HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Matthews, K. W. Articles by Wetsel, R. A. Search for Related Content PubMed PubMed Citation Articles by Matthews, K. W. Articles by Wetsel, R. A.

Characterization of Mouse Carboxypeptidase N Small Active Subunit Gene Structure¹

Kirstin W. Matthews^* and Rick A. Wetsel^2,*,

^* University of Texas-Houston Institute of Molecular Medicine for the Prevention of Human Diseases, and Department of Biochemistry and Molecular Biology, University of Texas-Houston Medical School, Houston, TX 77030

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Carboxypeptidase N (CPN) is a plasma zinc metalloprotease comprised of two small subunits that have enzymatic activity, and two large subunits, which protect the enzyme from degradation. CPN cleaves the carboxyl-terminal amino acids arginine and lysine from biologically active peptides such as complement anaphylatoxins, kinins, and fibrinopeptides. To delineate the murine CPN small subunit coding region, gene structure, and chromosome location, cDNA and genomic clones were isolated, characterized, and used in Northern and fluorescence in situ hybridization analyses. The results from this study demonstrate that the murine CPN small subunit gene is a single copy gene of 29 kb that is transcribed in the liver into a 1793-bp mRNA with an open reading frame of 1371 nucleotides encoding 457 aa. The gene contains nine exons ranging in size from 455 bp (exon 1) to 100 bp (exon 7), and eight introns ranging in size from 6.2 kb (intron 2) to 1.4 kb (intron 4). All intron/exon junctions follow the normal consensus rule. The mouse CPN small subunit gene localized to chromosomal band 19D2, which is syntenic to human chromosome 10q23–25. Primer extension experiments using mouse liver mRNA indicate one major transcriptional initiation site and three minor sites. Sequence analysis of the 5'-flanking region indicated a TATA-less promoter and numerous transcription factor binding sites, which may confer liver-specific expression of the CPN small subunit gene.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Carboxypeptidase N (CPN)³ is a zinc metalloprotease comprised of two small subunits (M_r 50,000 each) and two large subunits (M_r 83,000 each) (1). The small subunits contain the enzymatic activity for the protease, while the large heavily glycosylated subunits protect the enzyme from being degraded or filtrated from the bloodstream. These subunits form a tetramer and are held together by noncovalent interactions.

CPN is produced by the liver (2) and, once secreted into the blood, it can cleave carboxyl-terminal arginine or lysine residues from biologically potent peptides released into the bloodstream, such as kinins (3), kallidin (4), fibrinopeptides (5), and other substrates (2). CPN also cleaves the carboxyl-terminal arginine from the complement anaphylatoxins C3a and C5a (3) (6). C3a and C5a are peptides generated from the activation of the complement cascade and can induce smooth muscle contraction, vasodilation, chemotaxis of leukocytes, and the release of histamine from mast cells (7, 8). By removing the carboxyl-terminal arginine from the complement anaphylatoxins, CPN greatly reduces C5a and C3a biological activities (8).

Currently, no known individual with a complete CPN deficiency has been described. However, an individual has been identified with CPN activity levels 21% of normal (9, 10). This individual exhibited chronic recurring angioedema characterized by swelling of the face and tongue and by red swellings on the extremities lasting 24 h. The severe phenotype of a partial deficiency indicates that CPN has an important role in vivo.

The cDNA encoding the human CPN small and large subunits have been cloned (11, 12). Furthermore, the human large subunit was localized to human chromosome 8p22–23, and the small subunit gene was mapped to chromosome 10 (13). In the current study, the cDNA and gene structure of mouse CPN small subunit were identified. The CPN cDNA was isolated and found to encode a protein 79% identical in amino acid sequence to the human CPN small subunit. By Northern analysis, the gene expression was tissue specific and detected only in the liver. The gene encoding for the murine CPN small subunit was 29 kb in length with nine exons and located on mouse chromosome 19 band position D2, which is syntenic with the human CPN small subunit gene.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Materials and reagents

Restriction enzymes and other molecular biology reagents were purchased from Roche Molecular Biochemicals (Indianapolis, IN) and used according to manufacturer’s recommendations. Hybond N⁺ nylon membranes and radionucleotides [-³²P]dCTP and [³⁵S]dATP were purchased from Amersham (Arlington Heights, IL). [-³²P]dATP was purchased from ICN (Costa Mesa, CA).

Cloning of mouse CPN small subunit cDNA

Two expression tag clones were identified from American Type Culture Collection (ATCC, Manassas, VA), 261J and 26K. ATCC-261J was 79% identical with the 3' end of human CPN small subunit cDNA and was purchased from ATCC. ATCC-26K was 75% identical with the 5' end of human CPN small subunit. Although a portion of the 26-K sequence has been determined, the clone was lost at ATCC and could not be obtained for further study. To obtain the entire sequence of the murine CPN small subunit cDNA, a mouse B10.D2/nSnJ liver cDNA library was screened (14). Approximately 500,000 plaques were plated, and duplicate filters were screened using a random primed ³²P-labeled ATCC-261J (used according to manufacturer instructions; Roche) as a probe. Filters were hybridized at 65°C in a 5x SSC, 10x Denhardt’s, and 1% SDS solution at pH 7.4. After 16 h, the filters were washed at 65°C in 0.2x SSC and 1% SDS and exposed to autoradiography film. Approximately 100 clones that hybridized to the CPN probe were found after two additional rounds of screening. Ten clones were plaque purified and sequenced on both strands.

Northern blot and genomic Southern analysis

For Northern analysis, a blot containing 2 µg of mRNA from various mouse tissues was obtained from Clontech (Palo Alto, CA). A random primed ³²P-labeled ATCC-261J insert was used as the probe. The blot was hybridized, washed, and autoradiographed, as described (15).

For Southern analysis, 25 µg of genomic DNA from 129SvJ mice was digested with specified enzymes (see Results). The DNA was electrophoresed on a 0.8% agarose gel with radiolabeled molecular mass markers and then transferred to a nitrocellulose filter. The blots were hybridized in modified Church and Gilbert buffer (500 mM sodium phosphate buffer (pH 7.2), 10 mM EDTA, 7% SDS, and 1% BSA) individually with two probes. The first probe was a random primed labeled PCR genomic DNA fragment of 205 bp. This fragment was made from primers corresponding to sequence in exon 8, e8p5 (GCACAGCACAGTGAAGCCCAGGA) and e8p3 (GCAGCCGGAAATCCCCGTGT). The second probe corresponded to a BamHI-digested exon 1 fragment of 248 bp. After hybridization, the blots were washed at 55°C in 0.2x SSC with 0.5% SDS and then exposed to film overnight.

Cloning of the mouse CPN small subunit gene

A 129Sv/J liver-derived mouse genomic library in the Lambda Fix II vector was obtained from Stratagene (La Jolla, CA). Approximately 500,000 recombinants were plated, and duplicate filters were screened with the clone, ATCC-261J, and a 500-bp probe that corresponded to the 5' end of the open reading frame. The probes were hybridized and washed in conditions similar to the cDNA library. Twelve positive clones were obtained. Phage DNA was purified and subjected to restriction enzyme digest and sequence analysis. Three overlapping clones (, T, and 6B) were used to obtain the full-length gene.

Intron size determination

Three phage clones were used to determine the CPN gene structure (Fig. 3). The DNA was digested with various enzymes and run on a DNA gel adjacent to radiolabeled DNA markers. The resulting Southern was probed with oligonucleotides corresponding to each individual exon. Sizes of the fragments were estimated and arranged into a map of the gene. Intron sizes were deduced by overlapping enzyme fragments. Introns 4 and 5 were not cut by overlapping restriction enzymes and therefore were sized and mapped by PCR using the same oligonucleotides.

View larger version (6K): [in this window] [in a new window]   FIGURE 3. Mouse CPN small subunit gene structure. The mouse CPN small subunit gene is 29 kb with nine exons. Shown is a schematic that illustrates the structural organization of the gene. The exons are indicated by boxes, and the intervening introns are represented by lines separating the exons. Three overlapping phage clones (6B, , and T) were isolated to delineate the gene structure.

All oligonucleotides were synthesized using an Oligo 1000 M DNA Synthesizer (Beckman Instruments, Fullerton, CA). Oligonucleotides (20 bp) were used as primers in the sequencing reactions. All cDNA and genomic sequencing was performed using double-stranded plasmid or phage templates and a model 377A automated DNA sequencer from Applied Biosystems (Foster City, CA), according to the standard protocol of the AmpliTaq BigDye deoxy terminator cycle sequencing kit.

Chromosome assignment and fluorescence in situ hybridization

The mouse CPN small subunit gene was localized by fluorescence in situ hybridization (16). The clones 6B and , which contained 30 kb and 76% of the gene, were labeled with digoxigenin-11-dUTP by nick translation, combined with sheared mouse DNA, and hybridized to normal metaphase chromosomes derived from mouse embryo fibroblast cells. Specific hybridization was detected by incubating hybridization slides in fluoresceinated anti-digoxigenin Abs, followed by counterstaining with propidium iodine. To verify specific hybridization to chromosome 19, a probe specific for chromosome 19 was cohybridized with 6B and clones.

Primer extension

Primer extension assays were performed as described with minor modifications (17). An antisense 40-mer oligonucleotide was made 150 bp downstream from the longest cDNA clone obtained (pCPN.103). Approximately 100 ng of the oligonucleotide was end labeled using [-³²P]dATP and polynucleotide kinase (30 U/µl) (Roche) for 1 h at 37°C. The end-labeled oligonucleotide (150,000 cpm) was hybridized to 4 µg of poly(A)⁺ selected mouse liver mRNA for 16 h at 50°C in 30 µl formamide buffer (40 mM PIPES, 1 mM EDTA, 0.4 M NaCl, and 50% deionized formamide). As a negative control, 20 µg of yeast tRNA (Roche) was incubated with the labeled oligonucleotide simultaneously. The RNA-oligo was then precipitated and resuspended in 30 µl reverse transcriptase buffer (5 mM Tris, 50 mM KCl, 10 mM MgCl₂, 1 mM DTT, 50 U RNase inhibitor, 3.2 mM sodium pyrophosphate, 2 mM deoxynucleotide triphosphates). Thirty units of avian myeloblastosis virus reverse transcriptase (Roche) were added to each sample and incubated at 42°C for 90 min. The mRNA was then digested by RNase A (100 µg/ml) for 30 min at 37°C. The samples were phenol/chloroform extracted and ethanol precipitated, and the samples were analyzed by electrophoresis on 6% acrylamide-urea gels in which a sequencing ladder was used to estimate the size of extended products. To assign the transcriptional initiation site accurately, the sequencing ladder was made by using the oligonucleotide in the primer extension analysis as primer and a plasmid clone that contained all of exon one as a template.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cloning of murine CPN small subunit cDNA

An ATCC expression sequence tag database was searched for a murine liver clone with high homology to the human CPN small subunit (11). A truncated clone of 644 bp was discovered (ATCC-261J) and was 79% identical in DNA sequence to the human CPN small subunit (Fig. 1, top). The search also revealed a clone that contained the open reading frame start site and 5'-untranslated sequence. This clone (ATCC-26K) had been lost at ATCC and therefore could not be obtained, but 400 bp of the sequence was known and used in the construction of the map. To complete the CPN small subunit cDNA sequence, the ATCC-261J clone was used to screen a murine liver cDNA library. Approximately 10 clones were isolated, and restriction digest maps were performed to determine the clone with the largest insert. Clone pCPN.103K that contained the longest insert was fully sequenced. The pCPN.103K insert was 1477 bp in length and overlapped the cDNA sequence of ATCC-26K and ATCC-261J, facilitating completion of the CPN small subunit cDNA structure (Fig. 1, top).

View larger version (58K): [in this window] [in a new window]   FIGURE 1. Mouse CPN small subunit cDNA sequence. The cloning strategy for CPN with two ATCC clones (26K and 261J) and a cDNA library clone (pCPN.103K) (top). The nucleotide and translated amino acid sequences were determined from the cDNA clones, as described in the text (bottom). The coding region is depicted in capital letters with the initiating methionine defined as +1. The 5'- and 3'-untranslated sequence are depicted in lower case. The 5'-untranslated sequence begins at the TIS, as determined by primer extension experiments. The resulting cDNA has 232 bp of 5'-untranslated, 1371-bp coding region, and 190-bp 3' untranslated. The CPN small subunit exons are denoted with slash marks at exon splice sites. The putative polyadenylation site (attaaa) is marked in bold. This sequence has been submitted to the GenBank/EMBL Data Bank with accession number AF326477.

Northern blot analysis

To examine the expression of the mouse CPN small subunit mRNA, a Northern blot containing RNA from various mouse tissues was probed with ATTC-261J (Fig. 2). Hybridization of the probe revealed two messages that were 1.8 and 2 kb in length. Both mRNA are most likely transcripts that were derived from alternative processing or alternative splicing of the CPN small subunit gene. This conclusion is made from data indicating that: 1) the CPN is most likely a single copy gene (see below), and 2) the ATCC-261J probe is specific for CPN, as demonstrated by the fact that no clones other than CPN cDNA were isolated for the mouse liver cDNA library. Moreover, CPN-specific signal was detected only in mRNA isolated from the liver, indicating that the CPN small subunit is predominately, if not exclusively, expressed in the liver (Fig. 2).

View larger version (46K): [in this window] [in a new window]   FIGURE 2. Mouse CPN small subunit mRNA expression. A Northern blot containing 2 µg mRNA from indicated mouse tissues was probed with a partial cDNA clone (ATCC-261J). Expression of CPN small subunit was only detected in the liver. There were two CPN small subunit mRNAs detected in the liver with approximate sizes of 1.8 and 2 kb.

To determine the gene copy number of mouse CPN small subunit, mouse 129SvJ genomic DNA (25 µg) was digested with the enzymes XbaI, BamHI, SmaI, BglII, EcoRV, HindIII, SacI, XhoI, and EcoRI separately and then hybridized with the radiolabeled exon 8 or exon 1 probes. For each enzyme, a single band was present on the Southern blot (data not shown). Because none of the enzymes cut the exon 8 or the exon 1 probes, these results strongly suggest that the murine CPN small subunit gene is present in the mouse genome as a single copy.

Murine CPN small subunit gene structure

To determine the CPN small subunit gene structure, a murine genomic library was screened for clones containing the CPN small subunit gene using the radiolabeled ATCC-261J partial cDNA as a probe. Two clones ( and T) were identified and plaque purified. The exons 3–9 were fully sequenced on both strands, and intron-exon boundaries were determined (Table I). The first two exons were not present, so the library was rescreened using a 340-bp probe 100 bp downstream of the initiating methionine. A clone (6B) was isolated that overlapped and contained both exons 1 and 2. Exons 1 and 2 were also sequenced on both strands, and the exon-intron boundaries were identified (Table I).

Transcription initiation site (TIS)

To ascertain the TIS in the murine CPN small subunit gene, primer extension analysis was performed as described in Materials and Methods. The primer-extended products were subjected to electrophoresis adjacent to a DNA-sequencing ladder generated using the same oligonucleotide as the primer. The template was a plasmid CPN.pe1 that contained 300 bp of exon 1 as well as 500 bp of DNA upstream of the gene. Analysis of the sequence revealed one major transcriptional initiation site with three minor bands present (Fig. 4). All four TIS were within 21 bp from each other, and the major initiation site was located 31 bp upstream of the 5' end of the ATCC-26K cDNA clone. These results indicate that the gene encodes 232 bp of 5'-untranslated sequence.

View larger version (52K): [in this window] [in a new window]   FIGURE 4. Determination of the TIS in the mouse CPN small subunit gene by primer extension. A radiolabeled oligonucleotide (40 mer), 150 bp downstream from the longest cDNA clone, was hybridized to mouse liver mRNA. Yeast tRNA was used as a control. After reverse transcriptase, the primer-extended products were subjected to electrophoresis adjacent to a DNA-sequencing ladder using the same oligonucleotide as primer. The one major TIS is indicated by an arrow, and three minor sites are indicated by circles. See Materials and Methods for experimental details.

The 5'-flanking sequence was determined by sequencing 916 bp upstream of the major TIS found on the -phage 6B (Fig. 5). Classical CAAT and TATA boxes were not observed, nor was there a GC-rich region. The lack of a TATA box is consistent with other CP genes, such as CPU (19) and CPH (20). The sequence was compared with known cis-sequence motifs that bind transcription factor proteins. The results included seven binding sites for hepatocyte nuclear factor 5 (HNF-5) (21), a binding site to CCAAT/enhancer binding protein (C/EBP) (21), and a binding site for AP-2, which can be a tissue-specific repressor (22, 23).

View larger version (38K): [in this window] [in a new window]   FIGURE 5. Analysis of the CPN small subunit 5'-flanking sequence. Shown is 916 bp of 5'-flanking sequence of the mouse CPN small subunit gene. This sequence was analyzed by the GCG Findpatterns program to determine sequence motifs known to bind transcription factors. The results included seven sites for HNF-5, a C/EBP site, and an AP-2 site (shown in bold). A bold arrow depicts the major hepatic TIS, while the small arrows represent the three minor sites. The start of the CPN gene is defined as +1, and exon one is present in bold. This sequence has been submitted to the GenBank/EMBL Data Bank with accession number AF326478.

The chromosome location of the CPN small subunit structural gene was determined by fluorescence in situ hybridization of digoxigenin-labeled CPN small subunit clones to mouse metaphase chromosome preparations. The probe specifically hybridized to the distal portion of chromosome 19 (Fig. 6). Measurements from 10 separate chromosomes, which hybridized specifically to the probe, confirmed that the mouse CPN small subunit gene is positioned at an area that corresponds to band 19D2.

View larger version (73K): [in this window] [in a new window]   FIGURE 6. Chromosomal localization of the mouse CPN small subunit gene by fluorescence in situ hybridization. Shown in the top panel is the fluorescence hybridization of CPN genomic clones to mouse metaphase chromosome 19D2 (small arrow). Cohybridizating probes specific to the centromeric region of mouse chromosome 19 (large arrow) confirmed the identity of the chromosome 19. The chromosomal band location of the mouse CPN small subunit gene is shown schematically in the lower panel.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

CPN is a member of a group of mammalian zinc CPs that have the ability to cleave carboxyl-terminal amino acids (2). This group can be separated based on sequence similarity into two subfamilies: 1) CPB, CPA, CPA2, mast cell CPA, and CPU; and 2) CPN, CPH, CPM, CPD, and CPZ. Although there is a low level of sequence identity between families, the active sites are conserved among the CPs (Fig. 7) (2). The only area not conserved is the amino acid involved in peptide specificity. From subfamily 1, CPA, CPA2, and mast cell CPA have an isoleucine that recognizes hydrophobic carboxyl-terminal amino acids. CPB and CPU of this subfamily have an aspartic acid residue, which interacts with lysine or arginine. The CPs in the CPN subfamily all have a glutamine residue in this position. Because subfamily 2 CPs also act on positively charged amino acids, it has been hypothesized that the glutamine undergoes posttranslational modification to a glutamic acid, or alternatively another negatively charged amino acid close by participates in peptide specificity (2).

View larger version (39K): [in this window] [in a new window]   FIGURE 7. Comparison of amino acid sequences in regions of high homology between common CPs. The amino acid sequences of six CPs were compared. The active sites are highly conserved, and amino acids that are involved in the binding of substrates (box 1) and zinc (box 2), as well as those that are responsible for the catalytic activity (box 4) and peptide specificity (box 3) are marked.

View larger version (20K): [in this window] [in a new window]   FIGURE 8. Comparison of CP gene structures. The gene structure of mouse CPN small subunit was compared with two other CP gene structures: rat CPB and rat CPH. The exons containing the amino acids involved in zinc binding (diamond), substrate binding (circle), and peptide specificity and catalytic activity (star) are noted on the gene structure.

In this work, a multitissue Northern blot was performed to determine expression of CPN. The results revealed a high level of expression in liver, but no expression in heart, brain, spleen, lung, skeletal muscle, kidney, and testis. This is in agreement with previous observations, which indicated that CPN expression was limited to the liver (2). In contrast, a recent publication by Sato et al. (27) documented expression not only in the liver, but also in the stomach, lung, intestine, spleen, and kidney by RT-PCR. Collectively, the combined results indicate that CPN is expressed predominately in the liver, if not exclusively, with perhaps much lower expression in certain other tissues that can be observed only by a sensitive RT-PCR assay.

Structural examination of the 5'-flanking sequence of the CPN gene revealed transcription factor binding sites involved in liver-specific expression. Nine transcription factor sites, which correspond to three different proteins, were located 916 bp upstream from the TIS. The three transcription factors were HNF-5, AP-2, and C/EBP. HNF-5 is a liver-specific transcription factor, which has seven recognition sites in the 5'-flanking region (21). Five of the seven sites, located 700 bp upstream of the TIS, overlapped. The second transcription factor site, located 650 bp from the TIS, was AP-2. AP-2 is expressed in nonliver cells and can function as a repressor (22) (23). For the serum amyloid A1 gene, AP-2 is a tissue-specific repressor, allowing expression in liver cells only. In the CPN gene, AP-2 may also play a suppressing role, limiting nonliver tissue expression. The third factor, C/EBP, is found in liver and adipose tissue (21). The C/EBP site is located 620 bp from the TIS and only 22 bp from the AP-2 site. The close proximity of the two sites could provide a means to block transcription in nonliver cells. Further work needs to be done to delineate which transcription factor sites are necessary for the expression and repression of the CPN gene.

The human chromosome locations of several CPs have been determined. For the CPB subfamily, CPU is found on chromosome 13, while CPA and mast cell CPA are located on chromosomes 7 and 3, respectively (26, 28, 29). In the CPN subfamily, CPN small subunit is on chromosome 10 (mouse 19), CPD is on chromosome 17 (mouse 11), and CPH and CPM are on chromosomes 4 and 12, respectively (13, 30, 31). Regardless of subfamilies, the CP genes are found throughout the genome with no conserved loci.

Many of the CPs have similar roles in vitro. Three CPs (CPN, cpm, and CPU) have been proposed to potentially have redundant in vivo functions as well. CPN and CPU are secreted into the bloodstream, while CPM is found on the cell membranes of various tissues, including blood vessels (2). All three are capable of interacting with vasoactive peptides, such as bradykinin or complement anaphylatoxins. CPU, unlike CPN and CPM, is secreted as a proenzyme whose known activators, plasmin and the thrombin-thrombomodulin complex, are members of the coagulation pathway (32). Whether CPU can be activated to cleave complement anaphylatoxins and kinins is not yet known. Another interesting discovery was the up-regulation of CPU, but not CPN, in LPS-challenged mice (27). Because many of the known substrates for these CPs are derived from acute phase proteins, it is plausible that CPU acts as a potent regulator of acute phase mediators. With the cDNA and gene structure of mouse CPN small subunit determined, further work can be done to delineate its role in vivo. An approach would be to make a CPN knockout mouse and determine whether CPN has unique function, or if it has redundant roles with other CPs.

	Acknowledgments

 
We gratefully acknowledge Dr. Scott Drouin, Dr. Irma Gigli, Dr. David Haviland, and Dr. Jens Kildsgaard for critical evaluation of data and text. We also thank Robert D. Matthews for countless hours of help with graphics and limitless moral support and Dr. Ronald Watts for years of expert mentoring.

	Footnotes

 
¹ This work was supported by National Institutes of Health Grant AI25011 and by American Heart Association National Grant-in-Aid 9950394 (both to R.A.W.). The sequence data presented in this article have been submitted to the EMBL/GenBank Data Libraries under the accession numbers AF326477 and AF326478.

² Address correspondence and reprint requests to Dr. Rick A. Wetsel, Institute of Molecular Medicine for the Prevention of Human Disease, University of Texas-Houston, 2121 West Holcombe Boulevard, Suite 907, Houston, TX 77030.

³ Abbreviations used in this paper: CPN, carboxypeptidase N; C/EBP, CCAAT/enhancer binding protein; HNF-5, hepatocyte nuclear factor 5; TIS, transcription initiation site.

Received for publication December 12, 2000. Accepted for publication March 5, 2001.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Levin, Y., R. A. Skidgel, E. G. Erdos. 1982. Isolation and characterization of the subunits of human plasma carboxypeptidase N (kininase I). Proc. Natl. Acad. Sci. USA 79:4618.[Abstract/Free Full Text]
2. Skidgel, R. A.. 1996. Structure and function of mammalian zinc carboxypeptidase. N. M. Hooper, ed. Zinc Metalloprotease in Health and Disease 241. Taylor and Francis, London.
3. Erdos, E. G., E. M. Sloane. 1962. An enzyme in human blood plasma that inactivates bradykinin and kallidins. Biochem. Pharmacol. 11:585.[Medline]
4. Erdos, E. G.. 1979. Bradykinin, kallidin and kallikrein. E. G. Erdos, ed. Handbook of Experimental Pharmacology 427. Springer-Verlag, Heidelberg.
5. Belew, M., G. B. Lindeberg, J. Porath, T. Saldeen, R. Wallin. 1980. Structure-activity relationships of vasoactive peptides derived from fibrin or fibrinogen degraded by plasmin. Biochim. Biophys. Acta 621:169.[Medline]
6. Bokisch, V. A., H. J. Muller-Eberhard. 1970. Anaphylatoxin inactivator of human plasma: its isolation and characterization as a carboxypeptidase. J. Clin. Invest. 49:2427.
7. Ember, J. A., M. A. Jagels, T. E. Hugli. 1998. Characterization of complement anaphylatoxins and their biological responses. M. Frank, and J. Volanakis, eds. Human Complement System in Health and Disease 241. Marcel Dekker, New York.
8. Wetsel, R. A., J. Kildsgaard, D. L. Haviland. 2000. Complement anaphylatoxins (C3a, C4a, C5a) and their receptors (C3aR, C5aR/CD88) as therapeutic targets in inflammation. J. D. Lambris, and V. M. Holers, eds. Therapeutic Interventions in the Complement System 113. Humana Press, Totowa.
9. Mathews, K. P.. 1986. Deficiencies in regulator proteins 4: anaphylatoxin inactivator. Prog. Allergy 39:344.[Medline]
10. Mathews, K. P., J. G. Curd, T. E. Hugli. 1986. Decreased synthesis of serum carboxypeptidase N (SCPN) in familial SCPN deficiency. J. Clin. Immunol. 6:87.[Medline]
11. Gebhard, W., S. Matthias, M. Eulitz. 1989. cDNA cloning and complete primary structure of the small, active subunit of human carboxypeptidase N. Eur. J. Biochem. 178:603.[Medline]
12. Tan, F., D. K. Weerasinghe, R. A. Skidgel, H. Tamei, R. K. Kaul, I. B. Roninson, J. W. Schilling, E. G. Erdos. 1990. The deduced protein sequence of the human carboxypeptidase N high molecular weight subunit reveals the presence of leucine-rich tandem repeats. J. Biol. Chem. 265:13.[Abstract/Free Full Text]
13. Riley, D. A., F. Tan, D. J. Miletich, R. A. Skidgel. 1998. Chromosomal localization of the genes for human carboxypeptidase D (CPD) and the active 50-kilodalton subunit of human carboxypeptidase N (CPN1). Genomics 50:105.[Medline]
14. Wetsel, R. A., D. T. Fleischer, D. L. Haviland. 1990. Deficiency of the murine fifth complement component 2-base pair gene deletion in a 5'-exon. J. Biol. Chem. 265:2435.[Abstract/Free Full Text]
15. Virca, G. D., W. Northemann, B. R. Shiels, G. Widera, S. Broome. 1990. Simplified Northern blot hybridization using 5% sodium dodecyl sulfate. BioTechniques 8:370.[Medline]
16. Lichter, P., C. J. Tang, K. Call, G. Hermanson, G. A. Evans, D. Housman, D. C. Ward. 1990. High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247:64.[Abstract/Free Full Text]
17. Sambrook J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual, Ch. 7. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, p. 79.
18. Lewin, B.. 1994. Building the transcription complex: promoters, factors, and RNA polymerases. Genes V 845. Oxford University Press, Oxford.
19. Boffa, M. B., T. S. Reid, E. Joo, M. E. Neshein, M. L. Koschinsky. 1999. Characterization of the gene encoding human TAFI (thrombin-activable fibrinolysis inhibitor; plasma procarboxypeptidase B). Biochemistry 38:6547.[Medline]
20. Jung, Y. K., C. J. Kunczt, R. K. Pearson, J. E. Dixon, L. D. Fricker. 1991. Structural characterization of the rat carboxypeptidase E gene. Mol. Endocrinol. 5:1257.[Abstract/Free Full Text]
21. Grange, T., J. Roux, G. Rigaud, R. Pictet. 1991. Cell-type specific activity of two glucocorticoid responsive units of rat tyrosine aminotransferase gene is associated with multiple binding sites for C/EBP and a novel liver-specific nuclear factor. Nucleic Acids Res. 19:131.[Abstract/Free Full Text]
22. Li, L., W. S. L. Liao. 1999. An upstream repressor element that contributes to hepatocyte-specific expression of the rat serum amyloid A1 gene. Biochem. Biophys. Res. Commun. 264:395.[Medline]
23. Ren, Y., S. A. G. Reddy, W. S. L. Liao. 1999. Purification and identification of a tissue-specific repressor involved in serum amyloid A1 gene expression. J. Biol. Chem. 274:37154.[Abstract/Free Full Text]
24. Clauser, E., S. J. Gardell, C. S. Craik, R. J. MacDonald, W. J. Rutter. 1988. Structural characterization of rat carboxypeptidase A1 and B genes. J. Biol. Chem. 263:17837.[Abstract/Free Full Text]
25. Gardell, S. J., C. S. Craik, E. Clauser, E. J. Goldsmith, C. B. Stewart, M. Graf, W. J. Rutter. 1988. A novel rat carboxypeptidase, CPA2: characterization, molecular cloning, and evolutionary implications on substrate specificity in the carboxypeptidase gene family. J. Biol. Chem. 263:17828.[Abstract/Free Full Text]
26. Reynolds, D. S., D. S. Gurley, K. F. Austen. 1992. Cloning and characterization of the novel gene for mast cell carboxypeptidase A. J. Clin. Invest. 89:273.
27. Sato, T., T. Miwa, H. Akatsu, N. Matsukawa, K. Obata, N. Okada, W. Campbell, H. Okada. 2000. Pro-carboxypeptidase R is an acute phase protein in the mouse, whereas carboxypeptidase N is not. J. Immunol. 165:1053.[Abstract/Free Full Text]
28. Tsai, S. P., D. Drayna. 1992. The gene encoding human plasma carboxypeptidase B (CPB2) resides on chromosome 13. Genomics 14:549.[Medline]
29. Honey, N. K., A. Y. Sakaguchi, P. A. Lalley, C. Quinto, W. J. Rutter, S. L. Naylor. 1986. Assignment of the gene for carboxypeptidase A to human chromosome 7q22-qter and to mouse chromosome 6. Hum. Genet. 72:27.[Medline]
30. Hall, C., E. Manser, N. K. Spurr, L. Lim. 1993. Assignment of the human carboxypeptidase E (CPE) gene to chromosome 4. Genomics 15:461.[Medline]
31. Kas, K., E. F. P. M. Schoenmakers, W. J. M. Van de Ven. 1995. Physical map location of the human carboxypeptidase M gene (CPM) distal to D12S375 and proximal to D12S8 at chromosome 12q15. Genomics 30:403.[Medline]
32. Bajzar, L., J. Morser, M. Nesheim. 1996. TAFI or plasma procarboxypeptidase B couples the coagulation and fibrinolytic cascades through the thrombin-thrombomodulin complex. J. Biol. Chem. 271:16603.[Abstract/Free Full Text]

This article has been cited by other articles:

				S. L. Mueller-Ortiz, D. Wang, J. E. Morales, L. Li, J.-Y. Chang, and R. A. Wetsel Targeted Disruption of the Gene Encoding the Murine Small Subunit of Carboxypeptidase N (CPN1) Causes Susceptibility to C5a Anaphylatoxin-Mediated Shock J. Immunol., May 15, 2009; 182(10): 6533 - 6539. [Abstract] [Full Text] [PDF]

				D. A. Davis, K. E. Singer, M. De La Luz Sierra, M. Narazaki, F. Yang, H. M. Fales, R. Yarchoan, and G. Tosato Identification of carboxypeptidase N as an enzyme responsible for C-terminal cleavage of stromal cell-derived factor-1{alpha} in the circulation Blood, June 15, 2005; 105(12): 4561 - 4568. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Matthews, K. W. Articles by Wetsel, R. A. Search for Related Content PubMed PubMed Citation Articles by Matthews, K. W. Articles by Wetsel, R. A.