The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Finch, R. J.
Right arrow Articles by Greenberg, P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Finch, R. J.
Right arrow Articles by Greenberg, P. D.
The Journal of Immunology, 2001, 166: 6530-6536.
Copyright © 2001 by The American Association of Immunologists

A Transcriptional Block in the IL-2 Promoter at the -150 AP-1 Site in Effector CD8+ T Cells1

Rosalynde J. Finch*, Patrick E. Fields2,§ and Philip D. Greenberg3,*,{dagger},{ddagger}

Department of * Immunology and {dagger} Medicine, University of Washington, Seattle, WA 98195; {ddagger} Fred Hutchinson Cancer Research Center, Seattle, WA 98109; and § Committee on Immunology, University of Chicago, Chicago, IL 60637


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Both CD4+ and CD8+ T cells that produce IL-2 in response to Ag recognition have been isolated. However, most effector CD8+ T cells recovered after exposure to Ag do not produce sufficient IL-2 to sustain growth, and depend on CD4+ T helper cells for this obligate growth factor. IL-2 expression in CD4+ T cells is primarily controlled at the level of transcription, but mechanisms restricting IL-2 production in CD8+ T cells have not been elucidated. To evaluate transcriptional regulation of the IL-2 gene in CD8+ T cells, we stably transfected reporter genes into Ag-specific CD8+ T cell clones. CD28+ CD8+ T cells unable to transcribe the IL-2 gene in response to antigenic stimulation had a block in transactivation of the -150 CD28 response element (CD28RE)/AP-1 site of the IL-2 promoter, but did transactivate the composite NFAT/AP-1 and OCT/AP-1 sites, and a consensus AP-1 motif. Mutation of the nonconsensus -150 AP-1 site to a consensus AP-1 site, or insertion of a CD28RE/AP-1 consensus site upstream of the native -150 CD28RE/AP-1 site restored transactivation of the altered promoter. These results suggest that the defect at the -150 site may reflect the absence or inactivity of a required factor rather than repression of the IL-2 promoter.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Interleukin-2 was first described as a lymphokine produced by activated CD4+ T cells (1). Although more recent experiments have shown that activated CD8+ T cells can also produce IL-2, CD4+ T helper cells represent the dominant IL-2-producing population. CD8+ T cells mediating long term in vivo effector responses depend on IL-2 produced by CD4+ T cells to sustain proliferation and promote survival (2, 3). Although CD8+ responses to viruses can be elicited in the absence of CD4+ T cells, the establishment of CD8+ T cell memory is severely compromised (4, 5, 6). Several studies have suggested that a dominant pathway for CD4 T cell help is via CD40 ligand-mediated activation of APC (7, 8, 9). However, a recent report has reaffirmed the importance of direct CD4+-to-CD8+ T cell communication by way of lymphokines (10), such as IL-2.

CD8+ T cells capable of IL-2 production in response to Ag have been isolated in selected settings, and maintenance of the ability to express IL-2 appears to be dependent on concurrent costimulation with each activation cycle. However, costimulation is not required for the retention of cytolytic function, a phenomenon termed "split anergy" (11). The potential for CD8+ T cells to produce IL-2 in the presence of sufficient costimulatory activity is further supported by the generation of potent CD8+ T cell responses to tumors independent of CD4 responses following in vitro stimulation with B7-transfected tumor cells (12, 13). CD8+ T cells appear to require costimulation each time Ag is encountered to sustain the facility for IL-2 expression. Naive CD8+ T cells from 2C TCR-transgenic mice produced IL-2 following recognition of allogeneic Ld+ target cells bearing B7 costimulatory molecules (14), but lost the capacity to produce IL-2 following two sequential stimulations in the absence of CD28 costimulation (P. Fields, unpublished observations). These studies suggest that all naive CD8+ T cells may initially be competent to produce IL-2, but lose the ability to sustain growth and survival as a consequence of not receiving the necessary costimulatory signals due to recognition of B7- targets and/or maturation to terminal effector cells.

The requirement for costimulation for CD8+ T cells to produce IL-2 can be circumvented if a sufficiently strong signal is delivered through the TCR. Effector CD8+ T cells that do not produce IL-2 in response to Ag (IL-2-) can be triggered to produce IL-2 by cross-linking the TCR with anti-CD3 Abs, or by treatment with a calcium ionophore, such as ionomycin, in conjunction with a phorbol ester, such as PMA (15). These responses to such nonphysiologic stimuli imply that the inability of most effector CD8+ T cells to produce IL-2 in response to Ag is not due to chromosomal inaccessibility of the IL-2 gene, but might instead be due to a mechanism operating at the transcriptional level, similar to what has been found in anergic CD4+ T cells. Indeed, the block to IL-2 production in anergic CD4+ T cells can also be overcome by stimulation with PMA plus ionomycin (16, 17).

Anergic CD4+ T cells share several additional characteristics with IL-2- CD8+ T cells. IL-2- effector CD8+ T cells can proliferate in response to Ag and supplemental exogenous IL-2, and retain the capacity to produce other cytokines such as IFN-{gamma}. Anergic CD4+ T cells can proliferate following stimulation if exogenous IL-2 is provided, but fail to expand when restimulated with Ag even if costimulation is provided because of a specific inability to produce IL-2, while retaining the capacity to produce other cytokines such as IL-3 and IFN-{gamma} (18). The isolated defect in IL-2 production in anergic CD4+ T cells has been linked to reduced levels of Fos/Jun proteins binding at the -150 AP-1 site in the IL-2 promoter (19), as well as to negative regulatory factors targeting the -150 and -180 AP-1 sites (20, 21, 22).

We examined the transcriptional regulation of the IL-2 gene in CD8+ T cells to better understand the molecular basis for the failure of effector CD8+ T cells to produce IL-2 in response to Ag. Our investigation focused on the AP-1 binding sites located in the IL-2 promoter based on studies in CD4+ T cells suggesting that AP-1 is the target of clonal anergy. AP-1 is composed of homodimers of Jun (c-Jun, Jun B, and Jun D) or heterodimers of Jun and Fos (c-Fos, Fos B, Fra-1, and Fra-2) (23). There are four AP-1 sites in the proximal IL-2 promoter that can bind dimeric combinations of Fos and Jun family members. Three of the AP-1 sites contain nonconsensus AP-1 motifs adjacent to binding sites for NFAT, CD28 response element (CD28RE),4 and OCT, respectively, and both elements of each composite site must be occupied for transactivation of the individual enhancers (24, 25, 26). All three of the composite AP-1 sites are required for transactivation of the IL-2 promoter (27). A fourth AP-1 site at -180 from the transcriptional start site is a consensus site in the reverse orientation, but varies from a consensus AP-1 binding site by one base pair in the forward orientation. The role of the -180 Ap-1 site in IL-2 promoter regulation has not previously been well defined. However, recent evidence indicates that a complex of cAMP response element-binding protein (CREB) and cAMP response element modulator binds to this site in anergic CD4+ T cells (22), perhaps acting to repress IL-2 gene transcription.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
T cell clones and stimulator lines

Four H-2Ld-reactive CD8+ T cell clones, provided by Frank Fitch (University of Chicago, Chicago, IL), were chosen for evaluation. L3 and DB45 (28, 29) do not produce IL-2 in response to antigenic stimulation (IL-2-), and Ld 8.6.1 and 2C (30, 31) produce IL-2 in response to Ag (IL-2+). All clones were restimulated every 14 days with allogeneic BALB/c splenocytes plus 12.5–25 U/ml recombinant human IL-2 (Chiron, Emeryville, CA). The H-2Ld-expressing murine mastocytoma P815, also obtained from Frank Fitch, and the murine BALB/c tumor, LSTRA, maintained in our laboratory, were used as stimulator cells. P815 was transfected with both B7-1 and B7-2 to provide costimulation, and LSTRA naturally expresses both B7-1 and B7-2. All cells were maintained in RPMI 1640-HEPES supplemented with 10% FCS (HyClone, Logan, UT), 4 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, and 5 x 10-5 M 2-ME.

Flow cytometric analysis of cell surface molecules on T cell clones

Cells were analyzed with a FACSCalibur flow cytometer using CellQuest software (BD Biosciences, Mountain View, CA.). All Abs were purchased from PharMingen (San Diego, CA), unless otherwise noted. CD3 and CD8 expression were evaluated with PE-conjugated anti-CD3 (145-2C11) and PE-conjugated anti-CD8{alpha} (53-6.7). PE-conjugated anti-CD4 (GK1.5) was used as a control for nonspecific staining. CD28 expression was evaluated with mAb 37.51, followed by FITC-labeled rabbit anti-hamster IgG (Jackson ImmunoResearch, West Grove, PA) using hamster IgG anti-keyhole limpet hemocyanin Ab Ha4/8 as an isotype control.

RT-PCR analysis of cytokine gene transcription

T cell clones were cultured at 37°C for 6 h in six-well plates (Costar, Cambridge, MA) with medium alone, an equal number of stimulator cells, plate-bound anti-CD3 (2C11) at 1 µg/ml, anti-CD3 plus anti-CD28 (37.51) at 1 µg/ml each, or 10 ng/ml PMA plus 1 µM ionomycin (Sigma, St. Louis, MO). Cells were washed twice with PBS, RNA was extracted with RNAgents Total RNA Isolation kit (Promega, Madison, WI), and reverse transcribed into cDNA using Superscript II (Life Technologies, Gaithersburg, MD). The cDNA was amplified with primers specific for murine IL-2 or IFN-{gamma}, and all reactions included {beta}-actin primers to control for cDNA input. Forward (F) and reverse (R) primers were generated by Life Technologies and paired as follows: IL-2F: CCTGCAGGCATGTACAGCATG + IL-2R: GAGGTACATAGTTATTGAGGGC, yielding a 510-bp product from the IL-2 gene that spans exon/intron boundaries, IFN-{gamma}F: GCTCTGAGACAATGAACGCTA + IFN-{gamma}R: CGAATCAGCAGCGACTCCTTT, yielding a 475-bp product from the IFN-{gamma} gene that spans exon/intron boundaries, and {beta}-actinF: GACGGGGTCACCCACACTGTGCCCATCTA + {beta}-actinR: GAAGTCTAGAGCAACATAGCACAGCTTCTC, yielding a 200-bp product. PCR was repeated for 25 cycles for IFN-{gamma} and 35 cycles for IL-2. PCR was performed on the DeltaCycler II (Ericomp, San Diego, CA). PCR products were resolved on 1.5% agarose gels and visualized by ethidium bromide staining.

Reporter gene constructs

The LacZH constructs containing multimers of IL-2 promoter enhancer elements driving expression of the Escherichia coli lacZ reporter gene, with the hygromycin resistance gene (H) for selection of stable transfectants have been described elsewhere (32). Briefly, IL-2-LacZH contains -326 to +47 of the proximal human IL-2 promoter; NFAT/AP-1-LacZH contains three copies of the NFAT/AP-1 binding site (-286 to -257) linked to the minimal IL-2 promoter (-72 to +47) encoding the TATA box and transcriptional start site; OCT/AP-1-LacZH contains four copies of the OCT/AP-1 binding site (-93 to -65) attached to the minimal IL-2 promoter; and CD28RE/AP-1-LacZH contains four copies of the CD28RE/AP-1 binding region (-159 to -134) linked to the minimal IL-2 promoter.

A consensus AP-1 reporter gene construct was generated using oligonucleotides (oligo) representing the AP-1 binding site from the human metallothionein gene (33): tcgaCGCTTGATGACTCAGCCGGAA and tcgaTTCCGGCTGAGTCATCAAGCG (AP-1 binding site underlined, XhoI overlap bases in lower case italics). Oligos were annealed and ligated into LacZH containing the minimal IL-2 promoter. A plasmid with six copies of the AP-1 consensus binding site in the forward orientation and one copy in the reverse orientation was selected for transfection studies. Fluorescent sequencing was performed on an Applied Biosystems Fluorescent Sequencer using Taq Dye Terminator reagents (Applied Biosystems, Foster City, CA).

Mutations to the IL-2 promoter were accomplished using the PCR Splice Overlap Extension technique (PCR SOEing) (34), with IL-2-LacZH serving as a template. External primers were the same for all PCR SOEing reactions. The external forward primer (EXF) ATCGATGTTTTCTGAGTTACTT is complementary to the 5' end of the 320-bp IL-2 promoter, and the external reverse primer (EXR) TTCCCAGTCACGACGTTGTA is complementary to the 5' end of the lacZ gene. In the internal primers listed below, the binding sites are underlined and mutations are in bold type. The -180 AP-1 site was mutated to a nonbinding site by pairing EXF with the -180 AP-1 Null reverse primer CCAAAGACTGCAAGAATGGATGTAG in one PCR, and EXR with the -180 AP-1 Null forward primer CTACATCCATTCTTGCAGTCTTTGG in a separate PCR. The -150 AP-1 site was replaced with a consensus AP-1 site by pairing EXF and the -150 AP-1 consensus reverse primer CTCTTCTGATGAGTCATTGGAATTTC in one PCR, and EXR with the -150 AP-1 consensus forward primer GAAATTCCAATGACTCATCAGAGAG in a separate PCR. A composite CD28RE/AP-1 consensus site was added to the IL-2 promoter by pairing EXF with the CD28RE/AP-1 consensus reverse primer ATTTCTTTAAACCCCCAAAGACTGAGTCA, and then EXR with the CD28RE/AP-1 consensus forward primer TTTGGGGGTTTAAAGAAATTCCAATGACTCA. The products from each of the sets of PCR were combined and used as overlapping templates in PCR SOEing reactions with external primers to generate the IL-2 promoter with the designated mutations (see Fig. 3GoA). The fidelity of the mutations was confirmed by sequencing.



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 3. Schematics of LacZH reporter gene constructs. A, IL-2-LacZH contains the proximal human IL-2 promoter (-326 to +47) linked to the lacZ gene. The -180 AP-1 null mutation, -150 AP-1 consensus mutation, and insertion of the CD28RE/AP-1 consensus site were performed as described in Materials and Methods. B, All multimerized elements were linked to the minimal IL-2 promoter containing the TATA box and transcriptional start site (-72 to +47) preceding the lacZ gene.

 
Stable transfection of murine T cell clones and P815

T cell clones were transfected by electroporation at 250 mV, 940 µF (Progenetor II; Hoefer, San Francisco, CA) 6 days after antigenic stimulation with irradiated BALB/c splenocytes. All reporter gene plasmids were linearized 5' of the promoter of interest. Electroporated cells were selected for 2–3 wk in medium containing 0.25 mg/ml hygromycin. Aliquots of the hygromycin-resistant cells were stimulated with 10 ng/ml PMA plus 1 µM ionomycin for 3 h, then assayed histochemically for {beta}-galactosidase ({beta}-gal) expression (35). It was necessary to subclone the majority of transfected lines to enrich for {beta}-gal-expressing cells. {beta}-gal+ lines were subcloned by limiting dilution in 96-well plates, and only transfectants that expressed negligible {beta}-gal in the absence of stimulation were selected.

cDNAs encoding murine B7-1 and B7-2 were cloned into the eukaryotic vectors pNA' and pHA', respectively, as described (14). Both constructs were linearized, then transfected into P815 cells via electroporation (250 mV, 940 µF). Electroporated cells were selected with 0.5 mg/ml G418 (Sigma) and 0.25 mg/ml hygromycin B (Boehringer Mannheim, Indianapolis, IN). Antibiotic-resistant cells were screened for both B7-1 and B7-2 expression by flow cytometry using FITC-coupled anti-B7-1 (1G10) and anti-B7-2 (GL-1). Positive cells were sorted into 96-well culture plates (Costar). Surface expression of B7-1 and B7-2 on subclones was determined by flow cytometry, and a subclone expressing matched high levels of B7-1 and B7-2 was selected for use as a stimulator cell line. Transfected P815 cells were maintained in medium with 0.5 mg/ml G418 and 0.25 mg/ml hygromycin B, and assessed by flow cytometry periodically to verify stable B7-1 and B7-2 expression.

Chemiluminescent assay for quantitation of {beta}-gal activity

{beta}-gal activity was measured using the chemiluminescent substrate Galacton-Star (Tropix, Bedford, MA). T cells (1.25 x 105) were plated in triplicate in 96-well plates for 6 h at 37°C with medium alone, an equal number of P815 stimulator cells, or 10 ng/ml PMA plus 1 µM ionomycin, washed with PBS, and lysed with buffer provided by the manufacturer. Samples were incubated with chemiluminescent substrate for 1 h in Dynex MicroFLUOR black 96-well microplates (Dynex Technologies, Chantilly, VA). Light output was measured using the Single Photon Count mode at 24°C for 1.2 s/well on a Packard Top Count microplate luminometer (Packard, Meriden, CT). Due to variations in {beta}-gal activity among subclones possibly resulting from a variable number of integrated transgenes, the induction of {beta}-gal activity in response to stimulation was compared with that detected in unstimulated cells for a panel of six subclones from each transfectant. The subclones representing the mean level of {beta}-gal induction for each stimulation condition are shown as the representative transfectants (see Figs. 4–6GoGoGo).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 4. Disruption of IL-2 promoter activity by -180 AP-1 site mutation. L3, DB45, and 2C transfectants were cultured for 6 h with medium (unstimulated), Ag, (P815), Ag plus costimulation (P815/B7-1 + 2), or PMA plus ionomycin (P+I). {beta}-gal activity was measured in counts per second (CPS) as described in Materials and Methods. Bar graphs represent the mean from three replicates ± SEM. A, IL-2-LacZH transfectants. B, IL-2-LacZH with -180 AP-1 "null" mutation. For both A and B, transfectants of L3 and DB45 are shown that represent the mean induction in a panel of six subclones for each transfectant. Activity of 2C was measured in a transfected clonal population.

 


View larger version (57K):
[in this window]
[in a new window]
  		FIGURE 5. Selective transactivation of composite AP-1 sites in IL-2 promoter. L3, DB45, and 2C transfectants were cultured for 6 h with medium (unstimulated), Ag, (P815), Ag plus costimulation (P815/B7-1 + 2), or PMA plus ionomycin (P+I). {beta}-gal activity was measured in CPS. Bar graphs represent the mean from three replicates ± SEM. A, NFAT/AP-1-LacZH: L3, DB45, and 2C transfectants shown represent the mean activity detected in a panel of six subclones for each transfectant. B, OCT/AP-1-LacZH: the representative mean transfectant from a panel of six subclones is shown for L3; DB45 and 2C activity was measured in transfected clonal populations. C, CD28RE/AP-1-LacZH: representative mean transfectants from panels of six subclones each are shown for L3 and DB45; activity of 2C was measured in a transfected clonal population.

 


View larger version (61K):
[in this window]
[in a new window]
  		FIGURE 6. Restoration of IL-2 promoter activity by consensus AP-1 site mutations. L3, DB45, and 2C transfectants were cultured for 6 h with medium (unstimulated), Ag, (P815), Ag plus costimulation (P815/B7-1 + 2), or PMA plus ionomycin (P+I). {beta}-gal activity was measured in CPS. Bar graphs represent the mean from three replicates ± SEM. A, Multimerized AP-1 consensus-LacZH: L3, DB45 and 2C transfectants representing the average level of induction measured in a panel of six subclones each are shown. B, IL-2-LacZH with -150 AP-1 consensus mutation. C, IL-2-LacZH with CD28RE/AP-1 consensus insertion. For both B and C, mean transfectants from panels of six subclones each are represented for L3 and 2C, and activity of DB45 was measured in a transfected clonal population.

 

   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
IL-2- and IL-2+ CD8+ T cell clones express comparable levels of CD3, CD8, and CD28

One possible explanation for the inability of some effector CD8+ T cells to produce IL-2 is decreased signal strength due to down-regulation of critical signaling molecules. Therefore, surface expression of CD3, CD8, and CD28 on CD8+ T cell clones was assessed by flow cytometry. The IL-2- clones, L3 and DB45, and the IL-2+ clones, 2C and Ld 8.6.1, expressed approximately equivalent levels of CD3 and CD8 (Fig. 1Go, A and B). CD28 was expressed at the highest levels on L3, and was approximately equivalent on DB45 and 2C, but slightly lower on Ld 8.6.1. (Fig. 1GoC). These results suggest that reduction of CD3, CD8, or CD28 on L3 and DB45 did not account for the inability of these clones to produce IL-2 in response to Ag.



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 1. Comparable expression of CD3, CD8, and CD28 on IL-2- and IL-2+ CD8+ T cell clones. T cell clones were stained for CD3 (A), CD8 (B), or CD28 (C) expression, as described in Materials and Methods. The shaded curve represents unstained cells, and the unshaded curve represents staining with the labeled Ab.

 
IL-2- CD8+ T cells do not transcribe IL-2 mRNA in response to Ag

Transcription of the IL-2 and IFN-{gamma} genes was assessed under varying conditions: either medium alone, or after stimulation with LSTRA, P815, P815/B7-1 + 2 transfectants, plate-bound anti-CD3, anti-CD3 plus anti-CD28, or PMA plus ionomycin. All clones were assessed 6 h after stimulation following a rest period of 10 days from the previous stimulation. IFN-{gamma} mRNA was induced in response to all stimuli, indicating that the cells were activated (Fig. 2GoA). No baseline transcription of the IL-2 gene was detectable in CD8+ T cell clones cultured in medium alone (Fig. 2GoB). Following stimulation with plate-bound anti-CD3, anti-CD3 plus anti-CD28, or PMA plus ionomycin, IL-2 mRNA was transcribed by all CD8+ T cell clones. In response to allogeneic stimulation with LSTRA, P815 cells, or P815/B7-1 + 2 transfectants, the IL-2+ CD8+ T cell clones 2C and Ld 8.6.1 transcribed IL-2 mRNA, whereas the IL-2- CD8+ T cell clones L3 and DB45 did not transcribe detectable IL-2 mRNA. Thus, the restriction of IL-2 production in CD8+ T cell subsets is controlled at least in part at the level of mRNA transcription and/or stability.



View larger version (104K):
[in this window]
[in a new window]
  		FIGURE 2. Differential transcription of IL-2 mRNA in IL-2- and IL-2+ CD8+ T cell clones in response to Ag. CD8+ T cell clones were cultured for 6 h with medium alone (lane 1), LSTRA (2 ), P815 (3 ), P815/B7-1 + 2 (4 ), PMA plus ionomycin (5 ), anti-CD3 (6 ), or anti-CD3 + anti-CD28 (7 ). MW, A 100-bp molecular weight ladder (Life Technologies). RNA was harvested and cDNA made as described in Materials and Methods. A 475-bp product was amplified by RT-PCR from IFN-{gamma} cDNA (A), and a 510-bp product was amplified from IL-2 cDNA (B). A 200-bp fragment of the {beta}-actin gene was amplified in all reactions as a control for cDNA input.

 
The proximal IL-2 promoter is not transactivated in IL-2- CD8+ T cells

Transactivation of the proximal IL-2 promoter was evaluated in response to varying stimuli. The proximal IL-2 promoter-LacZH reporter gene construct (Fig. 3GoA) was stably transfected into the IL-2- CD8+ clones L3 and DB45, and into the IL-2+ CD8+ clone 2C, which most closely matched the surface phenotype of the IL-2- CD8+ clones. Ld 8.6.1 was not used in reporter gene analyses due to variable stability of transgenes in this clone. Reporter gene expression was detected in both L3 and DB45 in response to PMA plus ionomycin, but no significant activity was observed after 6 h in response to antigenic stimulation with P815 or P85/B7-1 + 2 (Fig. 4GoA). In contrast, the IL-2+ CD8+ T cell clone 2C transactivated the IL-2 promoter in response to P815, and costimulation with B7-1 and B7-2 enhanced transactivation compared with stimulation with P815 alone. Analysis of a panel of L3 and DB45 subclones failed to detect any cells capable of transactivating the IL-2 promoter in response to Ag, or Ag plus costimulation.

Disruption of the potentially inhibitory -180 AP-1 binding site does not restore transactivation of the IL-2 promoter

We evaluated whether a negative regulatory factor similar to that identified in anergic CD4+ T cells played a role in negatively regulating IL-2 promoter transactivation in CD8+ T cells by removing the binding site for the putative inhibitor. The -180 AP-1 site in the IL-2 promoter was converted to a nonbinding site by mutating the TCAGTCA AP-1 motif to TCTTGCA (Fig. 3GoA), because an identical 3-bp mutation restored transactivation of the IL-2 promoter in anergic CD4+ cells (21). In L3 and DB45 transfectants, the -180 AP-1 null version of the IL-2 promoter was very weakly activated in response to PMA plus ionomycin (Fig. 4GoB). This reduced activity in comparison to the native IL-2 promoter suggested a potential positive rather than negative contribution from this site in CD8+ T cells. No significant response was observed in L3 or DB45 transfectants following stimulation with Ag or Ag plus costimulation. Analysis of multiple subclones of L3 and DB45 confirmed that the -180 AP-1 mutation severely reduced IL-2 promoter activity. IL-2+ 2C transfectants bearing the -180 AP-1 null mutation exhibited marginal promoter activity compared with the native IL-2 promoter in response to PMA plus ionomycin, Ag, or Ag plus costimulation, with only 1.3-fold induction over levels in unstimulated cells. Thus, the -180 AP-1 site appears to provide a positive signal, and is not responsible for repressing IL-2 transcription in CD8+ T cells.

The -150 CD28RE/AP-1 site is selectively not transactivated in response to Ag in IL-2- CD8+ T cells

The three enhancer binding sites for NFAT/AP-1, OCT/AP-1, and CD28RE/AP-1 have been identified as critical domains controlling IL-2 transcription in CD4+ T cells (27). To evaluate transactivation of these elements, reporter constructs (Fig. 3GoB) were transfected into L3, DB45, and 2C. Transactivation of the NFAT/AP-1 binding site was observed in response to PMA plus ionomycin, Ag stimulation, and Ag plus costimulation in all three clones (Fig. 5GoA). Analysis of multiple subclones for each transfectant confirmed transactivation in response to all stimulation conditions.

The OCT/AP-1-LacZ reporter construct demonstrated inducible {beta}-gal activity in all three clones in response to PMA plus ionomycin, Ag, or Ag plus costimulation (Fig. 5GoB), which was confirmed for L3 by analysis of multiple subclones. Although this binding site did not induce high levels of reporter gene activity in any of the CD8+ T cell clones, no significant differences were evident between the IL-2+ clone and IL-2- clones. Thus, neither the NFAT/AP-1 nor OCT/AP-1 binding site appear to be targets for differential regulation of the IL-2 promoter.

In contrast, the IL-2- clones L3 and DB45, despite being CD28+, induced the CD28RE/AP-1-LacZ reporter construct only in response to PMA plus ionomycin, and failed to induce {beta}-gal activity in response to Ag, even in the presence of costimulation (Fig. 5GoC). This was again confirmed by analysis of a panel of L3 and DB45 subclones. However, IL-2+ 2C transfectants exhibited reporter gene activity in response to all three stimuli, with the strongest response induced by Ag plus costimulation. The activity of this enhancer element in all three clones mirrored those observed for the intact proximal IL-2 promoter in response to PMA plus ionomycin and Ag recognition. These results suggest that the CD28RE/AP-1 element may be subject to differential regulation in subpopulations of CD8+ T cells.

IL-2- CD8+ T cells express functional AP-1 complexes

Although all of the analyzed reporter constructs of multimerized binding elements represent composite sites containing an AP-1 binding site, each composite site may bind different combinations of Jun and/or Fos family members. Therefore, to determine whether a general defect in AP-1 or a defect specific to the nonconsensus -150 AP-1 site exists in IL-2- CD8+ T cells, transactivation of a consensus AP-1 site was examined. The consensus AP-1 site differs from the CD28RE/AP-1 site in two significant ways: it does not contain the binding site for the CD28 response complex, and it exhibits higher affinity for the Jun/Fos heterodimer (36). The multimerized consensus AP-1-LacZ reporter gene (Fig. 3GoB) was induced following activation of L3, DB45, and 2C with PMA plus ionomycin, Ag, and Ag plus costimulation (Fig. 6GoA). These results, confirmed by analysis of a panel of subclones for each transfectant, suggest that functional AP-1 complexes are being induced in IL-2- CD8+ T cells in response to Ag recognition.

Mutation of -150 AP-1 site to a consensus AP-1 site restores transactivation of the IL-2 promoter

The failure of IL-2- CD8+ T cells to transactivate the CD28RE/AP-1 site could reflect either a defect in the CD28 response complex that binds to the CD28RE and/or a defect in specific AP-1 complexes required to transactivate the AP-1 component of the composite site, because both sites must be occupied for enhancer activity (25). To directly assess the AP-1 site, we left the CD28RE intact, but replaced the native -150 AGAGTCA AP-1 site with the consensus AP-1 motif TGACTCA, and transfected this modified IL-2 promoter-LacZ reporter construct (Fig. 3GoA) into L3, DB45, and 2C. In response to PMA plus ionomycin, all three clones transactivated the mutated IL-2 promoter (Fig. 6GoB). Moreover, in contrast to the native IL-2 promoter, detectable {beta}-gal activity from the modified -150 AP-1 consensus IL-2 promoter was induced by Ag in L3 and DB45, and was further increased by costimulation. Clone 2C exhibited high levels of {beta}-gal activity in response to Ag and Ag plus costimulation. This pattern of activation was confirmed by subclone analyses with L3 and 2C. Thus, conversion of the -150 AP-1 site to a consensus AP-1 site appears sufficient to at least partially restore IL-2 promoter activity in response to Ag in IL-2- CD8+ T cell clones.

Transactivation of the IL-2 promoter containing the -150 AP-1 consensus mutation in IL-2- CD8+ clones could have resulted from replacement of an AP-1 site requiring specific AP-1 family members that are not present with a binding site capable of being transactivated by alternate AP-1 complexes, or from disruption of a site that previously bound a negative regulator. To distinguish between these two possibilities, the native IL-2 promoter was altered by insertion of a modified CD28RE/AP-1 element containing a consensus AP-1 site between the -180 and -150 enhancer sites (Fig. 3GoA). This mutation adds a functional CD28RE/AP-1 site to the promoter while leaving the native CD28RE/AP-1 site intact and potentially capable of binding a negative regulator. This modified IL-2 promoter was responsive to PMA plus ionomycin, to Ag, and to Ag plus costimulation in all three CD8+ clones (Fig. 6GoC). This pattern of activation in response to all stimuli was consistent among all L3 and 2C subclones. However, we noted that higher levels of reporter gene activity were detected in the 2C transfectant than in L3 and DB45. This increase might reflect a greater transgene copy number in the 2C transfectant, but we cannot completely rule out the possibility of partial repressor activity at this site in L3 and DB45. Thus, the addition of a functional CD28RE/AP-1 site could conceivably override or displace a repressor binding at the -ISOAP-1 site in the native promoter, or alternatively restore transactivation by providing a composite site that can bind AP-1 complexes induced in response to Ag recognition.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Recent evidence demonstrating that a CREB/cAMP response element modulator complex binds to the -180 AP-1 site in anergic CD4+ T cells and negatively regulates IL-2 transcription suggested that a similar or related complex may restrict IL-2 expression in effector CD8+ T cells. However, mutations we made in the -180 AP-1 site, known to disrupt that site and restore promoter activity in anergic CD4+ T cells (21), suggested an alternative mechanism must be operative. In addition to the inhibitory mechanism operating at the -180 AP-1 site, a defect at the -150 AP-1 site has been implicated in anergy induction (19, 20, 21), and we have identified that this site is also targeted in the restriction of IL-2 production by effector CD8+ T cells.

One possibility for the observed failure of IL-2- CD8+ T cells to transactivate the nonconsensus -150 AP-1 site in response to Ag is that the obligatory transcription factors were not induced or activated. Members of the activating transcription factor-1/CREB family have been shown to transactivate the -150 AP-1 site (37), representing one possible complex that could act to differentially regulate the -150 AP-1 site. A second possibility is that the requisite Fos or Jun family member(s) were not induced or appropriately activated in response to antigenic stimulation. AP-1 complexes can consist of different dimeric Fos and Jun family members and exhibit variable DNA binding specificity. Although Jun/Jun homodimers can transactivate AP-1 sites, Fos/Jun heterodimers are more potent transactivators (38). The nonconsensus -150 AP-1 site is a "low affinity" site for the Fos/Jun heterodimer (36), and may require a specific combination of Fos/Jun family members for activation. By contrast, the NFAT/AP-1 site and consensus AP-1 sites are "high affinity" binding sites and can be transactivated with both Fos/Jun and Jun/Jun dimers (39). Hence, the ability of IL-2- CD8+ T cells to transactivate the NFAT/AP-1, OCT/AP-1, and consensus AP-1 sites but not the -150 AP-1 site could result from limitation or inactivation of a required factor, such as one of the Fos proteins. Several Fos family members such as Fra1, Fra2, and an alternatively spliced form of FosB lack transcriptional activation domains (40, 41). These transcriptionally inactive forms of Fos might have preferential affinity for the -150 AP-1 site while not efficiently binding and interfering with transactivation of the NFAT/AP-1, OCT/AP-1, or consensus AP-1 sites.

Our results are consistent with the hypothesis that antigenic stimulation of IL-2- CD8+ T cells does not result in the induction or activation of the specific nuclear proteins required to transactivate the -150 AP-1 site, and consequently the entire IL-2 promoter is rendered inactive. Protein-DNA interactions at distal sites within the IL-2 promoter have been demonstrated to be unstable if even one transcription factor is missing (42). The possibility that a missing factor is responsible for the differences in cytokine secretion patterns in IL-2+ and IL-2- CD8+ T cells is consistent with studies using heterokaryons between CD4+ and CD8+ T cell clones. In those studies, fusion of the CD8+ T cell clone L3 with an IL-2+ CD4+ fusion partner did not repress secretion of IL-2, suggesting the absence of a dominant negative regulatory factor for IL-2 expression in CD8+ T cells (43). In contrast, heterokaryon formation between nonanergic and anergic CD4+ T cells disrupted transactivation of the IL-2 gene in the fusion partner, suggesting the presence of a dominant negative regulatory mechanism for restriction of IL-2 production in anergic CD4+ T cells (44).

Although we did not examine potential signaling defects in this study, the data presented suggest that the failure of effector CD8+ T cells to produce IL-2 may lie in their failure to adequately transmit a costimulatory signal, resulting in the inability to transactivate the -150 AP-1 site. Identification of the specific transcription factors that bind to the -150 AP-1 site in CD8+ T cells in response to Ag would provide insight into which signaling molecules might be involved in the restriction of IL-2 production in effector CD8+ T cells. In light of the potential role of activating transcription factor/CREB family members at the -150 AP-1 site (37), it might be of interest to examine p38 mitogen-activated protein kinase. Other candidates include extracellular signal-regulated kinase (ERK), Fos regulating kinase (FRK), and Jun amino-terminal kinase (JNK), that function downstream of Ras, and act together to regulate the expression and function of Fos and Jun proteins (45, 46, 47). ERK induces the transcription of fos mRNA by phosphorylating the Elk-1 transcription factor in the fos promoter (48), FRK acts to enhance transcriptional activation of Fos proteins by phosphorylation (46), and JNK phosphorylates and activates Jun proteins (47). In anergic CD4+ T cells, Ras activation was shown to be selectively blocked, leading to reduced activity of ERK and JNK, but treatment with PMA, which bypasses the TCR to activate the Ras signaling pathway, restored activation of both ERK and JNK and partially restored IL-2 production (16, 17). Our observation that stimulation with ionomycin plus PMA induced IL-2 gene transcription in CD8+ T cells that do not produce IL-2 in response to Ag suggests that the Ras mitogen-activated protein kinase pathway may not be efficiently activated by Ag stimulation in IL-2- CD8+ T cells. Although NFAT/AP-1, OCT/AP-1, and a consensus AP-1 site were transactivated in response to Ag, this does not rule out the possibility that JNK was inactive in IL-2- CD8+ T cells. Studies in anergic cells have shown that some AP-1 sites remain functional, despite the apparent block in JNK activation (20). This suggests that jun proteins that are not phosphorylated by JNK, such as JunB, could act to transactivate certain AP-1 sites (49). Even if JNK was active, transactivation of the -150 AP-1 site also requires transcriptionally active fos protein. The only mechanism for inducing and activating Fos proteins is through ERK and FRK, which are both dependent on Ras activity. Consequently, a block in the Ras pathway could specifically affect the expression and activation of Fos proteins, leading to impaired transactivation of sites requiring Fos/Jun heterodimers and resulting in the failure of effector CD8+ T cells to produce IL-2.

CD8+ T cells may have evolved to lose the capacity for IL-2 expression to provide an additional regulatory mechanism for avoiding autoimmune tissue damage caused by self-reactive CTL that escape thymic deletion. Although there are settings in which CD8+ T cells can respond independently of CD4+ T cells, such as to clear certain acute viral infections, immune responses in the absence of CD4 help generally are limited in magnitude and do not persist long-term (2, 3, 4, 5, 6). Mechanistically, the division of roles in the T cell compartment could be governed by the different types of APC recognized by CD4+ and CD8+ T cell subsets. CD4+ T lymphocytes recognize cells bearing Ag in the context of class II MHC, and these "professional" APC usually express B7 molecules. Such APC are capable of delivering both a signal through the TCR and a costimulatory signal through CD28, resulting in IL-2 production by CD4+ T cells. CD8+ T lymphocytes recognize targets expressing Ag in the context of class I MHC, and most of these cells lack the costimulatory molecules B7-1 and B7-2. After encounter with Ag on class I targets in the absence of costimulation, the CD8+ T cell may become "anergized" with respect to IL-2 production while retaining effector function (11). The molecular mechanism for inducing and maintaining this state of split anergy in CD8+ T cells appears to share some, but not all, of the features that have been described in anergic CD4+ T cells. A greater understanding of the molecular events leading to the anergic state in CD8+ T cells could have implications for therapeutic intervention in a variety of clinical settings.


   Acknowledgments
 
We thank Dr. Gerald Crabtree and Dr. Steven Fiering for providing the LacZH constructs. We are also grateful to Kent Slaven, Wendy Walker, and Katie Weber for maintaining our mouse colonies, and we are indebted to Eric Baker for his assistance in the preparation of this manuscript.


   Footnotes
 
1 These studies were supported by National Institutes of Health Grants CA33084, CA18029, and AI36613. R.F. was supported in part by The Benaroya Foundation Training Grant in Immunology. Back

2 Current address: Department of Immunobiology, Yale University, New Haven, CT 06520. Back

3 Address correspondence and reprint requests to Dr. Philip D. Greenberg, Program in Immunology, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue North D3-100, Seattle, WA 98109. E-mail address: pgreen{at}u.washington.edu Back

4 Abbreviations used in this paper: CD28RE, CD28 response element; {beta}-gal, {beta}-galactosidase; CPS, counts per second; CREB, cAMP response element-binding protein; ERK, extracellular signal-regulated kinase; FRK, Fos regulating kinase; JNK, Jun amino-terminal kinase; PCR SOEing, PCR Splice Overlap Extension technique; F, forward; R, reverse. Back

Received for publication April 6, 2000. Accepted for publication March 21, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Miller, R. A.. 1983. IL-2 production by mitogen-stimulated T cell subsets: helper precursors are predominantly Lyt-2-. J. Immunol. 31:2864.
  2. Matloubian, M., R. J. Concepcion, R. Ahmed. 1994. CD4+ T cells are required to sustain CD8+ cytotoxic T-cell responses during chronic viral infection. J. Virol. 68:8056.[Abstract/Free Full Text]
  3. Cardin, R. D., J. W. Brooks, S. R. Sarawar, P. C. Doherty. 1996. Progressive loss of CD8+ T cell-mediated control of a {gamma}-herpesvirus in the absence of CD4+ T cells. J. Exp. Med. 184:863.[Abstract/Free Full Text]
  4. Rahemtulla, A., W. P. Fung-Leung, M. W. Schilham, T. M. Kundig, S. R. Sambhara, A. Narendran, A. Arabian, A. Wakeham, C. J. Paige, R. M. Zinkernagel, et al 1991. Normal development and function of CD8+ cells but markedly decreased helper cell activity in mice lacking CD4. Nature 353:180.[Medline]
  5. Battegay, M., D. Moskophidis, A. Rahemtulla, H. Hengartner, T. W. Mak, R. M. Zinkernagel. 1994. Enhanced establishment of a virus carrier state in adult CD4+ T-cell-deficient mice. J. Virol. 68:4700.[Abstract/Free Full Text]
  6. von Herrath, M. G., M. Yokoyama, J. Dockter, M. B. Oldstone, J. L. Whitton. 1996. CD4-deficient mice have reduced levels of memory cytotoxic T lymphocytes after immunization and show diminished resistance to subsequent virus challenge. J. Virol. 70:1072.[Abstract]
  7. Ridge, J. P., F. DiRosa, P. Matzinger. 1998. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature 393:474.[Medline]
  8. Bennett, S. R. M., F. R. Carbone, F. Karamalis, R. A. Flavell, J. F. A. P. Miller, W. R. Heath. 1998. Help for cytotoxic T-cell responses is mediated by CD40 signaling. Nature 393:478.[Medline]
  9. Schoenberger, S. P., R. E. M. Toes, E. I. H. van der Voort, R. Offringa, C. J. M. Melief. 1998. T cell help for cytotoxic T lymphocytes is mediated by CD40-CD40L interactions. Nature 393:480.[Medline]
  10. Lu, Z., L. Yuan, X. Zhou, E. Sotomayor, H. I. Levitsky, D. M. Pardoll. 2000. CD40-independent pathways of T cell help for priming of CD8+ cytotoxic T lymphocytes. J. Exp. Med. 191:541.[Abstract/Free Full Text]
  11. Otten, G. R., R. N. Germain. 1991. Split anergy in a CD8+ T cell: receptor dependent cytolysis in the absence of interleukin-2 production. Science 251:1228.[Abstract/Free Full Text]
  12. Chen, L., S. Ashe, W. A. Brady, I. Hellstrom, K. E. Hellstrom, J. A. Ledbetter, P. McGowan, P. S. Linsley. 1992. Costimulation of antitumor immunity by the B7 counterreceptor for the T lymphocyte molecules CD28 and CTLA-4. Cell 71:1093.[Medline]
  13. Townsend, S., J. P. Allison. 1993. Tumor rejection after direct costimulation of CD8+ T cells by B7-transfected melanoma cells. Science 258:368.
  14. Fields, P. E., R. J. Finch, G. S. Gray, R. Zollner, J. L. Thomas, K. Sturmhoefel, K. Lee, S. Wolf, T. F. Gajewski, F. W. Fitch. 1998. B7.1 is a quantitatively stronger costimulus than B7.2 in the activation of naïve CD8+ TCR-transgenic T cells. J. Immunol. 161:5268.[Abstract/Free Full Text]
  15. Noble, A., P. A. Macary, D. M. Kemeny. 1995. IFN{gamma} and IL-4 regulate the growth and differentiation of CD8+ T cells into subpopulations with distinct cytokine profiles. J. Immunol. 155:2928.[Abstract]
  16. Li, W., C. D. Whaley, A. Mondino, D. L. Mueller. 1996. Blocked signal transduction to the ERK and JNK protein kinases in anergic CD4+ T cells. Science 271:1272.[Abstract]
  17. Fields, P. E., T. F. Gajewski, F. W. Fitch. 1996. Blocked Ras activation in anergic CD4+ T cells. Science 271:1276.[Abstract]
  18. Jenkins, M. K., D. M. Pardoll, J. Mizuguchi, T. M. Chused, R. H. Schwartz. 1987. Molecular events in the induction of a non-responsive state in interleukin-2 producing helper T-lymphocyte clones. Proc. Natl. Acad. Sci. USA 84:5409.[Abstract/Free Full Text]
  19. Mondino, A., C. D. Whaley, D. R. DeSilva, W. Li, M. K. Jenkins, D. L. Mueller. 1996. Defective transcription of the IL-2 gene is associated with impaired expression of c-fos, FosB, and JunB in anergic T helper 1 cells. J. Immunol. 157:2048.[Abstract]
  20. Kang, S. M., B. Beverly, A. C. Tran, K. Brorson, R. H. Schwartz, M. J. Lenardo. 1992. Transactivation by AP-1 is a molecular target of T cell clonal anergy. Science 257:1134.[Abstract/Free Full Text]
  21. Sakakida, S. K., R. H. Schwartz. 1996. Multifactor cis-dominant negative regulation of IL-2 gene expression in anergized T cells. J. Immunol. 157:2328.[Abstract]
  22. Powell, J. D., C. G. Lerner, G. R. Ewoldt, R. H. Schwartz. 1999. The -180 site of the IL-2 promoter is the target of CREB/CREM binding in T cell anergy. J. Immunol. 163:6631.[Abstract/Free Full Text]
  23. Angel, P., M. Karin. 1991. The role of Jun, Fos, and the AP-1 complex in cell-proliferation and transformation. Biochim. Biophys. Acta 1072:129.[Medline]
  24. Jain, J., P. G. McCaffrey, Z. Miner, T. K. Kerppola, J. N. Lambert, G. L. Verdine, T. Curran, A. Rao. 1994. The T cell transcription factor NFATp is a substrate for calcineurin and interacts with Fos and Jun. Nature 365:352.
  25. Shapiro, V. S., K. E. Truitt, J. B. Imboden, A. Weiss. 1997. CD28 mediates transcriptional upregulation of the IL-2 promoter through a composite element containing the CD28RE and NFIL2B AP-1 sites. Mol. Cell. Biol. 17:4051.[Abstract]
  26. De Grazia, U., M. P. Felli, A. Vacca, A. R. Farina, M. Maroder, L. Cappabianca, D. Meco, M. Farina, I. Screpanti, L. Frati, A. Gulino. 1994. Positive and negative regulation of the composite octamer motif of the interleukin 2 enhancer by AP-1, Oct-2, and retinoic acid receptor. J. Exp. Med. 180:1485.[Abstract/Free Full Text]
  27. Durand, D. B., J. P. Shaw, M. R. Bush, R. E. Replogle, R. Belagaje, G. R. Crabtree. 1988. Characterization of antigen receptor response elements within the interleukin-2 enhancer. Mol. Cell. Biol. 8:1715.[Abstract/Free Full Text]
  28. Glasebrook, A. L., F. W. Fitch. 1980. Alloreactive cloned T cell lines. I. Interactions between cloned amplifier and cytolytic T cell lines. J. Exp. Med. 151:876.[Abstract/Free Full Text]
  29. Moldwin, R. L., D. W. Lancki, K. C. Herold, F. W. Fitch. 1986. An antigen receptor-driven, interleukin 2-independent pathway for proliferation of murine cytolytic T lymphocyte clones. J. Exp. Med. 163:1566.[Abstract/Free Full Text]
  30. McKisic, M. D., D. W. Lancki, D. C. Cronin, F. W. Fitch. 1993. Cytolytic activity of murine IL-2 producing CD4+ and CD8+ T cell clones cycles in response to IL-2. J. Immunol. 151:4055.[Abstract]
  31. Saito, H., D. M. Kranz, Y. Takagaki, A. C. Hayday, H. N. Eisen, S. Tonegawa. 1984. A third rearranged and expressed gene in a clone of cytotoxic T lymphocytes. Nature 312:36.[Medline]
  32. Mattila, P., K. S. Ullman, S. Fiering, E. A. Emmel, M. McCutcheon, G. R. Crabtree, L. A. Herzenberg. 1990. The actions of cyclosporin A and FK506 suggest a novel step in the activation of T lymphocytes. EMBO J. 9:4425.[Medline]
  33. Lee, W., P. Mitchell, R. Tjian. 1987. Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. Cell 6:741.
  34. Ho, S. N., S. D. Hunt, J. K. Pullen, L. R. Pearce. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51.[Medline]
  35. Bondi, A., G. Chieregatti, V. Eusebi, E. Fulcheri, G. Bussolati. 1982. The use of {beta}-galactosidase as a tracer in immunocytochemistry. Histochemistry 76:153.[Medline]
  36. Jain, J., V. E. Valge-Archer, A. Rao. 1992. Analysis of the AP-1 sites in the IL-2 promoter. J. Immunol. 148:1240.[Abstract]
  37. Butscher, W. G., C. Powers, M. Olive, C. Vinson, K. Gardner. 1998. Coordinate transactivation of the interleukin-2 CD28 response element by c-rel and ATF-1/CREB2. J. Biol. Chem. 273:552.[Abstract/Free Full Text]
  38. Ryseck, R. P., R. Bravo. 1991. c-Jun, JunB, and JunD differ in their binding affinities to AP-1 and CRE consensus sequences: effect of Fos proteins. Oncogene 6:533.[Medline]
  39. Petrak, D., S. A. Memon, M. J. Birrer, J. D. Ashwell, C. M. Zacharchuk. 1994. Dominant negative mutant of c-Jun inhibits NF-AT transcriptional activity and prevents IL-2 gene transcription. J. Immunol. 153:2046.[Abstract]
  40. Suzuki, T., H. Okuno, T. Yoshida, T. Endo, H. Nishina, H. Iba. 1991. Difference in transcriptional regulatory function between c-fos and Fra-2. Nucleic Acids Res. 19:5537.[Abstract/Free Full Text]
  41. Yen, J., R. M. Wisdom, I. Tratner, I. M. Verma. 1991. An alternative splice form of fosB is a negative regulator of transcriptional activation and transformation by fos proteins. Proc. Natl. Acad. Sci. USA 88:5077.[Abstract/Free Full Text]
  42. Chen, D., E. V. Rothenberg. 1994. Interleukin-2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles. J. Exp. Med. 179:931.[Abstract/Free Full Text]
  43. Havran, W. L., F. W. Fitch. 1987. Characterization of murine cytolytic-helper T cell clones. Nature 325:65.[Medline]
  44. Telander, D. G., E. N. Malvey, D. L. Mueller. 1998. Evidence for repression of IL-2 gene activation in anergic T cells. J. Immunol. 162:1460.[Abstract/Free Full Text]
  45. Izquierdo, M., S. J. Leevers, C. J. Marshall, D. Cantrell. 1993. p21ras couples the T cell antigen receptor to extracellular signal-regulated kinase-2 in T lymphocytes. J. Exp. Med. 178:1199.[Abstract/Free Full Text]
  46. Deng, T., M. Karin. 1994. c-Fos transcriptional activity stimulated by H-ras-activated protein kinase distinct from JNK and ERK. Nature 371:171.[Medline]
  47. Su, B., E. Jacinto, M. Hibi, T. Kallunki, M. Karin, Y. Ben-Neriah. 1994. JNK is involved in signal integration during costimulation of T lymphocytes. Cell 77:727.[Medline]
  48. Marais, R., J. Wynne, R. Treisman. 1993. The SRF accessory protein Elk-1 contains a growth-factor-regulated transcriptional activation domain. Cell 73:381.[Medline]
  49. Franklin, C. C., V. Sanchez, F. Wagner, J. R. Woodgett, A. S. Kraft. 1992. Phorbol ester-induced amino-terminal phosphorylation of human c-jun but not JunB regulates transcriptional activation. Proc. Natl. Acad. Sci. USA 89:7247.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Int ImmunolHome page
Y. Bian, S.-i. Hiraoka, M. Tomura, X.-Y. Zhou, Y. Yashiro-Ohtani, Y. Mori, J. Shimizu, S. Ono, K. Dunussi-Joannopoulos, S. Wolf, et al.
The capacity of the natural ligands for CD28 to drive IL-4 expression in naive and antigen-primed CD4+ and CD8+ T cells
Int. Immunol., January 1, 2005; 17(1): 73 - 83.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. A. Yui, L. L. Sharp, W. L. Havran, and E. V. Rothenberg
Preferential Activation of an IL-2 Regulatory Sequence Transgene in TCR{gamma}{delta} and NKT Cells: Subset-Specific Differences in IL-2 Regulation
J. Immunol., April 15, 2004; 172(8): 4691 - 4699.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Finch, R. J.
Right arrow Articles by Greenberg, P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Finch, R. J.
Right arrow Articles by Greenberg, P. D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS