|
|
||||||||

,
Department of
*
Immunology and
Medicine, University of Washington, Seattle, WA 98195;
Fred Hutchinson Cancer Research Center, Seattle, WA 98109; and
Committee on Immunology, University of Chicago, Chicago, IL 60637
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
CD8+ T cells capable of IL-2 production in response to Ag have been isolated in selected settings, and maintenance of the ability to express IL-2 appears to be dependent on concurrent costimulation with each activation cycle. However, costimulation is not required for the retention of cytolytic function, a phenomenon termed "split anergy" (11). The potential for CD8+ T cells to produce IL-2 in the presence of sufficient costimulatory activity is further supported by the generation of potent CD8+ T cell responses to tumors independent of CD4 responses following in vitro stimulation with B7-transfected tumor cells (12, 13). CD8+ T cells appear to require costimulation each time Ag is encountered to sustain the facility for IL-2 expression. Naive CD8+ T cells from 2C TCR-transgenic mice produced IL-2 following recognition of allogeneic Ld+ target cells bearing B7 costimulatory molecules (14), but lost the capacity to produce IL-2 following two sequential stimulations in the absence of CD28 costimulation (P. Fields, unpublished observations). These studies suggest that all naive CD8+ T cells may initially be competent to produce IL-2, but lose the ability to sustain growth and survival as a consequence of not receiving the necessary costimulatory signals due to recognition of B7- targets and/or maturation to terminal effector cells.
The requirement for costimulation for CD8+ T cells to produce IL-2 can be circumvented if a sufficiently strong signal is delivered through the TCR. Effector CD8+ T cells that do not produce IL-2 in response to Ag (IL-2-) can be triggered to produce IL-2 by cross-linking the TCR with anti-CD3 Abs, or by treatment with a calcium ionophore, such as ionomycin, in conjunction with a phorbol ester, such as PMA (15). These responses to such nonphysiologic stimuli imply that the inability of most effector CD8+ T cells to produce IL-2 in response to Ag is not due to chromosomal inaccessibility of the IL-2 gene, but might instead be due to a mechanism operating at the transcriptional level, similar to what has been found in anergic CD4+ T cells. Indeed, the block to IL-2 production in anergic CD4+ T cells can also be overcome by stimulation with PMA plus ionomycin (16, 17).
Anergic CD4+ T cells share several additional
characteristics with IL-2-
CD8+ T cells. IL-2-
effector CD8+ T cells can proliferate in response
to Ag and supplemental exogenous IL-2, and retain the capacity to
produce other cytokines such as IFN-
. Anergic
CD4+ T cells can proliferate following
stimulation if exogenous IL-2 is provided, but fail to expand when
restimulated with Ag even if costimulation is provided because of a
specific inability to produce IL-2, while retaining the capacity to
produce other cytokines such as IL-3 and IFN-
(18). The
isolated defect in IL-2 production in anergic
CD4+ T cells has been linked to reduced levels of
Fos/Jun proteins binding at the -150 AP-1 site in the IL-2 promoter
(19), as well as to negative regulatory factors targeting
the -150 and -180 AP-1 sites (20, 21, 22).
We examined the transcriptional regulation of the IL-2 gene in CD8+ T cells to better understand the molecular basis for the failure of effector CD8+ T cells to produce IL-2 in response to Ag. Our investigation focused on the AP-1 binding sites located in the IL-2 promoter based on studies in CD4+ T cells suggesting that AP-1 is the target of clonal anergy. AP-1 is composed of homodimers of Jun (c-Jun, Jun B, and Jun D) or heterodimers of Jun and Fos (c-Fos, Fos B, Fra-1, and Fra-2) (23). There are four AP-1 sites in the proximal IL-2 promoter that can bind dimeric combinations of Fos and Jun family members. Three of the AP-1 sites contain nonconsensus AP-1 motifs adjacent to binding sites for NFAT, CD28 response element (CD28RE),4 and OCT, respectively, and both elements of each composite site must be occupied for transactivation of the individual enhancers (24, 25, 26). All three of the composite AP-1 sites are required for transactivation of the IL-2 promoter (27). A fourth AP-1 site at -180 from the transcriptional start site is a consensus site in the reverse orientation, but varies from a consensus AP-1 binding site by one base pair in the forward orientation. The role of the -180 Ap-1 site in IL-2 promoter regulation has not previously been well defined. However, recent evidence indicates that a complex of cAMP response element-binding protein (CREB) and cAMP response element modulator binds to this site in anergic CD4+ T cells (22), perhaps acting to repress IL-2 gene transcription.
| Materials and Methods |
|---|
|
|
|---|
Four H-2Ld-reactive CD8+ T cell clones, provided by Frank Fitch (University of Chicago, Chicago, IL), were chosen for evaluation. L3 and DB45 (28, 29) do not produce IL-2 in response to antigenic stimulation (IL-2-), and Ld 8.6.1 and 2C (30, 31) produce IL-2 in response to Ag (IL-2+). All clones were restimulated every 14 days with allogeneic BALB/c splenocytes plus 12.525 U/ml recombinant human IL-2 (Chiron, Emeryville, CA). The H-2Ld-expressing murine mastocytoma P815, also obtained from Frank Fitch, and the murine BALB/c tumor, LSTRA, maintained in our laboratory, were used as stimulator cells. P815 was transfected with both B7-1 and B7-2 to provide costimulation, and LSTRA naturally expresses both B7-1 and B7-2. All cells were maintained in RPMI 1640-HEPES supplemented with 10% FCS (HyClone, Logan, UT), 4 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, and 5 x 10-5 M 2-ME.
Flow cytometric analysis of cell surface molecules on T cell clones
Cells were analyzed with a FACSCalibur flow cytometer using
CellQuest software (BD Biosciences, Mountain View, CA.). All Abs were
purchased from PharMingen (San Diego, CA), unless otherwise noted. CD3
and CD8 expression were evaluated with PE-conjugated anti-CD3
(145-2C11) and PE-conjugated anti-CD8
(53-6.7). PE-conjugated
anti-CD4 (GK1.5) was used as a control for nonspecific staining.
CD28 expression was evaluated with mAb 37.51, followed by FITC-labeled
rabbit anti-hamster IgG (Jackson ImmunoResearch, West Grove, PA)
using hamster IgG anti-keyhole limpet hemocyanin Ab Ha4/8 as an
isotype control.
RT-PCR analysis of cytokine gene transcription
T cell clones were cultured at 37°C for 6 h in six-well
plates (Costar, Cambridge, MA) with medium alone, an equal number of
stimulator cells, plate-bound anti-CD3 (2C11) at 1 µg/ml,
anti-CD3 plus anti-CD28 (37.51) at 1 µg/ml each, or 10 ng/ml
PMA plus 1 µM ionomycin (Sigma, St. Louis, MO). Cells were washed
twice with PBS, RNA was extracted with RNAgents Total RNA Isolation kit
(Promega, Madison, WI), and reverse transcribed into cDNA using
Superscript II (Life Technologies, Gaithersburg, MD). The cDNA was
amplified with primers specific for murine IL-2 or IFN-
, and all
reactions included
-actin primers to control for cDNA
input. Forward (F) and reverse (R) primers were generated by Life
Technologies and paired as follows: IL-2F:
CCTGCAGGCATGTACAGCATG + IL-2R:
GAGGTACATAGTTATTGAGGGC, yielding a 510-bp product from the
IL-2 gene that spans exon/intron boundaries,
IFN-
F: GCTCTGAGACAATGAACGCTA +
IFN-
R: CGAATCAGCAGCGACTCCTTT, yielding a
475-bp product from the IFN-
gene that spans exon/intron
boundaries, and
-actinF:
GACGGGGTCACCCACACTGTGCCCATCTA +
-actinR:
GAAGTCTAGAGCAACATAGCACAGCTTCTC, yielding a 200-bp product. PCR was
repeated for 25 cycles for IFN-
and 35 cycles for IL-2. PCR was
performed on the DeltaCycler II (Ericomp, San Diego, CA). PCR products
were resolved on 1.5% agarose gels and visualized by ethidium bromide
staining.
Reporter gene constructs
The LacZH constructs containing multimers of IL-2 promoter enhancer elements driving expression of the Escherichia coli lacZ reporter gene, with the hygromycin resistance gene (H) for selection of stable transfectants have been described elsewhere (32). Briefly, IL-2-LacZH contains -326 to +47 of the proximal human IL-2 promoter; NFAT/AP-1-LacZH contains three copies of the NFAT/AP-1 binding site (-286 to -257) linked to the minimal IL-2 promoter (-72 to +47) encoding the TATA box and transcriptional start site; OCT/AP-1-LacZH contains four copies of the OCT/AP-1 binding site (-93 to -65) attached to the minimal IL-2 promoter; and CD28RE/AP-1-LacZH contains four copies of the CD28RE/AP-1 binding region (-159 to -134) linked to the minimal IL-2 promoter.
A consensus AP-1 reporter gene construct was generated using oligonucleotides (oligo) representing the AP-1 binding site from the human metallothionein gene (33): tcgaCGCTTGATGACTCAGCCGGAA and tcgaTTCCGGCTGAGTCATCAAGCG (AP-1 binding site underlined, XhoI overlap bases in lower case italics). Oligos were annealed and ligated into LacZH containing the minimal IL-2 promoter. A plasmid with six copies of the AP-1 consensus binding site in the forward orientation and one copy in the reverse orientation was selected for transfection studies. Fluorescent sequencing was performed on an Applied Biosystems Fluorescent Sequencer using Taq Dye Terminator reagents (Applied Biosystems, Foster City, CA).
Mutations to the IL-2 promoter were accomplished using the PCR Splice
Overlap Extension technique (PCR SOEing) (34), with
IL-2-LacZH serving as a template. External primers were the same for
all PCR SOEing reactions. The external forward primer
(EXF) ATCGATGTTTTCTGAGTTACTT is complementary
to the 5' end of the 320-bp IL-2 promoter, and the external reverse
primer (EXR) TTCCCAGTCACGACGTTGTA is
complementary to the 5' end of the lacZ gene. In the
internal primers listed below, the binding sites are underlined and
mutations are in bold type. The -180 AP-1 site was mutated to a
nonbinding site by pairing EXF with the -180
AP-1 Null reverse primer
CCAAAGACTGCAAGAATGGATGTAG in one PCR, and
EXR with the -180 AP-1 Null forward primer
CTACATCCATTCTTGCAGTCTTTGG in a separate PCR. The
-150 AP-1 site was replaced with a consensus AP-1 site by pairing
EXF and the -150 AP-1 consensus reverse primer
CTCTTCTGATGAGTCATTGGAATTTC in one
PCR, and EXR with the -150 AP-1 consensus
forward primer
GAAATTCCAATGACTCATCAGAGAG in a
separate PCR. A composite CD28RE/AP-1 consensus site was
added to the IL-2 promoter by pairing EXF with
the CD28RE/AP-1 consensus reverse primer
ATTTCTTTAAACCCCCAAAGACTGAGTCA,
and then EXR with the CD28RE/AP-1 consensus
forward primer
TTTGGGGGTTTAAAGAAATTCCAATGACTCA.
The products from each of the sets of PCR were combined and used as
overlapping templates in PCR SOEing reactions with external primers to
generate the IL-2 promoter with the designated mutations (see Fig. 3
A). The fidelity of the mutations was confirmed by
sequencing.
|
T cell clones were transfected by electroporation at 250 mV, 940
µF (Progenetor II; Hoefer, San Francisco, CA) 6 days after
antigenic stimulation with irradiated BALB/c splenocytes. All reporter
gene plasmids were linearized 5' of the promoter of interest.
Electroporated cells were selected for 23 wk in medium containing
0.25 mg/ml hygromycin. Aliquots of the hygromycin-resistant cells were
stimulated with 10 ng/ml PMA plus 1 µM ionomycin for 3 h, then
assayed histochemically for
-galactosidase (
-gal) expression
(35). It was necessary to subclone the majority of
transfected lines to enrich for
-gal-expressing cells.
-gal+ lines were subcloned by limiting
dilution in 96-well plates, and only transfectants that expressed
negligible
-gal in the absence of stimulation were selected.
cDNAs encoding murine B7-1 and B7-2 were cloned into the eukaryotic vectors pNA' and pHA', respectively, as described (14). Both constructs were linearized, then transfected into P815 cells via electroporation (250 mV, 940 µF). Electroporated cells were selected with 0.5 mg/ml G418 (Sigma) and 0.25 mg/ml hygromycin B (Boehringer Mannheim, Indianapolis, IN). Antibiotic-resistant cells were screened for both B7-1 and B7-2 expression by flow cytometry using FITC-coupled anti-B7-1 (1G10) and anti-B7-2 (GL-1). Positive cells were sorted into 96-well culture plates (Costar). Surface expression of B7-1 and B7-2 on subclones was determined by flow cytometry, and a subclone expressing matched high levels of B7-1 and B7-2 was selected for use as a stimulator cell line. Transfected P815 cells were maintained in medium with 0.5 mg/ml G418 and 0.25 mg/ml hygromycin B, and assessed by flow cytometry periodically to verify stable B7-1 and B7-2 expression.
Chemiluminescent assay for quantitation of
-gal activity
-gal activity was measured using the chemiluminescent
substrate Galacton-Star (Tropix, Bedford, MA). T cells
(1.25 x 105) were plated in triplicate in
96-well plates for 6 h at 37°C with medium alone, an equal
number of P815 stimulator cells, or 10 ng/ml PMA plus 1 µM ionomycin,
washed with PBS, and lysed with buffer provided by the manufacturer.
Samples were incubated with chemiluminescent substrate for 1 h in
Dynex MicroFLUOR black 96-well microplates (Dynex Technologies,
Chantilly, VA). Light output was measured using the Single
Photon Count mode at 24°C for 1.2 s/well on a Packard Top Count
microplate luminometer (Packard, Meriden, CT). Due to variations in
-gal activity among subclones possibly resulting from a variable
number of integrated transgenes, the induction of
-gal activity in
response to stimulation was compared with that detected in unstimulated
cells for a panel of six subclones from each transfectant. The
subclones representing the mean level of
-gal induction for each
stimulation condition are shown as the representative transfectants
(see
Figs. 46![]()
![]()
).
|
|
|
| Results |
|---|
|
|
|---|
One possible explanation for the inability of some effector
CD8+ T cells to produce IL-2 is decreased signal
strength due to down-regulation of critical signaling molecules.
Therefore, surface expression of CD3, CD8, and CD28 on
CD8+ T cell clones was assessed by flow
cytometry. The IL-2- clones, L3 and DB45, and
the IL-2+ clones, 2C and Ld 8.6.1, expressed
approximately equivalent levels of CD3 and CD8 (Fig. 1
, A and B). CD28
was expressed at the highest levels on L3, and was approximately
equivalent on DB45 and 2C, but slightly lower on Ld 8.6.1. (Fig. 1
C). These results suggest that reduction of CD3, CD8, or
CD28 on L3 and DB45 did not account for the inability of these clones
to produce IL-2 in response to Ag.
|
Transcription of the IL-2 and IFN-
genes
was assessed under varying conditions: either medium alone, or after
stimulation with LSTRA, P815, P815/B7-1 + 2 transfectants, plate-bound
anti-CD3, anti-CD3 plus anti-CD28, or PMA plus ionomycin.
All clones were assessed 6 h after stimulation following a rest
period of 10 days from the previous stimulation. IFN-
mRNA was
induced in response to all stimuli, indicating that the cells were
activated (Fig. 2
A). No
baseline transcription of the IL-2 gene was detectable in
CD8+ T cell clones cultured in medium alone (Fig. 2
B). Following stimulation with plate-bound anti-CD3,
anti-CD3 plus anti-CD28, or PMA plus ionomycin, IL-2 mRNA was
transcribed by all CD8+ T cell clones. In
response to allogeneic stimulation with LSTRA, P815 cells, or P815/B7-1
+ 2 transfectants, the IL-2+
CD8+ T cell clones 2C and Ld 8.6.1 transcribed
IL-2 mRNA, whereas the IL-2-
CD8+ T cell clones L3 and DB45 did not transcribe
detectable IL-2 mRNA. Thus, the restriction of IL-2 production in
CD8+ T cell subsets is controlled at least in
part at the level of mRNA transcription and/or stability.
|
Transactivation of the proximal IL-2 promoter was evaluated in
response to varying stimuli. The proximal IL-2 promoter-LacZH reporter
gene construct (Fig. 3
A) was
stably transfected into the IL-2-
CD8+ clones L3 and DB45, and into the
IL-2+ CD8+ clone 2C, which
most closely matched the surface phenotype of the
IL-2- CD8+ clones. Ld
8.6.1 was not used in reporter gene analyses due to variable stability
of transgenes in this clone. Reporter gene expression was detected in
both L3 and DB45 in response to PMA plus ionomycin, but no significant
activity was observed after 6 h in response to antigenic
stimulation with P815 or P85/B7-1 + 2 (Fig. 4
A). In contrast, the
IL-2+ CD8+ T cell clone 2C
transactivated the IL-2 promoter in response to P815, and costimulation
with B7-1 and B7-2 enhanced transactivation compared with stimulation
with P815 alone. Analysis of a panel of L3 and DB45 subclones failed to
detect any cells capable of transactivating the IL-2 promoter in
response to Ag, or Ag plus costimulation.
Disruption of the potentially inhibitory -180 AP-1 binding site does not restore transactivation of the IL-2 promoter
We evaluated whether a negative regulatory factor similar to that
identified in anergic CD4+ T cells played a role
in negatively regulating IL-2 promoter transactivation in
CD8+ T cells by removing the binding site for the
putative inhibitor. The -180 AP-1 site in the IL-2 promoter was
converted to a nonbinding site by mutating the TCAGTCA AP-1
motif to TCTTGCA (Fig. 3
A), because an identical
3-bp mutation restored transactivation of the IL-2 promoter in anergic
CD4+ cells (21). In L3 and DB45
transfectants, the -180 AP-1 null version of the IL-2 promoter was
very weakly activated in response to PMA plus ionomycin (Fig. 4
B). This reduced activity in comparison to the native IL-2
promoter suggested a potential positive rather than negative
contribution from this site in CD8+ T cells. No
significant response was observed in L3 or DB45 transfectants following
stimulation with Ag or Ag plus costimulation. Analysis of multiple
subclones of L3 and DB45 confirmed that the -180 AP-1 mutation
severely reduced IL-2 promoter activity. IL-2+ 2C
transfectants bearing the -180 AP-1 null mutation exhibited marginal
promoter activity compared with the native IL-2 promoter in response to
PMA plus ionomycin, Ag, or Ag plus costimulation, with only 1.3-fold
induction over levels in unstimulated cells. Thus, the -180 AP-1 site
appears to provide a positive signal, and is not responsible for
repressing IL-2 transcription in CD8+ T
cells.
The -150 CD28RE/AP-1 site is selectively not transactivated in response to Ag in IL-2- CD8+ T cells
The three enhancer binding sites for NFAT/AP-1, OCT/AP-1, and
CD28RE/AP-1 have been identified as critical domains controlling IL-2
transcription in CD4+ T cells (27).
To evaluate transactivation of these elements, reporter constructs
(Fig. 3
B) were transfected into L3, DB45, and 2C.
Transactivation of the NFAT/AP-1 binding site was observed in response
to PMA plus ionomycin, Ag stimulation, and Ag plus costimulation in all
three clones (Fig. 5
A).
Analysis of multiple subclones for each transfectant confirmed
transactivation in response to all stimulation conditions.
The OCT/AP-1-LacZ reporter construct demonstrated inducible
-gal
activity in all three clones in response to PMA plus ionomycin, Ag, or
Ag plus costimulation (Fig. 5
B), which was confirmed for L3
by analysis of multiple subclones. Although this binding site did not
induce high levels of reporter gene activity in any of the
CD8+ T cell clones, no significant differences
were evident between the IL-2+ clone and
IL-2- clones. Thus, neither the NFAT/AP-1 nor
OCT/AP-1 binding site appear to be targets for differential regulation
of the IL-2 promoter.
In contrast, the IL-2- clones L3 and DB45,
despite being CD28+, induced the CD28RE/AP-1-LacZ
reporter construct only in response to PMA plus ionomycin, and failed
to induce
-gal activity in response to Ag, even in the presence of
costimulation (Fig. 5
C). This was again confirmed by
analysis of a panel of L3 and DB45 subclones. However,
IL-2+ 2C transfectants exhibited reporter gene
activity in response to all three stimuli, with the strongest response
induced by Ag plus costimulation. The activity of this enhancer element
in all three clones mirrored those observed for the intact proximal
IL-2 promoter in response to PMA plus ionomycin and Ag recognition.
These results suggest that the CD28RE/AP-1 element may be subject to
differential regulation in subpopulations of CD8+
T cells.
IL-2- CD8+ T cells express functional AP-1 complexes
Although all of the analyzed reporter constructs of multimerized
binding elements represent composite sites containing an AP-1 binding
site, each composite site may bind different combinations of Jun and/or
Fos family members. Therefore, to determine whether a general defect in
AP-1 or a defect specific to the nonconsensus -150 AP-1 site exists in
IL-2- CD8+ T cells,
transactivation of a consensus AP-1 site was examined. The consensus
AP-1 site differs from the CD28RE/AP-1 site in two significant ways: it
does not contain the binding site for the CD28 response complex, and it
exhibits higher affinity for the Jun/Fos heterodimer (36).
The multimerized consensus AP-1-LacZ reporter gene (Fig. 3
B)
was induced following activation of L3, DB45, and 2C with PMA plus
ionomycin, Ag, and Ag plus costimulation (Fig. 6
A). These results, confirmed
by analysis of a panel of subclones for each transfectant, suggest that
functional AP-1 complexes are being induced in
IL-2- CD8+ T cells in
response to Ag recognition.
Mutation of -150 AP-1 site to a consensus AP-1 site restores transactivation of the IL-2 promoter
The failure of IL-2-
CD8+ T cells to transactivate the CD28RE/AP-1
site could reflect either a defect in the CD28 response complex that
binds to the CD28RE and/or a defect in specific AP-1 complexes required
to transactivate the AP-1 component of the composite site, because both
sites must be occupied for enhancer activity (25). To
directly assess the AP-1 site, we left the CD28RE intact, but replaced
the native -150 AGAGTCA AP-1 site with the
consensus AP-1 motif TGACTCA, and transfected
this modified IL-2 promoter-LacZ reporter construct (Fig. 3
A) into L3, DB45, and 2C. In response to PMA plus
ionomycin, all three clones transactivated the mutated IL-2 promoter
(Fig. 6
B). Moreover, in contrast to the native IL-2
promoter, detectable
-gal activity from the modified -150 AP-1
consensus IL-2 promoter was induced by Ag in L3 and DB45, and was
further increased by costimulation. Clone 2C exhibited high
levels of
-gal activity in response to Ag and Ag plus costimulation.
This pattern of activation was confirmed by subclone analyses with L3
and 2C. Thus, conversion of the -150 AP-1 site to a consensus AP-1
site appears sufficient to at least partially restore IL-2 promoter
activity in response to Ag in IL-2-
CD8+ T cell clones.
Transactivation of the IL-2 promoter containing the -150 AP-1
consensus mutation in IL-2-
CD8+ clones could have resulted from replacement
of an AP-1 site requiring specific AP-1 family members that are not
present with a binding site capable of being transactivated by
alternate AP-1 complexes, or from disruption of a site that previously
bound a negative regulator. To distinguish between these two
possibilities, the native IL-2 promoter was altered by insertion of a
modified CD28RE/AP-1 element containing a consensus AP-1 site between
the -180 and -150 enhancer sites (Fig. 3
A). This mutation
adds a functional CD28RE/AP-1 site to the promoter while leaving the
native CD28RE/AP-1 site intact and potentially capable of binding a
negative regulator. This modified IL-2 promoter was responsive to PMA
plus ionomycin, to Ag, and to Ag plus costimulation in all three
CD8+ clones (Fig. 6
C). This pattern of
activation in response to all stimuli was consistent among all L3 and
2C subclones. However, we noted that higher levels of reporter gene
activity were detected in the 2C transfectant than in L3 and DB45. This
increase might reflect a greater transgene copy number in the 2C
transfectant, but we cannot completely rule out the possibility of
partial repressor activity at this site in L3 and DB45. Thus, the
addition of a functional CD28RE/AP-1 site could conceivably override or
displace a repressor binding at the -ISOAP-1 site in the native
promoter, or alternatively restore transactivation by providing a
composite site that can bind AP-1 complexes induced in response to Ag
recognition.
| Discussion |
|---|
|
|
|---|
One possibility for the observed failure of IL-2- CD8+ T cells to transactivate the nonconsensus -150 AP-1 site in response to Ag is that the obligatory transcription factors were not induced or activated. Members of the activating transcription factor-1/CREB family have been shown to transactivate the -150 AP-1 site (37), representing one possible complex that could act to differentially regulate the -150 AP-1 site. A second possibility is that the requisite Fos or Jun family member(s) were not induced or appropriately activated in response to antigenic stimulation. AP-1 complexes can consist of different dimeric Fos and Jun family members and exhibit variable DNA binding specificity. Although Jun/Jun homodimers can transactivate AP-1 sites, Fos/Jun heterodimers are more potent transactivators (38). The nonconsensus -150 AP-1 site is a "low affinity" site for the Fos/Jun heterodimer (36), and may require a specific combination of Fos/Jun family members for activation. By contrast, the NFAT/AP-1 site and consensus AP-1 sites are "high affinity" binding sites and can be transactivated with both Fos/Jun and Jun/Jun dimers (39). Hence, the ability of IL-2- CD8+ T cells to transactivate the NFAT/AP-1, OCT/AP-1, and consensus AP-1 sites but not the -150 AP-1 site could result from limitation or inactivation of a required factor, such as one of the Fos proteins. Several Fos family members such as Fra1, Fra2, and an alternatively spliced form of FosB lack transcriptional activation domains (40, 41). These transcriptionally inactive forms of Fos might have preferential affinity for the -150 AP-1 site while not efficiently binding and interfering with transactivation of the NFAT/AP-1, OCT/AP-1, or consensus AP-1 sites.
Our results are consistent with the hypothesis that antigenic stimulation of IL-2- CD8+ T cells does not result in the induction or activation of the specific nuclear proteins required to transactivate the -150 AP-1 site, and consequently the entire IL-2 promoter is rendered inactive. Protein-DNA interactions at distal sites within the IL-2 promoter have been demonstrated to be unstable if even one transcription factor is missing (42). The possibility that a missing factor is responsible for the differences in cytokine secretion patterns in IL-2+ and IL-2- CD8+ T cells is consistent with studies using heterokaryons between CD4+ and CD8+ T cell clones. In those studies, fusion of the CD8+ T cell clone L3 with an IL-2+ CD4+ fusion partner did not repress secretion of IL-2, suggesting the absence of a dominant negative regulatory factor for IL-2 expression in CD8+ T cells (43). In contrast, heterokaryon formation between nonanergic and anergic CD4+ T cells disrupted transactivation of the IL-2 gene in the fusion partner, suggesting the presence of a dominant negative regulatory mechanism for restriction of IL-2 production in anergic CD4+ T cells (44).
Although we did not examine potential signaling defects in this study, the data presented suggest that the failure of effector CD8+ T cells to produce IL-2 may lie in their failure to adequately transmit a costimulatory signal, resulting in the inability to transactivate the -150 AP-1 site. Identification of the specific transcription factors that bind to the -150 AP-1 site in CD8+ T cells in response to Ag would provide insight into which signaling molecules might be involved in the restriction of IL-2 production in effector CD8+ T cells. In light of the potential role of activating transcription factor/CREB family members at the -150 AP-1 site (37), it might be of interest to examine p38 mitogen-activated protein kinase. Other candidates include extracellular signal-regulated kinase (ERK), Fos regulating kinase (FRK), and Jun amino-terminal kinase (JNK), that function downstream of Ras, and act together to regulate the expression and function of Fos and Jun proteins (45, 46, 47). ERK induces the transcription of fos mRNA by phosphorylating the Elk-1 transcription factor in the fos promoter (48), FRK acts to enhance transcriptional activation of Fos proteins by phosphorylation (46), and JNK phosphorylates and activates Jun proteins (47). In anergic CD4+ T cells, Ras activation was shown to be selectively blocked, leading to reduced activity of ERK and JNK, but treatment with PMA, which bypasses the TCR to activate the Ras signaling pathway, restored activation of both ERK and JNK and partially restored IL-2 production (16, 17). Our observation that stimulation with ionomycin plus PMA induced IL-2 gene transcription in CD8+ T cells that do not produce IL-2 in response to Ag suggests that the Ras mitogen-activated protein kinase pathway may not be efficiently activated by Ag stimulation in IL-2- CD8+ T cells. Although NFAT/AP-1, OCT/AP-1, and a consensus AP-1 site were transactivated in response to Ag, this does not rule out the possibility that JNK was inactive in IL-2- CD8+ T cells. Studies in anergic cells have shown that some AP-1 sites remain functional, despite the apparent block in JNK activation (20). This suggests that jun proteins that are not phosphorylated by JNK, such as JunB, could act to transactivate certain AP-1 sites (49). Even if JNK was active, transactivation of the -150 AP-1 site also requires transcriptionally active fos protein. The only mechanism for inducing and activating Fos proteins is through ERK and FRK, which are both dependent on Ras activity. Consequently, a block in the Ras pathway could specifically affect the expression and activation of Fos proteins, leading to impaired transactivation of sites requiring Fos/Jun heterodimers and resulting in the failure of effector CD8+ T cells to produce IL-2.
CD8+ T cells may have evolved to lose the capacity for IL-2 expression to provide an additional regulatory mechanism for avoiding autoimmune tissue damage caused by self-reactive CTL that escape thymic deletion. Although there are settings in which CD8+ T cells can respond independently of CD4+ T cells, such as to clear certain acute viral infections, immune responses in the absence of CD4 help generally are limited in magnitude and do not persist long-term (2, 3, 4, 5, 6). Mechanistically, the division of roles in the T cell compartment could be governed by the different types of APC recognized by CD4+ and CD8+ T cell subsets. CD4+ T lymphocytes recognize cells bearing Ag in the context of class II MHC, and these "professional" APC usually express B7 molecules. Such APC are capable of delivering both a signal through the TCR and a costimulatory signal through CD28, resulting in IL-2 production by CD4+ T cells. CD8+ T lymphocytes recognize targets expressing Ag in the context of class I MHC, and most of these cells lack the costimulatory molecules B7-1 and B7-2. After encounter with Ag on class I targets in the absence of costimulation, the CD8+ T cell may become "anergized" with respect to IL-2 production while retaining effector function (11). The molecular mechanism for inducing and maintaining this state of split anergy in CD8+ T cells appears to share some, but not all, of the features that have been described in anergic CD4+ T cells. A greater understanding of the molecular events leading to the anergic state in CD8+ T cells could have implications for therapeutic intervention in a variety of clinical settings.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Immunobiology, Yale University, New Haven, CT 06520. ![]()
3 Address correspondence and reprint requests to Dr. Philip D. Greenberg, Program in Immunology, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue North D3-100, Seattle, WA 98109. E-mail address: pgreen{at}u.washington.edu ![]()
4 Abbreviations used in this paper: CD28RE, CD28 response element;
-gal,
-galactosidase; CPS, counts per second; CREB, cAMP response element-binding protein; ERK, extracellular signal-regulated kinase; FRK, Fos regulating kinase; JNK, Jun amino-terminal kinase; PCR SOEing, PCR Splice Overlap Extension technique; F, forward; R, reverse. ![]()
Received for publication April 6, 2000. Accepted for publication March 21, 2001.
| References |
|---|
|
|
|---|
-herpesvirus in the absence of CD4+ T cells. J. Exp. Med. 184:863.
and IL-4 regulate the growth and differentiation of CD8+ T cells into subpopulations with distinct cytokine profiles. J. Immunol. 155:2928.[Abstract]
-galactosidase as a tracer in immunocytochemistry. Histochemistry 76:153.[Medline]
This article has been cited by other articles:
![]() |
Y. Bian, S.-i. Hiraoka, M. Tomura, X.-Y. Zhou, Y. Yashiro-Ohtani, Y. Mori, J. Shimizu, S. Ono, K. Dunussi-Joannopoulos, S. Wolf, et al. The capacity of the natural ligands for CD28 to drive IL-4 expression in naive and antigen-primed CD4+ and CD8+ T cells Int. Immunol., January 1, 2005; 17(1): 73 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Yui, L. L. Sharp, W. L. Havran, and E. V. Rothenberg Preferential Activation of an IL-2 Regulatory Sequence Transgene in TCR{gamma}{delta} and NKT Cells: Subset-Specific Differences in IL-2 Regulation J. Immunol., April 15, 2004; 172(8): 4691 - 4699. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |