The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kunz, B.
Right arrow Articles by Held, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kunz, B.
Right arrow Articles by Held, W.
The Journal of Immunology, 2001, 166: 6181-6187.
Copyright © 2001 by The American Association of Immunologists

Positive and Negative Roles of the Trans-Acting T Cell Factor-1 for the Acquisition of Distinct Ly-49 MHC Class I Receptors by NK Cells1

Béatrice Kunz and Werner Held2

Ludwig Institute for Cancer Research, Lausanne Branch, University of Lausanne, Epalinges, Switzerland


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Members of the Ly-49 gene family code for class I MHC-specific receptors that regulate NK cell function. Due to a combinatorial distribution of Ly-49 receptors, NK cells display considerable clonal heterogeneity. The acquisition of one Ly-49 receptor, Ly-49A is strictly dependent on the transcriptional trans-acting factor T cell-specific factor-1 (TCF-1). Indeed, TCF-1 binds to two sites in the Ly-49a promoter and regulates its activity, suggesting that the Ly-49a gene is a direct TCF-1 target. TCF-1 deficiency resulted in the altered usage of additional Ly-49 receptors. We show in this study, using TCF-1 {beta}2-microglobulin double-deficient mice, that these repertoire alterations are not due to Ly-49/MHC class I interactions. Our findings rather suggest a TCF-1-dependent, cell autonomous effect on the acquisition of multiple Ly-49 receptors. Besides reduced receptor usage (Ly-49A and D), we also observed no effect (Ly-49C) and significantly expanded (Ly-49G and I) receptor usage in the absence of TCF-1. These effects did not in all cases correlate with the presence of TCF binding sites in the respective proximal promoter. Therefore, besides TCF-1 binding to the proximal promoter, Ly-49 acquisition may also be regulated by TCF-1 binding to more distant cis-acting elements and/or by regulating the expression of additional trans-acting factors. Consistent with the observed differential, positive or negative role of TCF-1 for Ly-49 receptor acquisition, reporter gene assays revealed the presence of an inducing as well as a repressing TCF site in certain proximal Ly-49 promoters. These findings reveal an important role of TCF-1 for the formation of the NK cell receptor repertoire.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ly-49 receptors regulate NK cell function upon interaction with their cognate ligands on target cells. This receptor family includes both activating and inhibitory receptors that are specific for classical MHC class I molecules. The expression of inhibitory receptors prevents NK cells from attacking normal cells and enables them to detect autologous MHC class I loss variants. These receptors are thus important to maintain NK cell tolerance toward normal cells and to ensure reactivity toward aberrant cells. The role of activating Ly-49 receptors is less well known.

Members of the Ly-49 receptor family are highly homologous (59–91%), except Ly-49B, which is more distantly related (1, 2). Six family members were shown to recognize classical MHC class I molecules using functional and/or cell-cell adhesion assays. Although some Ly-49 receptors exhibit rather broad MHC class I cross-reactivity (e.g., Ly-49A, C, and I), others (Ly-49E, F, and G2) bind selectively to certain MHC class I alleles (3). Inhibitory Ly-49 receptors contain immunoreceptor tyrosine-based inhibitory motifs in their cytoplasmic domain, which are required to transduce the inhibitory signal. Two family members (Ly-49D and H) lack this motif. Upon engagement of MHC ligand and/or receptor cross-linking using mAbs, these receptors are able to activate NK cells via associated DAP-12 adaptor molecules (4, 5, 6).

The genes encoding Ly-49 family receptors are tightly clustered in the NK complex on mouse chromosome 6 (7, 8). To date, 10 Ly-49 genes have been shown to give rise to complete mRNAs in C57BL/6 mice. The expression of Ly-49 receptors is restricted to NK cells, NK T cells, and occasional conventional CD8+ T cells (9). In contrast to other multigene families, like MHC class I or II, the expression of Ly-49 genes is not coregulated. Individual Ly-49 receptors are expressed by partially overlapping subpopulations of 10–50% of peripheral NK cells (9). Ly-49B and Ly-49E receptors are expressed only by occasional (<2%) NK cells based on single cell RT-PCR analysis (10). Therefore, NK cells display some, but not all, of the available Ly-49 receptors (10), whereby receptor expression usually occurs from a single allele (11, 12). Indeed, coexpression of inhibitory Ly-49 receptors is detected at frequencies that are expected when the receptors are expressed independently and coexpression coincides (12, 13, 14).

Ly-49 receptors are acquired during NK cell development, and the bone marrow environment seems to play an important role in inducing Ly-49 receptor expression (15, 16). During development, Ly-49 receptors are acquired in an ordered fashion, one Ly-49 receptor at a time (17, 18, 19). At each stage, NK cells acquire a particular receptor in an all or none fashion. Once acquired, the patterns of Ly-49 expression in NK cells are stably maintained also through cell division (18, 20). In contrast, extinction of Ly-49 expression seems to occur in NK T cells to allow their maturation (21).

To obtain insights into the process of Ly-49 receptor distribution, we have begun to investigate the control over Ly-49 gene expression. We have previously shown that the Ly-49a promoter contains two sites for transcriptional trans-acting factors such as T cell factor-1 (TCF-1),3 denoted TCF sites I and II. rTCF-1 binds these sites in EMSAs, and TCF-1 binding regulates Ly-49a promoter activity. Indeed, the acquisition of the Ly-49A receptor in vivo is strictly dependent on TCF-1 based on the analysis of TCF-1-deficient mice (22). These findings suggested that TCF-1 binding to the Ly-49a promoter is a critical event for Ly-49A acquisition during NK cell development.

TCF-1 was discovered based on its binding to certain lymphocyte-specific enhancers. Although TCF-1 and related factors of the TCF lymphoid enhancer factor (LEF) family (which includes TCF-1, -3, -4, and LEF-1 in mammals) have no transactivation capacity on binding site multimers, they acquire the ability to activate transcription upon the association with {beta}-catenin (23, 24). TCF/{beta}-catenin complexes are formed transiently in response to wingless/wnt signaling and mediate the expression of TCF-dependent target genes (23, 24, 25, 26). In the absence of {beta}-catenin, TCFs act as transcriptional repressors due to their association with Groucho-related proteins (27). In the context of genes that are constitutively expressed, TCF-1 (and its homologue LEF-1) plays an architectural role independent of {beta}-catenin binding (28, 29). For instance, the minimal TCR{alpha} enhancer is regulated by the TCF/LEF-induced, context-dependent assembly of a higher order nucleoprotein complex (30). Similarly, Ly-49a promoter activity in a T cell line was regulated by TCF-1 in the absence of {beta}-catenin binding (22).

In contrast to Ly-49A usage, other members of the Ly-49 receptor family were not stringently dependent on TCF-1 (22). Nevertheless, the sizes of most Ly-49-defined NK cell subsets were altered in TCF-1-deficient mice. In this study, we have assessed the Ly-49 receptor repertoire in TCF-1/{beta}2-microglobulin ({beta}2m) double-deficient mice to rule out the possibility that these alterations are due to Ly-49/MHC class I interaction. The data suggest that TCF-1 positively regulates the acquisition of Ly-49A and D, and depresses Ly-49G and I, while Ly-49C is not affected. These findings suggest a dual role for TCF-1 in the formation of the NK cell receptor repertoire. They are discussed in the context of the structure and function of the proximal promoter region of the respective Ly-49 genes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

C57BL/6 (B6) (H-2b) and B10.D2 (H-2d) were purchased from Harlan Olac (Horst, The Netherlands). {beta}2m-deficient B6 mice were obtained from The Jackson Laboratory (Bar Harbor, ME). TCF-1 exon VII knockout and Ly-49A transgenic mice have been described (31, 32). All mice used in this study were homozygous for a B6-derived NK gene complex. This was initially ascertained by Southern blot analysis to detect an RFLP in the Ly-49a gene between 129Sv and B6 mouse strains (EcoRI-digested genomic DNA hybridized with a Ly-49A cDNA probe). In addition, the B6 origin of receptors encoded in the NK gene complex was ascertained using flow cytometry with B6 allele-specific mAbs A1 (Ly-49A) and PK136 (NK1.1). TCF-1-deficient {beta}2m-deficient, H-2b/d or Ly-49A transgenic mice were obtained by back-crossing to the respective strains and intercrossing. Appropriate offspring was identified using flow cytometry with mAbs specific for H-2Db (KH-95), H-2Dd (34.2.12) (PharMingen, San Diego, CA), or Ly-49A (JR9-318). Experimental mice were 8–12 wk old.

Flow cytometry

Spleen cell suspensions were passed over nylon wool columns. One million nonadherent cells were incubated with 24G2 (anti-CD16/32) hybridoma supernatant to reduce background. Cells were stained with a mixture of NK1.1 PE and CD3 cychrome plus appropriate combinations of FITC- or biotin-labeled anti-Ly-49 mAbs: SW5E6 (Ly-49C/I); 4D11 (Ly-49G), 4E5 (Ly-49D) (all from PharMingen), JR9-318 (Ly-49A) (33), and 4LO3911 (Ly-49C) (34). EL-4 T cell lymphoma cells were stained with FITC-labeled Ly-49 mAbs (listed above) and propidium iodide to exclude dead cells. In general, 5 x 104 live cells were analyzed on a FACSCalibur using CellQuest software for data evaluation (Becton Dickinson, San Jose, CA).

Cloning of 5' Ly-49 sequence

Genomic DNA sequence upstream of known Ly-49 cDNA sequences was isolated by PCR using sense primers that are specific for the published Ly-49a upstream sequence. Numbers indicate the position relative to the Ly-49a transcriptional start site (35): Ly-49a (-362), the XbaI site is underlined: sense, 5'-AAAA TCTAgA AAA ATg TAA Agg AAg ACT TCA CC. A second sense primer at the PstI site of Ly-49a is indicated in boldface in Fig. 3Go. These two primers were used individually in conjunction with gene-specific antisense primers specific for 5'-untranslated regions of different Ly-49 cDNAs. The sequence complementary to the primers is indicated in boldface in Fig. 3Go. The Ly-49a fragment was derived from clone 9-1 (35).



View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 3. Alignment of Ly-49 5'-flanking sequences. Ly-49 upstream regions are aligned with the corresponding Ly-49a sequence. The numbering is relative to the tsp of Ly-49a (35 ). The first base shown corresponds to -344 in the Ly-49a promoter, i.e., 28 bp downstream of the XbaI site in the Ly-49a promoter. All sequences except for Ly-49c contain these 28 bp from the Ly-49a promoter due to the primer used for amplification. The location of gene-specific antisense primers is shown in boldface. Dashes (-) indicate the absence of nucleotides. Previously available B6-derived cDNA sequences are underlined. Gray boxes depict consensus TCF-binding motifs (CTTTGA/TA/T) (TCF I and TCF II). The open box depicts an ATF-2 binding site, shown to contribute to the activity of the Ly-49a promoter (43 ). The tsp of Ly-49a was previously determined (35 ). Bent arrows indicate tsps that were determined in this study using 5'-RACE (for details, see Materials and Methods). Based on the 5' cDNA ends, a potential TATA-like core promoter element identified in Ly-49a (ATAAA, depicted as TATA) (35 ) is also present in Ly-49g. This motif is mutant in all other Ly-49 promoter regions, suggesting that they represent TATA-less promoters.

 
PCR was performed in a total volume of 30 µl using 100 ng of B6-derived tail DNA, 300 nM of each primer, and 1.5 U of AmpliTaq in 1x buffer supplied by the manufacturer (Roche Diagnostics, Rotkreuz, Switzerland). Conditions for PCR were 5 min at 92°C, then 40 cycles of 1 min at 92°C, 1 min at 55°C, 1 min at 72°C, and finally 5 min at 72°C. Amplification products were gel purified and cloned using the TA cloning kit (Invitrogen, Carlsbad, CA). To control for PCR and sequencing errors, three or more independent clones were completely sequenced on both strands.

The antisense PCR primers were chosen to yield amplification products derived from specific Ly-49 genes and to include known cDNA sequence. This allowed the assignment of upstream sequences to given Ly-49 cDNAs. Because very little sequence information was available for Ly-49d exon I, we have used the amplified genomic Ly-49d sequence to design an additional sense primer. This primer was used then used in conjunction with a Ly-49d-specific primer (36) on B6 NK cell cDNA templates to obtain additional 5'-untranslated Ly-49d cDNA sequence. This amplification product was cloned and sequenced. It matched the Ly-49d cDNA and confirmed the correct upstream sequence of the Ly-49d gene.

PCR products were obtained with Ly-49a (XbaI (-362)) together with the above antisense primers, except for Ly-49c, for which only a shorter fragment was amplified using the sense primer Ly-49a (PstI (-177)). An additional sense primer (Ly-49a (EcoRI (-1066)) further upstream did not yield any amplification products. Moreover, no specific amplification products were obtained for Ly-49e and Ly-49h.

The Ly-49a sequence (accession L13874) was previously reported (35). The sequences described in this report are accessible at GenBank: Ly-49c (AY026327), Ly-49d (AY026324), Ly-49f (AY026325), Ly-49g (AY026323), and Ly-49i (AY026326). They were initially aligned with Sequencher (Gene Codes, Ann Arbor, MI). Portions of the alignment were manually adjusted to accommodate gaps.

5'-rapid amplification of cDNA end (5'-RACE)

The 5' end of Ly-49 cDNAs was determined using 5'-RACE. Total cellular RNA was isolated from IL-2-activated NK cells using TRIzol (Gibco BRL, Basel, Switzerland). cDNA was prepared using avian myeloblastosis virus reverse transcriptase (Roche) and oligo(dT(12, 13, 14, 15, 16, 17, 18)) as primer (Pharmacia Biotech, Uppsala, Sweden). Tailing of the 5' cDNA end and nested PCR was performed using the 5'-RACE kit (Roche Diagnostics), according to the manufacturer’s instructions. For first-round PCR Ly-49 gene-specific antisense primers are described previously (36), and for the second round PCR the specific primers are indicated in Fig. 3Go (boldface). PCR products were cloned using the TA cloning kit (Invitrogen), and multiple independent clones were sequenced to determine the cDNA end. Bent arrows in Fig. 3Go indicate preferred transcriptional start sites. These correspond to three of four clones for Ly-49g (one clone ended ~50 nt more 3'), three of five (5' arrow) and two of five (3'arrow) for Ly-49d, and two of three for Ly-49c (one clone ended ~50 nt more 3').

Deletion, insertion, and mutation constructs

Deletion, insertion, and mutation constructs were generated by sequential PCR using the appropriate genomic clone as a template and the flanking oligos (shown above) in conjunction with the primers shown below.

Deletion of 20 bp from the Ly-49a promoter that eliminates TCF site II: Only the sense primer is shown, -118 CTg gCA CAA TAC gTT ACT TCA ggT TTC ATT Aag Cag -63.

Insertion of 20 bp from the Ly-49a promoter into the Ly-49f promoter (insertion bold): sense, 5'-TCT CTC CTT TgT TCT CAg GG TCA gAT TgC AAT Aag CAA TTT CC; antisense, CCT Cag AAC AAA ggA gAg A AAC AAC ATA TAg TAT Cag gTg g.

Mutation of TCF site I: Only the sense primer is shown; the region containing TCF site I is underlined (introduced mutations bold). Ly-49a, CTCTTTTTGATTTGTCGACGAGGAGGAGC; Ly-49f, CTCTTTTTGATTTGTCGAAGAGGAGG; Ly-49i, CTCTTTTTGATTTGTCGACAAGGAGG.

All constructs were sequenced to ensure that only the intended mutations were introduced.

Transfections and reporter gene assays

The 5' region (-362 (XbaI) to +44 (EcoRV)) of the Ly-49a gene (35) or corresponding fragments from the other Ly-49 genes were inserted into the luciferase (luc) reporter plasmid pGL3 (Promega, Madison, WI). Ten million cells were electroporated with 5 µg of the luc plasmid or a promoter-less luc construct. One microgram of a SV40 promoter green fluorescent protein (GFP) plasmid was included to control for the transfection efficiency. After 36 h, the cells were analyzed for GFP expression using flow cytometry or lysed to measure luc activity (Promega, Walliselleu, Switzerland). Specific reporter gene activation was determined relative to a promoter-less luc construct. Values were normalized to the percentage of GFP+ cells, as determined by flow cytometry.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ly-49 receptor usage in TCF-1-deficient mice lacking MHC class I molecules

Besides the striking effect on Ly-49A, we have previously observed additional, but more subtle alterations of Ly-49 receptor usage in TCF-1-deficient mice (22). To rule out the possibility that the NK cell receptor repertoire in these mice was skewed based on Ly-49/MHC class I interactions, we generated double-deficient mice, which lack TCF-1 as well as class I MHC molecules (due to the targeted disruption of the {beta}2m gene). As shown in Fig. 1Go, in the absence of class I MHC molecules, the Ly-49 receptor repertoire of TCF-1+ and TCF-1- mice was significantly different. The frequency of Ly-49A-expressing NK cells was reduced ~10- to 20-fold in Tcf-1 mutant as compared with wild-type mice (Fig. 1GoA). In contrast, Ly-49C/I-expressing NK cells (identified by mAb 5E6) were significantly more abundant in the absence of TCF-1. This, together with the observation that the Ly-49C subset (identified by mAb 4LO431) was not significantly altered, suggests a positive effect on Ly-49I usage in the absence of TCF-1. Similarly, Ly-49G usage was increased, while the NK cell subset defined by the activating Ly-49D receptor was reduced ~3-fold in the absence of TCF-1 (Fig. 1GoB). Therefore, in the absence of MHC class I molecules, TCF-1 deficiency results in positive and negative effects on Ly-49 receptor usage.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 1. Ly-49 receptor usage in {beta}2m/TCF-1 double-deficient mice. A, Splenocytes from TCF-1/{beta}2m double-deficient mice were enriched for NK cells by nylon wool nonadherence and stained with mAbs against CD3 and NK1.1 (upper panel). Percentage of Ly-49A+ cells was determined among CD3- NK1.1+ NK cells (lower panel). B, Bar graphs depict the percentage of Ly-49+ NK cells among CD3- NK1.1+ NK cells in spleens of seven or more mice of the indicated genotypes. Ly-49C estimates represent single determinations. Corresponding results, i.e., no difference in Ly-49C usage between TCF-1+ and TCF-1- mice, were obtained in H-2b and H-2b/d background mice. *, Indicates statistically significant differences (p < 0.001) between TCF-1- NK cells of {beta}2m-sufficient and {beta}2m-deficient mice. C, Ly-49 receptor coexpression in the absence of TCF-1. The percentage of Ly-49A vs Ly-49C/I usage was determined among gated splenic CD3- NK1.1+ NK cells of TCF-1-deficient and TCF-1-sufficient H-2b mice. Numbers indicate percentage of positive cells in the respective quadrants. The number in brackets depicts the expected frequency of double expressors if coexpression coincides. This number corresponds to the product of the Ly-49A and Ly-49C/I frequencies.

 
To test whether it is the absence of TCF-1 or of Ly-49A that is responsible for the altered representation of the remaining Ly-49 receptors, we have generated Ly-49A transgenic, TCF-1-deficient mice. Transgene expression did not significantly alter endogenous Ly-49 usage in TCF-1-deficient mice (data not shown), suggesting that the Ly-49 receptor repertoire is skewed due to TCF-1, and not indirectly due to Ly-49A deficiency.

Finally, NK cells seem to express distinct Ly-49 receptors independently, based on the observation that the extent of receptor coexpression fits well with coincident coexpression (13, 14). Even though the sizes of individual Ly-49-defined NK cell subsets are significantly altered in TCF-1-deficient mice, coexpression of Ly-49 receptors was still observed at the expected frequencies, which indicate independent regulation of Ly-49 receptors (Fig. 1GoC and data not shown). Therefore, the lack of Ly-49A acquisition from the endogenous locus does not per se affect the acquisition of other Ly-49 receptors, and the lack of TCF-1 does not globally alter Ly-49 coexpression patterns. Collectively, these findings suggest that TCF-1 independently affects the acquisition of multiple Ly-49 receptors during NK cell development.

Isolation and analysis of Ly-49 promoter regions

We have previously shown that the TCF-1 dependence of Ly-49A acquisition correlated with the presence of two TCF binding sites in the proximal Ly-49a promoter (22). To begin to assess the basis for the altered usage of other Ly-49 family receptors in TCF-1-deficient mice, we have isolated upstream regions of five additional Ly-49 genes. This was achieved using primers specific for the Ly-49a promoter in combination with primers for individual Ly-49 genes, allowing us to PCR amplify Ly-49 upstream regions from genomic B6 DNA templates (Fig. 2Go). The longest amplification products obtained were ~400 bp, which corresponds to the XbaI-EcoRV fragment of the Ly-49a promoter (see Fig. 2Go). For Ly-49c, we obtained a shorter, 200-bp upstream fragment corresponding to the PstI-EcoRV fragment of the Ly-49a promoter. The alignment of Ly-49a with the novel sequences revealed three patterns (Fig. 3Go). First, Ly-49a-like sequences include Ly-49a and Ly-49g. These sequences contain two consensus TCF-1 binding sites (CTTTGA/TA/T) that are referred to as TCF I and II. Second, Ly-49c-like sequences (including Ly-49c, Ly-49f, and Ly-49i) are characterized by a 20-bp deletion that comprises in its center and consequently eliminates TCF site II. TCF site I is retained in Ly-49i and Ly-49f, but mutant in Ly-49c. Third, the Ly-49d upstream region resembles Ly-49a (i.e., it contains the above 20-bp sequence); however, both consensus TCF sites are mutant (Fig. 3Go, and schematic representation in Fig. 4Go). Because Ly-49D usage is significantly reduced in TCF-1-deficient mice, these latter findings suggest that TCF-1-dependent effects may also be indirect (i.e., based on deregulated expression of additional transcription factors) or be exerted by TCF-1 binding to cis-acting elements that are located elsewhere in the gene.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 2. Strategy to isolate Ly-49 promoters. Schematic representation of the Ly-49a upstream region. Restriction sites (R, EcoRI; X, XbaI, P, PstI; V, EcoRV) and their position relative to the tsp are shown (not to scale) (22 35 ). Open boxes represent consensus CTTTGA/TA/T motifs that can bind trans-acting factors such as TCF-1. Arrowheads indicate Ly-49a-specific sense primers that were used in conjunction with antisense primers (open arrow) complementary to the 5'-untranslated regions of the respective Ly-49 cDNAs. For further details, see Materials and Methods.

 


View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 4. Reporter gene activation by Ly-49 promoters. Approximately 400 bp of upstream sequence of the various Ly-49 genes were fused to a luciferase (luc) reporter gene. Rectangles indicate the location of consensus TCF sites, circles the presence of the putative TATA box. The thin line bridging gaps indicates deletions. Resulting plasmids were transiently transfected into EL-4 thymoma or A20 B lymphoma cells. Specific reporter gene activation was determined relative to a promoter-less luc construct. Data indicate mean of fold-specific induction (±SD) of three or more independent experiments.

 
A preliminary analysis of the 5' end of Ly-49 cDNAs identified preferred transcriptional start points (tsps) in several Ly-49 genes. These are located in 83% of all clones 18–22 nt downstream of the one previously reported for Ly-49a (bent arrows in Fig. 3Go) (for details, see Materials and Methods). Ly-49i cDNAs extended into the TATA box region; however, this analysis may have been biased for such products because the primer covered the major initiation site present in other Ly-49 genes. The data are compatible with the presence of a TATA-like (ATAAAA) core promoter element in Ly-49a and Ly-49g; however, the remaining Ly-49 promoters appear to be TATA-less. Moreover, the upstream sequences reported in this work do indeed contain promoter elements.

Regulation of Ly-49 promoters by TCF site II

To delineate a role for TCF binding sites that are located in proximal Ly-49 promoters, we have first compared the activity of the different Ly-49 promoters using reporter gene assays in the Ly-49A-expressing T cell lymphoma EL-4. Preliminary experiments indicated that the ~400-bp (XbaI-EcoRV) Ly-49a promoter fragment was sufficient to confer efficient reporter gene activation in EL-4 cells (data not shown). Similar to Ly-49a, the Ly-49g upstream regions conferred robust (30-fold) reporter gene activation in EL-4 T cells, but not in control A20 B cells (Fig. 4Go). In contrast, reporter gene activation by the Ly-49f (10-fold) and Ly-49i (3-fold) promoters was considerably less efficient, while Ly-49d was completely inactive (Fig. 2Go). Therefore, the functional differences in reporter gene assays seem to reflect structural differences in Ly-49 promoters.

The presence of TCF site II in proximal promoters correlated with efficient reporter gene activation (Fig. 4Go). Indeed, point mutations in TCF site II significantly reduced Ly-49a promoter activity (22). Natural promoters such as Ly-49c, Ly-49i, and Ly-49f lack TCF site II due to a 20-bp deletion. To further address the importance of TCF site II, the respective 20 bp was deleted from the Ly-49a promoter. This deletion resulted in a considerably reduced activity of the Ly-49a promoter (~4-fold) (Fig. 5Go). In a reciprocal experiment, we tested whether TCF site II was able to restore strong reporter gene activation by a Ly-49 promoter that lacked it. To this end, we introduced the 20 bp of the Ly-49a promoter-containing TCF site II into Ly-49f. Indeed, the Ly-49f insertion construct conferred efficient reporter gene activation in EL-4 cells (Fig. 5Go). The presence of the 20-bp stretch is thus necessary for efficient Ly-49 promoter activity in EL-4 cells, suggesting that TCF site II can significantly contribute to the activity of Ly-49 promoters.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 5. Regulation of reporter gene activity by TCF site II. The region corresponding to the 20-bp deletion found in Ly-49c, f, and i, which includes TCF site II, was deleted from the Ly-49a promoter using sequential PCR. The respective 20 bp from Ly-49a were inserted into Ly-49f. Rectangles indicate the location of consensus TCF sites, circles the presence of the putative TATA box. The thin line bridging gaps indicates deletions. The resulting luc reporter gene constructs were transiently transfected into EL-4 and A20 cells. Specific reporter gene activation was determined relative to a promoter-less luc construct. Data indicate mean of fold-specific induction (±SD) of three or more independent experiments.

 
Regulation of Ly-49 promoters by TCF site I

NK cells expressing certain Ly-49 receptors were overrepresented in the absence of TCF-1, raising the possibility that TCF-1 can inhibit Ly-49 acquisition. Because the Ly-49i promoter contains a single consensus TCF site (Figs. 3Go and 4Go), we hypothesized that TCF-1 binding to this site was inhibitory. To address this, we took advantage of a modified Ly-49a promoter, in which the 20 bp surrounding TCF site II were deleted and that had retained residual activity (Fig. 5Go). Reporter gene activation by this construct was compared with the corresponding construct in which TCF site I was mutated. Control experiments using EMSA assays ensured that the mutation of TCF site I abrogated the binding of rTCF-1 (22) or nuclear extract from EL-4 cells (data not shown). Indeed, the construct with the mutant TCF site I displayed significantly higher reporter gene activation in EL-4 cells compared with the construct with a wild-type TCF site I (>2-fold increase) (Fig. 6Go).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 6. Regulation of reporter gene activity by TCF site I. TCF site I was mutated in the Ly-49a, Ly-49f, and Ly-49i promoters. It was also mutated in the Ly-49a construct from which TCF site II has been deleted. Rectangles indicate the location of consensus TCF sites, circles the presence of the putative TATA box. The thin line bridging gaps indicates deletions. The resulting luciferase reporter gene constructs were transiently transfected into EL-4. Specific reporter gene activation was determined relative to a promoter-less luciferase construct. Data indicate mean of fold-specific induction (±SD) of four independent experiments.

 
To ensure that the inhibition by TCF site I was true for natural Ly-49 promoters, the respective site was also mutated in the Ly-49f and Ly-49i promoters. Again, the TCF site I mutant Ly-49f promoter was significantly more effective in reporter gene assays than its wild-type counterpart (~4-fold) (Fig. 6Go). Ly-49i activity was not increased upon the elimination of TCF site I (Fig. 6Go). Indeed, Ly-49i activity (of 129/J origin) may be repressed in EL-4 cells by sequences upstream of the PstI site (37). Our data thus provide evidence that in the absence of TCF II, TCF site I can negatively influence Ly-49 promoter function. Therefore, the functional studies using EL-4 cells revealed the potential of two cis-acting elements in proximal Ly-49 promoters, TCF sites II and I, to influence promoter function in a positive or a negative fashion, respectively. In extension, they may help to explain why TCF-1 deficiency can influence Ly-49 receptor acquisition in both positive and negative ways.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We show in this study that in the absence of MHC class I expression, the lack of TCF-1 results in contracted (Ly-49A and Ly-49D), expanded (Ly-49I and Ly-49G), or unaltered (Ly-49C) NK cell subsets expressing Ly-49 receptors. Additional experiments suggest that these effects are unrelated to the absence of Ly-49A protein or the failure to express the endogenous Ly-49a locus. The failure to acquire Ly-49A is indeed due to the lack of TCF-1 in the NK cells themselves, and not environment in which these develop (22). The TCF-1-dependent effects on Ly-49 usage are not readily mirrored by the gene order in the Ly-49 cluster (Ly-49d-//- Ly-49i- Ly-49g-//- Ly-49c- Ly-49a) (7, 8)). They seem also unrelated to the presumed order in which these receptors are acquired during NK cell development (A->G->C/I->D) (5, 17, 18). Our findings suggest that TCF-1 deficiency results in a cell autonomous defect, which independently perturbs the acquisition of multiple Ly-49 receptors.

Based on the TCF-1 dependence of Ly-49A acquisition in vivo, together with the presence of two consensus TCF sites in the proximal Ly-49a promoter, which bind TCF-1 and regulate promoter function (22), we have isolated and analyzed additional Ly-49 promoters. Indeed, inhibitory Ly-49 receptors that displayed an altered usage in TCF-1-deficient mice contained at least one TCF binding site. Surprisingly, however, no consensus TCF binding site was present in the proximal Ly-49d promoter, while Ly-49D usage was clearly reduced in the absence of TCF-1 in vivo. Therefore, in addition to a direct action of TCF-1 on proximal promoters, as suggested for Ly-49a, we have to consider the possibility that TCF-1-dependent effects may also be exerted by TCF-1 binding to cis-acting elements that are located elsewhere in the gene. In addition, it is possible that TCF-1-dependent effects may be indirect, i.e., based on deregulated expression of additional transcription factors. There is indeed some evidence that the regulation of activating Ly-49 receptors may differ from their inhibitory counterparts. Activating Ly-49 receptors are not expressed in NK T cells, and the extent of their coexpression deviates from the predicted value that indicates independent expression (5, 38).

Whatever the precise TCF-1 target, Ly-49 promoters seem to control important aspects of Ly-49 gene expression. The activity of the Ly-49a promoter strictly correlated with endogenous Ly-49A usage in cell lines (22). Moreover, the expression of Ly-49A and G by EL-4 cells correlated with the efficient activity of the respective (but not other) promoters. The promoter may thus be important to control tissue specificity of Ly-49 expression. The functional studies also revealed an important role of TCF binding sites to regulate Ly-49 promoter function. Site II was required for efficient function of proximal Ly-49 promoters (Fig. 5Go). Notably, this site was absent in three Ly-49 promoters due to a 20-bp deletion. This deletion removes exactly two turns of the DNA helix, leaving trans-acting factors bound adjacent to this site in phase, yet bringing them into proximity. Interestingly, that is the proposed role of TCF/LEF factors in the TCR{alpha} enhancer: DNA binding induces a bend in the DNA helix, which brings proteins bound to sites surrounding TCF/LEF sites into proximity (30).

In the absence of TCF II due to a 20-bp deletion, we observed that the remaining TCF site I repressed promoter function (Fig. 6Go). The deletion of TCF II seemed to be important for the repressing function of TCF I. The latter site failed to repress in the presence of TCF II or in its absence due to the introduction of point mutations (Fig. 6Go) (22). These findings demonstrate that distinct TCF sites can modulate promoter function in a positive or negative fashion. However, the precise role of TCF sites is influenced by their context. In extension, the data help to explain why TCF-1 is required for the acquisition of certain Ly-49 receptors, while it suppresses others. Although these findings illustrate the principle, there remain differences between the in vitro and in vivo data (see below). Perhaps these arise because transient transfections reveal the architectural function of TCF-1. The role of TCF-1 during Ly-49 receptor acquisition may be to make chromatin accessible and to allow additional transcription factors to bind the promoter (39). The dual role of TCFs has become apparent in cell fate determination during Xenopus and Drosophila development. Target gene induction is mediated by the wnt-dependent association of TCFs with {beta}-catenin (23, 24). In the absence of wnt signals and consequently intracellular free {beta}-catenin, target gene expression is repressed via the interaction of TCFs with Groucho-related proteins (27), CBP (40), or NEMO-like kinase (41). It will thus be important to determine whether Ly-49 receptor acquisition is influenced by TCF cofactors.

Like Ly-49a, the Ly-49g promoter contained two TCF sites (Fig. 3Go). However, unlike Ly-49A, Ly-49G usage was increased in TCF-1-deficient mice (Fig. 1Go). Because preliminary experiments indicate that Ly-49g promoter activity is also dependent in part on TCF site II (not shown), it is possible that in the absence of TCF-1, Ly-49G acquisition is ensured by another trans-acting factor that can bind TCF sites, such as LEF-1. Indeed, TCF-1 and LEF-1 have identical DNA-binding specificity and LEF-1 can substitute for TCF-1 to mediate TCR{alpha} enhancer function (42). We are thus currently testing whether in addition to TCF-1, LEF-1 is playing a role for the formation of the Ly-49 receptor repertoire. In addition, one of the differences between the Ly-49a and Ly-49g promoter sequences may affect ATF-2 binding to the Ly-49g promoter. In the Ly-49a promoter, ATF-2 binds a nonconsensus cAMP-responsive element and regulates promoter activity (43). Because the TCF site I and the ATF-2 binding site in the Ly-49a promoter overlap partially (see Fig. 3Go), it is possible that ATF-2 binding can prevent TCF-1 binding to the inhibitory site I in the Ly-49a, but not the Ly-49g promoter. In this way, TCF-1 might be able to depress Ly-49G, but not Ly-49A usage.

Promoter diversity and the formation of the Ly-49 receptor repertoire

When considering only the presence/absence of the two consensus TCF-binding motifs, we find four different configurations among the six Ly-49 promoters (see Fig. 2Go and schematic representation in Fig. 3Go), demonstrating considerable heterogeneity among Ly-49 promoters. The implication of TCF-1 suggests a role for additional factors for Ly-49 promoter function and/or the developmentally regulated Ly-49 acquisition process. As pointed out above, TCF-1 has no transactivation capacity by itself. In the minimal TCR{alpha} enhancer, TCF-1 and its homologue LEF-1 function in collaboration with additional transcription factors of the ets, cAMP response element-binding protein, and core binding factor families (28, 30, 44). The fact that Ly-49 promoter sequences (and relevant elements therein) display diversity provides circumstantial evidence that differential Ly-49 receptor expression in NK cells may be mediated via the differential yet partially conserved presence and occupancy of protein-binding sites in Ly-49 promoters. Therefore, distinct Ly-49 genes may be controlled by partially overlapping sets of DNA-binding factors. Ly-49 receptor acquisition during NK cell development may occur when an appropriate factor complex forms at a given promoter. The formation of this complex would be required to initiate Ly-49 receptor expression in an all or none fashion. That event may occur with a low probability, accounting for the relatively low rate of Ly-49 receptor acquisition during NK cell development. We propose that TCF-1 influences positively or negatively the formation of this putative complex at Ly-49 promoters.

Note added in proof. The sequence assigned here to Ly-49i corresponds to Ly-49j (45). The Ly-49i sequence has the same configuration of TCF/LEF sites as Ly-49j.


    Acknowledgments
 
We thank H. Clevers for providing TCF-1-deficient mice; J. Roland and S. Lemieux for providing mAbs; and J.-C. Cerottini, V. Ioannidis, F. Radtke, and J. Zimmer for critical reading of the manuscript.


    Footnotes
 
1 W.H. is the recipient of a START fellowship and supported in part by a grant from the Swiss National Science Foundation. Back

2 Address correspondence and reprint requests to Dr. Werner Held, Ludwig Institute for Cancer Research, 155 Ch. des Boveresses, 1066 Epalinges, Switzerland. Back

3 Abbreviations used in this paper: TCF, T cell factor; {beta}2m, {beta}2-microglobulin; GFP, green fluorescent protein; LEF, lymphoid enhancer factor; 5'-RACE, 5'-rapid amplification of cDNA end; tsp, transcriptional start point. Back

Received for publication September 14, 2000. Accepted for publication March 12, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Smith, H. R. C., F. M. Karlhofer, W. M. Yokoyama. 1994. Ly-49 multigene family expressed by IL-2-activated NK cells. J. Immunol. 153:1068.[Abstract]
  2. Wong, S., J. D. Freeman, C. Kelleher, D. Mager, F. Takei. 1991. Ly-49 multigene family: new members of a superfamily of type II membrane proteins with lectin-like domains. J. Immunol. 147:1417.[Abstract]
  3. Hanke, T., H. Takizawa, C. W. McMahon, D. H. Busch, E. G. Pamer, J. D. Miller, J. D. Altman, Y. Liu, D. Cado, F. A. Lemonnier, et al 1999. Direct assessment of MHC class I binding by seven Ly49 inhibitory NK cell receptors. Immunity 11:67.[Medline]
  4. Nakamura, M. C., P. A. Linnemeyer, E. C. Niemi, L. H. Mason, J. R. Ortaldo, J. C. Ryan, W. E. Seaman. 1999. Mouse Ly49D recognizes H-2Dd and activates natural killer cell cytotoxicity. J. Exp. Med. 189:493.[Abstract/Free Full Text]
  5. Smith, H. R. C., H. H. Chuang, L. L. Wang, M. Salcedo, J. W. Heusel, W. M. Yokoyama. 2000. Nonstochastic coexpression of activation receptors on murine natural killer cells. J. Exp. Med. 191:1341.[Abstract/Free Full Text]
  6. Smith, K. M., J. Wu, A. B. H. Bakker, J. H. Phillips, L. L. Lanier. 1998. Ly49-D and Ly49-H associate with mouse DAP12 and form activating receptors. J. Immunol. 161:7.[Abstract/Free Full Text]
  7. Brown, M. G., S. Fulmek, K. Matsumoto, R. Cho, P. A. Lyons, E. R. Levy, A. A. Scalzo, W. M. Yokoyama. 1997. A 2-Mb YAC contig and physical map of the natural killer gene complex on mouse chromosome 6. Genomics 42:16.[Medline]
  8. McQueen, K. L., J. D. Freeman, F. Takei, D. L. Mager. 1998. Localization of five new Ly49 genes, including three closely related to Ly49c. Immunogenetics 48:174.[Medline]
  9. Coles, M. C., C. W. McMahon, H. Takizawa, D. H. Raulet. 2000. Memory CD8 T lymphocytes express inhibitory MHC-specific Ly49 receptors. Eur. J. Immunol. 30:236.[Medline]
  10. Kubota, A., S. Kubota, S. Lohwasser, D. L. Mager, F. Takei. 1999. Diversity of NK cell receptor repertoire in adult and neonatal mice. J. Immunol. 163:212.[Abstract/Free Full Text]
  11. Held, W., J. Roland, D. H. Raulet. 1995. Allelic exclusion of Ly49 family genes encoding class I-MHC-specific receptors on NK cells. Nature 376:355.[Medline]
  12. Held, W., B. Kunz. 1998. An allele-specific, stochastic gene expression process controls the expression of multiple Ly49 family genes and generates a diverse, MHC-specific NK cell receptor repertoire. Eur. J. Immunol. 28:2407.[Medline]
  13. Held, W., J. R. Dorfman, M.-F. Wu, D. H. Raulet. 1996. Major histocompatibility complex class I dependent skewing of the natural killer cell Ly49 receptor repertoire. Eur. J. Immunol. 26:2286.[Medline]
  14. Raulet, D. H., W. Held, I. Correa, J. Dorfman, M.-F. Wu, L. Corral. 1997. Specificity, tolerance and developmental regulation of natural killer cells defined by expression of class I specific Ly49 receptors. Immunol. Rev. 155:41.[Medline]
  15. Williams, N. S., T. A. Moore, J. D. Schatzle, I. J. Puzanov, P. A. Sivakumar, A. Zlotnik, M. Bennett, V. Kumar. 1997. Generation of lytic natural killer 1.1+, Ly49- cells from multipotent murine bone marrow progenitors in a stroma-free culture: definition of cytokine requirements and developmental intermediates. J. Exp. Med. 186:1609.[Abstract/Free Full Text]
  16. Williams, N. S., J. Klem, I. J. Puzanov, P. V. Sivakumar, M. Bennett, V. Kumar. 1999. Differentiation of NK1.1+, Ly49+ NK cells from flt3+ multipotent progenitor cells. J. Immunol. 163:2648.[Abstract/Free Full Text]
  17. Dorfman, J. R., D. H. Raulet. 1998. Acquisition of Ly49 receptor expression by developing natural killer cells. J. Exp. Med. 187:609.[Abstract/Free Full Text]
  18. Roth, C., J. Carlyle, H. Takizawa, D. H. Raulet. 2000. Clonal acquisition of inhibitory Ly49 receptors on developing NK cells is successively restricted and regulated by stromal class I MHC. Immunity 13:143.[Medline]
  19. Williams, N. s., A. Kubota, M. Bennett, V. Kumar, F. Takei. 2000. Clonal analysis of NK cell development from bone marrow progenitors in vitro: orderly acquisition of receptor gene expression. Eur. J. Immunol. 30:2074.[Medline]
  20. Held, W., D. H. Raulet. 1997. Expression of the Ly49A gene in murine natural killer cell clones is predominantly but not exclusively mono-allelic. Eur. J. Immunol. 27:2876.[Medline]
  21. MacDonald, H. R., R. K. Lees, W. Held. 1998. Developmentally regulated extinction of Ly-49 receptor expression permits maturation and selection of NK1-1+ T cells. J. Exp. Med. 187:2109.[Abstract/Free Full Text]
  22. Held, W., B. Kunz, B. Lowin-Kropf, M. van de Wetering, H. Clevers. 1999. Clonal acquisition of the Ly49A NK cell receptor is dependent on the trans acting factor TCF-1. Immunity 11:433.[Medline]
  23. Behrens, J., J. P. von Kries, M. Kühl, L. Bruhm, D. Wedlich, R. Grosschedl, W. Birchmeier. 1996. Functional interaction of {beta}-catenin with the transcription factor LEF-1. Nature 382:638.[Medline]
  24. Molenaar, M., M. van de Wetering, M. Oosterwegel, J. Peterson-Maduro, V. Korinek, J. Roose, O. Destree, H. Clevers. 1996. XTcf-3 transcription factor mediates {beta}-catenin-induced axis formation in Xenopus embryos. Cell 86:391.[Medline]
  25. Brannon, M., M. Gomperts, L. Sumoy, R. T. Moon, D. Kimelman. 1997. A {beta}-catenin/X-Tcf-3 complex binds to the siamois promoter to regulate dorsal axis specification in Xenopus. Genes Dev. 11:2359.[Abstract/Free Full Text]
  26. Riese, J., X. Yu, A. Munnerlyn, S. Eresh, S.-C. Hsu, R. Grosschedl, M. Bienz. 1997. Lef-1, a nuclear factor coordinating signaling inputs from wingless and decapentaplegic. Cell 88:777.[Medline]
  27. Roose, J., M. Molenaar, J. Peterson, J. Hurenkamp, H. Brantjes, P. Moerer, M. van de Wetering, O. Destrée, H. Clevers. 1998. The Xenopus Wnt effector XTcf-3 interacts with Groucho-related transcriptional repressors. Nature 395:608.[Medline]
  28. Van de Wetering, M., J. Gastrop, V. Korinek, H. Clevers. 1996. Extensive alternative splicing and dual promoter usage generate TCF-1 protein isoforms with differential transcription control properties. Mol. Cell. Biol. 16:745.[Abstract/Free Full Text]
  29. Hsu, S.-H., J. Galceran, R. Grosschedl. 1998. Modulation of transcriptional regulation by LEF-1 in response to Wnt-1 signaling and association with {beta}-catenin. Mol. Cell. Biol. 18:4807.[Abstract/Free Full Text]
  30. Giese, K., C. Kingsley, J. R. Kirshner, R. Grosschedl. 1995. Assembly and function of a TCR{alpha} enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions. Genes Dev. 9:995.[Abstract/Free Full Text]
  31. Verbeek, S., D. Izon, F. Hofhuis, E. Robanus-Maandag, H. te Riele, M. van de Wetering, M. Oosterwegel, A. Wilson, H. R. MacDonald, H. Clevers. 1995. An HMG-box-containing T-cell factor required for thymocyte differentiation. Nature 374:70.[Medline]
  32. Held, W., D. H. Raulet. 1997. Ly49A transgenic mice provide evidence for a major histocompatibility complex-dependent education process in natural killer cell development. J. Exp. Med. 185:2079.[Abstract/Free Full Text]
  33. Roland, J., P. A. Cazenave. 1992. Ly-49 antigen defines an {alpha}{beta} TCR population in i-IEL with an extrathymic maturation. Int. Immunol. 4:699.[Abstract/Free Full Text]
  34. Gosslin, P., Y. Lusignana, J. Brennan, F. Takei, S. Lemieux. 1997. The NK2.1 receptor is encoded by Ly49C and its expression is regulated by MHC class I alleles. Int. Immunol. 9:533.[Abstract/Free Full Text]
  35. Kubo, S., Y. Itoh, N. Ishikawa, R. Nagasawa, T. Mitarai, N. Maruyama. 1993. The gene encoding mouse lymphocyte antigen Ly-49: structural analysis and the 5'-flanking sequence. Gene 136:329.[Medline]
  36. Toomey, J. A., S. Shrestha, S. A. de la Rue, F. Gayes, J. H. Robinson, Z. M. A. Chrzanowska-Lightowlers, C. Brooks. 1998. MHC class I expression protects target cells from lysis by Ly49-deficient fetal NK cells. Eur. J. Immunol. 28:47.[Medline]
  37. Gosslin, P., A. P. Makrigiannis, R. Nalewik, S. K. Anderson. 2000. Characterization of the Ly49I promoter. Immunogenetics 51:326.[Medline]
  38. Ortaldo, J. R., R. Winkler-Pickett, A. T. Mason, L. H. Mason. 1998. The Ly49 family: regulation of cytotoxicity and cytokine production in murine CD3+ cells. J. Immunol. 160:1158.[Abstract/Free Full Text]
  39. Hernandez-Munain, C., J. L. Roberts, M. Krangel. 1998. Cooperation among multiple transcription factors is required for access to minimal T-cell receptor {alpha}-enhancer chromatin in vivo. Mol. Cell. Biol. 18:3223.[Abstract/Free Full Text]
  40. Waltzer, L., M. Bienz. 1998. Drosophila CBP represses the transcription factor TCF to antagonize wingless signalling. Nature 395:521.[Medline]
  41. Ishitani, T., J. Ninomiya-Tsuji, S. Nagai, M. Nishita, M. Meneghini, N. Barker, M. Waterman, B. Bowerman, H. Clevers, H. Shibuya, K. Matsumoto. 1999. The TAK1-NLK-MAPK-related pathway antagonizes signalling between {beta}-catenin and transcription factor TCF. Nature 399:798.[Medline]
  42. Okamura, R. M., M. Sigvardsson, J. Galceran, S. Verbeek, H. Clevers, R. Grosschedl. 1998. Redundant regulation of T cell differentiation and TCR{alpha} gene expression by the transcription factors LEF-1 and TCF-1. Immunity 8:11.[Medline]
  43. Kubo, S., R. Nagasawa, H. Nishimura, K. Shigemoto, N. Maruyama. 1999. ATF-2 binding regulatory element is responsible for Ly49A expression in murine T lymphoid line, EL-4. Biochim. Biophys. Acta 1444:191.[Medline]
  44. Fitzsimmons, D., J. Hagman. 1996. Regulation of gene expression at the early stages of B-cell and T-cell differentiation. Curr. Opin. Immunol. 8:166.[Medline]
  45. McQueen, K. L., B. T. Wilhelm, F. Takei, D. L. Mager. 2001. Functional analysis of 5' or 3' regions of the closely related Ly-49c and j genes. Immunogenetics 52:212.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
A. Rouhi, L. Gagnier, F. Takei, and D. L. Mager
Evidence for epigenetic maintenance of Ly49A monoallelic gene expression.
J. Immunol., March 1, 2006; 176(5): 2991 - 2999.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Stevenaert, K. Van Beneden, V. De Colvenaer, A. S. Franki, V. Debacker, T. Boterberg, D. Deforce, K. Pfeffer, J. Plum, D. Elewaut, et al.
Ly49 and CD94/NKG2 receptor acquisition by NK cells does not require lymphotoxin-{beta} receptor expression
Blood, August 1, 2005; 106(3): 956 - 962.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Ioannidis, B. Kunz, D. M. Tanamachi, L. Scarpellino, and W. Held
Initiation and Limitation of Ly-49A NK Cell Receptor Acquisition by T Cell Factor-1
J. Immunol., July 15, 2003; 171(2): 769 - 775.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. A. Stewart, J. van Bergen, and J. Trowsdale
Different and Divergent Regulation of the KIR2DL4 and KIR3DL1 Promoters
J. Immunol., June 15, 2003; 170(12): 6073 - 6081.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kunz, B.
Right arrow Articles by Held, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kunz, B.
Right arrow Articles by Held, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS