|
|
||||||||





*
Department of Cell Biology and Immunology, Faculty of Medicine, Vrije Universiteit, Amsterdam, The Netherlands; and
Departments of Pathology and Developmental Biology, Stanford University School of Medicine, Stanford, CA 94305
| Abstract |
|---|
|
|
|---|
+Sca-1lowc-Kitlow
population in E14 fetal liver, which is the phenotypical analog of
common lymphoid progenitors (CLP) in adult bone marrow. After
transfer into newborn mice, the
IL-7R
+Sca-1lowc-Kitlow
population rapidly differentiated into
CD45+CD4+CD3- cells, which are
candidate cells for initiating lymph node and Peyers patch formation.
In addition, this population also gave rise to B, T, NK, and
CD8
+ and CD8
- dendritic cells. The fetal
liver precursors expressed a significantly lower level of the
myeloid-suppressing transcription factor Pax-5, than adult CLP, and
retained differentiation activity for macrophages in vitro. We propose
that the transition from fetal liver
IL-7R
+Sca-1lowc-Kitlow cells to
adult CLP involves a regulated restriction of their developmental
potential, controlled, at least in part, by Pax-5
expression. | Introduction |
|---|
|
|
|---|
, LT
, and LT
R are required
(1, 2, 3, 4, 5, 6). In addition, it is now clear that many other
genes, including the ones encoding IL-7, IL-7R, relB, transcription
factor Ikaros, CXC chemokine receptor (CXCR)5, Id-2,
retinoic acid receptor-related orphan receptor-
(ROR
), and
osteoprotegerin ligand/TNF-induced cytokine are involved in
lymphoid organ development (7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17). However, the cellular
requirements and sequence of events involving these gene products are
unknown. What we know so far is that before birth the developing LNs
are colonized selectively by TCR
T cells and
CD45+CD4+CD3-
cells in a mucosal addressin cell adhesion molecule-1
(MAdCAM-1)/
4
7-dependent
manner (18). The earliest cells that colonize the LNs and
that have cell surface expression of
LT
1
2
are
4
7+CD45+CD4+CD3-CD62L-
cells (19). A similar population of cells has been
reported to be present in the organizing centers for intestinal
Peyers patches in both humans and mice (20, 21). These
cells were shown to be specifically missing in fetal mesentery and/or
in fetal intestines of ROR
and Id2 knock-out mice, respectively.
Both mutant mouse strains have a complete lack of LNs and Peyers
patches (15, 17). Therefore,
CD45+CD4+CD3-
cells are likely candidates for delivering some of the required signals
for LN (and perhaps Peyers patch) induction during embryogenesis.
We have reported that the
4
7+CD45+CD4+CD3-
cells in newborn LNs express IL-7R
(19) that transduces
indispensable signals for adult T and B lymphopoiesis. The IL-7R
is
also expressed on the surface of B cell- and T cell-committed
progenitors; the IL-7R
+ fraction of adult bone
marrow does not contain cells that can differentiate into myeloid cells
(22). We have identified common lymphoid-restricted
progenitors (CLP) in the IL-7R
-expressing fraction in the adult
mouse bone marrow. The adult CLP can be purified with a FACS, and give
rise to B, T, NK (22), and both
CD8
+ and CD8
-
dendritic cells (23, 24) when injected into irradiated
hosts. The levels of c-Kit and Sca-1 are considerably lower on adult
CLP, compared with adult hemopoietic stem cells (HSC), suggesting a
partial down-regulation of these molecules upon lymphoid
differentiation (22). In contrast, we have recently
reported that the ectopic signals from human GM-CSFR or human IL-2R
-chain in adult CLP can reprogram the cells to transdifferentiate
into myelomonocytic cells in the presence of human GM-CSF or IL-2
(25). Therefore, it is suggested that adult CLP possess
plasticity for myelomonocytic differentiation, but the differentiation
programs are not accessible in physiological condition at the level
of CLP.
These data prompted us to search for counterpart fetal liver precursors
for adult CLP within the IL-7R
+ fraction of
fetal liver cells, to clarify the lymphoid differentiation pathways in
fetal liver, and to identify the origin of
CD45+CD4+CD3-
cells. We found that
IL-7R
+Sca-1lowc-Kitlow
cells, which are phenotypically similar to adult CLP, are present as a
distinct population in fetal liver at E12.5-E14.5. The in vivo
differentiation potential of this population included the
CD45+CD4+CD3-
cells, which colonize LNs early in development, in addition to B cells,
T cells, NK cells, and both CD8
+ and
CD8
- dendritic cells. Thus, the
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells might be the fetal equivalent of adult CLP, and are
the earliest precursors for
CD45+CD4+CD3-
cells and other accessory cells that may be crucial for the formation
of secondary lymphoid organs. However, the fetal phenotypic
analog of adult CLP, the
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells possess differentiation capacity for macrophages that
was only detectable in vitro. We show that the fetal liver
IL-7R
+Sca-1lowc-Kitlow
cells expressed a decreased level of Pax-5, a myeloid-suppressing
transcription factor, when compared with adult CLP. Therefore, it is
suggested that the regulation of Pax-5 expression may play an important
role in restriction of differentiation during the transition from fetal
liver
IL-7R
+Sca-1lowc-Kitlow
cells to adult CLP.
| Materials and Methods |
|---|
|
|
|---|
C57BL/Ka-Ly5.1 and C57BL/Ka-Ly5.2 mice were maintained in the laboratory animal colony at Stanford University School of Medicine (Stanford, CA) and the Vrije Universiteit Faculty of Medicine (Amsterdam, The Netherlands).
Abs and cell sorting
The following Abs were used for sorting of fetal liver
precursors: 6B2 (anti B220), M1/70 (anti Mac-1), 2B8 (anti c-Kit,
CD117), E13 (anti Sca-1), A7R34 (anti IL-7R
, CD127, a gift of S.
Nishikawa, Kyoto University, Kyoto, Japan). In addition to these
Abs, the following Abs were used for analysis of reconstituted mice:
KT-31 (anti CD3), 8C5 (anti Gr-1), NK1.1 (anti NK cell marker)
(PharMingen, San Diego, CA), N418 (anti CD11c) (PharMingen),
25-9-17 (anti Iab,d) (PharMingen), AL1-4A2 (anti
Ly-5.1), A20.1.7 (anti Ly-5.2) (mAb 6B2, M1/70, 2B8, E13, KT-31, 8C5,
AL1-4A2, and A20.1.7 were purified from culture supernatant from
hybridoma cells with protein G-Sepharose (Pharmacia, Uppsala, Sweden)
and labeled in our laboratory). Stained cells were sorted or analyzed
using a highly modified triple laser (488-nm argon laser, 599-nm dye
laser, and UV laser) FACS (FACSVantage; BD Immunocytometry Systems,
Mountain View, CA). Progenitors were purified by sorting and then
resorted to obtain precise numbers of cells that were essentially pure
for the indicated surface marker phenotype. In the limiting dilution
assays and single cell clonogenic assays, the resort was performed by
using a carefully calibrated automatic cell deposition unit system (BD
Immunocytometry Systems). This system deposited a specific number of
purified cells onto methylcellulose medium, S17 stromal cell cultures,
or HBSS in 96-well plates. In most cases, we reconfirmed the specific
number of cells sorted in each well under an inverted microscope. The
detailed protocols for sorting has been published elsewhere (22, 26).
Reconstitution of newborn animals
Newborn mice (days 02) were used for analysis of the progeny of fetal liver precursors and adult CLP. We used the congenic strains C57BL/Ka-Ly5.1 and C57BL/Ka-Ly5.2, which only differ at the Ly5 locus, allowing us to trace donor-derived cells generated from the injected fetal liver precursors. Newborn mice (from day 0 to day 2) were sublethally irradiated with 400 rad using an x-ray source operated at 200 kV, delivering 85 rad/min. Mice were irradiated in two doses, of 200 rad each, 3 h apart. Sorted cells, derived from E14.5 fetal livers or adult bone marrow, were injected into the liver of congenic newborn mice. The presence of donor-derived cells, at several time points after reconstitution, was determined by gating for donor Ly5.2+ as well as host Ly5.1- cells, to omit Ly5.1+Ly5.2+ artificial doublets from the analysis.
In vitro differentiation assays
To analyze the potential of precursors to generate myeloid
colonies, cells were cultured in an
-MEM-based methyl cellulose
medium (Methocult M3100; StemCell Technologies, Vancouver, Canada)
containing 30% FBS (Gemini Bio-Products, Woodland, CA), 1% BSA, 2 mM
L-glutamine, and 50 µM 2-ME and the following cytokines:
IL-3 (30 ng/ml; R&D Systems, Minneapolis, MN), IL-6 (10 ng/ml; R&D
Systems), mouse GM-CSF (10 ng/ml; R&D Systems), Steel factor (SLF, 10
ng/ml; R&D Systems), human M-CSF (25 U/ml; R&D Systems), and human
erythropoietin (2 U/ml; Kirin, Tokyo, Japan). To analyze the frequency
of cells that could give rise to B cell or macrophage colonies in
liquid cultures, precursors were sorted, at one cell per well, onto
irradiated (4000 rad) S17 stromal cell layers in 96-well plates with
RPMI 1640 medium containing 10% FBS, SLF (100 ng/ml; R&D Systems), and
mouse IL-7 (10 ng/ml; R&D Systems). IL-7 was supplied in sufficient
amounts because 10-fold higher concentrations did not alter the
results. All cultures were incubated at 37°C in a humidified chamber
under 7% CO2. For differentiation of fetal liver
or adult bone marrow precursors toward dendritic or
CD45+CD4+CD3-
cells, precursors were placed in liquid culture with addition of
IL-1
, IL-3, IL-7, SLF, Flt-3 ligands (R&D Systems), and TNF-
, or
IL-7 alone, respectively.
CD45+CD4+CD3-
and the remaining CD45+ cells from day 0
mesenteric LNs (MLNs), were double-sorted and placed in IL-1
, IL-3,
IL-7, TNF-
, and SLF to let them differentiate into dendritic cells,
according to the method described earlier (27).
PCR analysis
Total RNA was isolated from double-sorted CD45+CD4+CD3- cells taken from MLN at the day of birth using Trizol reagent (Life Technologies, Grand Island, NY) and reverse transcribed using M-MLV Reverse Transcriptase (Life Technologies). cDNA was analyzed for the presence of EBV-induced molecule-1 ligand chemokine (ELC) by amplification of an equivalent of 1200, 600, and 300 cells with the following primers: ELC-forward GGTGCTAATGATGCGGAAGAC and ELC-reverse AGACACAGGGCTCCTTCTGGT for 40 cycles (annealing temperature (Tanneal): 58°C). Primers were provided by Jason Cyster (University of California, San Francisco, CA).
To evaluate the differential expression profiles of lineage-related genes, total RNA was purified from 1000 double-sorted cells from each population, diluted, and was amplified by RT-PCR as previously described (26). Quantitation of expression of each gene was done by a relative determination, comparing the level of any subject sequence in target samples to that in control cDNA prepared from 2 x 105 whole bone marrow cells or thymocytes, using the Integrated Image analysis system (Bio-Rad, Hercules, CA). The PCR cycles for each target gene were at a point where the reaction is in the exponential phase, to obtain linear correlation between pixel density units of the PCR products and the amount of control cDNA applied (28). After PCR amplification, each product was visualized by the Gel Doc 1000 Video Gel Documentation System (Bio-Rad), and pixel density units of each product were read by Molecular Analyst Software (Bio-Rad). The following primers were used: Pax5-forward: CTA CAG GCT CCG TGA CGC AG, Pax5-reverse: TCT CGG CCT GTG ACA ATA GG (Tanneal: 65°C) (29); VpreB-forward: GTC TGA ATT CCT CCA GAG CCT AAG ATC CC, VpreB-reverse: CAG GTC TAG AGC CAT GGC CTG GAC GTC TG (Tanneal: 60°C) (30); Lambda5-forward: GGG TCT AGT GGA TGG TGT CC, Lambda5-reverse: CAA AAC TGG GGC TTA GAT GG (Tanneal: 60°C) (31); GATA-3 forward: TCG GCC ATT CGT ACA TGG AA, GATA-3 reverse: GAG AGC CGT GGT GGA TGG AC (Tanneal: 55°C) (32); Aiolos forward: GTG TGC GGG TTA TCC TGC ATT AGC, Aiolos reverse: ATC GAA GCA GTG CCG CTT CTC ACC (Tanneal: 65°C) (33); M-CSFR forward: TCA TTC AGA GCC AGC TGC CCA T, M-CSFR reverse; ACA GGC TCC CAA GAG GTT GAC T (Tanneal: 60°C); hypoxanthine phosphoribosyltransferase forward: CAC AGG ACT AGA ACA CCT GC, hypoxanthine phosphoribosyltransferase reverse: GCT GGT GAA AAG GAC CTC T (Tanneal: 65°C).
| Results |
|---|
|
|
|---|
+Sca-1lowc-Kitlow cells in
fetal liver
To find the fetal liver counterpart of the adult bone marrow CLP,
fetal liver cells from E12.5-E15.5 embryos were analyzed for IL-7R
expression in combination with several lineage markers and
anti-c-Kit and Sca-1 Abs. As in adult bone marrow, fetal liver HSC
(34) are present in the IL-7R
-
fraction (Fig. 1
). The
IL-7R
+ population expressed negative to high
levels of B220 at E14.5 (Fig. 1
), whereas lower levels of B220 were
observed on IL-7R
+ cells at E12.5 (data not
shown). IL-7R
+ cells were divided into
B220+ and B220-/low
populations; the
IL-7R
+B220+ cells do not
express IgM but express CD19 and CD43, indicating that they are mainly
at the proB stage (35). In contrast,
IL-7R
+B220-/low cells
are CD19- and, like adult CLP, contain cells
expressing c-Kit and Sca-1 at lower levels than fetal liver HSC
(Fig. 1
).
|
RII/III, have been reported to be enriched for B and T lymphoid
precursors relative to myeloid and erythroid precursors, we analyzed
the expression of these two Ags on IL-7R
+
fetal liver cells as well (36). All
IL-7R
+ cells in the E14 fetal liver expressed
high levels of AA4.1 but were negative for 2.4G2 (Fc
RII/III) (Fig. 2
RII/III+ subset
does not express IL-7R
(Fig. 2
+ population does not overlap with the
precursor population reported by Lacaud et al. (36).
|
+Sca-1lowc-Kitlow fetal
liver cells reconstitute all lymphoid lineages, dendritic cells, and
CD45+CD4+CD3- cells in newborn
mice
To test their developmental potential, 35 x
103
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells from Ly5.2 mice were injected into the liver of
sublethally irradiated Ly5.1 newborn mice. In this assay system,
hemopoietic reconstitution of all lineages was observed in
60% of
newborn mice injected with 20 HSC, and in >90% of those injected with
100 HSC (our unpublished data). At 68 days after injection,
analysis of LN revealed a pronounced population of donor-derived
B220+IgM- pre-B cells and
B220+IgM+ mature B cells
(Fig. 3
A). The transient
appearance of pre-B cells in the LN could be due to homing of
injected progenitors and/or their early descendants to LN in an early
reconstitution period. No donor-derived Mac-1- or Gr-1-expressing cells
were observed. In the thymus, the majority of donor-derived cells were
developing thymocytes such as immature
CD4-CD8- double-negative
and CD4+CD8+
double-positive cells. At 16 days after injection, mature B cells,
mature T cells, but no pre-B cells were found in the LN and spleen
(Fig. 3
B). The donor-derived cells in the thymus consisted
only of mature CD4+CD8-
and CD4-CD8+
single-positive cells. These data indicate that both T and B cell
differentiation from the
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells is completed by
3 wk; therefore, these cells have
limited self-renewal activity. At 24 days after injection, in addition
to T and B cells,
CD3-NK1.1+ NK cells and
MHC class
II+(I-Ab+)CD11c+
dendritic cells were found in the spleen as progeny from the injected
cells (Fig. 3
C). These MHC class
II+CD11c+ cells consisted
of CD8
+ as well as
CD8
- cells. Cells positive for Mac-1 and/or
Gr-1 were not found throughout these experiments. We have found that
adult CLP as well as myeloid-restricted common myeloid progenitors
(26) can give rise to both types of dendritic cells;
therefore, CD8
expression is not a marker for their lymphoid origin
(24). Thus, as is the case for adult CLP, the
IL-7R
+Sca-1lowc-Kitlow
cells possess a rapid and transient in vivo differentiation activity
for lymphoid and dendritic cells.
|
+Sca-1lowc-Kitlow
fetal liver precursors also gave rise to a significant population of
CD45+CD4+CD3-
cells in LN, as well as in spleen at 7, 14, and 21 days after
reconstitution (Fig. 4
|
+Sca-1lowc-Kitlow fetal
liver cells can differentiate into macrophages,
CD45+CD4+CD3- cells, as well as B
cells in vitro, but not into other myeloerythroid cells
The differentiation potential of
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells was further evaluated in vitro (Fig. 5
). In the methylcellulose supplemented
with SLF, IL-11, Flt-3 ligands, IL-3, GM-CSF, M-CSF, erythropoietin,
and thrombopoietin, the adult CLP did not give rise to myeloerythroid
colonies as reported previously (22) (Fig. 5
A).
In contrast,
4% of the
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells formed macrophage colonies (Fig. 5
A).
Other myeloerythroid colonies containing granulocytes, erythrocytes,
and megakaryocytes did not develop from the
IL-7R
+Sca-1lowc-Kitlow
cells in this culture.
|
+Sca-1lowc-Kitlow
fetal liver cells and 1 in 6 adult CLP differentiated into mature B
cells (Fig. 5
+Sca-1lowc-Kitlow
fetal liver cells also gave rise to macrophages in the same culture
condition. The frequency of macrophage differentiation was 1 in 14
cells (Fig. 5
+Sca-1lowc-Kitlow
fetal liver cells, but not adult CLP, retain differentiation potential
to macrophages.
In addition, the
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells can give rise to
CD45+CD4+CD3-
cells in vitro. As shown in Fig. 4
C, 5 days after culture of
103
IL-7R
+Sca-1lowc-Kitlow
cells in medium supplemented with IL-7, the cells differentiated into
CD45+CD4+CD3-
cells, as well as
CD19+IgM- proB cells.
Newborn LN CD45+CD4+CD3- cells
as well as
IL-7R
+Sca-1lowc-Kitlow fetal
liver cells differentiate into dendritic cells in vitro
Because transfer of
IL-7R
+Sca-1lowc-Kitlow
fetal liver precursors gave rise to dendritic cells and
CD45+CD4+CD3-
cells in vivo, and because
CD45+CD4+CD3-
cells can give rise to APCs in vitro (19), we
wished to test whether
CD45+CD4+CD3-
cells might be the precursors of dendritic cells in the LN.
The combination of cytokines such as IL-1
, IL-3, IL-7, SLF, Flt-3
ligands, and TNF-
is reportedly effective in inducing dendritic cell
differentiation from thymic lymphoid precursors (24). We
cultured
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells in this culture condition. Ten to 30 dendritic cell
clusters developed from 103 fetal liver cells
57 days after the initiation of culture (data not shown). The
CD45+CD4+CD3-
cells, obtained from day 0 MLN, also gave rise to small dendritic cell
clusters on day 5. FACS analysis of cultured
CD45+CD4+CD3-
cells showed that a subset expressed dendritic and thymic epithelial
cell receptor DEC-205, CD40, ICAM-1, CD86, and high levels of
MHC class II (Fig. 6
A). The
fraction of day 0 MLN that did not contain
CD45+CD4+CD3-
cells did not give rise to DEC-205+ cells. In
addition, when anti-CD40 was added on day 5 to the
CD45+CD4+CD3-
cultures and kept there until day 13, a further increase in MHC class
II expression was observed (Fig. 6
B). To test whether these
in vitro differentiated cells had functional characteristics of APCs,
cultured
CD45+CD4+CD3-
cells were pulsed with OVA for 12 h, and subsequently
placed in culture with T cells obtained from mice that had been
immunized with OVA. A significant proliferation of T cells was observed
after a 4-day culture, indicating that the dendritic cells developed in
vitro had efficiently processed and presented Ag (data not
shown). Recently, it was shown that ELC was expressed constitutively in
dendritic cells within the T cell zone of secondary lymphoid organs
(34). Therefore, we analyzed ELC expression in freshly
isolated
CD45+CD4+CD3-
cells by RT-PCR, and found that the cells expressed ELC (Fig. 6
C).
|
+Sca-1lowc-Kitlow fetal
liver cells
We have found that adult CLP express both T and B lymphoid-related
transcription factors such as GATA-3, Aiolos, and Pax-5 (Fig. 7
) at low levels (26). The
expression of these genes increased
10-fold in more mature
progenitors; Pax-5 and GATA-3 are up-regulated in either proB or proT
stages, respectively, whereas Aiolos is up-regulated in both proB and
proT stages by semiquantitative RT-PCR assays (26). The
low level expression of Pax-5 may inhibit adult CLP from
differentiating into myeloid lineages (37), because it has
been reported that in the absence of Pax-5, cells expressing VpreB or
5 still retain their differentiation potential to T, and
myelomonocytic lineages (38, 39, 40).
|
5
were all expressed at high levels in the
IL-7R
+B220+CD19+
proB cells in fetal liver and proB cells in adult bone marrow. Adult
CLP and fetal liver
IL-7R
+Sca-1lowc-Kitlow
cells did not express significant levels of VpreB and
5, which were
completely undetectable in adult and fetal HSC (Fig. 7
(data not shown), and M-CSFR (Fig. 7
Expression of Aiolos, GATA-3 (Fig. 7
C), and PU.1
(data not shown) were analyzed in fetal liver
IL-7R
+Sca-1lowc-Kitlow
precursors by using the carefully calibrated semiquantitative PCR
assays (see Materials and Methods). These genes were
expressed at the similar low levels (
10-fold less than proB cells)
as in adult CLP (Fig. 7
B). In contrast, the fetal liver
IL-7R
+Sca-1lowc-Kitlow
precursors expressed very low amounts of Pax-5 at a level that was
10-fold less when compared with adult CLP (Fig. 7
, B and
C). Thus, in fetal liver hemopoiesis, Pax-5 expression is
not synchronized with expression of other lymphoid-related
transcription factors; the initiation of Pax-5 expression might occur
in conjunction with B cell commitment in fetal liver, whereas the low
level expression of Pax-5 already begins at the stage of CLP in adult
bone marrow.
| Discussion |
|---|
|
|
|---|
+Sca-1lowc-Kitlow
fetal liver population that is a phenotypic analog of CLP in adult bone
marrow. The
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells possess rapid and prominent reconstitution activity
for lymphoid lineages including T, B, and NK cells, and also
CD8
+ and CD8
-
dendritic cells. However, in the fetal liver, expression of IL-7R
does not mark absolute lymphoid-restricted differentiation activity of
precursors, because the
IL-7R
+Sca-1lowc-Kitlow
cells could give rise to macrophages at a fairly high frequency in
vitro. This suggests that the lymphoid and myeloid commitment pathways
may not be completely separated in fetal liver hemopoiesis. The broader
potential of the
IL-7R
+Sca-1lowc-Kitlow
cells when compared with adult CLP was further revealed by their
ability to give rise to
CD45+CD4+CD3-
cells both in vivo and in vitro.
The
CD45+CD4+CD3-
cells, which are found early in developing LNs, are potentially crucial
for the induction of LNs and Peyers patches. Support for their role
in this induction process is based on the observations that
CD45+CD4+CD3-
cells express many genes required for LN and/or Peyers patch
development, and that in Id2-/- mice, which
lack LNs and Peyers patches,
CD45+CD4+CD3-
cells are completely absent (15). In addition, we
have recently shown that there is a complete lack of LNsand
Peyers patches in mice that have a functional deletion
ofthe ROR
, and that this coincides with the absence
of
CD45+CD4+CD3-
cells in both fetal mesentery and intestines (17).
Therefore, differentiation of
IL-7R
+Sca-1lowc-Kitlow
fetal liver precursors toward
CD45+CD4+CD3-
cells, which migrate to developing lymphoid organs, might involve the
presence of ROR
and Id2. It has been suggested that signaling
through the IL-7R could directly or indirectly up-regulate cell surface
expression of LT
1
2 on
IL-7R+CD45+ cells in
Peyers patch organizing centers in the fetal intestines
(41). A role for signaling through the chemokine receptor
CXCR5 in up-regulation of
LT
1
2 on B cells has
been described, and it remains to be seen whether this signaling can
also up-regulate LT
1
2
on the earliest cells involved in induction of Peyers patches and LNs
(16). The reported lack of LNs and Peyers patches in
CXCR5-/- mice suggests such a role for CXCR5
(16). It is also described that
Ikaros-/- mice lack lymphocytes, NK, and
dendritic cells, as well as all LNs and Peyers patches (11, 13, 42). Therefore, it is possible that some isoforms of Ikaros
(43) are involved in the early differentiation of
IL-7R
+Sca-1lowc-Kitlow
fetal liver precursors, whereas further differentiation into
CD45+CD4+CD3-
cells involves Id2 and ROR
.
The
IL-7R
+Sca-1lowc-Kitlow
cells gave rise to both CD8
+ and
CD8
- dendritic cells in vivo. CD8
expression has been suggested to indicate a "lymphoid" origin of
these dendritic cells (44). However, it does not
necessarily mean that the "myeloid" CD8
-
dendritic cells differentiated from the monocyte/macrophage progeny of
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells, because we recently found that both adult common
myeloid progenitors and adult CLP in the bone marrow can give rise to
CD8
+ as well as CD8
-
dendritic cells in vivo (23, 24). We also show that in
developing LNs at the day of birth, DEC-205-expressing dendritic cells
can be generated from
CD45+CD4+CD3-
cells, but not from the remaining
CD45+CD4-CD3-
cells. Thus, the
IL-7R
+Sca-1lowc-Kitlow
cells might be able to regenerate dendritic cells in developing LNs via
CD45+CD4+CD3-
cells.
It has been shown that IL-7R-mediated signals maintain survival of
developing 
T cells (45), promote rearrangement of
IgH genes in B cells (46), and promote 
TCR
rearrangement through activation of STAT5 (47).
IL-7R-mediated signals have been shown to up-regulate
LT
1
2 on
CD45+IL-7R
+ cells in the
fetal intestine (41). In addition, we demonstrate here
that IL-7 alone can support the development of
CD45+CD4+CD3-
cells from the
IL-7R
+Sca-1lowc-Kitlow
fetal liver precursors in vitro. However, the role of IL-7R signaling
at the stage of CLP or during differentiation of fetal liver precursors
into
CD45+CD4+CD3-
cells or dendritic cells remains unknown. IL-7R-mediated signals have
been reported to be necessary for Pax-5 up-regulation in adult proB
cells to initiate rearrangement of V-DJ recombination
(46), and Pax-5-deficient adult proB cells are reportedly
capable of differentiating into myelomonocytic and T cells (39, 40). It is also reported that the transduction of Pax-5 into
adult HSC results in inhibition of their myeloid differentiation
(37). These data strongly suggest that expression of Pax-5
might suppress the initiation of differentiation program toward T cells
and myelomonocytic lineages (37, 39, 40).
The transcription factors related to independent lineages are expressed
at low levels in oligopotential progenitors (48), and this
phenomenon has been proposed to reflect priming stages at which lineage
commitment remains flexible (49). In our hands, the
IL-7R+ adult CLP express low levels of Pax-5 as
well as other lymphoid-related transcription factors such as Aiolos and
GATA-3 (Fig. 7
), but not myeloid-related ones (26).
However, adult CLP can read-out differentiation into myelomonocytic
cells if the cells are transduced ectopic cytokine receptors, and
received nonphysiological cytokine signals (25).
Therefore, it is possible that adult CLP express low but sufficient
levels of Pax-5 to suppress the differentiation into myelomonocytic
lineages, whereas
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells express minimal levels of Pax-5 that allow
them to access differentiation programs at least for the
monocyte/macrophage lineage. The difference in Pax-5 expression in
adult CLP vs
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells may be due to different signaling cascades downstream
of the IL-7R in these populations. However, we cannot exclude the
possibility that the
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells form a heterogeneous population with a more
restricted potential at the clonal level. The growth requirements for
these precursors did not allow for clonal analysis yet.
The
IL-7R
+Sca-1lowc-Kitlow
cells and CD19+ proB cells cover >95% of the
IL-7R+ population in the E14 fetal liver, the
population of fetal liver cells in which we expect the CLP activity.
Thus, it is possible that the fully lymphoid-restricted CLP does not
exist as a significant population in fetal liver lymphopoiesis, and
fetal lymphoid commitment may initiate at a distinct stage common to T,
B, NK cells, dendritic cells, and macrophages. Lacaud et al.
(36) reported the possible existence of precursors common
to T and B cells, and macrophages in the
AA4.1+Fc
R+ fetal liver
population. This population does not include the
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells (Fig. 2
), and contains some multipotential stem
cells. Sagara et al. (50) reported that the
B220+c-Kit+ fetal liver cells
that have in vitro differentiation potential toward T and B cells can
form macrophage colonies. In our hands, the
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells expressed negative to low levels of B220 (but not
CD19) (Fig. 1
), and both B220low and
B220- fractions within this population possessed
macrophage-differentiation potential on S17 stromal layers (data not
shown). These data strongly suggest that developing fetal liver
precursors maintain differentiation potential to macrophages and T
cells after they begin to express B220 and IL-7R, which are important
markers for B cell progenitors in adult hemopoiesis (35).
The
IL-7R
+Sca-1lowc-Kitlow
fetal liver population contains clonogenic cells at least for B cells
and macrophages. Cumano et al. (51) reported the same
phenomenon for
AA4.1+B220-Mac-1-Sca-1+
fetal liver cells, although the population of this phenotype should
also include fetal liver HSC as well as the
IL-7R
+Sca-1lowc-Kitlow
cells (51).
The data presented here suggest that in fetal liver hemopoiesis, the
developmental capacity for macrophages might be maintained after cells
lose their differentiation potential for other myeloid cells but
acquire rapid differentiation potential for all lymphoid lineages.
However, the burst size of macrophage progeny from the
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells might be limited because we failed to detect
macrophage progeny from 3 to 5 x 103
IL-7R
+Sca-1lowc-Kitlow
cells after in vivo reconstitution assay, and from 5 to 50 cells in a
fetal thymic organ culture assay that was reported by Kawamoto et al.
(52) (our unpublished data). The latter finding is
compatible with a recent report from this group that showed that the
Lin-IL-7R+ fraction of
fetal liver cells did not possess significant macrophage
differentiation activity in this assay, although a few percent
of these cells can form macrophage colonies in the methylcellulose
assay (53). The
IL-7R
+Sca-1lowc-Kitlow
cells did not proliferate in methylcellulose containing IL-7, SLF, and
Flt-3 ligand, in which single adult CLP proliferate ideally to perform
clonal assays (22). These problems currently prevent us
from performing clonogenic assays for
IL-7R
+Sca-1lowc-Kitlow
cells.
Thus, the newly identified
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells differentiate in vivo into all lymphoid cells,
dendritic cells, and
CD45+CD4+CD3-
precursors, all of which are essential components of LNs and Peyers
patches. This study provides evidence that the precursors to all the
cells that form, and potentially induce, LNs and Peyers patches
originate from
IL-7R
+Sca-1lowc-Kitlow
fetal liver cells, and that this population might be at the earliest
known stage for lymphoid organ development in fetal liver. These
experiments and others (54) suggest that stem and
progenitor cells become increasingly restricted in their
differentiation potential from fetal to adult life. Therefore, it is
important to clarify the machinery that regulates the developmental
switch in fetal and adult lymphoid development.
| Acknowledgments |
|---|
Ab, and Yoshimoto
Katsura and Hiroshi Kawamoto for providing a detailed protocol for the
multilineage progenitor assay. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Reina E. Mebius, Department of Cell Biology and Immunology, Faculty of Medicine, Vrije Universiteit, v.d. Boechorststraat 7, 1081 BT Amsterdam, The Netherlands. E-mail address: r.mebius.cell{at}med.vu.nl ![]()
3 Current address: Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, 44 Binney Street, Boston, MA 02115. ![]()
4 Abbreviations used in this paper: LN, lymph node; CLP, common lymphoid-restricted progenitors; LT, lymphotoxin; CXCR, CXC chemokine receptor; HSC, hemopoietic stem cells; SLF, Steel factor; MLN, mesenteric LN; ELC, EBV-induced molecule-1 ligand chemokine; Tanneal, annealing temperature; ROR
, retinoic acid receptor-related orphan receptor-
![]()
Received for publication December 26, 2000. Accepted for publication March 30, 2001.
| References |
|---|
|
|
|---|
/
complex is required for the development of peripheral lymphoid organs. J. Exp. Med. 184:1999.
receptor. Immunity 9:71.[Medline]
receptor controls organogenesis and affinity maturation in peripheral lymphoid tissues. Immunity 9:59.[Medline]
-deficient mice. Proc. Natl. Acad. Sci. USA 94:9302.
-deficient mice: effects on secondary lymphoid organ development and humoral immune responsiveness. J. Immunol. 155:1685.[Abstract]
chain. Immunity 2:223.[Medline]
B/Rel family. Cell 80:331.[Medline]
in thymocyte survival and lymphoid organ development. Science 288:2369.
+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells. Immunity 7:493.[Medline]
-positive dendritic cells from a common myeloid progenitor. Science 290:2152.
gene enhancer. Mol. Cell. Biol. 11:2778.
+ CD3- cells in the embryonic intestine induces the organizing center of Peyers patches. Int. Immunol. 11:643.
locus by Stat5: implications for accessibility control by the IL-7 receptor. Immunity 11:213.[Medline]
This article has been cited by other articles:
![]() |
H. Jin, R. Sood, J. Xu, F. Zhen, M. A. English, P. P. Liu, and Z. Wen Definitive hematopoietic stem/progenitor cells manifest distinct differentiation output in the zebrafish VDA and PBI Development, February 15, 2009; 136(4): 647 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Luis, F. Weerkamp, B. A. E. Naber, M. R. M. Baert, E. F. E. de Haas, T. Nikolic, S. Heuvelmans, R. R. De Krijger, J. J. M. van Dongen, and F. J. T. Staal Wnt3a deficiency irreversibly impairs hematopoietic stem cell self-renewal and leads to defects in progenitor cell differentiation Blood, January 15, 2009; 113(3): 546 - 554. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Desanti, A. Cumano, and R. Golub Identification of CD4int progenitors in mouse fetal spleen, a source of resident lymphoid cells J. Leukoc. Biol., May 1, 2008; 83(5): 1145 - 1154. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Boos, Y. Yokota, G. Eberl, and B. L. Kee Mature natural killer cell and lymphoid tissue-inducing cell development requires Id2-mediated suppression of E protein activity J. Exp. Med., May 14, 2007; 204(5): 1119 - 1130. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Bertrand, G. E. Desanti, R. Lo-Man, C. Leclerc, A. Cumano, and R. Golub Fetal spleen stroma drives macrophage commitment Development, September 15, 2006; 133(18): 3619 - 3628. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Roybon, Z. Ma, F. Asztely, A. Fosum, S. E. W. Jacobsen, P. Brundin, and J.-Y. Li Failure of Transdifferentiation of Adult Hematopoietic Stem Cells into Neurons Stem Cells, June 1, 2006; 24(6): 1594 - 1604. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Veinotte, C. P. Greenwood, N. Mohammadi, C. A. Parachoniak, and F. Takei Expression of rearranged TCR{gamma} genes in natural killer cells suggests a minor thymus-dependent pathway of lineage commitment Blood, April 1, 2006; 107(7): 2673 - 2679. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Giebel, T. Zhang, J. Beckmann, J. Spanholtz, P. Wernet, A. D. Ho, and M. Punzel Primitive human hematopoietic cells give rise to differentially specified daughter cells upon their initial cell division Blood, March 1, 2006; 107(5): 2146 - 2152. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Lai, S. M. Lin, and M. Kondo Heterogeneity of Flt3-Expressing Multipotent Progenitors in Mouse Bone Marrow J. Immunol., October 15, 2005; 175(8): 5016 - 5023. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Iwasaki, C. Somoza, H. Shigematsu, E. A. Duprez, J. Iwasaki-Arai, S.-i. Mizuno, Y. Arinobu, K. Geary, P. Zhang, T. Dayaram, et al. Distinctive and indispensable roles of PU.1 in maintenance of hematopoietic stem cells and their differentiation Blood, September 1, 2005; 106(5): 1590 - 1600. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Hager-Theodorides, J. T. Dessens, S. V. Outram, and T. Crompton The transcription factor Gli3 regulates differentiation of fetal CD4-CD8- double-negative thymocytes Blood, August 15, 2005; 106(4): 1296 - 1304. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dakic, D. Metcalf, L. Di Rago, S. Mifsud, L. Wu, and S. L. Nutt PU.1 regulates the commitment of adult hematopoietic progenitors and restricts granulopoiesis J. Exp. Med., May 2, 2005; 201(9): 1487 - 1502. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dias, H. Silva Jr., A. Cumano, and P. Vieira Interleukin-7 is necessary to maintain the B cell potential in common lymphoid progenitors J. Exp. Med., March 21, 2005; 201(6): 971 - 979. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Everhart, W. Han, K. S. Parman, V. V. Polosukhin, H. Zeng, R. T. Sadikot, B. Li, F. E. Yull, J. W. Christman, and T. S. Blackwell Intratracheal administration of liposomal clodronate accelerates alveolar macrophage reconstitution following fetal liver transplantation J. Leukoc. Biol., February 1, 2005; 77(2): 173 - 180. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zamisch, B. Moore-Scott, D.-m. Su, P. J. Lucas, N. Manley, and E. R. Richie Ontogeny and Regulation of IL-7-Expressing Thymic Epithelial Cells J. Immunol., January 1, 2005; 174(1): 60 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Haddad, P. Guardiola, B. Izac, C. Thibault, J. Radich, A.-L. Delezoide, C. Baillou, F. M. Lemoine, J. C. Gluckman, F. Pflumio, et al. Molecular characterization of early human T/NK and B-lymphoid progenitor cells in umbilical cord blood Blood, December 15, 2004; 104(13): 3918 - 3926. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Esashi, H. Ito, K. Ishihara, T. Hirano, S. Koyasu, and A. Miyajima Development of CD4+ Macrophages from Intrathymic T Cell Progenitors Is Induced by Thymic Epithelial Cells J. Immunol., October 1, 2004; 173(7): 4360 - 4367. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Cupedo, M. F. R. Vondenhoff, E. J. Heeregrave, A. E. de Weerd, W. Jansen, D. G. Jackson, G. Kraal, and R. E. Mebius Presumptive Lymph Node Organizers are Differentially Represented in Developing Mesenteric and Peripheral Nodes J. Immunol., September 1, 2004; 173(5): 2968 - 2975. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Eberl and D. R. Littman Thymic Origin of Intestinal {alpha}{beta} T Cells Revealed by Fate Mapping of ROR{gamma}t+ Cells Science, July 9, 2004; 305(5681): 248 - 251. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Esashi, T. Sekiguchi, H. Ito, S. Koyasu, and A. Miyajima Cutting Edge: A Possible Role for CD4+ Thymic Macrophages as Professional Scavengers of Apoptotic Thymocytes J. Immunol., September 15, 2003; 171(6): 2773 - 2777. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nikolic, M. F. T. R. d. Bruijn, M. B. Lutz, and P. J. M. Leenen Developmental stages of myeloid dendritic cells in mouse bone marrow Int. Immunol., April 1, 2003; 15(4): 515 - 524. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. de Andres, P. Gonzalo, S. Minguet, J. A. Martinez-Marin, P. G. Soro, M. A. R. Marcos, and M. L. Gaspar The first 3 days of B-cell development in the mouse embryo Blood, December 1, 2002; 100(12): 4074 - 4081. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Lian, M. Maeda, S. Lohwasser, M. Delcommenne, T. Nakano, R. E. Vance, D. H. Raulet, and F. Takei Orderly and Nonstochastic Acquisition of CD94/NKG2 Receptors by Developing NK Cells Derived from Embryonic Stem Cells In Vitro J. Immunol., May 15, 2002; 168(10): 4980 - 4987. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Graf Differentiation plasticity of hematopoietic cells Blood, May 1, 2002; 99(9): 3089 - 3101. [Full Text] [PDF] |
||||
![]() |
R. Ceredig The ontogeny of B cells in the thymus of normal, CD3{varepsilon} knockout (KO), RAG-2 KO and IL-7 transgenic mice Int. Immunol., January 1, 2002; 14(1): 87 - 99. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Traver, T. Miyamoto, J. Christensen, J. Iwasaki-Arai, K. Akashi, and I. L. Weissman Fetal liver myelopoiesis occurs through distinct, prospectively isolatable progenitor subsets Blood, August 1, 2001; 98(3): 627 - 635. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |