The Journal of Immunology, 2001, 166: 6266-6275.
Copyright © 2001 by The American Association of Immunologists
Extrafollicular Plasmablast B Cells Play a Key Role in Carrying Retroviral Infection to Peripheral Organs1
Daniela Finke*,
Frédéric Baribaud
,
Heidi Diggelmann
and
Hans Acha-Orbea2,*,
*
Ludwig Institute for Cancer Research, Lausanne Branch, and
Institute of Biochemistry, University of Lausanne, Epalinges, Switzerland; and
Institute for Microbiology, University Hospital of Lausanne, Lausanne, Switzerland
 |
Abstract
|
|---|
B cells can either differentiate in germinal centers or in
extrafollicular compartments of secondary lymphoid organs. Here we show
the migration properties of B cells after differentiation in murine
peripheral lymph node infected with mouse mammary tumor virus. Naive B
cells become activated, infected, and carry integrated retroviral DNA
sequences. After production of a retroviral superantigen, the infected
B cells receive cognate T cell help and differentiate along the two
main differentiation pathways analogous to classical Ag responses. The
extrafollicular differentiation peaks on day 6 of mouse mammary tumor
virus infection, and the follicular one becomes detectable after day
10. B cells participating in this immune response carry a retroviral
DNA marker that can be detected by using semiquantitative PCR. We
determined the migration patterns of B cells having taken part in the T
cell-B cell interaction from the draining lymph node to different
tissues. Waves of immigration and retention of infected cells in
secondary lymphoid organs, mammary gland, salivary gland, skin, lung,
and liver were observed correlating with the two peaks of B cell
differentiation in the draining lymph node. Other organs revealed
immigration of infected cells at later time points. The migration
properties were correlated with a strong up-regulation of
4
1 integrin expression. These results
show the migration properties of B cells during an immune response and
demonstrate that a large proportion of extrafolliculary differentiating
plasmablasts can escape local cell death and carry the retroviral
infection to peripheral organs.
 |
Introduction
|
|---|
Following
encounter with foreign Ag in the presence of T cell help, B cells start
proliferating and differentiating into Ab-secreting cells
(1). After cognate interaction with T lymphocytes, B cells
either migrate to adjacent follicles or to extrafollicular sites of
proliferation. In the spleen, extrafollicular B cell proliferation and
plasma cell differentiation occur in the periarteriolar lymphocytic
sheaths (2, 3, 4). In lymph nodes
(LNs),3
extrafollicular plasmablast growth is localized in the medullary cords
(5). Ig switch is observed in both germinal center and
extrafollicular B cells (6). Although follicular B cell
differentiation and germinal center formation have been studied in
great detail, the fate of extrafollicularly differentiated B
lymphocytes is less well defined. Most of the B cells proliferating in
extrafollicular sites have been considered to secrete low affinity Abs
and undergo rapid elimination by cell death soon after proliferation
(7, 8). Apoptosis has been argued as a mechanism to
exclude self-reactive B cells from affinity maturation in germinal
centers (9, 10). However, rescue of extrafollicular
plasmablasts from apoptosis by interaction with dendritic cells has
been reported (11).
In this study, we have undertaken a systematic analysis of the fate of
extrafollicularly differentiated plasmablasts in vivo using the Swiss
strain (SW) of mouse mammary tumor virus (MMTV) as an antigenic
model. After s.c. injection of MMTV into the hind footpad of BALB/c
mice, the virus is transported to the draining popliteal (PO)-LN, where
it productively infects naive B lymphocytes, which are the main target
cells for MMTV infection (12, 13). MMTV(SW)-infected B
cells present a viral superantigen (SAg) to
V
6+ T cells, which leads to a strong T cell-B
cell collaboration. The MMTV SAg-specific B cell response has the
characteristics of a classical Ag response in terms of localization,
phenotype, Ab secretion, and longevity. Having received cognate
SAg-mediated T cell help, infected B cells strongly proliferate and
differentiate into extrafollicular plasmablast B cells by day 5,
followed by formation of germinal centers by day 10 (5).
Extrafollicularly differentiating B cells are large plasmablasts that
are localized in the medullary cords of the draining PO-LN and secrete
polyclonal, as well as Ag-specific, Abs (5, 14). As
previously shown, these cells have down-modulated B220 (CD45R) and are
MHC class IIint, IgD-, and
syndecan-1 (CD138)high (15). The
near-exclusive infection of all plasmablasts 6 days after MMTV
infection, together with their phenotypic profile, allowed us to
determine whether these cells had entered the recirculating pool of
lymphocytes and migrated to peripheral tissues. Because infectious
viral particles can be shed by both B and T cells (16), we
treated mice after infection with the reverse transcriptase inhibitor
AZT to block residual reinfection of peripheral organs
(17). Therefore, detection of reverse-transcribed viral
DNA in lymphoid and nonlymphoid organs reflected migration of infected
cells exported from the draining PO-LN. The essential findings of the
present study are: First, B cell plasmablasts leave the medullary cord
of the draining PO-LN and carry the virus among other organs to the
mammary gland. Second, recruitment of infected B lymphocytes to the
periphery is synchronized with extrafollicular and follicular
lymphocyte differentiation. Third, MMTV-infected plasmablast B cells
express elevated levels of
4
1 integrin, which
can mediate adhesion and entry into peripheral tissues.
 |
uMaterials and Methods
|
|---|
Mice, viruses, and immunization
BALB/c mice, 6- to 7-wk-old, were obtained from Harlan Olac
(Bicester, U.K.). Mtv-7 congenic BALB/c mice (BALB.D2)
(18) were bred at the Swiss Institute for Cancer Research
(Lausanne, Switzerland). Mice were housed under standard conditions and
provided with food and water ad libitum. MMTV(SW) encoding a
V
6-specific SAg was recovered from the milk of lactating
virus-infected female mice as described previously (12).
It was diluted 1:3 in PBS, centrifuged at 600 x g for
10 min to skim and remove cells, and stored in aliquots at -70°C.
Mice were injected s.c. into one hind footpad with MMTV(SW) (5 x
107-108 virus particles).
Where indicated, mice were i.p. injected with 2 mg AZT (Sigma, St.
Louis, MO) 2 days after viral infection or before infection. AZT
treatment was continued by dissolving AZT in the drinking water at a
concentration of 1 mg AZT/ml water (19).
Flow cytometry and cell separation
The following mAbs were used (When no provider is indicated the
antibodies were produced in our laboratory): FITC-conjugated rat
anti-CD3 (17A2; BD PharMingen, San Diego, CA), FITC-conjugated
anti-B220 (6A3-6B2; Caltag, San Francisco, CA), FITC-conjugated
goat anti-rat IgG (polyclonal serum; Caltag), PE-conjugated mouse
anti-MHC class II I-E (14-4-4S; BD PharMingen), biotin-conjugated
rat anti-mouse syndecan-1 (CD138) (281.2; BD PharMingen),
biotin-conjugated hamster anti-mouse CD11c (N418;
(20)), biotin-conjugated rat anti-mouse Mac 1 (CD11b)
(M1/70; BD PharMingen), biotin-conjugated
anti-L-selectin (CD62L) (Mel-14), biotin-conjugated
anti-
2 (FD 18.5; (21)),
biotin-conjugated anti-
7 (M293) (BD
PharMingen), biotin-conjugated anti-
1 (CD29)
(HA2/5; BD PharMingen (22)), biotin-conjugated and
unconjugated anti-
4 (clone PS/2,
(23); clone R1-2, (24)), biotin-conjugated
hamster anti-
intraepithelial lymphocyte (IEL) (clone 2E7; BD
PharMingen), biotin-conjugated hamster anti-
3 (CD61)
(clone 2C9.G2; BD PharMingen), Cy-Chrome-conjugated anti-B220
(CD45R) (clone RA3-6B2; BD PharMingen), APC-conjugated anti-B220
(RA3-6B2; BD PharMingen), streptavidin-Cy-Chrome (BD PharMingen),
and streptavidin-APC (Molecular Probes, Eugene, OR).
Lymphocytes were preincubated with anti-Fc
RII mAb (2.4G2; BD
Pharmingen) and stained in one step with a mixture of FITC-, PE-,
APC-, and biotinylated Abs diluted in PBS/3% FCS. Alternatively, a
combination of FITC- and PE- biotinylated and Tricolor-labeled Abs was
used. If indicated, staining with anti-integrin mAbs was performed
in PBS/3% FCS containing 0.25 mM Mn2+. After
incubation, cells were washed and stained with streptavidin-Cy-Chrome
or streptavidin-APC. Acquisition was performed by a FACSCalibur (BD
Biosciences, Mountain View, CA) cell analyzer. Dead cells were excluded
from acquisition. Data were analyzed with CellQuest Software (BD
Biosciences).
For separation of B and T cells from secondary lymphoid organs after
MMTV infection, tissues were homogenized, and cells were stained with
PE-conjugated anti-MHC class II I-E (14-4-4S), biotin-conjugated
rat anti-mouse CD11c (N418), and biotin-conjugated rat
anti-mouse Mac 1 (M1/70). B cells (FITC-conjugated anti-B220
(6A3-6B2) and T cells (FITC-conjugated anti-CD3; 145-2C11) were
stained with the same fluorophore and were identified by the presence
(B cells) or absence (T cells) of MHC class II expression. After
incubation, cells were washed and stained with streptavidin-Cy-Chrome.
B220highMHC class IIhigh,
B220lowMHC class IIint,
B220highMHC class IIlow,
and CD3+ MHC class II-
cells were sorted with FACStar (BD Biosciences). Dendritic cells and
macrophages were excluded by gating out Cy-Chrome-positive cells.
PCR and virus-specific hybridization
DNA was amplified with the oligonucleotide MS10
(AGGTGGGTCACAATCAACGGC), which reacts with all the open reading
frame molecules and with the MMTV(SW)/Mtv-7-specific
oligonucleotide VJ83 (GCGACCCCCATGAGTATATTTC) complementary to the
long terminal repeat positions 705725). A total of 500 ng of DNA from
cells extracted from the draining PO-LN was analyzed by PCR. The number
of cycles used for amplification of viral DNA from nondraining tissue
was 26 cycles (1 cycle consisting of 5 min at 94°C, 1 min at 60°C,
and 1 min at 72°C; 26 cycles with one cycle consisting of 30 s
at 94°C, 30 s at 60°C, and 30 s at 72°C; and finally an
extension step for 10 min at 72°C) in 1x PCR buffer containing 20 mM
Tris-HCl (pH 8.55), 16 mM
(NH4)2SO4,
2.5 mM MgCl2, 150 µg/ml BSA, 0.2 mM of each of
the four dNTPs, and 2.5 U of Taq polymerase (Biotaq;
Bioprobe International, Richmond, CA); a total of 25 µM of each
oligonucleotide was added per PCR. For each experiment, the optimal
number of cycles to stay in the linear range was determined. PCR on DNA
from draining PO-LN was performed with 22 cycles because the number of
infected cells was much higher. A total of 30 cycles of PCR with
specific primers for Mtv-6, -8, and -9 were used
to quantify DNA isolated from LN cells as described before
(15). For FACS-sorted cells, 25 ng (30 cycles) were used.
To determine the numbers of viral copies per microgram of DNA, DNA was
extracted from lymphocytes derived from BALB.D2 mice containing two
copies of the endogenous provirus Mtv-7 per cell. The Sag
sequence of Mtv-7 was amplified from 10-fold dilutions of
DNA starting with 50 ng DNA mixed with 450 ng DNA of BALB/c mice,
keeping the total DNA concentration constant. Results in Fig. 4
are
represented as the amount of BALB.D2 DNA that gives an identical PCR
signal or, alternatively, assuming that two to three DNA copies of MMTV
are found per infected lymphocyte, we estimated the number of
MMTV(SW)-infected cells in 105 total cells. The
PCR product was detected by liquid hybridization using a radioactive
oligo-probe as follows: 1 µl of specific primer (5'-CAA GGA GGT CTA
GCT CTG GCG-3'), 11 µl H2O, 1 µl phosphotyrosine kinase
(10 U/µl), 5 µl of [
32P]ATP (2 pmol/µl), and 2
µl of hybridization buffer (0.5 mM Tris (pH 7.6), 0.1 M
MgCl2, 50 mM DTT, 1 mM EDTA, and 1 mM spermidine)
were coincubated for 45 min at 37°C. The reaction was stopped by
adding 180 µl of 10 mM Tris/0.5 mM EDTA + 1 µl EDTA (0.5 M). The
oligo-probe was washed three times by using a Sephadex G50 column
(Pharmacia, Uppsala, Sweden), and 1 µl was added to 10 µl PCR
product together with 7 µl of H2O and 2 µl of
a solution containing 1.5 M NaCl and 25 mM EDTA. The annealing reaction
was performed with 1 cycle consisting of 5 min at 98°C and 1 cycle
consisting of 15 min at 55°C. PCR products were separated on a 6%
denaturing polyacrylamide gel, which was dried and then exposed to
Kodak X-OMAT film (Eastman Kodak, Rochester, NY).

View larger version (35K):
[in this window]
[in a new window]
|
FIGURE 4. MMTV infection in lymphoid and nonlymphoid organs. Three to 24 days
after s.c. MMTV(SW) infection into the hind footpad of BALB/c mice,
organs were removed and purified DNA was analyzed by 26 cycles of PCR
amplifying MMTV(SW) or Mtv-6, -8, and -9.
PCR amplification products of mammary gland (A), lung
(C), salivary gland (E), thymus
(G), and kidney (I) are shown from one
representative experiment. The PCR signal was compared with serial
dilutions of BALB.D2 DNA. As a second y-axis, the
numbers of MMTV(SW) DNA-containing cells per 105 cells was
estimated for all organs, assuming that each cell contained two copies
of viral DNA (B, D, F,
H, and K). The y-axis has
a logarithmic scale. Curves represent mean values of three to four
organs from individual mice analyzed in independent experiments. Arrows
indicate an increase in number of infected cells above 50 infected
cells/105 cells. Based on the PCR profiles and infection
curves, organs were integrated into five groups as shown in the figure.
Identical values of independent experiments are represented by a single
point.
|
|
Immunoprecipitation
Extrafollicular plasmablast B cells were isolated from draining
PO-LN 6 days after infection by incubating LN cells with biotinylated
anti-syndecan-1 Ab. After washing and incubating with
streptavidin-conjugated MACS beads for 15 min at 4°C, lymphocytes
were resuspended in PBS/5% FCS. After loading on to a MACS separation
column (Miltenyi Biotec, Bergisch Gladbach, Germany) and extensive
washing, bound cells were removed from the column in 1 ml PBS and
analyzed by flow cytometry. The purity of each cell population
collected from columns ranged from 90 to 95%. A total of
107 purified plasmablast B cells were surface
labeled by incubating with 5 µl Na[125I] (0.5 mCi) for
20 min in a glass vial coated with 200 µl of iodogen solution (0.5
mg/ml chloroform; Pierce, Rockford, IL) on ice. A total of 500 µl of
L-Tyrosin solution (0.3 mg/ml PBS) was added and incubated
for several minutes on ice. Cells were washed in 1 ml PBS and lysed in
600 µl lysis buffer (150 mM NaCl, 50 mM Tris (pH 7.5), 1 mM
CaCl2, 1 mM MgCl2, 1%
Nonidet P-40, and 0.02% NaN3) and EDTA-free
protease inhibitors (Boehringer Mannheim, Mannheim, Germany; 1
tablet/10 ml lysis buffer). Insoluble material was removed by
centrifugation at 12,000 x g for 15 min. Supernatant
was precleared by three sequential 2-h incubations with 60 µl packed
protein A-Sepharose (Amersham Pharmacia Biotech, Uppsala, Sweden)
conjugated to anti-
1 mAb (HA2/5; 1 µg/20
µl) and anti-
7 mAb (M293; BD PharMingen;
1 µg/20 µl) and a 2-h incubation with unconjugated protein
A-Sepharose. The precleared extract was immunoprecipitated with 80 µl
protein A-Sepharose coated with anti-
4 mAb
(PS/2; 1 µg/20 µl). Samples were fractionated by 6% SDS-PAGE and
visualized by exposure to Kodak X-OMAT film.
 |
Results
|
|---|
MMTV infection is synchronized with extrafollicular and follicular
B cell differentiation in the draining PO-LN
To study the amplification of MMTV in the draining PO-LN during
extrafollicular and follicular B cell differentiation, we determined
the reverse-transcribed retroviral DNA copies 323 days after virus
injection. PCR with primers amplifying exogenous MMTV as well as
endogenous Mtv-7 sequences were performed from 500 ng DNA
extracted from 105 lymphocytes of the PO-LN. The
number of copies of DNA from endogenous Mtv-7 is two, and
the number from infectious exogenous MMTV sequences is two to three
(25). Therefore, serial dilutions of Mtv-7
congenic BALB/c (BALB.D2) DNA mixed with a constant amount of BALB/c
DNA were used to allow the estimation of exogenous MMTV DNA in draining
PO-LNs (Fig. 1
B). In parallel,
PCR analysis with primers specific for endogenous Mtv-6, -8,
and -9 sequences served as internal controls to confirm
equal amounts of DNA in each sample (Fig. 1
A). After MMTV
injection into the hind footpad, we observed two peaks of viral
amplification in the draining PO-LN. The first one was maximal at day 6
after MMTV infection (Fig. 1
A), when extrafollicular B cell
differentiation in the medullary cords is at a maximum (5, 15). The second peak of viral DNA amplification was at day 11,
when follicular differentiation and germinal center reaction of B cells
takes place in the draining PO-LN (5).

View larger version (42K):
[in this window]
[in a new window]
|
FIGURE 1. MMTV(SW) infection in the draining PO-LN. Three to 23 days after s.c.
injection of MMTV(SW) into the hind footpad of BALB/c mice, DNA was
isolated from draining PO-LN and 500 ng of DNA was used to perform
MMTV(SW)-specific PCR with 22 cycles (A). PCR with
specific primers for Mtv-6, -8, and -9
was used to amplify DNA from each sample. As control, serial dilutions
(500.005 ng) of DNA extracted from BALB.D2 lymphocytes containing the
endogenous proviruses Mtv-7 in a constant amount of
BALB/c DNA (450 ng) were used in PCR with 22 cycles (B).
The experiment was performed four times with similar results.
|
|
Because peak infection in the draining lymph node occurs around day
56 and 11, we attempted to identify the lymphocyte subset being
infected 6 and 14 days after MMTV injection in the draining PO-LN. As
shown previously and in Fig. 1
, germinal center reaction peaks around
days 1012 (5). We chose day 14 for PCR analysis because,
at this time point, practically no extrafollicular plasmablasts are
found in the LN (15). Staining of draining PO-LN cells
with Abs to B220 and MHC class II revealed four subsets of lymphocytes:
B220low, class IIint,
CD3-, CD11c-,
Mac1- B cells, which appeared as large blast
cells in forward-sideward scatter profiles (15); B cells
expressing B220high, class
IIhigh, CD3-,
CD11c-, Mac1-, which were
either naive or activated follicular B cells;
CD3+, B220-, class
II-, CD11c-,
Mac1- T cells; and
B220high, class IIlow,
CD3-, CD11c-,
Mac1- B cells. DNA from equal numbers of sorted
cells of these four subsets were analyzed by PCR with primers specific
for reverse-transcribed exogenous MMTV. B220low
plasmablast B cells were highly infected with MMTV at day 6, whereas
only a few small B220high B cells, class
IIlow B cells, or T cells contained viral DNA
(Fig. 2
A). The PCR signal was
1000 times weaker for these cells, indicating that only about one
cell in a thousand was infected compared with complete infection of the
plasmablasts. However, at day 14 after infection, viral DNA was mainly
detectable in DNA extracted from B220high B cells
and, to a minor extent, from class IIlow B cells
(Fig. 2
B). These observations supplement our earlier
studies, indicating that infected B cells isolated from draining PO-LN
2 wk after MMTV injection are mainly germinal center-derived B cells
(26). Therefore, 14 days after infection, follicularly
differentiated B cells represent the major reservoir of MMTV in the
draining LN, whereas infected plasmablasts are no longer detectable in
the draining LN.

View larger version (56K):
[in this window]
[in a new window]
|
FIGURE 2. MMTV(SW) infection in sorted B and T lymphocytes of the draining PO-LN.
BALB/c mice were infected with MMTV(SW) into the hind footpad. Six
(A) or 14 days (B) later, draining PO-LN
cells were isolated, and 25 ng of DNA was derived from FACS-sorted
B220low plasmablast B cells, B220high small B
cells, CD3+T cells, and class
IIlowB220high B cells, all of which were
analyzed by MMTV(SW)-specific PCR. As control, serial dilutions (25
ng-0.0025 ng) of DNA extracted from BALB.D2 lymphocytes containing the
endogenous provirus Mtv-7 in a constant amount of BALB/c
DNA (total amount of BALB. D2 plus BALB/c DNA = 25 ng) were used
in PCR with 30 cycles (C). The experiment was performed
twice with similar results.
|
|
Extrafollicularly differentiated B lymphocytes emigrate out of the
draining LN in early MMTV infection
Seven days after MMTV infection, the number of
B220low plasmablast B cells decreases
dramatically in the draining PO-LN (15). Because the total
number of B cells diminishes in parallel, it is unlikely that the
disappearance of B220low plasmablasts form
draining PO-LN was a result of further differentiation rather than a
result of local cell death and/or emigration of the cells. The
phenotypic profile of MMTV-infected plasmablasts, together with MMTV
DNA as a genetic marker, allowed us to address this question and to
analyze whether some plasmablasts escaped from in situ cell death and
entered the pool of recirculating lymphocytes. To exclude virus
transfer from MMTV-infected lymphocytes to noninfected cells in the
periphery, BALB/c mice were continuously treated with the reverse
transcriptase inhibitor AZT. As demonstrated in earlier studies, AZT
treatment efficiently inhibits MMTV replication (19) and
therefore prevents virus transmission from infected to noninfected
lymphocytes. AZT treatment was started 2 days after infection, when
retroviral DNA is not detectable outside the draining LN
(15). At this time point, B cells are infected and present
a viral SAg to V
6 T cells. This leads to an amplification of
infected B cells by receiving T cell help analogous to mice not treated
with AZT. DNA was extracted from equal numbers of sorted plasmablasts
(B220low), small B cells
(B220high), T cells (CD3+),
and MHC class IIlow B cells isolated from
peripheral lymphoid tissue 6 days after s.c. MMTV infection. Analysis
of DNA from axillary LNs, mesenteric LNs, and spleens of MMTV-infected
and AZT-treated mice revealed that viral DNA was almost exclusively
detectable in DNA extracted from plasmablast B cells (Fig. 3
). When AZT treatment was started 4
h before MMTV injection, infection of B cells in draining and
peripheral LNs was completely inhibited (Fig. 3
D). This
confirms that AZT treatment was efficient and that infected
plasmablasts isolated from peripheral tissue were originated from
draining PO-LN. When the analogous experiments were performed without
AZT treatment 2 days after infection, no significant differences were
observed (data not shown). This indicates that, at that time point,
neither virus shedding from infected cells nor viremia play a cruical
role in infection of peripheral tissue. Taken together, our data
clearly show that a significant proportion of extrafollicularly
differentiated plasmablasts are able to reach the recirculating
lymphocyte pool and transport MMTV to peripheral lymphoid organs.

View larger version (47K):
[in this window]
[in a new window]
|
FIGURE 3. MMTV(SW) infection in sorted B and T lymphocytes of nondraining LN and
spleen. Two days after s.c. MMTV(SW) injection, BALB/c were
continuously treated with AZT (3 mg/day). Six days after infection, DNA
was isolated from FACS-sorted B220low plasmablast B cells,
B220high small B cells, CD3+ T cells, and class
IIlowB220high B cells of axillary LN
(A), mesenteric LN (B), and spleen
(C). A total of 25 ng DNA was used in the PCR.
Pretreatment of BALB/c mice with AZT before infection was performed,
and DNA was isolated from draining PO-LN and analyzed by PCR (25 ng)
with 30 cycles (D). As controls, 25 ng
(1), 2.5 ng (2), 0.25ng
(3), and 0.025 ng (4) BALB. D2 DNA were
diluted with BALB/c DNA to a total amount of 25 ng DNA
(E). The experiment was performed twice with similar
results.
|
|
MMTV-infected cells selectively migrate to lymphoid and nonlymphoid
organs
Based on these observations, we determined whether recirculating
MMTV-infected plasmablasts also entered nonlymphoid organs. Therefore,
lymphoid and nonlymphoid organs of BALB/c mice were removed 324 days
after MMTV infection, and extracted DNA was analyzed by PCR using
primers specific for reverse-transcribed exogenous MMTV. Results in the
presence or absence of AZT were identical (data not shown). As
demonstrated in Fig. 4
, we observed two
major migration patterns. Either infection became detectable just after
the emigration of extrafollicular plasmablasts on days 56 (Fig. 4
, B, D, and F) or between days 14 and 20 (Fig. 4
, H and K). These two major patterns consistently
allowed subdivision. In mammary gland and skin, three peaks of
infection were found. The first peak appeared 56 days after s.c.
injection of MMTV, whereas the second was found by day 14 (Fig. 4
, A and B). At day 24, not only mammary gland and
skin, but also all other organs that we had tested, were strongly
infected (Fig. 4
, AK). In addition, viral DNA containing
cells appeared in lung, bone marrow, spleen, axillar, and contralateral
PO-LN by day 6 (Fig. 4
, C and D), and infection
was slightly decreased thereafter. However, after the first peak of
infection at day 6, a drop of infection was observed in the salivary
gland and liver, followed by a second peak of infection on days 1820
(Fig. 4
, E and F). These results, together with
our preceding observations, demonstrate that, upon MMTV infection,
early-infected plasmablasts emigrate out of the draining PO-LN and
transport the virus not only to particular lymphoid organs but also to
several nonlymphoid organs. By estimating the number of MMTV-infected
cells per 105 cells at day 6 of infection,
510 x 106 infected cells were found
outside the draining LN. MMTV infection in thymus, intestine, Peyers
patches, mesenteric LNs, and cervical LNs was not observed before day
14 after MMTV injection (Fig. 4
, G and H). The
remaining nonlymphoid organs were infected later, around days 1824
(Fig. 4
, I and K). Taken together, these data
demonstrate two waves of cellular recruitment, with the first wave
appearing by day 6, when MMTV infection is almost exclusively found in
extrafollicular plasma blast B cells. These cells transport the virus
to the mammary gland, skin, lung, bone marrow, spleen, axillary and
contralateral PO-LN, salivary gland, and liver. It has to be pointed
out that the mammary gland is a mixed tissue consisting of mammary
gland and adipose tissue, but we did not find accumulation of
radioactivity in fat tissue. A portion of plasmablasts either dies
after infiltrating peripheral organs or reenters the pool of
circulating cells. A second wave of migration of MMTV-infected cells
appears between days 1418, when virus is detectable in all lymphocyte
subpopulations but predominantly in follicularly differentiated
germinal center B cells. These infected lymphocytes infiltrate
peripheral tissue and lead to life-long MMTV infection of all
organs.
MMTV-infected plasmablast B cells express high levels of
4 and
1
The striking organ-specificity of MMTV-infected plasmablasts
prompted us to investigate whether the expression profile of adhesion
molecules on B cells was modulated upon viral infection and
SAg-mediated immune response. Using four-color flow cytometry, we
analyzed four different populations derived from draining PO-LN 6 days
after MMTV-infection (Fig. 5
):
extrafollicular B220lowMHC class
IIint plasmablasts (1), follicular
B220highMHC class IIhigh B
cells (2), B220-MHC class
II- non-B cells (3), and
B220high/intMHC class IIlow
B cells (4). When testing
anti-
4 mAb PS/2 and
anti-
1 mAb HA2/5, a small number of
B220lowMHC class IIint B
cells was detectable in naive animals, and most of them consisted of
either
4-
1-
or
4low
1high
cells (Fig. 5
A). All other lymphocyte populations derived
from naive LN were mainly
4-
1-.
We then examined the expression levels of
4
and
1 on lymphocytes isolated from the
draining PO-LN of 6-day-MMTV-infected BALB/c mice (Fig. 5
B).
Interestingly, almost all B220low plasmablast B
cells coexpressed
4 and
1-chains, indicating a noticeable
up-regulation of
4 integrin expression upon
MMTV infection. A total of 18.6% of B220highMHC
class IIlow cells (4) from
MMTV-infected LN coexpressed
4 and
1, whereas only 4.8% of follicular B cells
(2) displayed
4
1 expression.
Similar results were obtained when we performed flow cytometry with
anti-
1 mAb 9EG7, which recognizes an
epitope of the activated
1-molecule (data not
shown). This indicates that
1 was expressed in
an activated conformation on plasmablasts. Because extrafollicular
plasmablasts have lost migration toward chemokine gradients
(27), this observation might also explain tissue migration
in the absence of chemokine responsiveness.

View larger version (70K):
[in this window]
[in a new window]
|
FIGURE 5. 4 1 integrin expression
of B cells in the draining PO-LN. Six days after MMTV(SW) infection,
total LN cells were analyzed by four-color flow cytometry. Lymphocytes
were stained with mAbs to B220, MHC class II I-E, and 4
(PS/2) and 1 (HA2/5) integrins. After exclusion of dead
cells, FACS dot plot shows four populations of cells (delineated on the
plot) based on expression levels of B220 and MHC class II:
extrafollicular plasmablast B cells (B220lowMHC class
IIint) (1), follicular B cells
(B220highMHC class IIhigh) (2),
non-B cells (B220-MHC class II-)
(3), and plasma cells
(B220highMHC class IIlow B cells)
(4). In forward and side scatter profiles, populations
1 and 4 were identified as large blast
cells and 2 and 3 as small cells (data
not shown). Gated on plasmablasts (1), follicular B
cells (2), non-B cells (3), and plasma
cells (4), 4 and 1
integrin expression was analyzed.
|
|
We found considerable differences in expression levels of adhesion
molecules not only for
4 and
1 integrin but also for
IELs,
2-, and
7- chains
when plasmablast B cells and B220high B cells
from MMTV-infected LNs were compared with naive LN cells (Table I
). Upon MMTV infection, both
B220low plasmablast B cells and
B220high B cells had very low levels of
IELs
and
7 and had up-regulated
2 (Table I
). However, only
B220low B cells from MMTV-infected LNs were found
to reveal elevated expression levels of syndecan-1. They had also
strongly down-modulated L-selectin that corresponds to the activation
state of plasmablast B cells. Taken together, our data demonstrate that
the MMTV-induced immune response can modulate the pattern of adhesion
molecules on activated B cells, explaining the newly acquired migration
patterns. Because
1 and
7 integrin chains, the known heterodimer
partners of
4 integrin, did not increase to
the same magnitude as
4 integrin on
plasmablast B cells, we investigated whether
4
was coexpressed with another
-chain or was present alone on
MMTV-activated plasmablast B cells. Day 6 plasmablast B cells from
MMTV-infected draining PO-LN were purified by magnet separation,
surface labeled by iodination, and solubilized, and preclearing was
performed with protein A-Sepharose conjugated to
anti-
1 and
anti-
7 mAbs (Fig. 6
, lane 1) followed by
preclearing with unconjugated protein A-Sepharose (Fig. 6
, lane
2). The subsequent anti-
4
immunoprecipitate revealed three prominent species of 152 kDa, 81 kDa,
and 61 kDa and a faint band of 130 kDa under nonreducing conditions
(Fig. 6
, lane 3). These correspond to murine
4 integrin (155 kDa), the two breakdown
products of disulfide-linked
4 integrin (81
kDa and 66 kDa), and
1 integrin (130 kDa). The
quantitative differences of
4 and
1 bands could be presumably explained by
different efficiency in iodination of both molecules or, alternatively,
in the presence of
4 homodimers or monomers.
Taken together, we were unable to detect a new
-chain associated
with
4 integrin but clearly demonstrate
coexpression of
4
1
integrin heterodimers on almost all plasmablast B cells of
MMTV-infected LN.
 |
Discussion
|
|---|
To exploit the fate of extrafollicularly differentiated
plasmablast B cells, we studied the differentiation and the migration
route of retrovirally infected plasmablasts in mice. Our results
demonstrate that, at the peak of differentiation in the medullary
cords, MMTV-infected plasmablasts escape from the draining LN and
migrate to peripheral sites of the body, but mainly to the mammary
gland, skin, lung, liver, and spleen. They have modulated their
expression pattern of adhesion molecules with high expression levels of
4
1 and
2 integrin, indicating a role in entry into
target organs.
In vitro and in vivo studies have demonstrated that Ag-stimulated B
cells differentiate into enlarged plasmablasts, express syndecan-1, and
down-modulate B220 and IgD (28, 29). Although follicular
germinal center B cells express normal levels of B220, after secondary
stimulation the appearance of B220low B cells has
been reported, which most likely belong to germinal center-derived
plasma cells (30). In MMTV infection, extrafollicular B
cell differentiation takes place before germinal centers develop. This
is distinct from conventional T-dependent Ag responses in the draining
LN (5) and provided the tool to discriminate
extrafollicular from follicular B220low
plasmablast B cells. All other parameters of the B cell response after
MMTV infection are analogous to classical Ag responses as described
before (5).
Because extrafollicular plasmablast B cells have differentiated from
naive B cells, which are the major target cells of MMTV infection
(5, 13, 15), reverse-transcribed retroviral DNA in B cells
is a highly sensitive genetic marker that can be traced by specific
PCR. In a PO-LN draining the site of MMTV injection at day 6,
2
x 106 cells of 2 x
107 total cells were infected (Fig. 1
). As
previously described, B cells but not T cells are the target cells for
early MMTV infection in mice (14). Our results demonstrate
that, at day 6, >99% of infected cells are plasmablasts, and only
0.1% B220high B cells,
CD3+ T cells, or class
IIlow cells contain provirus DNA (Fig. 2
A). This low level of infection in the sorted T cells might
represent contaminating B cells. To detect infected B cells distributed
all over the body, DNA samples were analyzed by specific hybridization
of PCR amplification products. This allowed us to detect five infected
plasmablast B cells among 105 total cells of
lymphoid or nonlymphoid tissues. Our results confirm that the number of
virus-infected plasmablasts in the draining PO-LN dramatically
increased by day 6 and were strongly decreased by day 9
(15). This was most likely not a result of further
differentiation because the total number of B cells in the draining LN
decreased at the same time. In addition, MMTV had no lytic effect on
target cells, and, therefore, disappearance of plasmablast B cells
could either reflect elimination by cell death of proliferating B cells
that had not been positively selected in germinal centers or export of
cells out of the draining LN. From earlier studies, it is known that B
cells participating in primary immune responses are rapidly eliminated
by cell death soon after proliferation (7, 31). Similarly,
in vitro-stimulated B cells have been shown to undergo apoptosis after
a burst of proliferation (29). However, our results
clearly demonstrate that 510 x 106
MMTV-infected plasmablast B cells are detectable outside the draining
PO-LN (Fig. 3
), indicating that these cells had escaped from local cell
death and emigrated out of the draining LN. By blocking reverse
transcription 2 days after infection with AZT, we were able to block
reinfection without reducing the SAg response (19). Using
this tool, we ruled out that the presence of infected plasmablast B
cells outside the primary responding LN was a result of peripheral
infection rather than export of infected cells from the draining LN.
Although we cannot exclude that most extrafollicular plasmablast B
cells underwent apoptosis soon after proliferation, the number of
plasmablast B cells that survived was sufficient to transport the virus
to peripheral lymphoid and nonlymphoid organs, such as the mammary
gland, consisting of glandular and adipose tissue. Germinal
center-derived Ab-secreting plasma cells are known to migrate out of
the draining LN to the bone marrow (32, 33). However,
recirculating Ab-producing B cells are not found in nondraining LN and
bone marrow before day 22 after viral infection (34). In
contrast to this study, MMTV-primed plasmablast B cells secreting
virus-specific Abs (5) were found among total cells of
axillary LN, contralateral PO-LN, bone marrow, and spleen (Figs. 3
and 4
) and, after enrichment by FACS, were also found in mesenteric LN
(Fig. 3
) by day 6. The discrepancy between the two studies can be
explained by the higher frequency of MMTV-infected plasmablasts due to
their strong expansion by viral SAg-mediated T cell-B cell
collaboration and the highly sensitive method required to trace
plasmablast B cell by PCR and virus-specific hybridization. Infected
plasmablast B cells appear in the periphery at the same time as
extrafollicular B cell proliferation peaks in the draining LN. We
postulate that extrafollicularly differentiated plasmablast B cells are
no longer retained in the medullary cords of the LN and leave the
draining LN via the efferent lymphatics. This hypothesis is supported
by the finding that extrafollicular plasmablast B cells have lost
responsiveness to homeostatic chemokines and have down-modulated most
CC and CXC receptors specific for chemokines secreted in the draining
LN (27). Loss of chemokine receptor function has also been
observed in developing B cells as well as during differentiation into
germinal center B cells (35). Therefore, chemokines that
have been shown to arrest naive B cells (36) or attract
Ag-primed B cells to the follicle (37, 38) might fail to
induce retention of extrafollicular plasmablast B cells.
We have previously demonstrated that the germinal center reaction in
the follicles of MMTV-primed LNs started by days 1012
(5). In our present study, we observed a second peak of
viral infection in the draining LN 11 days after MMTV infection (Fig. 1
). Viral DNA was predominantly found in follicularly differentiating B
cells (B220highMHC class
IIhigh) and plasma cells
(B220high/intMHC class
IIlow) (Fig. 2
). Interestingly, follicular
differentiation of B cells was accompanied by export of MMTV infection
to lymphoid organs and mucosal tissue (Fig. 4
, G and
H). This was even more striking in the mammary gland, in
which we observed a second peak of infection by days 1214 (Fig. 4
, A and B). This strongly indicates that two
independent waves of emigration of B cells appear during the primary
immune response to MMTV. The first is dependent on extrafollicular B
cell differentiation in the medullary cords, and the second is at the
time when the germinal center reaction occurs. At later time points,
all tissue of infected mice contain retroviral proviruses, and
infection is maintained for life.
Once plasmablast B cells enter the pool of recirculating lymphocytes
around day 6, they migrate to a range of lymphoid and nonlymphoid
organs such as the spleen, mammary gland, skin, salivary gland, and
lung. The affinity of lymphoblasts to secretory tissue such as mammary
and salivary glands has been reported in earlier studies (39, 40). The detection of radioactivity in lactating mammary glands
after transfer of radiolabeled rat T cells into naive animals led to
the conclusion that T cells play a role in maternal-to-neonatal
transfer of immunity (41). However, the in vivo relevance
of T cell vs B cell migration to the mammary gland has not been
clarified, and studies of naive lymphocytes instead of immunoblasts, as
well as cells isolated from lymph or blood instead of lymphoid organs,
have to be interpreted with caution. Transfer of both T cells and B
cells from MMTV-infected donors to naive recipients was found to induce
infection of the mammary gland (42, 43, 44). Whether this was
a result of virus shedding, a SAg response, or migration to the mammary
gland has not been shown. Here we demonstrate that, in the first weeks
after infection, the presence of MMTV DNA in the mammary gland is the
result of cellular export of infected B cells from the draining LN and
is neither from virus shedding nor recruitment of T cells to the
mammary gland. Because only 0.1% of T cells in the draining PO-LN are
infected 6 and 14 days after MMTV injection (Fig. 2
) by virus-specific
PCR, we cannot rule out migration of T cells to the mammary gland.
However, we found that radiolabeled plasmablast B cells, but not T
cells, from draining PO-LN that were at day 6 adoptively transfered
into naive recipient mice entered the mammary
gland.4 Clearly,
tissue-specific homing requires the interaction of adhesion receptors
with the corresponding ligand. Therefore, we analyzed the expression
profile of homing receptors on plasmablast B cells from MMTV-infected
LNs. In the present study, we show first that
4
1 integrin is
expressed on almost all MMTV-infected plasmablast B cells and, second,
that expression levels are higher on both plasmablast B cells of
MMTV-infected mice compared with rare B220lowMHC
class IIint B cells of naive control animals.
Mn2+ treatment of cells did not enhance the
efficiency of 9EG7 mAb staining, indicating that
4
1 heterodimer is
present on MMTV-infected B cells in the activated conformation (data
not shown). The loss of chemokine receptor function and the induction
of activated
4
1
integrin molecules explain the observed migration properties. MMTV
infection induced a dramatic increase in
4
integrin coexpressed with
1 (Fig. 5
B), whereas, in naive control mice, most plasmablast B
cells were either
4-
1-
or expressed
1 integrin without
4 (Fig. 5
A). We confirmed by
immunoprecipitation that both
4 and
1 integrins were expressed on plasmablast B
cells (Fig. 6
). We found VCAM-1, a ligand for
4
1 integrin, to be
expressed on mammary gland vascular endothelium, and homing of
adoptively transferred plasmablast B cells to the mammary gland was
dependent on
4
1.4
Our data clearly demonstrate that 
integrin expression can be
modulated by MMTV infection. Whether this is a result of viral
infection or SAg-mediated T cell-B cell interaction is unclear. In
different antigenic models of mice and humans, an altered expression of
4
7 or
4
1 on
activated/memory B and T cells has been reported (45, 46, 47, 48).
Mycobacterium tuberculosis infection leads to expansion of
4
1high
7-/low
cells (49), whereas staphylococcal enterotoxin B induces
down-modulation of
4
1
on activated T cells (50), indicating an influence of the
Ag stimulus on integrin expression. Elevated expression of
4 integrin (CD49d) is not only correlated with
a memory phenotype of T cells (51, 52) but is also
dependent on the local tissue microenvironment (53) and
the differentiation into either type 1 or type 2 lymphokine-secreting
subsets (54). Taken together, many pathogens can induce
4
1 and
4
7 integrin
expression on B and T lymphocytes, but expression levels can differ
depending on cellular subsets, localizations, and Ags. Therefore,
elevated levels of
4
1
integrin on plasmablast B cells are not a unique effect of MMTV and, as
in other Ag models, can mediate entry of infected cells into tissues
that express VCAM-1 on endothelial cells.
1
expression on B lymphocytes plays not only an essential role in homing
to particular organs but also in increased cell proliferation and
rescue from apoptosis, as demonstrated for T cells
(55, 56, 57). Therefore,
4
1 expression on
plasmablast B cells might play a key role in rescue from
activation-induced cell death in the draining PO-LN. Additionally,
these cells have elevated expression levels of
2 and syndecan-1. The interaction of
4
1 with VCAM-1 has
been shown to increase the avidity of
2
(58), suggesting that migration of extrafollicular
plasmablast B cells to peripheral organs is controlled by complex
molecular interactions involving cross-talk between different
integrins. Because plasmablast B cells have down-modulated L-selectin,
the affinity for high endothelial venules in secondary lymphoid organs
should be low. We were able to isolate MMTV-infected plasmablast B
cells from axillary and mesenteric LNs (Fig. 3
), indicating entry
independent of L-selectin via afferent lymphatics. It must be
emphasized that, by analyzing total LN cells 6 days after MMTV
infection, viral DNA was detectable only in axillary and contralateral
PO-LN but not in mesenteric LN. Therefore, trafficking of
extrafollicular plasmablast B cells to secondary lymphoid organs
differs in terms of quantity and may be influenced by additional
parameters.
How long MMTV-infected plasmablast B cells survive in a particular
environment outside the draining LN remains unclear. Studies examining
the longevity of plasma cells indicate that a substantial fraction can
survive for extended periods of time in bone marrow and spleen
(59, 60). These cells have been considered to survive in
the absence of Ag and to spontaneously secrete Abs ex vivo
(61). Plasma cells that home to the bone marrow in
response to the hapten (4-hydroxy-3-nitrophenyl)acetyl have been shown
to be selected for high-affinity variants (6, 62).
Therefore, the bone marrow seems to play a major role in
affinity-driven clonal competition independent of germinal centers.
This is supported by the fact that, in germinal center-deficient mice,
affinity maturation can occur (63). In a recent
manuscript, B220+/-CD138+
B cells have been described as one of three memory B cell subsets that
can persist through at least 42 days of a secondary immune response in
spleen and bone marrow and secrete specific switched isotype Ab
(28). Similarly, B220-CD19+ B
cells containing hypermutated Ig genes have been isolated from
peripheral blood of quasimonoclonal mouse model (64, 65),
indicating that this cell population is circulating.
What is the general consequence of survival of infected B cells for the
virus? In many viral infections, B cell differentiation is critical for
amplification and persistenc. During EBV infection, activation to the
blastoid stage is an essential step in the process of latency. Some
activated B cell blasts can exit the cell cycle and reach a resting
state, allowing persistence of EBV in these cells (66). We
hypothesize that a similar mechanism acts in MMTV infection, allowing
survival of some latently infected B cells. In this model, MMTV
infection of naive B cells leads to differentiation into cycling
extrafollicular B cell blasts. A proportion of these blasts exits the
draining LN and enters peripheral tissue via
4
1, resulting in
persistent infection of lymphoid and nonlymphoid tissue. It is possible
that these cells exit the cell cycle and belong to a subtype of
B220- memory B cells that have been described
recently (28). This model is supported by the observation
that adoptive transfer of MMTV-infected syngeneic plasmablast B cells
in AZT-treated recipient mice leads to a long-lasting deletion of viral
SAg-reactive T cells, whereas transfer of allogeneic MMTV
SAg-presenting B cells induces a reversible deletion due to rapid
elimination of allogenic donor cells (our unpublished observations).
To complete the MMTV life cycle, B cell differentiation requires T
cell-B cell collaboration (25, 67, 68). Both B and T cells
have been demonstrated to be principally capable of shedding MMTV
particles (16). However, in the first two weeks of MMTV
infection, we never observed a dramatic increase of viral load in
peripheral organs when mice were not treated with AZT. This indicates
that infection of peripheral organs reflects emigration of
virus-infected cells rather then infection by viremia. Here we show
that extrafollicular plasmablast B cells play a key role in carrying
retroviral DNA to peripheral nonlymphoid organs such as the mammary
gland, skin, lung, salivary gland, and liver. In all of these organs, a
large amount of MMTV has been described (69, 70). By days
1218 of MMTV infection, MMTV infection in the draining LN is mainly
localized in germinal center B cells (26). At the same
time, a second peak of viral infection appears in mammary gland and
skin but also in most other organs. This can be a result of either
proliferation and cellular expansion of infected plasmablasts or
infiltration by germinal center-derived plasma cells and memory B
cells. The explanation we favor is the latter one, because B blasts
outside the draining LN are known to be mainly noncycling cells
(71).
In summary, our experiments illustrate that a substantial portion of
plasmablast B cells differentiated from early MMTV-infected B cells
have escaped local cell death in the draining LN and have migrated to
peripheral tissue. Homing of these cells to the mammary gland is
synchronized with a peak of extrafollicular differentiation in the
draining LN, whereas most of the nonlymphoid organs are not infected
before germinal center reactions in the follicles occur. MMTV-infected
plasmablasts have an expression profile of adhesion molecules with
elevated levels of
4
1,
2, and syndecan-1 but low expression levels of
L-selectin. This pattern is unique between all lymphocytes isolated
from the draining LN and gives new insights into the mechanism of
tissue-specific plasmablast homing.
 |
Acknowledgments
|
|---|
We thank Beat Imhof, Bernhard Holzmann, and Curzio Rüegg for
helpful discussions and for providing anti-integrin Abs, Donata
Rimoldi for help in the immunoprecipitations, and Anne Wilson for
critical reading of the manuscript.
 |
Footnotes
|
|---|
1 This work was supported by Grants 31-32271.94 and 31-59165.99 from the Swiss National Science Foundation. 
2 Address correspondence and reprint requests to Dr. Hans Acha-Orbea, Ludwig Institute for Cancer Research, Lausanne Branch, Chemin des Boveresses 155, 1066 Epalinges, Switzerland. 
3 Abbreviations used in this paper: LN, lymph node; SW, Swiss strain; MMTV, mouse mammary tumor virus; SAg, superantigen; PO, popliteal; IEL, intraepithelial lymphocyte. 
4 D. Finke and H. Acha-Orbea. Differential migration of in vivo primed B and T lymphocytes to lymphoid and nonlymphoid organs. Submitted for publication. 
Received for publication July 28, 2000.
Accepted for publication March 15, 2001.
 |
References
|
|---|
-
MacLennan, I. C. M., A. Gulbranson-Judge, K. M. Toellner, M. Casamayor-Palleja, E. Chan, D. M. Sze, S. A. Luther, H. Acha-Orbea. 1997. The changing preference of T and B cells for partners as T-dependent antibody responses develop. Immunol. Rev. 156:53.[Medline]
-
Liu, Y. J., J. Zhang, P. J. Lane, E. Y. Chan, I. C. M. MacLennan. 1991. Sites of specific B cell activation in primary and secondary responses to T cell-dependent and T cell-independent antigens. Eur. J. Immunol. 21:2951.[Medline]
-
Jacob, J., R. Kassir, G. Kelsoe. 1991. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. I. The architecture and dynamics of responding cell populations. J. Exp. Med. 173:1165.[Abstract/Free Full Text]
-
Gulbranson-Judge, A., I. C. M. MacLennan. 1996. Sequential antigen-specific growth of T cells in the T zones and follicles in response to pigeon cytochrome c. Eur. J. Immunol. 26:1830.[Medline]
-
Luther, S. A., A. Gulbranson-Judge, H. Acha-Orbea, I. C. M. MacLennan. 1997. Viral superantigen drives extrafollicular and follicular B cell differentiation leading to virus-specific antibody production. J. Exp. Med. 185:551.[Abstract/Free Full Text]
-
Takahashi, Y., P. R. Dutta, D. M. Cerasoli, G. Kelsoe. 1998. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. V. Affinity maturation develops in two stages of clonal selection. J. Exp. Med. 187:885.[Abstract/Free Full Text]
-
Smith, K. G., T. D. Hewitson, G. J. Nossal, D. M. Tarlinton. 1996. The phenotype and fate of the antibody-forming cells of the splenic foci. Eur. J. Immunol. 26:444.[Medline]
-
Lalor, P. A., G. J. Nossal, R. D. Sanderson, M. G. McHeyzer-Williams. 1992. Functional and molecular characterization of single, (4-hydroxy-3-nitrophenyl)acetyl (NP)-specific, IgG1+ B cells from antibody-secreting and memory B cell pathways in the C57BL/6 immune response to NP. Eur. J. Immunol. 22:3001.[Medline]
-
Cyster, J. G., C. C. Goodnow. 1995. Antigen-induced exclusion from follicles and anergy are separate and complementary processes that influence peripheral B cell fate. Immunity 3:691.[Medline]
-
Pulendran, B., R. van Driel, G. J. Nossal. 1997. Immunological tolerance in germinal centres. Immunol. Today 18:27.[Medline]
-
Garcia De Vinuesa, C., A. Gulbranson-Judge, M. Khan, P. OLeary, M. Cascalho, M. Wabl, G. G. Klaus, M. J. Owen, I. C. M. MacLennan. 1999. Dendritic cells associated with plasmablast survival. Eur. J. Immunol. 29:3712.[Medline]
-
Held, W., A. N. Shakhov, G. Waanders, L. Scarpellino, R. Luethy, J. P. Kraehenbuhl, H. R. MacDonald, H. Acha-Orbea. 1992. An exogenous mouse mammary tumor virus with properties of Mls-1a (Mtv-7). J. Exp. Med. 175:1623.[Abstract/Free Full Text]
-
Finke, D., L. Mortezavi, H. Acha-Orbea. 1998. Preactivation of B lymphocytes does not enhance mouse mammary tumor virus infection. J. Virol. 72:7688.[Abstract/Free Full Text]
-
Held, W., A. N. Shakhov, S. Izui, G. A. Waanders, L. Scarpellino, H. R. MacDonald, H. Acha-Orbea. 1993. Superantigen-reactive CD4+ T cells are required to stimulate B cells after infection with mouse mammary tumor virus. J. Exp. Med. 177:359.[Abstract/Free Full Text]
-
Ardavin, C., P. Martin, I. Ferrero, I. Azcoitia, F. Anjuere, H. Diggelmann, F. Luthi, S. Luther, H. Acha-Orbea. 1999. B cell response after MMTV infection: extrafollicular plasmablasts represent the main infected population and can transmit viral infection. J. Immunol. 162:2538.[Abstract/Free Full Text]
-
Dzuris, J. L., T. V. Golovkina, S. R. Ross. 1997. Both T and B cells shed infectious mouse mammary tumor virus. J. Virol. 71:6044.[Abstract]
-
Ruprecht, R. M., L. G. OBrien, L. D. Rossoni, S. Nusinoff-Lehrman. 1986. Suppression of mouse viraemia and retroviral disease by 3'-azido-3'- deoxythymidine. Nature 323:467.[Medline]
-
Festenstein, H., L. Berumen. 1984. BALB.D2-Mlsaa new congenic mouse strain. Transplantation 37:322.[Medline]
-
Held, W., G. A. Waanders, H. R. MacDonald, H. Acha-Orbea. 1994. Reverse transcriptase-dependent and -independent phase of infection with mouse mammary tumor virus: implication for superantigen function. J. Exp. Med. 180:2347.[Abstract/Free Full Text]
-
Metlay, J. P., M. D. Witmer-Pack, R. Agger, M. T. Crowley, D. Lawless, R. M. Steinman. 1990. The distinct leukocyte integrins of mouse spleen dendritic cells as identified with new hamster monoclonal antibodies. J. Exp. Med. 171:1753.[Abstract/Free Full Text]
-
Sarmiento, M., D. P. Dialynas, D. W. Lancki, K. A. Wall, M. I. Lorber, M. R. Loken, F. W. Fitch. 1982. Cloned T lymphocytes and monoclonal antibodies as probes for cell surface molecules active in T cell-mediated cytolysis. Immunol. Rev. 68:135.[Medline]
-
Mendrick, D. L., D. M. Kelly. 1993. Temporal expression of VLA-2 and modulation of its ligand specificity by rat glomerular epithelial cells in vitro. Lab. Invest. 69:690.[Medline]
-
Miyake, K., I. L. Weissman, J. S. Greenberger, P. W. Kincade. 1991. Evidence for a role of the integrin VLA-4 in lympho-hemopoiesis. J. Exp. Med. 173:599.[Abstract/Free Full Text]
-
Holzmann, B., B. W. McIntyre, I. L. Weissman. 1989. Identification of a murine Peyers patch-specific lymphocyte homing receptor as an integrin molecule with an
chain homologous to human VLA-4
. Cell 56:37.[Medline]
-
Held, W., G. A. Waanders, A. N. Shakhov, L. Scarpellino, H. Acha-Orbea, H. R. MacDonald. 1993. Superantigen-induced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission. Cell 74:529.[Medline]
-
Acha-Orbea, H., D. Finke, A. Attinger, S. Schmid, N. Wehrli, S. Vacheron, I. Xenarios, L. Scarpellino, K. M. Toellner, I. C. M. MacLennan, S. A. Luther. 1999. Interplays between mouse mammary tumor virus and the cellular and humoral immune response. Immunol. Rev. 168:287.[Medline]
-
Wehrli, N., D. F. Legler, D. Finke, K. M. Toellner, P. Loetscher, M. Baggiolini, I. C. M. MacLennan, H. Acha-Orbea. 2001. Changing responsiveness to chemokines allows medullary plasmablasts to leave lymph nodes. Eur. J. Immunol. 31:609.[Medline]
-
McHeyzer-Williams, L. J., M. Cool, M. G. McHeyzer-Williams. 2000. Antigen-specific B cell memory. Expression and replenishment of a novel B220- memory b cell compartment. J. Exp. Med. 191:1149.[Abstract/Free Full Text]
-
Dustin, L. B., E. D. Bullock, Y. Hamada, T. Azuma, D. Y. Loh. 1995. Antigen-driven differentiation of naive Ig-transgenic B cells in vitro. J. Immunol. 154:4936.[Abstract]
-
Han, S., S. R. Dillon, B. Zheng, M. Shimoda, M. S. Schlissel, G. Kelsoe. 1997. V(D)J recombinase activity in a subset of germinal center B lymphocytes. Science 278:301.[Abstract/Free Full Text]
-
Sprent, J.. 1994. T and B memory cells. Cell 76:315.[Medline]
-
Tew, J. G., R. M. DiLosa, G. F. Burton, M. H. Kosco, L. I. Kupp, A. Masuda, A. K. Szakal. 1992. Germinal centers and antibody production in bone marrow. Immunol. Rev. 126:99.[Medline]
-
MacLennan, I. C. M., D. Gray. 1986. Antigen-driven selection of virgin and memory B cells. Immunol. Rev. 91:61.[Medline]
-
Bachmann, M. F., T. M. Kündig, B. Odermatt, H. Hengartner, R. M. Zinkernagel. 1994. Free recirculation of memory B cells versus antigen-dependent differentiation to antibody-forming cells. J. Immunol. 153:3386.[Abstract]
-
Bowman, E. P., J. J. Campbell, D. Soler, Z. Dong, N. Manlongat, D. Picarella, R. R. Hardy, E. C. Butcher. 2000. Developmental switches in chemokine response profiles during B cell differentiation and maturation. J. Exp. Med. 191:1303.[Abstract/Free Full Text]
-
Campbell, J. J., J. Hedrick, A. Zlotnik, M. A. Siani, D. A. Thompson, E. C. Butcher. 1998. Chemokines and the arrest of lymphocytes rolling under flow conditions. Science 279:381.[Abstract/Free Full Text]
-
Forster, R., A. E. Mattis, E. Kremmer, E. Wolf, G. Brem, M. Lipp. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037.[Medline]
-
Ngo, V. N., H. L. Tang, J. G. Cyster. 1998. Epstein-Barr virus-induced molecule 1 ligand chemokine is expressed by dendritic cells in lymphoid tissues and strongly attracts naive T cells and activated B cells. J. Exp. Med. 188:181.[Abstract/Free Full Text]
-
Roux, M. E., M. McWilliams, J. M. Phillips-Quagliata, P. Weisz-Carrington, M. E. Lamm. 1977. Origin of IgA-secreting plasma cells in the mammary gland. J. Exp. Med. 146:1311.[Abstract/Free Full Text]
-
Manning, L. S., M. J. Parmely. 1980. Cellular determinants of mammary cell-mediated immunity in the rat. I. The migration of radioisotopically labeled T lymphocytes. J. Immunol. 125:2508.[Abstract]
-
Kumar, S. N., L. L. Seelig, J. R. Head. 1985. Migration of radiolabeled, adoptively transferred T-lymphocytes into the mammary gland and milk of lactating rats. J. Reprod. Immunol. 8:235.[Medline]
-
Tsubura, A., M. Inaba, S. Imai, A. Murakami, N. Oyaizu, R. Yasumizu, Y. Onishi, H. Tanaka, S. Morii, S. Ikehara. 1988. Intervention of T-cells in transportation of mouse mammary tumor virus (milk factor) to mammary gland cells in vivo. Cancer Res. 48:6555.[Abstract/Free Full Text]
-
Waanders, G. A., A. N. Shakhov, W. Held, P. Karapetian, H. Acha-Orbea, H. R. MacDonald. 1993. Peripheral T cell activation and deletion induced by transfer of lymphocyte subsets expressing endogenous or exogenous mouse mammary tumor virus. J. Exp. Med. 177:1359.[Abstract/Free Full Text]
-
Golovkina, T. V., J. P. Dudley, S. R. Ross. 1998. B and T cells are required for mouse mammary tumor virus spread within the mammary gland. J. Immunol. 161:2375.[Abstract/Free Full Text]
-
Williams, M. B., J. R. Rose, L. S. Rott, M. A. Franco, H. B. Greenberg, E. C. Butcher. 1998. The memory B cell subset responsible for the secretory IgA response and protective humoral immunity to rotavirus expresses the intestinal homing receptor,
4
7. J. Immunol. 161:4227.[Abstract/Free