into macrophages, CD45+CD4+CD3- cells, as well as B cells in vitro, but not into other myeloerythroid cells

The differentiation potential of IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells was further evaluated in vitro (Fig. 5Go). In the methylcellulose supplemented with SLF, IL-11, Flt-3 ligands, IL-3, GM-CSF, M-CSF, erythropoietin, and thrombopoietin, the adult CLP did not give rise to myeloerythroid colonies as reported previously (22) (Fig. 5GoA). In contrast, ~4% of the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells formed macrophage colonies (Fig. 5GoA). Other myeloerythroid colonies containing granulocytes, erythrocytes, and megakaryocytes did not develop from the IL-7R{alpha}+Sca-1lowc-Kitlow cells in this culture.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 5. Differentiation potential of IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors in vitro. A, Result of a clonogenic progenitor assay in methylcellulose containing multiple cytokines. Mix: CFU-Mix, Meg/E: CFU-erythroid, CFU-megakaryocytes, or CFU-erythrocyte/megakaryocyte, G: CFU-granulocyte, GM: CFU-granulocyte/macrophage. M{phi}: CFU-macrophage. B, Frequency of B cell (upper panels) and macrophage (lower panels) development from adult CLP (left panels) or IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors (right panels). Specified numbers of cells were resorted into 96-well plates with S17 stromal layer. Numbers in the parentheses indicate estimated frequency of B cell or macrophage read-out in each experiment.

 
On a S17 stromal layer supplemented with IL-7, 1 in 7 IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells and 1 in 6 adult CLP differentiated into mature B cells (Fig. 5GoB) that were CD19+IgM+ (data not shown). However, IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells also gave rise to macrophages in the same culture condition. The frequency of macrophage differentiation was 1 in 14 cells (Fig. 5GoB) irrespective of additional M-CSF in the cultures. In this experiment, we found that 15% of single cell-derived macrophage colonies also contained B220+IgM+ B cells. As we reported previously (22), adult CLP did not give rise to myeloid cells under these conditions (Fig. 5GoB). Thus, IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells, but not adult CLP, retain differentiation potential to macrophages.

In addition, the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells can give rise to CD45+CD4+CD3- cells in vitro. As shown in Fig. 4GoC, 5 days after culture of 103 IL-7R{alpha}+Sca-1lowc-Kitlow cells in medium supplemented with IL-7, the cells differentiated into CD45+CD4+CD3- cells, as well as CD19+IgM- proB cells.

Newborn LN CD45+CD4+CD3- cells as well as IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells differentiate into dendritic cells in vitro

Because transfer of IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors gave rise to dendritic cells and CD45+CD4+CD3- cells in vivo, and because CD45+CD4+CD3- cells can give rise to APCs in vitro (19), we wished to test whether CD45+CD4+CD3- cells might be the precursors of dendritic cells in the LN.

The combination of cytokines such as IL-1{beta}, IL-3, IL-7, SLF, Flt-3 ligands, and TNF-{alpha} is reportedly effective in inducing dendritic cell differentiation from thymic lymphoid precursors (24). We cultured IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells in this culture condition. Ten to 30 dendritic cell clusters developed from 103 fetal liver cells 5–7 days after the initiation of culture (data not shown). The CD45+CD4+CD3- cells, obtained from day 0 MLN, also gave rise to small dendritic cell clusters on day 5. FACS analysis of cultured CD45+CD4+CD3- cells showed that a subset expressed dendritic and thymic epithelial cell receptor DEC-205, CD40, ICAM-1, CD86, and high levels of MHC class II (Fig. 6GoA). The fraction of day 0 MLN that did not contain CD45+CD4+CD3- cells did not give rise to DEC-205+ cells. In addition, when anti-CD40 was added on day 5 to the CD45+CD4+CD3- cultures and kept there until day 13, a further increase in MHC class II expression was observed (Fig. 6GoB). To test whether these in vitro differentiated cells had functional characteristics of APCs, cultured CD45+CD4+CD3- cells were pulsed with OVA for 12 h, and subsequently placed in culture with T cells obtained from mice that had been immunized with OVA. A significant proliferation of T cells was observed after a 4-day culture, indicating that the dendritic cells developed in vitro had efficiently processed and presented Ag (data not shown). Recently, it was shown that ELC was expressed constitutively in dendritic cells within the T cell zone of secondary lymphoid organs (34). Therefore, we analyzed ELC expression in freshly isolated CD45+CD4+CD3- cells by RT-PCR, and found that the cells expressed ELC (Fig. 6GoC).



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 6. Differentiation of CD45+CD4+CD3- cells toward the dendritic cell lineage. A, CD45+CD4+CD3- cells were sorted from day 0 MLN and cultured in the presence of IL-1{beta}, IL-3, IL-7, TNF-{alpha}, and SLF for 13 days and subsequently analyzed for expression of several cell surface molecules known to be expressed on dendritic cells. Within the total culture the majority of the cells expressed MHC class II, whereas the highest expression of MHC class II could be found on DEC-205+ cells. CD40, ICAM-1, and CD86 were also expressed by the majority of the cells. Filled-in overlays represent specific staining above background (lines only). B, Addition of anti-CD40 mAb to the cultures of CD45+CD4+CD3- cells in IL-1{beta}, IL-3, IL-7, TNF-{alpha}, and SLF from day 5 until day 13 further induced the expression of MHC class II when analyzed at day 13. Shown is MHC class II expression on CD11C+ cells. C, Analysis of cDNA from CD45+CD4+CD3- cells isolated from day 0 MLN by RT-PCR showed ELC-specific bands.

 
Semiquantitative analyses of lymphoid-related genes in the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells

We have found that adult CLP express both T and B lymphoid-related transcription factors such as GATA-3, Aiolos, and Pax-5 (Fig. 7Go) at low levels (26). The expression of these genes increased ~10-fold in more mature progenitors; Pax-5 and GATA-3 are up-regulated in either proB or proT stages, respectively, whereas Aiolos is up-regulated in both proB and proT stages by semiquantitative RT-PCR assays (26). The low level expression of Pax-5 may inhibit adult CLP from differentiating into myeloid lineages (37), because it has been reported that in the absence of Pax-5, cells expressing VpreB or {lambda}5 still retain their differentiation potential to T, and myelomonocytic lineages (38, 39, 40).



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 7. Differential expression of lineage-related genes in fetal liver precursors. A, The differential expression of Pax-5 in the prospectively isolated adult progenitor populations in bone marrow (26 ). Results shown were obtained by 36 PCR cycles amplification targeted for total RNA from 1000 cells of each population. B and C, Comparison of lineage-related gene expression between adult CLP (B) and the IL-7R{alpha}+Sca-1lowc-Kitlow (7R+SlowKlow) fetal liver precursors (C). Aiolos, GATA-3, and Pax-5 were evaluated by semiquantitative RT-PCR assays. For each reaction a calibration curve was performed to obtain linear correlation between pixel density units of the PCR products and the amount of control cDNA applied (see Materials and Methods). A very low expression level of Pax-5 is observed in fetal liver IL-7R{alpha}+Sca-1lowc-Kitlow precursors. The levels of Pax-5 detected in IL-7R{alpha}+Sca-1lowc-Kitlow precursors are ~10-fold less when compared with adult CLP, which express Pax-5 at a low level. Both adult CLP and fetal liver IL-7R{alpha}+Sca-1lowc-Kitlow cells express other lymphoid-related transcription factors, Aiolos and GATA-3, at low levels. Control cDNAs are derived from thymocytes for Aiolos, or total bone marrow cells for remaining genes, and are controls for B and C, which were performed at the same time. The symbols under each lane depict relative amounts of mRNA in each population compared with control cDNA (2 x 105 cells, bands not shown) by the ratio Pixel Density Units of target cDNA/Pixel Density Units of control cDNA: <0.1 (-), 0.1–0.5 (+), 0.5–1.5 (+), >1.5 (++); CMP: common myeloid progenitors; MEP: megakaryocyte/erythrocyte progenitors; GMP: granulocyte/macrophage progenitors.

 
We tested the expression profiles of these B cell-related genes in the fetal liver precursors. B cell-specific genes such as VpreB, and {lambda}5 were all expressed at high levels in the IL-7R{alpha}+B220+CD19+ proB cells in fetal liver and proB cells in adult bone marrow. Adult CLP and fetal liver IL-7R{alpha}+Sca-1lowc-Kitlow cells did not express significant levels of VpreB and {lambda}5, which were completely undetectable in adult and fetal HSC (Fig. 7Go, B and C). These populations were also negative for the expression of other myeloid-related genes including GATA-1, NF-E2, C/EBP{alpha} (data not shown), and M-CSFR (Fig. 7Go, B and C). These data strongly suggest that a majority of cells in these populations have not initiated a differentiation program for B cell or myeloid lineage.

Expression of Aiolos, GATA-3 (Fig. 7GoC), and PU.1 (data not shown) were analyzed in fetal liver IL-7R{alpha}+Sca-1lowc-Kitlow precursors by using the carefully calibrated semiquantitative PCR assays (see Materials and Methods). These genes were expressed at the similar low levels (~10-fold less than proB cells) as in adult CLP (Fig. 7GoB). In contrast, the fetal liver IL-7R{alpha}+Sca-1lowc-Kitlow precursors expressed very low amounts of Pax-5 at a level that was ~10-fold less when compared with adult CLP (Fig. 7Go, B and C). Thus, in fetal liver hemopoiesis, Pax-5 expression is not synchronized with expression of other lymphoid-related transcription factors; the initiation of Pax-5 expression might occur in conjunction with B cell commitment in fetal liver, whereas the low level expression of Pax-5 already begins at the stage of CLP in adult bone marrow.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have characterized the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver population that is a phenotypic analog of CLP in adult bone marrow. The IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells possess rapid and prominent reconstitution activity for lymphoid lineages including T, B, and NK cells, and also CD8{alpha}+ and CD8{alpha}- dendritic cells. However, in the fetal liver, expression of IL-7R{alpha} does not mark absolute lymphoid-restricted differentiation activity of precursors, because the IL-7R{alpha}+Sca-1lowc-Kitlow cells could give rise to macrophages at a fairly high frequency in vitro. This suggests that the lymphoid and myeloid commitment pathways may not be completely separated in fetal liver hemopoiesis. The broader potential of the IL-7R{alpha}+Sca-1lowc-Kitlow cells when compared with adult CLP was further revealed by their ability to give rise to CD45+CD4+CD3- cells both in vivo and in vitro.

The CD45+CD4+CD3- cells, which are found early in developing LNs, are potentially crucial for the induction of LNs and Peyer’s patches. Support for their role in this induction process is based on the observations that CD45+CD4+CD3- cells express many genes required for LN and/or Peyer’s patch development, and that in Id2-/- mice, which lack LNs and Peyer’s patches, CD45+CD4+CD3- cells are completely absent (15). In addition, we have recently shown that there is a complete lack of LNsand Peyer’s patches in mice that have a functional deletion ofthe ROR{gamma}, and that this coincides with the absence of CD45+CD4+CD3- cells in both fetal mesentery and intestines (17). Therefore, differentiation of IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors toward CD45+CD4+CD3- cells, which migrate to developing lymphoid organs, might involve the presence of ROR{gamma} and Id2. It has been suggested that signaling through the IL-7R could directly or indirectly up-regulate cell surface expression of LT{alpha}1{beta}2 on IL-7R+CD45+ cells in Peyer’s patch organizing centers in the fetal intestines (41). A role for signaling through the chemokine receptor CXCR5 in up-regulation of LT{alpha}1{beta}2 on B cells has been described, and it remains to be seen whether this signaling can also up-regulate LT{alpha}1{beta}2 on the earliest cells involved in induction of Peyer’s patches and LNs (16). The reported lack of LNs and Peyer’s patches in CXCR5-/- mice suggests such a role for CXCR5 (16). It is also described that Ikaros-/- mice lack lymphocytes, NK, and dendritic cells, as well as all LNs and Peyer’s patches (11, 13, 42). Therefore, it is possible that some isoforms of Ikaros (43) are involved in the early differentiation of IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors, whereas further differentiation into CD45+CD4+CD3- cells involves Id2 and ROR{gamma}.

The IL-7R{alpha}+Sca-1lowc-Kitlow cells gave rise to both CD8{alpha}+ and CD8{alpha}- dendritic cells in vivo. CD8{alpha} expression has been suggested to indicate a "lymphoid" origin of these dendritic cells (44). However, it does not necessarily mean that the "myeloid" CD8{alpha}- dendritic cells differentiated from the monocyte/macrophage progeny of IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells, because we recently found that both adult common myeloid progenitors and adult CLP in the bone marrow can give rise to CD8{alpha}+ as well as CD8{alpha}- dendritic cells in vivo (23, 24). We also show that in developing LNs at the day of birth, DEC-205-expressing dendritic cells can be generated from CD45+CD4+CD3- cells, but not from the remaining CD45+CD4-CD3- cells. Thus, the IL-7R{alpha}+Sca-1lowc-Kitlow cells might be able to regenerate dendritic cells in developing LNs via CD45+CD4+CD3- cells.

It has been shown that IL-7R-mediated signals maintain survival of developing {alpha}{beta}T cells (45), promote rearrangement of IgH genes in B cells (46), and promote {gamma}{delta}TCR rearrangement through activation of STAT5 (47). IL-7R-mediated signals have been shown to up-regulate LT{alpha}1{beta}2 on CD45+IL-7R{alpha}+ cells in the fetal intestine (41). In addition, we demonstrate here that IL-7 alone can support the development of CD45+CD4+CD3- cells from the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver precursors in vitro. However, the role of IL-7R signaling at the stage of CLP or during differentiation of fetal liver precursors into CD45+CD4+CD3- cells or dendritic cells remains unknown. IL-7R-mediated signals have been reported to be necessary for Pax-5 up-regulation in adult proB cells to initiate rearrangement of V-DJ recombination (46), and Pax-5-deficient adult proB cells are reportedly capable of differentiating into myelomonocytic and T cells (39, 40). It is also reported that the transduction of Pax-5 into adult HSC results in inhibition of their myeloid differentiation (37). These data strongly suggest that expression of Pax-5 might suppress the initiation of differentiation program toward T cells and myelomonocytic lineages (37, 39, 40).

The transcription factors related to independent lineages are expressed at low levels in oligopotential progenitors (48), and this phenomenon has been proposed to reflect priming stages at which lineage commitment remains flexible (49). In our hands, the IL-7R+ adult CLP express low levels of Pax-5 as well as other lymphoid-related transcription factors such as Aiolos and GATA-3 (Fig. 7Go), but not myeloid-related ones (26). However, adult CLP can read-out differentiation into myelomonocytic cells if the cells are transduced ectopic cytokine receptors, and received nonphysiological cytokine signals (25). Therefore, it is possible that adult CLP express low but sufficient levels of Pax-5 to suppress the differentiation into myelomonocytic lineages, whereas IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells express minimal levels of Pax-5 that allow them to access differentiation programs at least for the monocyte/macrophage lineage. The difference in Pax-5 expression in adult CLP vs IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells may be due to different signaling cascades downstream of the IL-7R in these populations. However, we cannot exclude the possibility that the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells form a heterogeneous population with a more restricted potential at the clonal level. The growth requirements for these precursors did not allow for clonal analysis yet.

The IL-7R{alpha}+Sca-1lowc-Kitlow cells and CD19+ proB cells cover >95% of the IL-7R+ population in the E14 fetal liver, the population of fetal liver cells in which we expect the CLP activity. Thus, it is possible that the fully lymphoid-restricted CLP does not exist as a significant population in fetal liver lymphopoiesis, and fetal lymphoid commitment may initiate at a distinct stage common to T, B, NK cells, dendritic cells, and macrophages. Lacaud et al. (36) reported the possible existence of precursors common to T and B cells, and macrophages in the AA4.1+Fc{gamma}R+ fetal liver population. This population does not include the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells (Fig. 2Go), and contains some multipotential stem cells. Sagara et al. (50) reported that the B220+c-Kit+ fetal liver cells that have in vitro differentiation potential toward T and B cells can form macrophage colonies. In our hands, the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells expressed negative to low levels of B220 (but not CD19) (Fig. 1Go), and both B220low and B220- fractions within this population possessed macrophage-differentiation potential on S17 stromal layers (data not shown). These data strongly suggest that developing fetal liver precursors maintain differentiation potential to macrophages and T cells after they begin to express B220 and IL-7R, which are important markers for B cell progenitors in adult hemopoiesis (35). The IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver population contains clonogenic cells at least for B cells and macrophages. Cumano et al. (51) reported the same phenomenon for AA4.1+B220-Mac-1-Sca-1+ fetal liver cells, although the population of this phenotype should also include fetal liver HSC as well as the IL-7R{alpha}+Sca-1lowc-Kitlow cells (51).

The data presented here suggest that in fetal liver hemopoiesis, the developmental capacity for macrophages might be maintained after cells lose their differentiation potential for other myeloid cells but acquire rapid differentiation potential for all lymphoid lineages. However, the burst size of macrophage progeny from the IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells might be limited because we failed to detect macrophage progeny from 3 to 5 x 103 IL-7R{alpha}+Sca-1lowc-Kitlow cells after in vivo reconstitution assay, and from 5 to 50 cells in a fetal thymic organ culture assay that was reported by Kawamoto et al. (52) (our unpublished data). The latter finding is compatible with a recent report from this group that showed that the Lin-IL-7R+ fraction of fetal liver cells did not possess significant macrophage differentiation activity in this assay, although a few percent of these cells can form macrophage colonies in the methylcellulose assay (53). The IL-7R{alpha}+Sca-1lowc-Kitlow cells did not proliferate in methylcellulose containing IL-7, SLF, and Flt-3 ligand, in which single adult CLP proliferate ideally to perform clonal assays (22). These problems currently prevent us from performing clonogenic assays for IL-7R{alpha}+Sca-1lowc-Kitlow cells.

Thus, the newly identified IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells differentiate in vivo into all lymphoid cells, dendritic cells, and CD45+CD4+CD3- precursors, all of which are essential components of LNs and Peyer’s patches. This study provides evidence that the precursors to all the cells that form, and potentially induce, LNs and Peyer’s patches originate from IL-7R{alpha}+Sca-1lowc-Kitlow fetal liver cells, and that this population might be at the earliest known stage for lymphoid organ development in fetal liver. These experiments and others (54) suggest that stem and progenitor cells become increasingly restricted in their differentiation potential from fetal to adult life. Therefore, it is important to clarify the machinery that regulates the developmental switch in fetal and adult lymphoid development.


    Acknowledgments
 
We thank Georg Kraal for helpful discussions, Jason Cyster for providing ELC primers, Veronica Braunstein for Ab preparation, Shin-Ichi Nishikawa for providing the anti IL-7R{alpha} Ab, and Yoshimoto Katsura and Hiroshi Kawamoto for providing a detailed protocol for the multilineage progenitor assay.


    Footnotes
 
1 R.E.M. was supported by the Royal Netherlands Academy of Arts and Sciences, T.C. was a recipient of Grant 901-05-340 from The Netherlands Organization for Scientific Research, I.L.W. was funded by National Cancer Institute Grant CA42551, and K.A was funded by a Jose Carreras International Leukemia Society (1997) grant and a Claudia Adams-Barr grant. Back

2 Address correspondence and reprint requests to Dr. Reina E. Mebius, Department of Cell Biology and Immunology, Faculty of Medicine, Vrije Universiteit, v.d. Boechorststraat 7, 1081 BT Amsterdam, The Netherlands. E-mail address: r.mebius.cell{at}med.vu.nl Back

3 Current address: Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, 44 Binney Street, Boston, MA 02115. Back

4 Abbreviations used in this paper: LN, lymph node; CLP, common lymphoid-restricted progenitors; LT, lymphotoxin; CXCR, CXC chemokine receptor; HSC, hemopoietic stem cells; SLF, Steel factor; MLN, mesenteric LN; ELC, EBV-induced molecule-1 ligand chemokine; Tanneal, annealing temperature; ROR{gamma}, retinoic acid receptor-related orphan receptor-{gamma} Back

Received for publication December 26, 2000. Accepted for publication March 30, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rennert, P. D., J. L. Browning, R. Mebius, F. Mackay, P. S. Hochman. 1996. Surface lymphotoxin {alpha}/{beta} complex is required for the development of peripheral lymphoid organs. J. Exp. Med. 184:1999.[Abstract/Free Full Text]
  2. Rennert, P. D., D. James, F. Mackay, J. L. Browning, P. S. Hochman. 1998. Lymph node genesis is induced by signaling through the lymphotoxin {beta} receptor. Immunity 9:71.[Medline]
  3. Futterer, A., K. Mink, A. Luz, M. H. Kosco-Vilbois, K. Pfeffer. 1998. The lymphotoxin {beta} receptor controls organogenesis and affinity maturation in peripheral lymphoid tissues. Immunity 9:59.[Medline]
  4. De Togni, P. D., J. Goellner, N. H. Ruddle, P. R. Streeter, A. Fick, S. Mariathasan, S. C. Smith, R. Carlson, L. P. Shornick, J. Strauss-Schoenberger, et al 1994. Abnormal development of peripheral lymphoid organs in mice deficient in lymphotoxin. Science 264:703.[Abstract/Free Full Text]
  5. Alimzhanov, M. B., D. V. Kuprash, M. H. Kosco-Vilbois, A. Luz, R. L. Turetskaya, A. Tarakhovsky, K. Rajewsky, S. A. Nedospasov, K. Pfeffer. 1997. Abnormal development of secondary lymphoid tissues in lymphotoxin {beta}-deficient mice. Proc. Natl. Acad. Sci. USA 94:9302.[Abstract/Free Full Text]
  6. Banks, T. A., B. T. Rouse, M. K. Kerley, P. J. Blair, V. L. Godfrey, N. A. Kuklin, D. M. Bouley, J. Thomas, S. Kanangat, M. L. Mucenski. 1995. Lymphotoxin-{alpha}-deficient mice: effects on secondary lymphoid organ development and humoral immune responsiveness. J. Immunol. 155:1685.[Abstract]
  7. Burkly, L., C. Hession, L. Ogata, C. Reilly, L. A. Marconi, D. Olson, R. Tizard, R. Cate, D. Lo. 1995. Expression of relB is required for the development of thymic medulla and dendritic cells. Nature 373:531.[Medline]
  8. Cao, X., E. W. Shores, J. Hu-Li, M. R. Anver, B. L. Kelsall, S. M. Russell, J. Drago, M. Noguchi, A. Grinberg, E. T. Bloom. 1995. Defective lymphoid development in mice lacking expression of the common cytokine receptor {gamma} chain. Immunity 2:223.[Medline]
  9. Forster, R., A. E. Mattis, E. Kremmer, E. Wolf, G. Brem, M. Lipp. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037.[Medline]
  10. Freeden-Jeffry, U. V., P. Vieira, L. A. Lucian, T. McNeil, S. E. Burdach, R. Murray. 1995. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J. Exp. Med. 181:1519.[Abstract/Free Full Text]
  11. Georgopoulos, K., M. Bigby, J. H. Wang, A. Molnar, P. Wu, S. Winandy, A. Sharpe. 1994. The Ikaros gene is required for the development of all lymphoid lineages. Cell 79:143.[Medline]
  12. Kong, Y. Y., H. Yoshida, I. Sarosi, H. L. Tan, E. Timms, C. Capparelli, S. Morony, A. J. Oliveira-dos-Santos, G. Van, A. Itie, et al 1999. OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature 397:315.[Medline]
  13. Wang, J. H., A. Nichogiannopoulou, L. Wu, L. Sun, A. H. Sharpe, M. Bigby, K. Georgopoulos. 1996. Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation. Immunity 5:537.[Medline]
  14. Weih, F., D. Carrasco, S. K. Durham, D. S. Barton, C. A. Rizzo, R. P. Ryseck, S. A. Lira, R. Bravo. 1995. Multiorgan inflammation and hematopoietic abnormalities in mice with a targeted disruption of RelB, a member of the NF-{kappa}B/Rel family. Cell 80:331.[Medline]
  15. Yokota, Y., A. Mansouri, S. Mori, S. Sugawara, S. Adachi, S.-I. Nishikawa, P. Gruss. 1999. Development of peripheral lymphoid organs and natural killer cells depends on the helix-loop-helix inhibitor Id2. Nature 397:702.[Medline]
  16. Ansel, K. M., V. N. Ngo, P. L. Hyman, S. A. Luther, R. Förster, J. Sedgwick, J. L. Browning, M. Lipp, J. G. Cyster. 2000. A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature 406:309.[Medline]
  17. Sun, Z., D. Unutmaz, Y.-R. Zou, M. J. Sunshine, A. Pierani, S. Brenner-Morton, R. E. Mebius, D. R. Littman. 2000. Requirement for ROR{gamma} in thymocyte survival and lymphoid organ development. Science 288:2369.[Abstract/Free Full Text]
  18. Mebius, R. E., P. R. Streeter, S. Michie, E. C. Butcher, I. L. Weissman. 1996. A developmental switch in lymphocyte homing receptor and endothelial vascular addressin expression regulates lymphocyte homing and permits CD4+ CD3- cells to colonize lymph nodes. Proc. Natl. Acad. Sci. USA 93:11019.[Abstract/Free Full Text]
  19. Mebius, R. E., P. Rennert, I. L. Weissman. 1997. Developing lymph nodes collect CD4+CD3-LT{beta}+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells. Immunity 7:493.[Medline]
  20. Spencer, J., T. T. MacDonald, T. Finn, P. G. Isaacson. 1986. The development of gut associated lymphoid tissue in the terminal ileum of fetal human intestine. Clin. Exp. Immunol. 64:536.[Medline]
  21. Adachi, S., H. Yoshida, H. Kataoka, S. Nishikawa. 1997. Three distinctive steps in Peyer’s patch formation of murine embryo. Int. Immunol. 9:507.[Abstract/Free Full Text]
  22. Kondo, M., I. L. Weissman, K. Akashi. 1997. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell 91:661.[Medline]
  23. Manz, M., D. Traver, T. Miyamoto, I. L. Weissman, and K. Akashi. 2001. Dendritic cell potentials in early lymphoid and myeloid hematopoiesis. Blood. In press.
  24. Traver, D., K. Akashi, M. Manz, M. Merad, T. Miyamoto, E. G. Engleman, I. L. Weissman. 2000. Development of CD8{alpha}-positive dendritic cells from a common myeloid progenitor. Science 290:2152.[Abstract/Free Full Text]
  25. Kondo, M., D. C. Scherer, T. Miyamoto, A. G. King, K. Akashi, K. Sugamura, I. L. Weissman. 2000. Cell-fate conversion of lymphoid-committed progenitors by instructive actions of cytokines. Nature 407:383.[Medline]
  26. Akashi, K., D. Traver, T. Miyamoto, I. L. Weissman. 2000. A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature 404:193.[Medline]
  27. Saunders, D., K. Lucas, J. Ismaili, L. Wu, E. Maraskovsky, A. Dunn, K. Shortman. 1996. Dendritic cell development in culture from thymic precursor cells in the absence of granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 184:2185.[Abstract/Free Full Text]
  28. Horikoshi, T., K. D. Danenberg, T. H. Stadlbauer, M. Volkenandt, L. C. Shea, K. Aigner, B. Gustavsson, L. Leichman, R. Frösing, M. Ray, et al 1992. Quantitation of thymidylate synthase, dihydrofolate reductase, and DT-diaphorase gene expression in human tumors using the polymerase chain reaction. Cancer Res. 52:108.[Abstract/Free Full Text]
  29. Adams, B., P. Dorfler, A. Aguzzi, Z. Kozmik, P. Urbanek, I. Maurer-Fogy, M. Busslinger. 1992. Pax-5 encodes the transcription factor BSAP and is expressed in B lymphocytes, the developing CNS, and adult testis. Genes Dev. 6:1589.[Abstract/Free Full Text]
  30. Rolink, A., E. ten Boekel, F. Melchers, D. T. Fearon, I. Krop, J. Andersson. 1996. A subpopulation of B220+ cells in murine bone marrow does not express CD19 and contains natural killer cell progenitors. J. Exp. Med. 183:187.[Abstract/Free Full Text]
  31. Delassus, S., I. Titley, T. Enver. 1999. Functional and molecular analysis of hematopoietic progenitors derived from the aorta-gonad-mesonephros region of the mouse embryo. Blood 94:1495.[Abstract/Free Full Text]
  32. Ko, L. J., M. Yamamoto, M. W. Leonard, K. M. George, P. Ting, J. D. Engel. 1991. Murine and human T-lymphocyte GATA-3 factors mediate transcription through a cis-regulatory element within the human T-cell receptor {delta} gene enhancer. Mol. Cell. Biol. 11:2778.[Abstract/Free Full Text]
  33. Morgan, B., L. Sun, N. Avitahl, K. Andrikopoulos, T. Ikeda, E. Gonzales, P. Wu, S. Neben, K. Georgopoulos. 1997. Aiolos, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation. EMBO J. 16:2004.[Medline]
  34. Morrison, S. J., H. D. Hemmati, A. M. Wandycz, I. L. Weissman. 1995. The purification and characterization of fetal liver hematopoietic stem cells. Proc. Natl. Acad. Sci. USA 92:10302.[Abstract/Free Full Text]
  35. Hardy, R. R., C. E. Carmack, S. A. Shinton, J. D. Kemp, K. Hayakawa. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173:1213.[Abstract/Free Full Text]
  36. Lacaud, G., L. Carlsson, G. Keller. 1998. Identification of a fetal hematopoietic precursor with B cell, T cell, and macrophage potential. Immunity 9:827.[Medline]
  37. Chiang, M. Y., J. G. Monroe. 1999. BSAP/Pax5A expression blocks survival and expansion of early myeloid cells implicating its involvement in maintaining commitment to the B-lymphocyte lineage. Blood 94:3621.[Abstract/Free Full Text]
  38. Nutt, S. L., P. Urbánek, A. Rolink, M. Busslinger. 1997. Essential functions of Pax5 (BSAP) in pro-B cell development: difference between fetal and adult B lymphopoiesis and reduced V-to-DJ recombination at the IgH locus. Genes Dev. 11:476.[Abstract/Free Full Text]
  39. Nutt, S. L., B. Heavey, A. G. Rolink, M. Busslinger. 1999. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature 401:556.[Medline]
  40. Rolink, A. G., S. L. Nutt, F. Melchers, M. Busslinger. 1999. Long-term in vivo reconstitution of T-cell development by Pax5-deficient B-cell progenitors. Nature 401:603.[Medline]
  41. Yoshida, H., K. Honda, R. Shinkura, S. Adachi, S. Nishikawa, K. Maki, K. Ikuta, S. I. Nishikawa. 1999. IL-7 receptor {alpha}+ CD3- cells in the embryonic intestine induces the organizing center of Peyer’s patches. Int. Immunol. 11:643.[Abstract/Free Full Text]
  42. Wu, L., A. Nichogiannopoulou, K. Shortman, K. Georgopoulos. 1997. Cell-autonomous defects in dendritic cell populations of Ikaros mutant mice point to a developmental relationship with the lymphoid lineage. Immunity 7:483.[Medline]
  43. Klug, C. A., S. J. Morrison, M. Masek, K. Hahm, S. T. Smale, I. L. Weissman. 1998. Hematopoietic stem cells and lymphoid progenitors express different Ikaros isoforms, and Ikaros is localized to heterochromatin in immature lymphocytes. Proc. Natl. Acad. Sci. USA 95:657.[Abstract/Free Full Text]
  44. Shortman, K., D. Vremec, L. M. Corcoran, K. Georgopoulos, K. Lucas, L. Wu. 1998. The linkage between T cell and dendritic cell development in the mouse thymus. Immunol. Rev. 165:39.[Medline]
  45. Akashi, K., M. Kondo, U. von Freeden-Jeffry, R. Murray, I. L. Weissman. 1997. Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice. Cell 89:1033.[Medline]
  46. Corcoran, A. E., A. Riddell, D. Krooshoop, A. R. Venkitaraman. 1998. Impaired immunoglobulin gene rearrangement in mice lacking the IL-7 receptor. Nature 391:904.[Medline]
  47. Ye, S. K., K. Maki, T. Kitamura, S. Sunaga, K. Akashi, J. Domen, I. L. Weissman, T. Honjo, K. Ikuta. 1999. Induction of germline transcription in the TCR{gamma} locus by Stat5: implications for accessibility control by the IL-7 receptor. Immunity 11:213.[Medline]
  48. Hu, M., D. Krause, M. Greaves, S. Sharkis, M. Dexter, C. Heyworth, T. Enver. 1997. Multilineage gene expression precedes commitment in the hemopoietic system. Genes Dev. 11:774.[Abstract/Free Full Text]
  49. Enver, T., M. Greaves. 1998. Loops, lineage, and leukemia. Cell 94:9.[Medline]
  50. Sagara, S., K. Sugaya, Y. Tokoro, S. Tanaka, H. Takano, H. Kodama, H. Nakauchi, Y. Takahama. 1997. B220 expression by T lymphoid progenitor cells in mouse fetal liver. J. Immunol. 158:666.[Abstract]
  51. Cumano, A., C. J. Paige, N. N. Iscove, G. Brady. 1992. Bipotential precursors of B cells and macrophages in murine fetal liver. Nature 356:612.[Medline]
  52. Kawamoto, H., K. Ohmura, Y. Katsura. 1997. Direct evidence for the commitment of hematopoietic stem cells to T, B and myeloid lineages in murine fetal liver. Int. Immunol. 9:1011.[Abstract/Free Full Text]
  53. Kawamoto, H., T. Ikawa, K. Ohmura, S. Fujimoto, Y. Katsura. 2000. T cell progenitors emerge earlier than B cell progenitors in the murine fetal liver. Immunity 12:441.[Medline]
  54. Ikuta, K., T. Kina, I. MacNeil, N. Uchida, B. Peault, Y. H. Chien, I. L. Weissman. 1990. A developmental switch in thymic lymphocyte maturation potential occurs at the level of hematopoietic stem cells. Cell 62:863.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. Schmutz, N. Bosco, S. Chappaz, O. Boyman, H. Acha-Orbea, R. Ceredig, A. G. Rolink, and D. Finke
Cutting Edge: IL-7 Regulates the Peripheral Pool of Adult ROR{gamma}+ Lymphoid Tissue Inducer Cells
J. Immunol., August 15, 2009; 183(4): 2217 - 2221.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Jin, R. Sood, J. Xu, F. Zhen, M. A. English, P. P. Liu, and Z. Wen
Definitive hematopoietic stem/progenitor cells manifest distinct differentiation output in the zebrafish VDA and PBI
Development, February 15, 2009; 136(4): 647 - 654.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. C. Luis, F. Weerkamp, B. A. E. Naber, M. R. M. Baert, E. F. E. de Haas, T. Nikolic, S. Heuvelmans, R. R. De Krijger, J. J. M. van Dongen, and F. J. T. Staal
Wnt3a deficiency irreversibly impairs hematopoietic stem cell self-renewal and leads to defects in progenitor cell differentiation
Blood, January 15, 2009; 113(3): 546 - 554.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. E. Desanti, A. Cumano, and R. Golub
Identification of CD4int progenitors in mouse fetal spleen, a source of resident lymphoid cells
J. Leukoc. Biol., May 1, 2008; 83(5): 1145 - 1154.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. D. Boos, Y. Yokota, G. Eberl, and B. L. Kee
Mature natural killer cell and lymphoid tissue-inducing cell development requires Id2-mediated suppression of E protein activity
J. Exp. Med., May 14, 2007; 204(5): 1119 - 1130.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Y. Bertrand, G. E. Desanti, R. Lo-Man, C. Leclerc, A. Cumano, and R. Golub
Fetal spleen stroma drives macrophage commitment
Development, September 15, 2006; 133(18): 3619 - 3628.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. L. Veinotte, C. P. Greenwood, N. Mohammadi, C. A. Parachoniak, and F. Takei
Expression of rearranged TCR{gamma} genes in natural killer cells suggests a minor thymus-dependent pathway of lineage commitment
Blood, April 1, 2006; 107(7): 2673 - 2679.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Giebel, T. Zhang, J. Beckmann, J. Spanholtz, P. Wernet, A. D. Ho, and M. Punzel
Primitive human hematopoietic cells give rise to differentially specified daughter cells upon their initial cell division
Blood, March 1, 2006; 107(5): 2146 - 2152.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Y. Lai, S. M. Lin, and M. Kondo
Heterogeneity of Flt3-Expressing Multipotent Progenitors in Mouse Bone Marrow
J. Immunol., October 15, 2005; 175(8): 5016 - 5023.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Iwasaki, C. Somoza, H. Shigematsu, E. A. Duprez, J. Iwasaki-Arai, S.-i. Mizuno, Y. Arinobu, K. Geary, P. Zhang, T. Dayaram, et al.
Distinctive and indispensable roles of PU.1 in maintenance of hematopoietic stem cells and their differentiation
Blood, September 1, 2005; 106(5): 1590 - 1600.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. L. Hager-Theodorides, J. T. Dessens, S. V. Outram, and T. Crompton
The transcription factor Gli3 regulates differentiation of fetal CD4-CD8- double-negative thymocytes
Blood, August 15, 2005; 106(4): 1296 - 1304.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Dakic, D. Metcalf, L. Di Rago, S. Mifsud, L. Wu, and S. L. Nutt
PU.1 regulates the commitment of adult hematopoietic progenitors and restricts granulopoiesis
J. Exp. Med., May 2, 2005; 201(9): 1487 - 1502.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Dias, H. Silva Jr., A. Cumano, and P. Vieira
Interleukin-7 is necessary to maintain the B cell potential in common lymphoid progenitors
J. Exp. Med., March 21, 2005; 201(6): 971 - 979.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. B. Everhart, W. Han, K. S. Parman, V. V. Polosukhin, H. Zeng, R. T. Sadikot, B. Li, F. E. Yull, J. W. Christman, and T. S. Blackwell
Intratracheal administration of liposomal clodronate accelerates alveolar macrophage reconstitution following fetal liver transplantation
J. Leukoc. Biol., February 1, 2005; 77(2): 173 - 180.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Zamisch, B. Moore-Scott, D.-m. Su, P. J. Lucas, N. Manley, and E. R. Richie
Ontogeny and Regulation of IL-7-Expressing Thymic Epithelial Cells
J. Immunol., January 1, 2005; 174(1): 60 - 67.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Haddad, P. Guardiola, B. Izac, C. Thibault, J. Radich, A.-L. Delezoide, C. Baillou, F. M. Lemoine, J. C. Gluckman, F. Pflumio, et al.
Molecular characterization of early human T/NK and B-lymphoid progenitor cells in umbilical cord blood
Blood, December 15, 2004; 104(13): 3918 - 3926.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Esashi, H. Ito, K. Ishihara, T. Hirano, S. Koyasu, and A. Miyajima
Development of CD4+ Macrophages from Intrathymic T Cell Progenitors Is Induced by Thymic Epithelial Cells
J. Immunol., October 1, 2004; 173(7): 4360 - 4367.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Cupedo, M. F. R. Vondenhoff, E. J. Heeregrave, A. E. de Weerd, W. Jansen, D. G. Jackson, G. Kraal, and R. E. Mebius
Presumptive Lymph Node Organizers are Differentially Represented in Developing Mesenteric and Peripheral Nodes
J. Immunol., September 1, 2004; 173(5): 2968 - 2975.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
G. Eberl and D. R. Littman
Thymic Origin of Intestinal {alpha}{beta} T Cells Revealed by Fate Mapping of ROR{gamma}t+ Cells
Science, July 9, 2004; 305(5681): 248 - 251.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Esashi, T. Sekiguchi, H. Ito, S. Koyasu, and A. Miyajima
Cutting Edge: A Possible Role for CD4+ Thymic Macrophages as Professional Scavengers of Apoptotic Thymocytes
J. Immunol., September 15, 2003; 171(6): 2773 - 2777.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
T. Nikolic, M. F. T. R. d. Bruijn, M. B. Lutz, and P. J. M. Leenen
Developmental stages of myeloid dendritic cells in mouse bone marrow
Int. Immunol., April 1, 2003; 15(4): 515 - 524.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. de Andres, P. Gonzalo, S. Minguet, J. A. Martinez-Marin, P. G. Soro, M. A. R. Marcos, and M. L. Gaspar
The first 3 days of B-cell development in the mouse embryo
Blood, December 1, 2002; 100(12): 4074 - 4081.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. H. Lian, M. Maeda, S. Lohwasser, M. Delcommenne, T. Nakano, R. E. Vance, D. H. Raulet, and F. Takei
Orderly and Nonstochastic Acquisition of CD94/NKG2 Receptors by Developing NK Cells Derived from Embryonic Stem Cells In Vitro
J. Immunol., May 15, 2002; 168(10): 4980 - 4987.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Graf
Differentiation plasticity of hematopoietic cells
Blood, May 1, 2002; 99(9): 3089 - 3101.
[Full Text] [PDF]


Home page
Int ImmunolHome page
R. Ceredig
The ontogeny of B cells in the thymus of normal, CD3{varepsilon} knockout (KO), RAG-2 KO and IL-7 transgenic mice
Int. Immunol., January 1, 2002; 14(1): 87 - 99.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Traver, T. Miyamoto, J. Christensen, J. Iwasaki-Arai, K. Akashi, and I. L. Weissman
Fetal liver myelopoiesis occurs through distinct, prospectively isolatable progenitor subsets
Blood, August 1, 2001; 98(3): 627 - 635.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mebius, R. E.
Right arrow Articles by Akashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mebius, R. E.
Right arrow Articles by Akashi, K.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Stem Cells


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS