The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Finke, D.
Right arrow Articles by Acha-Orbea, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Finke, D.
Right arrow Articles by Acha-Orbea, H.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2001, 166: 6266-6275.
Copyright © 2001 by The American Association of Immunologists

Extrafollicular Plasmablast B Cells Play a Key Role in Carrying Retroviral Infection to Peripheral Organs1

Daniela Finke*, Frédéric Baribaud{ddagger}, Heidi Diggelmann{ddagger} and Hans Acha-Orbea2,*,{dagger}

* Ludwig Institute for Cancer Research, Lausanne Branch, and {dagger} Institute of Biochemistry, University of Lausanne, Epalinges, Switzerland; and {ddagger} Institute for Microbiology, University Hospital of Lausanne, Lausanne, Switzerland


    Abstract
 Top
 Abstract
 Introduction
 uMaterials and Methods
 Results
 Discussion
 References
 
B cells can either differentiate in germinal centers or in extrafollicular compartments of secondary lymphoid organs. Here we show the migration properties of B cells after differentiation in murine peripheral lymph node infected with mouse mammary tumor virus. Naive B cells become activated, infected, and carry integrated retroviral DNA sequences. After production of a retroviral superantigen, the infected B cells receive cognate T cell help and differentiate along the two main differentiation pathways analogous to classical Ag responses. The extrafollicular differentiation peaks on day 6 of mouse mammary tumor virus infection, and the follicular one becomes detectable after day 10. B cells participating in this immune response carry a retroviral DNA marker that can be detected by using semiquantitative PCR. We determined the migration patterns of B cells having taken part in the T cell-B cell interaction from the draining lymph node to different tissues. Waves of immigration and retention of infected cells in secondary lymphoid organs, mammary gland, salivary gland, skin, lung, and liver were observed correlating with the two peaks of B cell differentiation in the draining lymph node. Other organs revealed immigration of infected cells at later time points. The migration properties were correlated with a strong up-regulation of {alpha}4{beta}1 integrin expression. These results show the migration properties of B cells during an immune response and demonstrate that a large proportion of extrafolliculary differentiating plasmablasts can escape local cell death and carry the retroviral infection to peripheral organs.


    Introduction
 Top
 Abstract
 Introduction
 uMaterials and Methods
 Results
 Discussion
 References
 
Following encounter with foreign Ag in the presence of T cell help, B cells start proliferating and differentiating into Ab-secreting cells (1). After cognate interaction with T lymphocytes, B cells either migrate to adjacent follicles or to extrafollicular sites of proliferation. In the spleen, extrafollicular B cell proliferation and plasma cell differentiation occur in the periarteriolar lymphocytic sheaths (2, 3, 4). In lymph nodes (LNs),3 extrafollicular plasmablast growth is localized in the medullary cords (5). Ig switch is observed in both germinal center and extrafollicular B cells (6). Although follicular B cell differentiation and germinal center formation have been studied in great detail, the fate of extrafollicularly differentiated B lymphocytes is less well defined. Most of the B cells proliferating in extrafollicular sites have been considered to secrete low affinity Abs and undergo rapid elimination by cell death soon after proliferation (7, 8). Apoptosis has been argued as a mechanism to exclude self-reactive B cells from affinity maturation in germinal centers (9, 10). However, rescue of extrafollicular plasmablasts from apoptosis by interaction with dendritic cells has been reported (11).

In this study, we have undertaken a systematic analysis of the fate of extrafollicularly differentiated plasmablasts in vivo using the Swiss strain (SW) of mouse mammary tumor virus (MMTV) as an antigenic model. After s.c. injection of MMTV into the hind footpad of BALB/c mice, the virus is transported to the draining popliteal (PO)-LN, where it productively infects naive B lymphocytes, which are the main target cells for MMTV infection (12, 13). MMTV(SW)-infected B cells present a viral superantigen (SAg) to V{beta}6+ T cells, which leads to a strong T cell-B cell collaboration. The MMTV SAg-specific B cell response has the characteristics of a classical Ag response in terms of localization, phenotype, Ab secretion, and longevity. Having received cognate SAg-mediated T cell help, infected B cells strongly proliferate and differentiate into extrafollicular plasmablast B cells by day 5, followed by formation of germinal centers by day 10 (5). Extrafollicularly differentiating B cells are large plasmablasts that are localized in the medullary cords of the draining PO-LN and secrete polyclonal, as well as Ag-specific, Abs (5, 14). As previously shown, these cells have down-modulated B220 (CD45R) and are MHC class IIint, IgD-, and syndecan-1 (CD138)high (15). The near-exclusive infection of all plasmablasts 6 days after MMTV infection, together with their phenotypic profile, allowed us to determine whether these cells had entered the recirculating pool of lymphocytes and migrated to peripheral tissues. Because infectious viral particles can be shed by both B and T cells (16), we treated mice after infection with the reverse transcriptase inhibitor AZT to block residual reinfection of peripheral organs (17). Therefore, detection of reverse-transcribed viral DNA in lymphoid and nonlymphoid organs reflected migration of infected cells exported from the draining PO-LN. The essential findings of the present study are: First, B cell plasmablasts leave the medullary cord of the draining PO-LN and carry the virus among other organs to the mammary gland. Second, recruitment of infected B lymphocytes to the periphery is synchronized with extrafollicular and follicular lymphocyte differentiation. Third, MMTV-infected plasmablast B cells express elevated levels of {alpha}4{beta}1 integrin, which can mediate adhesion and entry into peripheral tissues.


    uMaterials and Methods
 Top
 Abstract
 Introduction
 uMaterials and Methods
 Results
 Discussion
 References
 
Mice, viruses, and immunization

BALB/c mice, 6- to 7-wk-old, were obtained from Harlan Olac (Bicester, U.K.). Mtv-7 congenic BALB/c mice (BALB.D2) (18) were bred at the Swiss Institute for Cancer Research (Lausanne, Switzerland). Mice were housed under standard conditions and provided with food and water ad libitum. MMTV(SW) encoding a V{beta}6-specific SAg was recovered from the milk of lactating virus-infected female mice as described previously (12). It was diluted 1:3 in PBS, centrifuged at 600 x g for 10 min to skim and remove cells, and stored in aliquots at -70°C. Mice were injected s.c. into one hind footpad with MMTV(SW) (5 x 107-108 virus particles). Where indicated, mice were i.p. injected with 2 mg AZT (Sigma, St. Louis, MO) 2 days after viral infection or before infection. AZT treatment was continued by dissolving AZT in the drinking water at a concentration of 1 mg AZT/ml water (19).

Flow cytometry and cell separation

The following mAbs were used (When no provider is indicated the antibodies were produced in our laboratory): FITC-conjugated rat anti-CD3 (17A2; BD PharMingen, San Diego, CA), FITC-conjugated anti-B220 (6A3-6B2; Caltag, San Francisco, CA), FITC-conjugated goat anti-rat IgG (polyclonal serum; Caltag), PE-conjugated mouse anti-MHC class II I-E (14-4-4S; BD PharMingen), biotin-conjugated rat anti-mouse syndecan-1 (CD138) (281.2; BD PharMingen), biotin-conjugated hamster anti-mouse CD11c (N418; (20)), biotin-conjugated rat anti-mouse Mac 1 (CD11b) (M1/70; BD PharMingen), biotin-conjugated anti-L-selectin (CD62L) (Mel-14), biotin-conjugated anti-{beta}2 (FD 18.5; (21)), biotin-conjugated anti-{beta}7 (M293) (BD PharMingen), biotin-conjugated anti-{beta}1 (CD29) (HA2/5; BD PharMingen (22)), biotin-conjugated and unconjugated anti-{alpha}4 (clone PS/2, (23); clone R1-2, (24)), biotin-conjugated hamster anti-{alpha} intraepithelial lymphocyte (IEL) (clone 2E7; BD PharMingen), biotin-conjugated hamster anti-{beta}3 (CD61) (clone 2C9.G2; BD PharMingen), Cy-Chrome-conjugated anti-B220 (CD45R) (clone RA3-6B2; BD PharMingen), APC-conjugated anti-B220 (RA3-6B2; BD PharMingen), streptavidin-Cy-Chrome (BD PharMingen), and streptavidin-APC (Molecular Probes, Eugene, OR).

Lymphocytes were preincubated with anti-Fc{gamma}RII mAb (2.4G2; BD Pharmingen) and stained in one step with a mixture of FITC-, PE-, APC-, and biotinylated Abs diluted in PBS/3% FCS. Alternatively, a combination of FITC- and PE- biotinylated and Tricolor-labeled Abs was used. If indicated, staining with anti-integrin mAbs was performed in PBS/3% FCS containing 0.25 mM Mn2+. After incubation, cells were washed and stained with streptavidin-Cy-Chrome or streptavidin-APC. Acquisition was performed by a FACSCalibur (BD Biosciences, Mountain View, CA) cell analyzer. Dead cells were excluded from acquisition. Data were analyzed with CellQuest Software (BD Biosciences).

For separation of B and T cells from secondary lymphoid organs after MMTV infection, tissues were homogenized, and cells were stained with PE-conjugated anti-MHC class II I-E (14-4-4S), biotin-conjugated rat anti-mouse CD11c (N418), and biotin-conjugated rat anti-mouse Mac 1 (M1/70). B cells (FITC-conjugated anti-B220 (6A3-6B2) and T cells (FITC-conjugated anti-CD3; 145-2C11) were stained with the same fluorophore and were identified by the presence (B cells) or absence (T cells) of MHC class II expression. After incubation, cells were washed and stained with streptavidin-Cy-Chrome. B220highMHC class IIhigh, B220lowMHC class IIint, B220highMHC class IIlow, and CD3+ MHC class II- cells were sorted with FACStar (BD Biosciences). Dendritic cells and macrophages were excluded by gating out Cy-Chrome-positive cells.

PCR and virus-specific hybridization

DNA was amplified with the oligonucleotide MS10 (AGGTGGGTCACAATCAACGGC), which reacts with all the open reading frame molecules and with the MMTV(SW)/Mtv-7-specific oligonucleotide VJ83 (GCGACCCCCATGAGTATATTTC) complementary to the long terminal repeat positions 705–725). A total of 500 ng of DNA from cells extracted from the draining PO-LN was analyzed by PCR. The number of cycles used for amplification of viral DNA from nondraining tissue was 26 cycles (1 cycle consisting of 5 min at 94°C, 1 min at 60°C, and 1 min at 72°C; 26 cycles with one cycle consisting of 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C; and finally an extension step for 10 min at 72°C) in 1x PCR buffer containing 20 mM Tris-HCl (pH 8.55), 16 mM (NH4)2SO4, 2.5 mM MgCl2, 150 µg/ml BSA, 0.2 mM of each of the four dNTPs, and 2.5 U of Taq polymerase (Biotaq; Bioprobe International, Richmond, CA); a total of 25 µM of each oligonucleotide was added per PCR. For each experiment, the optimal number of cycles to stay in the linear range was determined. PCR on DNA from draining PO-LN was performed with 22 cycles because the number of infected cells was much higher. A total of 30 cycles of PCR with specific primers for Mtv-6, -8, and -9 were used to quantify DNA isolated from LN cells as described before (15). For FACS-sorted cells, 25 ng (30 cycles) were used. To determine the numbers of viral copies per microgram of DNA, DNA was extracted from lymphocytes derived from BALB.D2 mice containing two copies of the endogenous provirus Mtv-7 per cell. The Sag sequence of Mtv-7 was amplified from 10-fold dilutions of DNA starting with 50 ng DNA mixed with 450 ng DNA of BALB/c mice, keeping the total DNA concentration constant. Results in Fig. 4Go are represented as the amount of BALB.D2 DNA that gives an identical PCR signal or, alternatively, assuming that two to three DNA copies of MMTV are found per infected lymphocyte, we estimated the number of MMTV(SW)-infected cells in 105 total cells. The PCR product was detected by liquid hybridization using a radioactive oligo-probe as follows: 1 µl of specific primer (5'-CAA GGA GGT CTA GCT CTG GCG-3'), 11 µl H2O, 1 µl phosphotyrosine kinase (10 U/µl), 5 µl of [{gamma}32P]ATP (2 pmol/µl), and 2 µl of hybridization buffer (0.5 mM Tris (pH 7.6), 0.1 M MgCl2, 50 mM DTT, 1 mM EDTA, and 1 mM spermidine) were coincubated for 45 min at 37°C. The reaction was stopped by adding 180 µl of 10 mM Tris/0.5 mM EDTA + 1 µl EDTA (0.5 M). The oligo-probe was washed three times by using a Sephadex G50 column (Pharmacia, Uppsala, Sweden), and 1 µl was added to 10 µl PCR product together with 7 µl of H2O and 2 µl of a solution containing 1.5 M NaCl and 25 mM EDTA. The annealing reaction was performed with 1 cycle consisting of 5 min at 98°C and 1 cycle consisting of 15 min at 55°C. PCR products were separated on a 6% denaturing polyacrylamide gel, which was dried and then exposed to Kodak X-OMAT film (Eastman Kodak, Rochester, NY).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 4. MMTV infection in lymphoid and nonlymphoid organs. Three to 24 days after s.c. MMTV(SW) infection into the hind footpad of BALB/c mice, organs were removed and purified DNA was analyzed by 26 cycles of PCR amplifying MMTV(SW) or Mtv-6, -8, and -9. PCR amplification products of mammary gland (A), lung (C), salivary gland (E), thymus (G), and kidney (I) are shown from one representative experiment. The PCR signal was compared with serial dilutions of BALB.D2 DNA. As a second y-axis, the numbers of MMTV(SW) DNA-containing cells per 105 cells was estimated for all organs, assuming that each cell contained two copies of viral DNA (B, D, F, H, and K). The y-axis has a logarithmic scale. Curves represent mean values of three to four organs from individual mice analyzed in independent experiments. Arrows indicate an increase in number of infected cells above 50 infected cells/105 cells. Based on the PCR profiles and infection curves, organs were integrated into five groups as shown in the figure. Identical values of independent experiments are represented by a single point.

 
Immunoprecipitation

Extrafollicular plasmablast B cells were isolated from draining PO-LN 6 days after infection by incubating LN cells with biotinylated anti-syndecan-1 Ab. After washing and incubating with streptavidin-conjugated MACS beads for 15 min at 4°C, lymphocytes were resuspended in PBS/5% FCS. After loading on to a MACS separation column (Miltenyi Biotec, Bergisch Gladbach, Germany) and extensive washing, bound cells were removed from the column in 1 ml PBS and analyzed by flow cytometry. The purity of each cell population collected from columns ranged from 90 to 95%. A total of 107 purified plasmablast B cells were surface labeled by incubating with 5 µl Na[125I] (0.5 mCi) for 20 min in a glass vial coated with 200 µl of iodogen solution (0.5 mg/ml chloroform; Pierce, Rockford, IL) on ice. A total of 500 µl of L-Tyrosin solution (0.3 mg/ml PBS) was added and incubated for several minutes on ice. Cells were washed in 1 ml PBS and lysed in 600 µl lysis buffer (150 mM NaCl, 50 mM Tris (pH 7.5), 1 mM CaCl2, 1 mM MgCl2, 1% Nonidet P-40, and 0.02% NaN3) and EDTA-free protease inhibitors (Boehringer Mannheim, Mannheim, Germany; 1 tablet/10 ml lysis buffer). Insoluble material was removed by centrifugation at 12,000 x g for 15 min. Supernatant was precleared by three sequential 2-h incubations with 60 µl packed protein A-Sepharose (Amersham Pharmacia Biotech, Uppsala, Sweden) conjugated to anti-{beta}1 mAb (HA2/5; 1 µg/20 µl) and anti-{beta}7 mAb (M293; BD PharMingen; 1 µg/20 µl) and a 2-h incubation with unconjugated protein A-Sepharose. The precleared extract was immunoprecipitated with 80 µl protein A-Sepharose coated with anti-{alpha}4 mAb (PS/2; 1 µg/20 µl). Samples were fractionated by 6% SDS-PAGE and visualized by exposure to Kodak X-OMAT film.


    Results
 Top
 Abstract
 Introduction
 uMaterials and Methods
 Results
 Discussion
 References
 
MMTV infection is synchronized with extrafollicular and follicular B cell differentiation in the draining PO-LN

To study the amplification of MMTV in the draining PO-LN during extrafollicular and follicular B cell differentiation, we determined the reverse-transcribed retroviral DNA copies 3–23 days after virus injection. PCR with primers amplifying exogenous MMTV as well as endogenous Mtv-7 sequences were performed from 500 ng DNA extracted from 105 lymphocytes of the PO-LN. The number of copies of DNA from endogenous Mtv-7 is two, and the number from infectious exogenous MMTV sequences is two to three (25). Therefore, serial dilutions of Mtv-7 congenic BALB/c (BALB.D2) DNA mixed with a constant amount of BALB/c DNA were used to allow the estimation of exogenous MMTV DNA in draining PO-LNs (Fig. 1GoB). In parallel, PCR analysis with primers specific for endogenous Mtv-6, -8, and -9 sequences served as internal controls to confirm equal amounts of DNA in each sample (Fig. 1GoA). After MMTV injection into the hind footpad, we observed two peaks of viral amplification in the draining PO-LN. The first one was maximal at day 6 after MMTV infection (Fig. 1GoA), when extrafollicular B cell differentiation in the medullary cords is at a maximum (5, 15). The second peak of viral DNA amplification was at day 11, when follicular differentiation and germinal center reaction of B cells takes place in the draining PO-LN (5).



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 1. MMTV(SW) infection in the draining PO-LN. Three to 23 days after s.c. injection of MMTV(SW) into the hind footpad of BALB/c mice, DNA was isolated from draining PO-LN and 500 ng of DNA was used to perform MMTV(SW)-specific PCR with 22 cycles (A). PCR with specific primers for Mtv-6, -8, and -9 was used to amplify DNA from each sample. As control, serial dilutions (50–0.005 ng) of DNA extracted from BALB.D2 lymphocytes containing the endogenous proviruses Mtv-7 in a constant amount of BALB/c DNA (450 ng) were used in PCR with 22 cycles (B). The experiment was performed four times with similar results.

 
Because peak infection in the draining lymph node occurs around day 5–6 and 11, we attempted to identify the lymphocyte subset being infected 6 and 14 days after MMTV injection in the draining PO-LN. As shown previously and in Fig. 1Go, germinal center reaction peaks around days 10–12 (5). We chose day 14 for PCR analysis because, at this time point, practically no extrafollicular plasmablasts are found in the LN (15). Staining of draining PO-LN cells with Abs to B220 and MHC class II revealed four subsets of lymphocytes: B220low, class IIint, CD3-, CD11c-, Mac1- B cells, which appeared as large blast cells in forward-sideward scatter profiles (15); B cells expressing B220high, class IIhigh, CD3-, CD11c-, Mac1-, which were either naive or activated follicular B cells; CD3+, B220-, class II-, CD11c-, Mac1- T cells; and B220high, class IIlow, CD3-, CD11c-, Mac1- B cells. DNA from equal numbers of sorted cells of these four subsets were analyzed by PCR with primers specific for reverse-transcribed exogenous MMTV. B220low plasmablast B cells were highly infected with MMTV at day 6, whereas only a few small B220high B cells, class IIlow B cells, or T cells contained viral DNA (Fig. 2GoA). The PCR signal was ~1000 times weaker for these cells, indicating that only about one cell in a thousand was infected compared with complete infection of the plasmablasts. However, at day 14 after infection, viral DNA was mainly detectable in DNA extracted from B220high B cells and, to a minor extent, from class IIlow B cells (Fig. 2GoB). These observations supplement our earlier studies, indicating that infected B cells isolated from draining PO-LN 2 wk after MMTV injection are mainly germinal center-derived B cells (26). Therefore, 14 days after infection, follicularly differentiated B cells represent the major reservoir of MMTV in the draining LN, whereas infected plasmablasts are no longer detectable in the draining LN.



View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 2. MMTV(SW) infection in sorted B and T lymphocytes of the draining PO-LN. BALB/c mice were infected with MMTV(SW) into the hind footpad. Six (A) or 14 days (B) later, draining PO-LN cells were isolated, and 25 ng of DNA was derived from FACS-sorted B220low plasmablast B cells, B220high small B cells, CD3+T cells, and class IIlowB220high B cells, all of which were analyzed by MMTV(SW)-specific PCR. As control, serial dilutions (25 ng-0.0025 ng) of DNA extracted from BALB.D2 lymphocytes containing the endogenous provirus Mtv-7 in a constant amount of BALB/c DNA (total amount of BALB. D2 plus BALB/c DNA = 25 ng) were used in PCR with 30 cycles (C). The experiment was performed twice with similar results.

 
Extrafollicularly differentiated B lymphocytes emigrate out of the draining LN in early MMTV infection

Seven days after MMTV infection, the number of B220low plasmablast B cells decreases dramatically in the draining PO-LN (15). Because the total number of B cells diminishes in parallel, it is unlikely that the disappearance of B220low plasmablasts form draining PO-LN was a result of further differentiation rather than a result of local cell death and/or emigration of the cells. The phenotypic profile of MMTV-infected plasmablasts, together with MMTV DNA as a genetic marker, allowed us to address this question and to analyze whether some plasmablasts escaped from in situ cell death and entered the pool of recirculating lymphocytes. To exclude virus transfer from MMTV-infected lymphocytes to noninfected cells in the periphery, BALB/c mice were continuously treated with the reverse transcriptase inhibitor AZT. As demonstrated in earlier studies, AZT treatment efficiently inhibits MMTV replication (19) and therefore prevents virus transmission from infected to noninfected lymphocytes. AZT treatment was started 2 days after infection, when retroviral DNA is not detectable outside the draining LN (15). At this time point, B cells are infected and present a viral SAg to V{beta}6 T cells. This leads to an amplification of infected B cells by receiving T cell help analogous to mice not treated with AZT. DNA was extracted from equal numbers of sorted plasmablasts (B220low), small B cells (B220high), T cells (CD3+), and MHC class IIlow B cells isolated from peripheral lymphoid tissue 6 days after s.c. MMTV infection. Analysis of DNA from axillary LNs, mesenteric LNs, and spleens of MMTV-infected and AZT-treated mice revealed that viral DNA was almost exclusively detectable in DNA extracted from plasmablast B cells (Fig. 3Go). When AZT treatment was started 4 h before MMTV injection, infection of B cells in draining and peripheral LNs was completely inhibited (Fig. 3GoD). This confirms that AZT treatment was efficient and that infected plasmablasts isolated from peripheral tissue were originated from draining PO-LN. When the analogous experiments were performed without AZT treatment 2 days after infection, no significant differences were observed (data not shown). This indicates that, at that time point, neither virus shedding from infected cells nor viremia play a cruical role in infection of peripheral tissue. Taken together, our data clearly show that a significant proportion of extrafollicularly differentiated plasmablasts are able to reach the recirculating lymphocyte pool and transport MMTV to peripheral lymphoid organs.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 3. MMTV(SW) infection in sorted B and T lymphocytes of nondraining LN and spleen. Two days after s.c. MMTV(SW) injection, BALB/c were continuously treated with AZT (3 mg/day). Six days after infection, DNA was isolated from FACS-sorted B220low plasmablast B cells, B220high small B cells, CD3+ T cells, and class IIlowB220high B cells of axillary LN (A), mesenteric LN (B), and spleen (C). A total of 25 ng DNA was used in the PCR. Pretreatment of BALB/c mice with AZT before infection was performed, and DNA was isolated from draining PO-LN and analyzed by PCR (25 ng) with 30 cycles (D). As controls, 25 ng (1), 2.5 ng (2), 0.25ng (3), and 0.025 ng (4) BALB. D2 DNA were diluted with BALB/c DNA to a total amount of 25 ng DNA (E). The experiment was performed twice with similar results.

 
MMTV-infected cells selectively migrate to lymphoid and nonlymphoid organs

Based on these observations, we determined whether recirculating MMTV-infected plasmablasts also entered nonlymphoid organs. Therefore, lymphoid and nonlymphoid organs of BALB/c mice were removed 3–24 days after MMTV infection, and extracted DNA was analyzed by PCR using primers specific for reverse-transcribed exogenous MMTV. Results in the presence or absence of AZT were identical (data not shown). As demonstrated in Fig. 4Go, we observed two major migration patterns. Either infection became detectable just after the emigration of extrafollicular plasmablasts on days 5–6 (Fig. 4Go, B, D, and F) or between days 14 and 20 (Fig. 4Go, H and K). These two major patterns consistently allowed subdivision. In mammary gland and skin, three peaks of infection were found. The first peak appeared 5–6 days after s.c. injection of MMTV, whereas the second was found by day 14 (Fig. 4Go, A and B). At day 24, not only mammary gland and skin, but also all other organs that we had tested, were strongly infected (Fig. 4Go, A–K). In addition, viral DNA containing cells appeared in lung, bone marrow, spleen, axillar, and contralateral PO-LN by day 6 (Fig. 4Go, C and D), and infection was slightly decreased thereafter. However, after the first peak of infection at day 6, a drop of infection was observed in the salivary gland and liver, followed by a second peak of infection on days 18–20 (Fig. 4Go, E and F). These results, together with our preceding observations, demonstrate that, upon MMTV infection, early-infected plasmablasts emigrate out of the draining PO-LN and transport the virus not only to particular lymphoid organs but also to several nonlymphoid organs. By estimating the number of MMTV-infected cells per 105 cells at day 6 of infection, 5–10 x 106 infected cells were found outside the draining LN. MMTV infection in thymus, intestine, Peyer’s patches, mesenteric LNs, and cervical LNs was not observed before day 14 after MMTV injection (Fig. 4Go, G and H). The remaining nonlymphoid organs were infected later, around days 18–24 (Fig. 4Go, I and K). Taken together, these data demonstrate two waves of cellular recruitment, with the first wave appearing by day 6, when MMTV infection is almost exclusively found in extrafollicular plasma blast B cells. These cells transport the virus to the mammary gland, skin, lung, bone marrow, spleen, axillary and contralateral PO-LN, salivary gland, and liver. It has to be pointed out that the mammary gland is a mixed tissue consisting of mammary gland and adipose tissue, but we did not find accumulation of radioactivity in fat tissue. A portion of plasmablasts either dies after infiltrating peripheral organs or reenters the pool of circulating cells. A second wave of migration of MMTV-infected cells appears between days 14–18, when virus is detectable in all lymphocyte subpopulations but predominantly in follicularly differentiated germinal center B cells. These infected lymphocytes infiltrate peripheral tissue and lead to life-long MMTV infection of all organs.

MMTV-infected plasmablast B cells express high levels of {alpha}4 and {beta}1

The striking organ-specificity of MMTV-infected plasmablasts prompted us to investigate whether the expression profile of adhesion molecules on B cells was modulated upon viral infection and SAg-mediated immune response. Using four-color flow cytometry, we analyzed four different populations derived from draining PO-LN 6 days after MMTV-infection (Fig. 5Go): extrafollicular B220lowMHC class IIint plasmablasts (1), follicular B220highMHC class IIhigh B cells (2), B220-MHC class II- non-B cells (3), and B220high/intMHC class IIlow B cells (4). When testing anti-{alpha}4 mAb PS/2 and anti-{beta}1 mAb HA2/5, a small number of B220lowMHC class IIint B cells was detectable in naive animals, and most of them consisted of either {alpha}4-{beta}1- or {alpha}4low{beta}1high cells (Fig. 5GoA). All other lymphocyte populations derived from naive LN were mainly {alpha}4-{beta}1-. We then examined the expression levels of {alpha}4 and {beta}1 on lymphocytes isolated from the draining PO-LN of 6-day-MMTV-infected BALB/c mice (Fig. 5GoB). Interestingly, almost all B220low plasmablast B cells coexpressed {alpha}4 and {beta}1-chains, indicating a noticeable up-regulation of {alpha}4 integrin expression upon MMTV infection. A total of 18.6% of B220highMHC class IIlow cells (4) from MMTV-infected LN coexpressed {alpha}4 and {beta}1, whereas only 4.8% of follicular B cells (2) displayed {alpha}4{beta}1 expression. Similar results were obtained when we performed flow cytometry with anti-{beta}1 mAb 9EG7, which recognizes an epitope of the activated {beta}1-molecule (data not shown). This indicates that {beta}1 was expressed in an activated conformation on plasmablasts. Because extrafollicular plasmablasts have lost migration toward chemokine gradients (27), this observation might also explain tissue migration in the absence of chemokine responsiveness.



View larger version (70K):
[in this window]
[in a new window]
 
FIGURE 5. {alpha}4{beta}1 integrin expression of B cells in the draining PO-LN. Six days after MMTV(SW) infection, total LN cells were analyzed by four-color flow cytometry. Lymphocytes were stained with mAbs to B220, MHC class II I-E, and {alpha}4 (PS/2) and {beta}1 (HA2/5) integrins. After exclusion of dead cells, FACS dot plot shows four populations of cells (delineated on the plot) based on expression levels of B220 and MHC class II: extrafollicular plasmablast B cells (B220lowMHC class IIint) (1), follicular B cells (B220highMHC class IIhigh) (2), non-B cells (B220-MHC class II-) (3), and plasma cells (B220highMHC class IIlow B cells) (4). In forward and side scatter profiles, populations 1 and 4 were identified as large blast cells and 2 and 3 as small cells (data not shown). Gated on plasmablasts (1), follicular B cells (2), non-B cells (3), and plasma cells (4), {alpha}4 and {beta}1 integrin expression was analyzed.

 
We found considerable differences in expression levels of adhesion molecules not only for {alpha}4 and {beta}1 integrin but also for {alpha} IELs, {beta}2-, and {beta}7- chains when plasmablast B cells and B220high B cells from MMTV-infected LNs were compared with naive LN cells (Table IGo). Upon MMTV infection, both B220low plasmablast B cells and B220high B cells had very low levels of {alpha} IELs and {beta}7 and had up-regulated {beta}2 (Table IGo). However, only B220low B cells from MMTV-infected LNs were found to reveal elevated expression levels of syndecan-1. They had also strongly down-modulated L-selectin that corresponds to the activation state of plasmablast B cells. Taken together, our data demonstrate that the MMTV-induced immune response can modulate the pattern of adhesion molecules on activated B cells, explaining the newly acquired migration patterns. Because {beta}1 and {beta}7 integrin chains, the known heterodimer partners of {alpha}4 integrin, did not increase to the same magnitude as {alpha}4 integrin on plasmablast B cells, we investigated whether {alpha}4 was coexpressed with another {beta}-chain or was present alone on MMTV-activated plasmablast B cells. Day 6 plasmablast B cells from MMTV-infected draining PO-LN were purified by magnet separation, surface labeled by iodination, and solubilized, and preclearing was performed with protein A-Sepharose conjugated to anti-{beta}1 and anti-{beta}7 mAbs (Fig. 6Go, lane 1) followed by preclearing with unconjugated protein A-Sepharose (Fig. 6Go, lane 2). The subsequent anti-{alpha}4 immunoprecipitate revealed three prominent species of 152 kDa, 81 kDa, and 61 kDa and a faint band of 130 kDa under nonreducing conditions (Fig. 6Go, lane 3). These correspond to murine {alpha}4 integrin (155 kDa), the two breakdown products of disulfide-linked {alpha}4 integrin (81 kDa and 66 kDa), and {beta}1 integrin (130 kDa). The quantitative differences of {alpha}4 and {beta}1 bands could be presumably explained by different efficiency in iodination of both molecules or, alternatively, in the presence of {alpha}4 homodimers or monomers. Taken together, we were unable to detect a new {beta}-chain associated with {alpha}4 integrin but clearly demonstrate coexpression of {alpha}4{beta}1 integrin heterodimers on almost all plasmablast B cells of MMTV-infected LN.


View this table:
[in this window]
[in a new window]
 
Table I. Expression of adhesion molecules on naive and MMTV-activated B cells1

 


View larger version (105K):
[in this window]
[in a new window]
 
FIGURE 6. Detection of {alpha}4{beta}1 integrin on plasmablast B cells by immunoprecipitation. B220lowMHC class IIint B cells were isolated from day 6 MMTV-infected draining PO-LNs and surface labeled with Na125I. Detergent extracts were precleared with anti-{beta}1 and anti-{beta}7 mAbs (lane 1) or protein A-Sepharose alone (lane 2). Thereafter, cell extracts were immunoprecipitated with anti-{alpha}4 (PS/2) (lane 3). The relative molecular masses (in kDa) are marked.

 

    Discussion
 Top
 Abstract
 Introduction
 uMaterials and Methods
 Results
 Discussion
 References
 
To exploit the fate of extrafollicularly differentiated plasmablast B cells, we studied the differentiation and the migration route of retrovirally infected plasmablasts in mice. Our results demonstrate that, at the peak of differentiation in the medullary cords, MMTV-infected plasmablasts escape from the draining LN and migrate to peripheral sites of the body, but mainly to the mammary gland, skin, lung, liver, and spleen. They have modulated their expression pattern of adhesion molecules with high expression levels of {alpha}4{beta}1 and {beta}2 integrin, indicating a role in entry into target organs.

In vitro and in vivo studies have demonstrated that Ag-stimulated B cells differentiate into enlarged plasmablasts, express syndecan-1, and down-modulate B220 and IgD (28, 29). Although follicular germinal center B cells express normal levels of B220, after secondary stimulation the appearance of B220low B cells has been reported, which most likely belong to germinal center-derived plasma cells (30). In MMTV infection, extrafollicular B cell differentiation takes place before germinal centers develop. This is distinct from conventional T-dependent Ag responses in the draining LN (5) and provided the tool to discriminate extrafollicular from follicular B220low plasmablast B cells. All other parameters of the B cell response after MMTV infection are analogous to classical Ag responses as described before (5).

Because extrafollicular plasmablast B cells have differentiated from naive B cells, which are the major target cells of MMTV infection (5, 13, 15), reverse-transcribed retroviral DNA in B cells is a highly sensitive genetic marker that can be traced by specific PCR. In a PO-LN draining the site of MMTV injection at day 6, ~2 x 106 cells of 2 x 107 total cells were infected (Fig. 1Go). As previously described, B cells but not T cells are the target cells for early MMTV infection in mice (14). Our results demonstrate that, at day 6, >99% of infected cells are plasmablasts, and only 0.1% B220high B cells, CD3+ T cells, or class IIlow cells contain provirus DNA (Fig. 2GoA). This low level of infection in the sorted T cells might represent contaminating B cells. To detect infected B cells distributed all over the body, DNA samples were analyzed by specific hybridization of PCR amplification products. This allowed us to detect five infected plasmablast B cells among 105 total cells of lymphoid or nonlymphoid tissues. Our results confirm that the number of virus-infected plasmablasts in the draining PO-LN dramatically increased by day 6 and were strongly decreased by day 9 (15). This was most likely not a result of further differentiation because the total number of B cells in the draining LN decreased at the same time. In addition, MMTV had no lytic effect on target cells, and, therefore, disappearance of plasmablast B cells could either reflect elimination by cell death of proliferating B cells that had not been positively selected in germinal centers or export of cells out of the draining LN. From earlier studies, it is known that B cells participating in primary immune responses are rapidly eliminated by cell death soon after proliferation (7, 31). Similarly, in vitro-stimulated B cells have been shown to undergo apoptosis after a burst of proliferation (29). However, our results clearly demonstrate that 5–10 x 106 MMTV-infected plasmablast B cells are detectable outside the draining PO-LN (Fig. 3Go), indicating that these cells had escaped from local cell death and emigrated out of the draining LN. By blocking reverse transcription 2 days after infection with AZT, we were able to block reinfection without reducing the SAg response (19). Using this tool, we ruled out that the presence of infected plasmablast B cells outside the primary responding LN was a result of peripheral infection rather than export of infected cells from the draining LN. Although we cannot exclude that most extrafollicular plasmablast B cells underwent apoptosis soon after proliferation, the number of plasmablast B cells that survived was sufficient to transport the virus to peripheral lymphoid and nonlymphoid organs, such as the mammary gland, consisting of glandular and adipose tissue. Germinal center-derived Ab-secreting plasma cells are known to migrate out of the draining LN to the bone marrow (32, 33). However, recirculating Ab-producing B cells are not found in nondraining LN and bone marrow before day 22 after viral infection (34). In contrast to this study, MMTV-primed plasmablast B cells secreting virus-specific Abs (5) were found among total cells of axillary LN, contralateral PO-LN, bone marrow, and spleen (Figs. 3Go and 4Go) and, after enrichment by FACS, were also found in mesenteric LN (Fig. 3Go) by day 6. The discrepancy between the two studies can be explained by the higher frequency of MMTV-infected plasmablasts due to their strong expansion by viral SAg-mediated T cell-B cell collaboration and the highly sensitive method required to trace plasmablast B cell by PCR and virus-specific hybridization. Infected plasmablast B cells appear in the periphery at the same time as extrafollicular B cell proliferation peaks in the draining LN. We postulate that extrafollicularly differentiated plasmablast B cells are no longer retained in the medullary cords of the LN and leave the draining LN via the efferent lymphatics. This hypothesis is supported by the finding that extrafollicular plasmablast B cells have lost responsiveness to homeostatic chemokines and have down-modulated most CC and CXC receptors specific for chemokines secreted in the draining LN (27). Loss of chemokine receptor function has also been observed in developing B cells as well as during differentiation into germinal center B cells (35). Therefore, chemokines that have been shown to arrest naive B cells (36) or attract Ag-primed B cells to the follicle (37, 38) might fail to induce retention of extrafollicular plasmablast B cells.

We have previously demonstrated that the germinal center reaction in the follicles of MMTV-primed LNs started by days 10–12 (5). In our present study, we observed a second peak of viral infection in the draining LN 11 days after MMTV infection (Fig. 1Go). Viral DNA was predominantly found in follicularly differentiating B cells (B220highMHC class IIhigh) and plasma cells (B220high/intMHC class IIlow) (Fig. 2Go). Interestingly, follicular differentiation of B cells was accompanied by export of MMTV infection to lymphoid organs and mucosal tissue (Fig. 4Go, G and H). This was even more striking in the mammary gland, in which we observed a second peak of infection by days 12–14 (Fig. 4Go, A and B). This strongly indicates that two independent waves of emigration of B cells appear during the primary immune response to MMTV. The first is dependent on extrafollicular B cell differentiation in the medullary cords, and the second is at the time when the germinal center reaction occurs. At later time points, all tissue of infected mice contain retroviral proviruses, and infection is maintained for life.

Once plasmablast B cells enter the pool of recirculating lymphocytes around day 6, they migrate to a range of lymphoid and nonlymphoid organs such as the spleen, mammary gland, skin, salivary gland, and lung. The affinity of lymphoblasts to secretory tissue such as mammary and salivary glands has been reported in earlier studies (39, 40). The detection of radioactivity in lactating mammary glands after transfer of radiolabeled rat T cells into naive animals led to the conclusion that T cells play a role in maternal-to-neonatal transfer of immunity (41). However, the in vivo relevance of T cell vs B cell migration to the mammary gland has not been clarified, and studies of naive lymphocytes instead of immunoblasts, as well as cells isolated from lymph or blood instead of lymphoid organs, have to be interpreted with caution. Transfer of both T cells and B cells from MMTV-infected donors to naive recipients was found to induce infection of the mammary gland (42, 43, 44). Whether this was a result of virus shedding, a SAg response, or migration to the mammary gland has not been shown. Here we demonstrate that, in the first weeks after infection, the presence of MMTV DNA in the mammary gland is the result of cellular export of infected B cells from the draining LN and is neither from virus shedding nor recruitment of T cells to the mammary gland. Because only 0.1% of T cells in the draining PO-LN are infected 6 and 14 days after MMTV injection (Fig. 2Go) by virus-specific PCR, we cannot rule out migration of T cells to the mammary gland. However, we found that radiolabeled plasmablast B cells, but not T cells, from draining PO-LN that were at day 6 adoptively transfered into naive recipient mice entered the mammary gland.4 Clearly, tissue-specific homing requires the interaction of adhesion receptors with the corresponding ligand. Therefore, we analyzed the expression profile of homing receptors on plasmablast B cells from MMTV-infected LNs. In the present study, we show first that {alpha}4{beta}1 integrin is expressed on almost all MMTV-infected plasmablast B cells and, second, that expression levels are higher on both plasmablast B cells of MMTV-infected mice compared with rare B220lowMHC class IIint B cells of naive control animals. Mn2+ treatment of cells did not enhance the efficiency of 9EG7 mAb staining, indicating that {alpha}4{beta}1 heterodimer is present on MMTV-infected B cells in the activated conformation (data not shown). The loss of chemokine receptor function and the induction of activated {alpha}4{beta}1 integrin molecules explain the observed migration properties. MMTV infection induced a dramatic increase in {alpha}4 integrin coexpressed with {beta}1 (Fig. 5GoB), whereas, in naive control mice, most plasmablast B cells were either {alpha}4-{beta}1- or expressed {beta}1 integrin without {alpha}4 (Fig. 5GoA). We confirmed by immunoprecipitation that both {alpha}4 and {beta}1 integrins were expressed on plasmablast B cells (Fig. 6Go). We found VCAM-1, a ligand for {alpha}4{beta}1 integrin, to be expressed on mammary gland vascular endothelium, and homing of adoptively transferred plasmablast B cells to the mammary gland was dependent on {alpha}4{beta}1.4 Our data clearly demonstrate that {alpha}{beta} integrin expression can be modulated by MMTV infection. Whether this is a result of viral infection or SAg-mediated T cell-B cell interaction is unclear. In different antigenic models of mice and humans, an altered expression of {alpha}4{beta}7 or {alpha}4{beta}1 on activated/memory B and T cells has been reported (45, 46, 47, 48). Mycobacterium tuberculosis infection leads to expansion of {alpha}4{beta}1high{beta}7-/low cells (49), whereas staphylococcal enterotoxin B induces down-modulation of {alpha}4{beta}1 on activated T cells (50), indicating an influence of the Ag stimulus on integrin expression. Elevated expression of {alpha}4 integrin (CD49d) is not only correlated with a memory phenotype of T cells (51, 52) but is also dependent on the local tissue microenvironment (53) and the differentiation into either type 1 or type 2 lymphokine-secreting subsets (54). Taken together, many pathogens can induce {alpha}4{beta}1 and {alpha}4{beta}7 integrin expression on B and T lymphocytes, but expression levels can differ depending on cellular subsets, localizations, and Ags. Therefore, elevated levels of {alpha}4{beta}1 integrin on plasmablast B cells are not a unique effect of MMTV and, as in other Ag models, can mediate entry of infected cells into tissues that express VCAM-1 on endothelial cells. {beta}1 expression on B lymphocytes plays not only an essential role in homing to particular organs but also in increased cell proliferation and rescue from apoptosis, as demonstrated for T cells (55, 56, 57). Therefore, {alpha}4{beta}1 expression on plasmablast B cells might play a key role in rescue from activation-induced cell death in the draining PO-LN. Additionally, these cells have elevated expression levels of {beta}2 and syndecan-1. The interaction of {alpha}4{beta}1 with VCAM-1 has been shown to increase the avidity of {beta}2 (58), suggesting that migration of extrafollicular plasmablast B cells to peripheral organs is controlled by complex molecular interactions involving cross-talk between different integrins. Because plasmablast B cells have down-modulated L-selectin, the affinity for high endothelial venules in secondary lymphoid organs should be low. We were able to isolate MMTV-infected plasmablast B cells from axillary and mesenteric LNs (Fig. 3Go), indicating entry independent of L-selectin via afferent lymphatics. It must be emphasized that, by analyzing total LN cells 6 days after MMTV infection, viral DNA was detectable only in axillary and contralateral PO-LN but not in mesenteric LN. Therefore, trafficking of extrafollicular plasmablast B cells to secondary lymphoid organs differs in terms of quantity and may be influenced by additional parameters.

How long MMTV-infected plasmablast B cells survive in a particular environment outside the draining LN remains unclear. Studies examining the longevity of plasma cells indicate that a substantial fraction can survive for extended periods of time in bone marrow and spleen (59, 60). These cells have been considered to survive in the absence of Ag and to spontaneously secrete Abs ex vivo (61). Plasma cells that home to the bone marrow in response to the hapten (4-hydroxy-3-nitrophenyl)acetyl have been shown to be selected for high-affinity variants (6, 62). Therefore, the bone marrow seems to play a major role in affinity-driven clonal competition independent of germinal centers. This is supported by the fact that, in germinal center-deficient mice, affinity maturation can occur (63). In a recent manuscript, B220+/-CD138+ B cells have been described as one of three memory B cell subsets that can persist through at least 42 days of a secondary immune response in spleen and bone marrow and secrete specific switched isotype Ab (28). Similarly, B220-CD19+ B cells containing hypermutated Ig genes have been isolated from peripheral blood of quasimonoclonal mouse model (64, 65), indicating that this cell population is circulating.

What is the general consequence of survival of infected B cells for the virus? In many viral infections, B cell differentiation is critical for amplification and persistenc. During EBV infection, activation to the blastoid stage is an essential step in the process of latency. Some activated B cell blasts can exit the cell cycle and reach a resting state, allowing persistence of EBV in these cells (66). We hypothesize that a similar mechanism acts in MMTV infection, allowing survival of some latently infected B cells. In this model, MMTV infection of naive B cells leads to differentiation into cycling extrafollicular B cell blasts. A proportion of these blasts exits the draining LN and enters peripheral tissue via {alpha}4{beta}1, resulting in persistent infection of lymphoid and nonlymphoid tissue. It is possible that these cells exit the cell cycle and belong to a subtype of B220- memory B cells that have been described recently (28). This model is supported by the observation that adoptive transfer of MMTV-infected syngeneic plasmablast B cells in AZT-treated recipient mice leads to a long-lasting deletion of viral SAg-reactive T cells, whereas transfer of allogeneic MMTV SAg-presenting B cells induces a reversible deletion due to rapid elimination of allogenic donor cells (our unpublished observations).

To complete the MMTV life cycle, B cell differentiation requires T cell-B cell collaboration (25, 67, 68). Both B and T cells have been demonstrated to be principally capable of shedding MMTV particles (16). However, in the first two weeks of MMTV infection, we never observed a dramatic increase of viral load in peripheral organs when mice were not treated with AZT. This indicates that infection of peripheral organs reflects emigration of virus-infected cells rather then infection by viremia. Here we show that extrafollicular plasmablast B cells play a key role in carrying retroviral DNA to peripheral nonlymphoid organs such as the mammary gland, skin, lung, salivary gland, and liver. In all of these organs, a large amount of MMTV has been described (69, 70). By days 12–18 of MMTV infection, MMTV infection in the draining LN is mainly localized in germinal center B cells (26). At the same time, a second peak of viral infection appears in mammary gland and skin but also in most other organs. This can be a result of either proliferation and cellular expansion of infected plasmablasts or infiltration by germinal center-derived plasma cells and memory B cells. The explanation we favor is the latter one, because B blasts outside the draining LN are known to be mainly noncycling cells (71).

In summary, our experiments illustrate that a substantial portion of plasmablast B cells differentiated from early MMTV-infected B cells have escaped local cell death in the draining LN and have migrated to peripheral tissue. Homing of these cells to the mammary gland is synchronized with a peak of extrafollicular differentiation in the draining LN, whereas most of the nonlymphoid organs are not infected before germinal center reactions in the follicles occur. MMTV-infected plasmablasts have an expression profile of adhesion molecules with elevated levels of {alpha}4{beta}1, {beta}2, and syndecan-1 but low expression levels of L-selectin. This pattern is unique between all lymphocytes isolated from the draining LN and gives new insights into the mechanism of tissue-specific plasmablast homing.


    Acknowledgments
 
We thank Beat Imhof, Bernhard Holzmann, and Curzio Rüegg for helpful discussions and for providing anti-integrin Abs, Donata Rimoldi for help in the immunoprecipitations, and Anne Wilson for critical reading of the manuscript.


    Footnotes
 
1 This work was supported by Grants 31-32271.94 and 31-59165.99 from the Swiss National Science Foundation. Back

2 Address correspondence and reprint requests to Dr. Hans Acha-Orbea, Ludwig Institute for Cancer Research, Lausanne Branch, Chemin des Boveresses 155, 1066 Epalinges, Switzerland. Back

3 Abbreviations used in this paper: LN, lymph node; SW, Swiss strain; MMTV, mouse mammary tumor virus; SAg, superantigen; PO, popliteal; IEL, intraepithelial lymphocyte. Back

4 D. Finke and H. Acha-Orbea. Differential migration of in vivo primed B and T lymphocytes to lymphoid and nonlymphoid organs. Submitted for publication. Back

Received for publication July 28, 2000. Accepted for publication March 15, 2001.


    References
 Top
 Abstract
 Introduction
 uMaterials and Methods
 Results
 Discussion
 References
 

  1. MacLennan, I. C. M., A. Gulbranson-Judge, K. M. Toellner, M. Casamayor-Palleja, E. Chan, D. M. Sze, S. A. Luther, H. Acha-Orbea. 1997. The changing preference of T and B cells for partners as T-dependent antibody responses develop. Immunol. Rev. 156:53.[Medline]
  2. Liu, Y. J., J. Zhang, P. J. Lane, E. Y. Chan, I. C. M. MacLennan. 1991. Sites of specific B cell activation in primary and secondary responses to T cell-dependent and T cell-independent antigens. Eur. J. Immunol. 21:2951.[Medline]
  3. Jacob, J., R. Kassir, G. Kelsoe. 1991. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. I. The architecture and dynamics of responding cell populations. J. Exp. Med. 173:1165.[Abstract/Free Full Text]
  4. Gulbranson-Judge, A., I. C. M. MacLennan. 1996. Sequential antigen-specific growth of T cells in the T zones and follicles in response to pigeon cytochrome c. Eur. J. Immunol. 26:1830.[Medline]
  5. Luther, S. A., A. Gulbranson-Judge, H. Acha-Orbea, I. C. M. MacLennan. 1997. Viral superantigen drives extrafollicular and follicular B cell differentiation leading to virus-specific antibody production. J. Exp. Med. 185:551.[Abstract/Free Full Text]
  6. Takahashi, Y., P. R. Dutta, D. M. Cerasoli, G. Kelsoe. 1998. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. V. Affinity maturation develops in two stages of clonal selection. J. Exp. Med. 187:885.[Abstract/Free Full Text]
  7. Smith, K. G., T. D. Hewitson, G. J. Nossal, D. M. Tarlinton. 1996. The phenotype and fate of the antibody-forming cells of the splenic foci. Eur. J. Immunol. 26:444.[Medline]
  8. Lalor, P. A., G. J. Nossal, R. D. Sanderson, M. G. McHeyzer-Williams. 1992. Functional and molecular characterization of single, (4-hydroxy-3-nitrophenyl)acetyl (NP)-specific, IgG1+ B cells from antibody-secreting and memory B cell pathways in the C57BL/6 immune response to NP. Eur. J. Immunol. 22:3001.[Medline]
  9. Cyster, J. G., C. C. Goodnow. 1995. Antigen-induced exclusion from follicles and anergy are separate and complementary processes that influence peripheral B cell fate. Immunity 3:691.[Medline]
  10. Pulendran, B., R. van Driel, G. J. Nossal. 1997. Immunological tolerance in germinal centres. Immunol. Today 18:27.[Medline]
  11. Garcia De Vinuesa, C., A. Gulbranson-Judge, M. Khan, P. O’Leary, M. Cascalho, M. Wabl, G. G. Klaus, M. J. Owen, I. C. M. MacLennan. 1999. Dendritic cells associated with plasmablast survival. Eur. J. Immunol. 29:3712.[Medline]
  12. Held, W., A. N. Shakhov, G. Waanders, L. Scarpellino, R. Luethy, J. P. Kraehenbuhl, H. R. MacDonald, H. Acha-Orbea. 1992. An exogenous mouse mammary tumor virus with properties of Mls-1a (Mtv-7). J. Exp. Med. 175:1623.[Abstract/Free Full Text]
  13. Finke, D., L. Mortezavi, H. Acha-Orbea. 1998. Preactivation of B lymphocytes does not enhance mouse mammary tumor virus infection. J. Virol. 72:7688.[Abstract/Free Full Text]
  14. Held, W., A. N. Shakhov, S. Izui, G. A. Waanders, L. Scarpellino, H. R. MacDonald, H. Acha-Orbea. 1993. Superantigen-reactive CD4+ T cells are required to stimulate B cells after infection with mouse mammary tumor virus. J. Exp. Med. 177:359.[Abstract/Free Full Text]
  15. Ardavin, C., P. Martin, I. Ferrero, I. Azcoitia, F. Anjuere, H. Diggelmann, F. Luthi, S. Luther, H. Acha-Orbea. 1999. B cell response after MMTV infection: extrafollicular plasmablasts represent the main infected population and can transmit viral infection. J. Immunol. 162:2538.[Abstract/Free Full Text]
  16. Dzuris, J. L., T. V. Golovkina, S. R. Ross. 1997. Both T and B cells shed infectious mouse mammary tumor virus. J. Virol. 71:6044.[Abstract]
  17. Ruprecht, R. M., L. G. O’Brien, L. D. Rossoni, S. Nusinoff-Lehrman. 1986. Suppression of mouse viraemia and retroviral disease by 3'-azido-3'- deoxythymidine. Nature 323:467.[Medline]
  18. Festenstein, H., L. Berumen. 1984. BALB.D2-Mlsa–a new congenic mouse strain. Transplantation 37:322.[Medline]
  19. Held, W., G. A. Waanders, H. R. MacDonald, H. Acha-Orbea. 1994. Reverse transcriptase-dependent and -independent phase of infection with mouse mammary tumor virus: implication for superantigen function. J. Exp. Med. 180:2347.[Abstract/Free Full Text]
  20. Metlay, J. P., M. D. Witmer-Pack, R. Agger, M. T. Crowley, D. Lawless, R. M. Steinman. 1990. The distinct leukocyte integrins of mouse spleen dendritic cells as identified with new hamster monoclonal antibodies. J. Exp. Med. 171:1753.[Abstract/Free Full Text]
  21. Sarmiento, M., D. P. Dialynas, D. W. Lancki, K. A. Wall, M. I. Lorber, M. R. Loken, F. W. Fitch. 1982. Cloned T lymphocytes and monoclonal antibodies as probes for cell surface molecules active in T cell-mediated cytolysis. Immunol. Rev. 68:135.[Medline]
  22. Mendrick, D. L., D. M. Kelly. 1993. Temporal expression of VLA-2 and modulation of its ligand specificity by rat glomerular epithelial cells in vitro. Lab. Invest. 69:690.[Medline]
  23. Miyake, K., I. L. Weissman, J. S. Greenberger, P. W. Kincade. 1991. Evidence for a role of the integrin VLA-4 in lympho-hemopoiesis. J. Exp. Med. 173:599.[Abstract/Free Full Text]
  24. Holzmann, B., B. W. McIntyre, I. L. Weissman. 1989. Identification of a murine Peyer’s patch-specific lymphocyte homing receptor as an integrin molecule with an {alpha} chain homologous to human VLA-4{alpha}. Cell 56:37.[Medline]
  25. Held, W., G. A. Waanders, A. N. Shakhov, L. Scarpellino, H. Acha-Orbea, H. R. MacDonald. 1993. Superantigen-induced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission. Cell 74:529.[Medline]
  26. Acha-Orbea, H., D. Finke, A. Attinger, S. Schmid, N. Wehrli, S. Vacheron, I. Xenarios, L. Scarpellino, K. M. Toellner, I. C. M. MacLennan, S. A. Luther. 1999. Interplays between mouse mammary tumor virus and the cellular and humoral immune response. Immunol. Rev. 168:287.[Medline]
  27. Wehrli, N., D. F. Legler, D. Finke, K. M. Toellner, P. Loetscher, M. Baggiolini, I. C. M. MacLennan, H. Acha-Orbea. 2001. Changing responsiveness to chemokines allows medullary plasmablasts to leave lymph nodes. Eur. J. Immunol. 31:609.[Medline]
  28. McHeyzer-Williams, L. J., M. Cool, M. G. McHeyzer-Williams. 2000. Antigen-specific B cell memory. Expression and replenishment of a novel B220- memory b cell compartment. J. Exp. Med. 191:1149.[Abstract/Free Full Text]
  29. Dustin, L. B., E. D. Bullock, Y. Hamada, T. Azuma, D. Y. Loh. 1995. Antigen-driven differentiation of naive Ig-transgenic B cells in vitro. J. Immunol. 154:4936.[Abstract]
  30. Han, S., S. R. Dillon, B. Zheng, M. Shimoda, M. S. Schlissel, G. Kelsoe. 1997. V(D)J recombinase activity in a subset of germinal center B lymphocytes. Science 278:301.[Abstract/Free Full Text]
  31. Sprent, J.. 1994. T and B memory cells. Cell 76:315.[Medline]
  32. Tew, J. G., R. M. DiLosa, G. F. Burton, M. H. Kosco, L. I. Kupp, A. Masuda, A. K. Szakal. 1992. Germinal centers and antibody production in bone marrow. Immunol. Rev. 126:99.[Medline]
  33. MacLennan, I. C. M., D. Gray. 1986. Antigen-driven selection of virgin and memory B cells. Immunol. Rev. 91:61.[Medline]
  34. Bachmann, M. F., T. M. Kündig, B. Odermatt, H. Hengartner, R. M. Zinkernagel. 1994. Free recirculation of memory B cells versus antigen-dependent differentiation to antibody-forming cells. J. Immunol. 153:3386.[Abstract]
  35. Bowman, E. P., J. J. Campbell, D. Soler, Z. Dong, N. Manlongat, D. Picarella, R. R. Hardy, E. C. Butcher. 2000. Developmental switches in chemokine response profiles during B cell differentiation and maturation. J. Exp. Med. 191:1303.[Abstract/Free Full Text]
  36. Campbell, J. J., J. Hedrick, A. Zlotnik, M. A. Siani, D. A. Thompson, E. C. Butcher. 1998. Chemokines and the arrest of lymphocytes rolling under flow conditions. Science 279:381.[Abstract/Free Full Text]
  37. Forster, R., A. E. Mattis, E. Kremmer, E. Wolf, G. Brem, M. Lipp. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037.[Medline]
  38. Ngo, V. N., H. L. Tang, J. G. Cyster. 1998. Epstein-Barr virus-induced molecule 1 ligand chemokine is expressed by dendritic cells in lymphoid tissues and strongly attracts naive T cells and activated B cells. J. Exp. Med. 188:181.[Abstract/Free Full Text]
  39. Roux, M. E., M. McWilliams, J. M. Phillips-Quagliata, P. Weisz-Carrington, M. E. Lamm. 1977. Origin of IgA-secreting plasma cells in the mammary gland. J. Exp. Med. 146:1311.[Abstract/Free Full Text]
  40. Manning, L. S., M. J. Parmely. 1980. Cellular determinants of mammary cell-mediated immunity in the rat. I. The migration of radioisotopically labeled T lymphocytes. J. Immunol. 125:2508.[Abstract]
  41. Kumar, S. N., L. L. Seelig, J. R. Head. 1985. Migration of radiolabeled, adoptively transferred T-lymphocytes into the mammary gland and milk of lactating rats. J. Reprod. Immunol. 8:235.[Medline]
  42. Tsubura, A., M. Inaba, S. Imai, A. Murakami, N. Oyaizu, R. Yasumizu, Y. Onishi, H. Tanaka, S. Morii, S. Ikehara. 1988. Intervention of T-cells in transportation of mouse mammary tumor virus (milk factor) to mammary gland cells in vivo. Cancer Res. 48:6555.[Abstract/Free Full Text]
  43. Waanders, G. A., A. N. Shakhov, W. Held, P. Karapetian, H. Acha-Orbea, H. R. MacDonald. 1993. Peripheral T cell activation and deletion induced by transfer of lymphocyte subsets expressing endogenous or exogenous mouse mammary tumor virus. J. Exp. Med. 177:1359.[Abstract/Free Full Text]
  44. Golovkina, T. V., J. P. Dudley, S. R. Ross. 1998. B and T cells are required for mouse mammary tumor virus spread within the mammary gland. J. Immunol. 161:2375.[Abstract/Free Full Text]
  45. Williams, M. B., J. R. Rose, L. S. Rott, M. A. Franco, H. B. Greenberg, E. C. Butcher. 1998. The memory B cell subset responsible for the secretory IgA response and protective humoral immunity to rotavirus expresses the intestinal homing receptor, {alpha}4{beta}7. J. Immunol. 161:4227.[Abstract/Free Full Text]
  46. Kedl, R. M., M. F. Mescher. 1997. Migration and activation of antigen-specific CD8+ T cells upon in vivo stimulation with allogeneic tumor. J. Immunol. 159:650.[Abstract]
  47. Farstad, I. N., T. S. Halstensen, A. I. Lazarovits, J. Norstein, O. Fausa, P. Brandtzaeg. 1995. Human intestinal B-cell blasts and plasma cells express the mucosal homing receptor integrin {alpha}4{beta}7. Scand. J. Immunol. 42:662.[Medline]
  48. Silvy, A., P. Altevogt, P. Mondiere, C. Bella, T. Defrance. 1997. A role for the VLA-4 integrin in the activation of human memory B cells. Eur. J. Immunol. 27:2757.[Medline]
  49. Feng, C. G., W. J. Britton, U. Palendira, N. L. Groat, H. Briscoe, A. G. D. Bean. 2000. Up-regulation of VCAM-1 and differential expansion of {beta} integrin-expressing T lymphocytes are associated with immunity to pulmonary Mycobacterium tuberculosis infection. J. Immunol. 164:4853.[Abstract/Free Full Text]
  50. Hernandez-Caselles, T., M. Martinez-Esparza, A. I. Lazarovits, P. Aparicio. 1996. Specific regulation of VLA-4 and {alpha}4{beta}7 integrin expression on human activated T lymphocytes. J. Immunol. 156:3668.[Abstract]
  51. Hamann, A., K. Klugewitz, F. Austrup, D. Jablonski-Westrich. 2000. Activation induces rapid and profound alterations in the trafficking of T cells. Eur. J. Immunol. 30:3207.[Medline]
  52. Williams, M. B., E. C. Butcher. 1997. Homing of naive and memory T lymphocyte subsets to Peyer’s patches, lymph nodes, and spleen. J. Immunol. 159:1746.[Abstract]
  53. Baumgarth, N., A. Kelsoe. 1996. Functionally distinct T cells in three compartments of the respiratory tract after influenza virus infection. Eur. J. Immunol. 26:2189.[Medline]
  54. Wirth, S., M. van den Broek, C. P. Frossard, A. W. Hügin, I. Leblond, H. Pircher, C. Hauser. 2000. CD8+ T cells secreting type 2 lymphokines are defective in protection against viral infection. Cell. Immunol. 202:13.[Medline]
  55. Matsuyama, T., A. Yamada, J. Kay, K. M. Yamada, S. K. Akiyama, S. F. Schlossman, C. Morimoto. 1989. Activation of CD4 cells by fibronectin and anti-CD3 antibody: a synergistic effect mediated by the VLA-5 fibronectin receptor complex. J. Exp. Med. 170:1133.[Abstract/Free Full Text]
  56. Rich, S., N. Van Nood, H. M. Lee. 1996. Role of {alpha}5{beta}1 integrin in TGF-{beta}1-costimulated CD8+ T cell growth and apoptosis. J. Immunol. 157:2916.[Abstract]
  57. Aoudjit, F., K. Vuori. 2000. Engagement of the {alpha}2{beta}1 integrin inhibits Fas ligand expression and activation-induced cell death in T cells in a focal adhesion kinase-dependent manner. Blood 95:2044.[Abstract/Free Full Text]
  58. Chan, J. R., S. J. Hyduk, M. I. Cybulsky. 2000. {alpha}4{beta}1 integrin/VCAM-1 interaction activates {alpha}L{beta}2 integrin-mediated adhesion to ICAM-1 in human T cells. J. Immunol. 164:746.[Abstract/Free Full Text]
  59. Manz, R. A., A. Thiel, A. Radbruch. 1997. Lifetime of plasma cells in the bone marrow. Nature 388:133.[Medline]
  60. Slifka, M. K., R. Antia, J. K. Whitmire, R. Ahmed. 1998. Humoral immunity due to long-lived plasma cells. Immunity 8:363.[Medline]
  61. Manz, R. A., M. Lohning, G. Cassese, A. Thiel, A. Radbruch. 1998. Survival of long-lived plasma cells is independent of antigen. Int. Immunol. 10:1703.[Abstract/Free Full Text]
  62. Smith, K. G., A. Light, G. J. Nossal, D. M. Tarlinton. 1997. The extent of affinity maturation differs between the memory and antibody-forming cell compartments in the primary immune response. EMBO J. 16:2996.[Medline]
  63. Matsumoto, M., S. F. Lo, C. J. Carruthers, J. Min, S. Mariathasan, G. Huang, D. R. Plas, S. M. Martin, R. S. Geha, M. H. Nahm, D. D. Chaplin. 1996. Affinity maturation without germinal centres in lymphotoxin-{alpha}-deficient mice. Nature 382:462.[Medline]
  64. Cascalho, M., A. Ma, S. Lee, L. Masat, M. Wabl. 1996. A quasi-monoclonal mouse. Science 272:1649.[Abstract]
  65. Cascalho, M., J. Wong, J. Brown, H. M. Jack, C. Steinberg, M. Wabl. 2000. A B220-, CD19- population of B cells in the peripheral blood of quasimonoclonal mice. Int. Immunol. 12:29.[Abstract/Free Full Text]
  66. Babcock, G. J., L. L. Decker, M. Volk, D. A. Thorley-Lawson. 1998. EBV persistence in memory B cells in vivo. Immunity 9:395.[Medline]
  67. Beutner, U., E. Kraus, D. Kitamura, K. Rajewsky, B. T. Huber. 1994. B cells are essential for murine mammary tumor virus transmission, but not for presentation of endogenous superantigens. J. Exp. Med. 179:1457.[Abstract/Free Full Text]
  68. Champagne, E., L. Scarpellino, P. Lane, H. Acha-Orbea. 1996. CD28/CTLA4-B7 interaction is dispensable for T cell stimulation by mouse mammary tumor virus superantigen but not for B cell differentiation and virus dissemination. Eur. J. Immunol. 26:1595.[Medline]
  69. Imai, S., J. Morimoto, Y. Tsubura, Y. Iwai, M. Okumoto, Y. Takamori, A. Tsubura, J. Hilgers. 1983. Tissue and organ distribution of mammary tumor virus antigens in low and high mammary cancer strain mice. Eur. J. Cancer Clin. Oncol. 19:1011.[Medline]
  70. Rollini, P., J. Billotte, E. Kolb, H. Diggelmann. 1992. Expression pattern of mouse mammary tumor virus in transgenic mice carrying exogenous proviruses of different origins. J. Virol. 66:4580.[Abstract/Free Full Text]
  71. Babcock, G. J., L. L. Decker, R. B. Freeman, D. A. Thorley-Lawson. 1999. Epstein-Barr virus-infected resting memory B cells, not proliferating lymphoblasts, accumulate in the peripheral blood of immunosuppressed patients. J. Exp. Med. 190:567.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. Racine, M. Chatterjee, and G. M. Winslow
CD11c Expression Identifies a Population of Extrafollicular Antigen-Specific Splenic Plasmablasts Responsible for CD4 T-Independent Antibody Responses during Intracellular Bacterial Infection
J. Immunol., July 15, 2008; 181(2): 1375 - 1385.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. S. Bromage, I. M. Kaattari, P. Zwollo, and S. L. Kaattari
Plasmablast and Plasma Cell Production and Distribution in Trout Immune Tissues
J. Immunol., December 15, 2004; 173(12): 7317 - 7323.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Marafioti, M. Jones, F. Facchetti, T. C. Diss, M.-Q. Du, P. G. Isaacson, M. Pozzobon, S. A. Pileri, A. J. Strickson, S.-Y. Tan, et al.
Phenotype and genotype of interfollicular large B cells, a subpopulation of lymphocytes often with dendritic morphology
Blood, October 15, 2003; 102(8): 2868 - 2876.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Mpandi, L. A. Otten, C. Lavanchy, H. Acha-Orbea, and D. Finke
Passive Immunization with Neutralizing Antibodies Interrupts the Mouse Mammary Tumor Virus Life Cycle
J. Virol., September 1, 2003; 77(17): 9369 - 9377.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Finke, S. A. Luther, and H. Acha-Orbea
The role of neutralizing antibodies for mouse mammary tumor virus transmission and mammary cancer development
PNAS, January 7, 2003; 100(1): 199 - 204.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Finke, D.
Right arrow Articles by Acha-Orbea, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Finke, D.
Right arrow Articles by Acha-Orbea, H.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS