The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, C. J.
Right arrow Articles by Tam, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, C. J.
Right arrow Articles by Tam, R. C.
The Journal of Immunology, 2001, 166: 6134-6143.
Copyright © 2001 by The American Association of Immunologists

Transcriptional Regulation of CD28 Expression by CD28GR, a Novel Promoter Element Located in Exon 1 of the CD28 Gene

Catherine J. Lin and Robert C. Tam1

Department of Drug Discovery, ICN Pharmaceuticals, Costa Mesa, CA 92626


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CD28 provides an essential costimulatory signal required for Ag-mediated T cell activation via the TCR. Although accumulating evidence exists for the signaling properties of CD28, less is known regarding the regulation of CD28 expression. In this study, we have identified a novel promoter element of CD28, CD28GR (GGGGAGGAGGGG), which is located between +181 and +192 in exon 1 of the CD28 gene. Mutations within the 12-bp CD28GR sequence abolished its transcriptional activity. CD28GR contains a Sp1/EGR-1 binding site, which was found to act as the predominant functional element for regulating CD28 gene expression in Jurkat cells. Exon 1/CD28GR-driven transcription in Jurkat cells was augmented by cotransfection with Sp1 or EGR-1 expression plasmid. Similar augmentation was also shown with pharmacologic activation. This study is the first to identify a regulatory element that is critical for conferring constitutive and activation-induced transcriptional activation of the CD28 gene. Furthermore, our results proposed potential involvement of Sp1 in regulating CD28 expression. The linkage between Sp1 and the expression of CD28 has important implications in how viral infections, such as HIV, can induce immunosuppression.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Two independent signals are required for the activation of T lymphocytes. The first signal involves the recognition, by specific TCR/CD3 complex, of Ag presented by MHC molecules on the surface of APCs. The second or costimulatory signal is nonspecific and is provided by the interaction of the T cell surface receptor CD28 with its natural ligands, B7-1/B7-2 on APCs (1) or T cells (2). If both signals are present, T cell proliferation and lymphokine production ensue. CD28 has also been implicated in the regulation of T cell survival (3). Blockade of the CD28 pathway has been shown to reduce cytokine expression (4) and elicit a state of T cell tolerance or anergy (5). Recent in vivo evidence (6, 7) has shown that molecular intervention of the CD28 pathway can result in immunosuppression, with implications for the treatment of autoimmune diseases, organ transplantation, and graft-vs-host disease.

CD28 is a 44-kDa homodimeric glycoprotein constitutively expressed in 95% of CD4+ T cells and 50% of CD8+ T cells (8). The human CD28 sequence was originally identified by Aruffo and Seed (8) and later characterized by Lee et al. (9) to consist of four exons, each defining a functional domain of the predicted protein. Although much accumulating evidence exists for the signaling properties of CD28, less is known regarding the regulation of CD28 expression and the role expression plays in the generation of these signaling effects. The region upstream of CD28 coding sequence contains an AP-1-like element at position -39 and an Alu family repetitive element located at the distal region (-448 to -177). However, no assignment of function was previously demonstrated for these elements.

We have previously shown that a guanosine-rich (G-rich)2 oligonucleotide (ODN), GR1, could inhibit both human and murine CD28 expression. Such interference resulted in abrogation of Ag- and alloantigen-dependent immune responses in vitro and impaired murine contact hypersensitivity responses in vivo (10). The inhibitory activity of GR1 was selective for CD28 since the levels of human IL-2R, ICAM-1, CD2, B7-1, or B7-2 were not affected. Furthermore, we showed that the inhibition of CD28 expression by GR1 was dependent on a sequence motif consisting of two G-tetrads separated by four bases (10). Thus, the activity of GR1 was not associated with hybridization to DNA or RNA, but rather an ODN sequence-specific aptameric association to a specific protein factor(s).

Interestingly, a copy of the GR1 sequence motif also exists in exon 1 of the CD28 gene (+181 to +192). Exon 1 encodes the 5'-untranslated region and the leader peptide (9). This GR1-like motif resides upstream of the leader peptide. It is likely that this GR1-like element is involved in regulating the transcription of CD28 through recruitment of a specific transcriptional factor. This is consistent with our previous hypothesis that GR1 ODN might have been acting as a molecular decoy by preventing the binding of a regulatory protein to the CD28 promoter region. To address this possibility, we used several strategies to determine whether this G-rich element in exon 1 played any regulatory role in CD28 expression. We found that the G-rich motif is critical for conferring constitutive and activation-induced transcriptional activation of CD28, probably by associating with the transcriptional factor Sp1 or EGR-1. We have designated this regulatory element in the CD28 gene as CD28GR.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture

The human T cell line Jurkat, clone E6-1, and the human epithelioid carcinoma cell line HeLa, clone S3 (American Type Culture Collection, Gaithersburg, MD), were grown in RPMI 1640 (ICN, Costa Mesa, CA) supplemented with 10% heat-inactivated FBS, 25 mM HEPES (HeLa cells only), 1% L-glutamine, and 1% penicillin/streptomycin, and maintained in a humidified incubator at 37°C with 5% CO2.

Total RNA isolation and RNase protection assay (RPA)

Resting Jurkat total RNA and HeLa total RNA were isolated using Qiagen RNeasy Mini kit and Qiagen Qiashredder (Qiagen, Valencia, CA). cDNA (28b1) encompassing the CD28 region of -53 to +251 was made by RT-PCR using primers (5'-CCGACTATTTTTCAGTGACA and 5'-AAGTTGAGAGCCAAGAGCAG) and PCR conditions as described previously (11). The cDNA was gel purified and cloned into TA cloning vector pCR2.1 (Invitrogen, San Diego, CA) in the antisense orientation using standard TA cloning techniques. RPA was performed using PharMingen RiboQuant RNase Protection Assay Kit (PharMingen, San Diego, CA) following manufacturer’s instructions. BamHI-linearized pCR2.1 antisense 28b1 and [{alpha}-32P]UTP (ICN) were used to synthesize T7 antisense RNA probe. A total of 25 µg of either resting Jurkat or HeLa total RNA was hybridized to 3 x 106 cpm of the probe at 56°C for 16–17 h, after which RNase treatments were followed to produce protected probes. Protected probes were subjected to gel resolution together with the unprotected probe on a 6% polyacrylamide sequencing gel (Acryl-a-Mix 6 Solution; Promega, Madison, WI) in 0.5x Tris-borate-EDTA (TBE) buffer run at 250 V. Dried gel was subjected to autoradiography using a phosphor imager (Bio-Rad, Hercules, CA) for 2–4 days.

Construction of CD28-chloramphenicol acetyltransferase (CAT) reporter plasmids

Various primer pairs used for RT-PCR to generate the cDNA inserts spanning the 5' flanking region of exon 1 of the human CD28 gene are shown in Table IGo. These inserts were used to first construct antisense clones in TA cloning vector pCR2.1 and then in reporter vector pCAT3 enhancer to produce CD28-CAT reporter plasmids pCAT3e28a, pCAT3e28a1, pCAT3e28a2, pCAT3e28b, pCAT3e28b1, pCAT3e28j, and pCAT3e28k, as described previously (11). The insert for the mutated plasmid pCAT3e28 h-2 was made using the method of ODN-directed mutagenesis by PCR, as described previously (11), in which the exact 12 bp of the motif (+181 to +192, GGGGAGGAGGGGG) were deleted and substituted with another 12 bp (ATCACATTGTGA). The truncated inserts for pCAT3e28j and pCAT3e28k, which lack the AP2 sites, were made through DNA PCR using new sense primers (Table IGo) and pCAT3e28h-2 or pCAT3e28b as template. All CD28 reporter constructs were verified by sequencing (Retrogen Sequencing Service, San Diego, CA).


View this table:
[in this window]
[in a new window]
  		Table I. Primers used in RT PCR and DNA PCR to produce inserts for pCAT3e constructs

 
Transient expression and CAT assays

Plasmids used in transfection studies were prepared by using Qiagen Plasmid Purification Kit (Qiagen). Cells were transfected with 5 µg of various plasmids using Qiagen Superfect transfection reagent, and relative CAT activities (RCA) were obtained, as described previously (11). Cotransfection studies were also performed. Expression plasmid pPacSp1, which has a 2.1-kb insert of the human Sp1 cDNA (encoding the C-terminal 696 aa of Sp1) (12), was kindly provided by Robert Tjian (Department of Molecular and Cell Biology, Howard Hughes Medical Institute, University of California, Berkeley, CA). Expression plasmid pPacEGR-1 was a kind gift from Eileen D. Adamson (Burnham Institute, La Jolla, CA) and contains nucleotide 306-1960 derived from CMV-neo EGR-1 (13). A suboptimal amount (2 µg) of pCAT3e28k and pCAT3e28j was cotransfected with different amounts of either pPacSp1 or pPacEGR-1 in 4 x 106 Jurkat cells in duplicates. After 24 h, cells were harvested and lysed for CAT assay, as described previously (11). A total of 2 µg of pCAT3e, an empty vector, was also cotransfected with the same amount of pPacSp1 or pPacEGR-1 in each experiment, and the resulting CAT expression was used as the denominator to calculate the RCA of test plasmids. Transfection efficiency was monitored by using {beta}-galactosidase control plasmid (pSV{beta}gal; from Promega) added to each transfection.

For the activation studies, cells were transfected 24 h before stimulation with 1 µg/ml of PHA (Calbiochem, San Diego, CA) and 25 ng/ml of PMA (Calbiochem). Cells were then harvested for CAT assay 24 h later.

Electrophoretic mobility shift assays

The dsODNs, ds1 (the wild-type CD28 exon 1 sequence from +172 to +201, GGGTTCCTCGGGGAGGAGGGGCTGGAACCC), and ds8 (the mutated sequence of ds1, GGGTTCCTCATCACATTGTGACTGGAACCC) were generated using a method described previously (11, 14). SacI-XhoI inserts 28a (~646 bp), 28b (~300 bp), and 28h-2 (~300 bp) were excised from their respective constructs. EMSA using 32P-end-labeled 30-bp dsODN or SacI-XhoI cDNA fragments as probes were performed as described previously (11). Unlabeled consensus dsODNs for AP2 and Sp1 used in competition gel-shift assays were purchased from Promega along with the purified AP2 and Sp1 proteins. Gel-shift grade Ab specific for Sp1 (mouse monoclonal IgG1, clone 1C6) and EGR-1 (rabbit polyclonal IgG, clone 588) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA) as well as resting and activated Jurkat nuclear extract and consensus EGR dsODN.

DNase I footprint assay

All footprint assays were performed using Promega’s Core Footprinting System, following manufacturer’s instructions. The probe used for the footprinting assay was generated following end labeling of the dephosphorylated 28b insert (SacI-XhoI fragment of the pCR2.1 antisense 28b, which encompasses the exon 1 region +26 to +251) with T4 polynucleotide kinase (Promega) and [{gamma}-32P]ATP (4500 Ci/mmol, 10 mCi/ml; ICN) and subsequent digestion with NotI (Boehringer Mannheim, Indianapolis, IN). Transcription factor binding was assessed using 25,000 cpm of the 32P-28b insert probe incubated with either 4 footprint units of purified Sp1 (Promega) or 1.3 µg of AP2 extract (Promega) at room temperature for 20–40 min in 1x binding buffer (25 mM Tris-HCl, pH 8, 50 mM KCl, 6.25 mM MgCl2, 0.5 mM EDTA, 10% glycerol, and 0.5 mM DTT). Following a 1-min digestion with DNase I and removal of proteins by extraction with phenol-chloroform-isoamyl alcohol, the DNA fragments were resolved by electrophoresis on a 6% polyacrylamide sequencing gel in 1x Tris-borate-EDTA (TBE) buffer run at 1500 V. Gels were dried and visualized following exposure to a phosphor imager (Bio-Rad) for between 4 and 5 days.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Mapping of the transcriptional start site of CD28

The transcription start site of the CD28 gene was previously mapped by S1 nuclease and primer extension analysis to between position +1 and +61 (9). The region 5' of the start site does not contain a consensus promoter element (such as TATA or CCAAT boxes) nor any proximal GC-rich motifs normally found in the TATA-less promoters (15). It does contain an AP-1-like element (GTGACAAA instead of the consensus GTGACTAA) at position -39 and a human Alu family-interspersed repetitive element located at the distal region (-448 to -177). However, to date no transcriptional activity has been ascribed to these elements. A recent report has shown that the mapped transcription initiation region (TIR) does have some functional promoter activity, but the putative DNA-binding proteins were not identified (16).

To test whether the previously determined transcription start site or its 5' flanking region or CD28GR (+181 to +192) possesses any transcriptional activity, we constructed an antisense cDNA clone (Fig. 1GoA) encompassing the region (-53 to +251) into TA cloning vector pCR2.1 (Invitrogen). This plasmid contains all of the AP-1-like sequence and exon 1, including the entire TIR (+1 to +61). RPA was performed using the T7 antisense RNA probe made from this DNA template (lane 1, Fig. 1GoB). Hybridization of this probe to the endogenous CD28 transcript (resting Jurkat total RNA) mapped the CD28 message start site to near +170 by showing a major protected band (~80 bp, lower band, lane 2, Fig. 1GoC). HeLa total RNA was used as a negative control (lane 3, Fig. 1GoC). Equivalent loading of RNA in the RPA was shown by ethidium bromide staining of the RNAs used (6 µg, Fig. 1GoD). Sequences from the previously determined TIR (+1 to +61) do not seem to contribute much to the promoter function, as a very weak band of ~190-bp protected probe size was observed (upper band, lane 2, Fig. 1GoC). A stronger signal of ~150 bp of the protected probe (middle band, lane 2, Fig. 1GoC) may be attributable to another G-rich region upstream of the CD28GR (about +100). These data show that the predominant functional promoter activity was not from the previously determined TIR, but from a more downstream area, CD28GR (+181 to +192), and that a third region near +100 may also have some minor promoter activity.



View larger version (40K):
[in this window]
[in a new window]
  		FIGURE 1. RPA demonstrating endogenous human CD28 transcripts are mostly initiated in exon 1 (near +170) and not in the previously determined TIR (+1 to +61). A, Schematic diagrams of the 5' human CD28 gene indicating the location of the TIR (putative start site) and CD28GR (observed start site) and the antisense region encompassing -53 to +251 for producing the antisense RNA probe. B, Lane 1, The labeled T7 antisense CD28 RNA probe (412 bp, flanking regions included). Lane 2, The end-labeled BMB marker VIII. C, Lane 1, The end-labeled BMB marker VIII. Lane 2, Shows protected bands resulting from hybridization of the antisense RNA probe to resting Jurkat total RNA and subsequent digestion with RNase. Three bands were observed: the weakest upper band (~190 bp) identified as the CD28 message initiated from the TIR, the middle band (~150 bp) as the message initiated from about +100 area (later identified as the AP2 site), and the strongest lower band (~80 bp) the message initiated from CD28GR (+181 to +192). Lane 3, The protected band after hybridizing the same RNA probe to HeLa total RNA. D, Lanes 1 and 2, Show the 18S and 28S bands from 6 µg of resting Jurkat total RNA and 6 µg of HeLa total RNA, respectively (25 µg of either was used to produce the data shown in C).

 
Exon 1 of the CD28 gene, but not the 5'-flanking region, possesses the transcriptional activity

We then monitored the CD28 5' upstream and exon 1 regions (Fig. 2GoA) for transcriptional activities following transient transfection of Jurkat T cells with CAT reporter plasmids. We constructed three CD28-CAT3e reporter plasmids (pCAT3e28a, pCAT3e28a1, pCAT3e28a2), which contained sequences from -448 bases upstream of the transcriptional start site to +251 after the transcription initiation of the CD28 gene (Fig. 2GoB). pCAT3e28a2 (-448 to +66) contains all of the Alu repetitive elements, the AP-1-like sequence, and the TIR (+1 to +61). pCAT3e28a1 (-327 to +66) deletes the first 121 bp of the Alu family while retaining all of the rest of the regions in pCAT3e28a2. pCAT3e28a (-327 to +251) contains all of the pCAT3e28a1 sequences, but extends further on the 3' side to +251 after transcription start.



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 2. A, Schematic diagram of the 5' flanking region of exon 1 and exon 1 of human CD28 gene, and B, RCA of various pCAT3e constructs containing CD28 5' flanking region of exon 1 and/or exon 1. A, The region shown includes the TIR of CD28 located at +1 to +61, an AP-1-like element (GTGACAAA) located at -39, and an Alu family-interspersed repetitive element located at -448 to -177. Exon 1 is 274 bp long (+1 to +274), and the translation start site (ATG) is at +223. B, The left panel represents the schematic diagrams of various CD28 5' upstream/exon 1-pCAT3e constructs used in transient transfection assays. Hatched box represents the G-rich motif at +181 to +192 (CD28GR). The right panel shows the RCA of these constructs. The RCA was determined by dividing the CAT activity of the test plasmid by that of the negative control plasmid, pCAT3e, which was also transfected in each experiment. CAT activities were generated from whole cell extracts following 24-h transfection of 5 µg of each plasmid DNA into 4 x 106 resting Jurkat cells in duplicate. The data shown represent the mean RCA ± SD of five separate experiments. *, Values significantly greater (p < 0.001) than pCAT3e28a series.

 
These constructs were tested for transcriptional activity in resting Jurkat cells using transient expression assays. A positive control (a SV40 promoter/enhancer-driven CAT expression plasmid, pCAT3 control; Promega) and a negative control (a promoter-less, but SV40 enhancer-containing CAT plasmid, pCAT3e; Promega) were also included in each experiment (data not shown). The RCA of each construct was calculated as the ratio of the test plasmid and the negative control, pCAT3e. Fig. 2GoB shows that CAT expression was not significantly elevated in pCAT3e28a, pCAT3e28a1 or pCAT3e28a2 when compared with pCAT3e.

Next we constructed two plasmids that were devoid of most of the 5' distal region but still contained sequences up to +251 downstream of the transcription start site (Fig. 2GoB). The first plasmid, pCAT3e28b1, contains all of the AP-1-like sequence and exon 1, including the whole TIR. The second plasmid, pCAT3e28b, deletes the AP-1-like sequence while retaining only ~60% of the TIR (35 of 61 bases). Surprisingly, the RCA of both these 28b constructs increased dramatically when compared with the 28a series of constructs (p < 0.001 compared with 28a series). pCAT3e28b, which had a RCA 78% higher than pCAT3e28b1, approached the maximal activity seen with pCAT3 control (data not shown). These data showed that constructs lacking most of the 5' upstream region, the AP-1-like sequence, and the initiation region, but retained the exon 1 segment had the greatest positive transcriptional activity. Furthermore, pCAT3e28a, which has both 5' upstream region and exon 1, may contain sequences within the 5' upstream region that inhibit exon 1-driven transcription.

Mutation of the G-rich motif CD28GR (+181 to +192) abrogates exon 1-driven CAT expression

To evaluate whether the G-rich motif CD28GR (+181 to +192) is required for the elevated transcriptional activity of pCAT3e28b, we constructed a mutant pCAT3e28h-2 in which the 12 bp of the G-rich motif (GGGGAGGAGGGG) were changed to a non-G-rich sequence (ATCACATTGTGA). The RCA of pCAT3e28h-2 dropped significantly (73%) when compared with pCAT3e28b (p < 0.001, Fig. 3Go). These data showed that the G-rich region was critical for the elevated transcriptional activity of the exon 1 construct, pCAT3e28b.



View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 3. Effect of mutation of CD28GR on transcriptional activity of the CD28 exon 1 construct pCAT3e28b. In pCAT3e28h-2, the original CD28 sequence, +181 to +192 (), was replaced by another 12 bp ({square}). Resting Jurkat cells were transfected with either pCAT3e28b or pCAT3e28h-2 and harvested the same way as for Fig. 2Go. The RCA of pCAT3e28h-2 was 73% lower than that of pCAT3e28b. The data shown represent the mean RCA ± SD from six separate experiments. *, p < 0.001.

 
Protein factors interacting with the exon 1 region

We used the following approaches to determine whether the exon 1 region contained specific binding sites for transcription factors, in particular Sp1 and Ap2 based on sequence analyses. First, by using EMSAs, the ability of the exon 1 region (+26 to +251) was examined for protein binding. Second, the precise locations of these binding sites were mapped by DNase I-footprinting assays. Finally, the transcriptional factor recognition sites were generated synthetically as dsODN and their binding activity were further confirmed.

32P-Labeled DNA probes of the 28a, 28b, and 28 h-2 inserts were examined by EMSA for Sp1 and AP2 binding. Gel-shift analyses showed that AP2 bound strongly to 28a, 28b, and 28 h-2. However, a distinct band was produced only with 28a and 28b, but not with 28 h-2 when incubated with Sp1 (Fig. 4Go). These data indicated that sequences of 28a and 28b contain binding sites for both AP2 and Sp1 proteins. Upon mutation of the G-rich motif (28 h-2), only the Sp1 binding site was affected, suggesting that this G-rich motif CD28GR is at least partially responsible for binding with Sp1.



View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 4. Determination of Sp1 and AP2 transcriptional factor binding sites in CD28 exon 1. EMSA were performed following incubation of 32P end-labeled cDNA probes (SacI-XhoI fragments of the pCR2.1 antisense constructs containing either the 28a or 28b or 28h-2 insert) and Sp1 or AP2. All cDNA probes (28a, 28b, and 28 h-2 inserts) produced a single band after incubating with 1.3 µg of AP2 (lanes 3, 6, and 9). Sp1 (4 fpu) bound to labeled 28a insert (lane 4) and 28b insert (lane 7), but not labeled 28 h-2 insert (lane 10). Lanes 2, 5, and 8, 32P-labeled cDNA probes alone. Lane 1, The labeled BMB marker VIII.

 
Next, the precise locations of the Sp1 and AP2 binding sites were mapped by DNase I footprint analysis using the 32P-labeled 28b insert (+26 to +251) DNA probe. A Sp1 binding site was found to be located from +177 to +206, an area that covers the CD28GR (+181 to +192) (Fig. 5GoA). A second possible Sp1 footprint was observed around +141 to +170. However, subsequent gel-shift analysis showed that a 30-bp dsODN encompassing this second region did not bind to Sp1 (data not shown).



View larger version (77K):
[in this window]
[in a new window]
  		FIGURE 5. DNase I footprint analyses of the CD28 exon 1 region using 28b insert cDNA probe, Sp1, and AP2. End-labeled 300-bp probes, generated from 28b insert cDNA or SV40 cDNA (used as a control), were incubated with Sp1 or AP2 protein at room temperature for 20 or 40 min, briefly digested with DNase I, and resolved on a 6% polyacrylamide sequencing gel. Footprints are bracketed, and the precise location is shown relative to the start site of transcription. Lane 1 in each panel is 32P end-labeled BMB marker V. 32P end-labeled 28b insert was incubated: A, in the absence (lane 2) or presence of 4 fpu of Sp1 at room temperature for 20 min (lane 3) or 40 min (lane 4), or B, in the absence (lane 2) or presence of 1.3 µg of AP2 at room temperature for 20 min (lane 3). C, 32P end-labeled SV40 was incubated with no protein (lane 2) or with 1.3 µg of AP2 (lane 3) or 2 fpu of Sp1 (lane 4).

 
In addition, one AP2-protected region was observed around +81 to +112 (Fig. 5GoB), a region that corresponds to where transcription of the 150-bp protected band in Fig. 1GoC was initiated. The 310-bp SV40 DNA (Promega) was used as a positive control (Fig. 5GoC). It has six Sp1 binding sites (127–132, 139–144, 148–153, 160–165, 170–175, 181–186) and a very distinct footprint with AP2 at about +65 to +89 (reported footprint is at +62 to +69; Promega).

These data indicated that a Sp1 binding site exists in the region +177 to +206 of CD28 exon 1 (which encompasses the G-rich motif CD28GR), and an AP2 site exists ~65 bp upstream of this Sp1 binding site.

Finally, we confirmed the interaction between Sp1 and CD28GR by using dsODNs (30 bp) derived from wild-type (ds1) or mutated (ds8) G-rich region. The 32P-ds1/Sp1 protein complex resolved as one distinct band, whereas no 32P-ds8/Sp1 complex was observed (Fig. 6Go). The 32P-ds1/Sp1 protein complex could be supershifted with Sp1 Ab and was abolished following coincubation with excess cold Sp1 consensus dsODN, but not with excess cold consensus AP2 dsODN in competition gel-shift assays (Fig. 6Go).



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 6. Sp1 binds to dsODN containing the wild-type but not the mutated 12-bp motif. ds1 and ds8 are 30-mer dsODNs derived from the same regions (+172 to +201) of pCAT3e28b and pCAT3e28h-2, respectively. These dsODNs were end labeled and their abilities to bind Sp1 were evaluated using EMSA. Specificity for Sp1 binding was determined by supershift and competition gel-shift assays. Lane 1, The labeled ds1, a dsODN containing the wild-type 12-bp motif. Lane 2, Shows 4 fpu of Sp1 bound to labeled ds1, and this complex could be supershifted with 2 µg of Sp1 Ab (lane 3). Lane 4, The labeled ds8 that has the mutated 12-bp motif, and lane 5, the labeled ds8 probe incubated with 4 fpu of Sp1. Competition for the ds1/Sp1 complex was shown using 100-molar excess of unlabeled Sp1 consensus ODN (S, lane 6) or AP2 consensus ODN (A, lane 7). Lane 8, The labeled BMB marker VIII.

 
These results taken collectively suggest that: 1) CD28 exon 1 has a Sp1 and an AP2 binding site; 2) Sp1 protein binds to a region covering CD28GR; 3) mutation of the CD28GR (+181 to +192) abolishes Sp1 binding. The lack of Sp1 binding following mutation of the CD28GR suggests that occupancy of the Sp1 binding site may account for the higher transcriptional activity shown with pCAT3e28b than with pCAT3e28 h-2 (Fig. 3Go). However, Sp1 binding also occurs in the construct pCAT3e28a, which contains the 5' upstream region in addition to exon 1, but showed low transcriptional activity, suggesting that the inhibition of exon 1-driven transcription by the 5' upstream region does not act by preventing the binding of Sp1.

The Sp1 binding site is more critical for transcription than AP2

The identification of the AP2 and Sp1 binding site in exon 1 prompted us to further examine the relative importance of these sites in driving transcription of the CD28 gene, and in addition, to determine whether these sites acted independently. Preliminary evidence from the RPA data in Fig. 1Go indicated that transcription initiated from CD28GR (80-bp protected band) was more predominant than transcription initiated from the putative AP2 binding site (150-bp protected band). The following study was performed to confirm this preliminary observation. We made truncated constructs (+113 to +251), pCAT3e28j and pCAT3e28k, in which the AP2 binding site was deleted from pCAT3e28h-2 (mutated CD28GR) and from pCAT3e28b (wild-type CD28GR), respectively. The RCA of these plasmids and their untruncated counterparts were determined following transient transfection in resting Jurkat cells. The pCAT3e28k (lacking AP2) showed no significant change in RCA when compared with pCAT3e28b (AP2 intact) (Fig. 7Go). Similarly, the pCAT3e28j (lacking AP2) showed no significant change in RCA when compared with pCAT3e28h-2 (AP2 intact) (Fig. 7Go). These data indicated that removal of the AP2 site did not significantly influence the transcriptional activity of exon 1. pCAT3e28k, which still has the intact Sp1 binding site, expressed significantly (300%) higher activity than pCAT3e28j, which contains the mutated G-rich motif region (p < 0.001, Fig. 7Go). These data supported the RPA data generated in Fig. 1Go and suggested that the G-rich, Sp1-binding motif CD28GR can act independently and provide the predominant transcriptional activity for CD28 gene expression.



View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 7. The relative importance of the AP2 and Sp1 motifs for exon 1-driven CD28 transcriptional activity was determined by comparing the CAT expression of plasmids lacking the AP2 sites (pCAT3e28j and pCAT3e28k) with their untruncated counterparts (pCAT3e28h-2 and pCAT3e28b, respectively). In the left panel, the schematic diagrams of the various plasmids used are shown. The hatched box represents the wild-type 12-bp motif, the open box represents the mutated motif, and the solid box represents the AP2 motif. Resting Jurkat cells were transfected and harvested the same way as for Fig. 1Go. The right panel shows the RCA of these plasmids following transfection. pCAT3e28j had a 29% drop in CAT activity when compared with pCAT3e28 h-2. pCAT3e28k had a 23% drop in CAT activity when compared with pCAT3e28b. But pCAT3e28k, having no AP2 motif, still expressed 300% higher than pCAT3e28j, which does not have either an AP2 or a Sp1 motif. The data shown represent the mean RCA ± SD from six separate experiments. *, Values significantly greater (p < 0.001) than pCAT3e28j and pCAT3e28h-2.

 
CD28GR is a Sp1/EGR-1 binding site

The ODN consensus sequences for the transcription factors Sp1 and EGR-1 are GGGGCGGGG and GCGGGGGCG, respectively, whereas CD28GR is GGGGAGGAGGGG. We hypothesized that the CD28GR could be an overlapping Sp1/EGR-1 site. Therefore, we examined the DNA/protein-binding profiles in crude nuclear extract from HeLa cells, a known source of Sp1 and EGR-1 proteins (17, 18), and in resting Jurkat nuclear extract. Using EMSA, we showed that the CD28GR-containing sequence, ds1, resolved as two distinct bands following interaction with HeLa nuclear extract (lane 3, Fig. 8GoA). The thick upper band appeared to be the comigration of two closely resolving bands. The upper portion of this upper band, which migrated at the same position as the ds1/Sp1 protein complex (lane 2, Fig. 8GoA), can be supershifted upon coincubation with Sp1 Ab (lane 4, Fig. 8GoA). The interaction of the 32P-Sp1 consensus ODN and the resting Jurkat nuclear extract also resolved with an upper band at a similar position as observed in HeLa nuclear extract, and the subsequent supershift by Sp1 Ab identified the protein bound as Sp1 (lanes 6 and 7, Fig. 8GoA). The lower portion of the upper band in HeLa nuclear extract was abolished upon coincubation with EGR-1 Ab (lane 5, Fig. 8GoA), identifying the bound protein as EGR-1. The abolition of the lower portion of this band is a phenomenon also observed by others using EGR-1 Ab with other Sp1/EGR-1 binding sites (19, 20). Sp1 Ab or EGR-1 Ab alone did not bind to 32P-ds1, and EGR-1 Ab could not compete with Sp1 binding to a canonical 32P-Sp1 dsODN (data not shown). We designated this upper 32P-ds1/HeLa extract band as the ES complex because both Sp1/32P-ds1 and the EGR-1/32P-ds1 complexes in HeLa cells comigrated to this same position. This comigration phenomenon has also been observed by others in regulatory elements of the IL-2 promoter (19). Owing to the lack of commercially available purified EGR-1 protein, characterization of ds1/EGR-1 binding was only possible by competition experiments using EGR-1 Ab or EGR consensus ODN.



View larger version (44K):
[in this window]
[in a new window]
  		FIGURE 8. EMSA demonstrating CD28GR (the 12-bp motif in the exon 1 region, +181 to +192) is a Sp1/EGR-1 binding site. A, Supershift gel assay: Labeled ds1 (which encompasses CD28GR) resolved as two bands after incubation with 10 µg of HeLa nuclear extract (lane 3), one migrated at the same position as the ds1/Sp1 protein complex (lane 2). This band was designated the ES complex. This upper portion of this ES complex was supershifted by 2 µg of Sp1 Ab (lane 4), and the lower portion was abolished upon coincubation with 2 µg of EGR-1 Ab (lane 5). The interaction of labeled Sp1 consensus ODN and 10 µg of resting Jurkat nuclear extract resulted in the resolution of several bands with the upper portion of the uppermost band (ES complex) supershifted upon coincubation with 2 µg of Sp1 Ab (lanes 6 and 7). B, The competitive effect of unlabeled ODN on the interaction of labeled ds1 and HeLa nuclear extract. Competition with a 70-, 140-, and 210-fold molar excess of the unlabeled ds1 abolished the ES complex (lanes 3–5, descending order), while a mutated ds1 (ds8) had no effect (lanes 6–8, descending order). Competition with 100-molar excess of the unlabeled EGR consensus ODN (lane 8) or unlabeled Sp1 consensus ODN (lane 9) specifically interfered with formation of the ES complex (upper band). Lanes 1 and 11, Labeled BMB marker VIII, and lane 2, labeled ds1 bound to HeLa nuclear extract.

 
Next we demonstrated the specificity of the protein binding by the CD28GR sequence. Competition by 70-, 140-, and 210-fold excess of unlabeled ds1 (containing wild-type CD28GR, lanes 3–5), but not by ds8 (containing mutated CD28GR, lanes 6–8), prevented resolution of the ES complex (Fig. 8GoB). Interestingly, both unlabeled dsODN could compete for the lower complex (lanes 3–8), suggesting protein binding by a base sequence common to both ds1 and ds8 other than the CD28GR sequence. The protein bound at this lower band was not Sp1 or EGR-1, as both unlabeled EGR or Sp1 consensus ODN could compete with 32P-ds1 for the formation of the ES complex, but not the lower band (lanes 9 and 10, Fig. 8GoB). Taken together, these results suggest that CD28GR serves as a binding site for both Sp1 and EGR-1 transcription factors.

The transcriptional activity of CD28GR is enhanced through cotransfection of Sp1/EGR-1 expression plasmids and through activation

To determine whether the Sp1/EGR-1 site in CD28GR was of functional importance, we conducted cotransfection experiments to determine whether Sp1 or EGR-1 can up-regulate CD28 exon 1 activity. Since the AP2 site has some minor transcriptional activity, as shown in both Figs. 1Go and 7Go, we chose pCAT3e28k and its mutant pCAT3e28j, which lack the AP2 site for the following experiments. We cotransfected resting Jurkat cells with suboptimal amounts (2 µg) of pCAT3e28k (containing wild-type CD28GR) or pCAT3e28j (containing a mutated CD28GR) and 0.25–2 µg of Sp1 (pPacSp1) or EGR-1 (pPacEGR-1) expression plasmids (only 2 µg of either of the expression plasmids was cotransfected with pCAT3e28j). Cotransfection with either Sp1 or EGR-1 expression plasmid significantly (p < 0.0001) up-regulated the expression of the exon 1-driven CAT reporter plasmid pCAT3e28k, but not pCAT3e28j (Fig. 9Go). The enhancement of the reporter activity was proportional to the quantity of the cotransfected expression vector (p < 0.0001). pPacEGR-1 showed greater enhancement of CD28GR-driven transcription than pPacSp1 (p < 0.0001). The effect of EGR-1 plasmid doses of 0.5 and 1 µg on CD28GR-induced transcription was significantly higher than the cotransfection effect with corresponding doses of Sp1 (p < 0.0001). These data show that Sp1 and EGR-1 can up-regulate exon 1-driven transcriptional activity mediated by CD28GR.



View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 9. Dose-dependent enhancement of the CD28GR-driven transcriptional activity by Sp1/EGR-1. A suboptimal amount (2 µg) of the wild-type CD28 reporter plasmid containing +113 to +251 of the CD28 exon 1 region, pCAT3e28k, was cotransfected with increasing amounts (0.25–2 µg) of either pPacSp1 or pPacEGR-1 expression plasmid in resting Jurkat cells, as outlined in Materials and Methods. The effect of cotransfection with 2 µg of the expression pPacSp1 or pPacEGR-1 plasmid was also determined with 2 µg of pCAT3e28j (mutant of pCAT3e28k).

 
It is noteworthy that Sp1 is constitutively expressed in Jurkat T cells and both Sp1 and EGR-1 expression are elevated following activation with PMA and PHA (19). In addition, constitutive CD28 expression is also enhanced following activation with PMA in T cells (21) and in Jurkat cells (data not shown). Presumably modulation of the Sp1 and EGR-1 expression during T cell activation would augment CD28GR-driven transcriptional activity. We thus examined whether the transcriptional activities driven by CD28 exon 1 reporter constructs are influenced by pharmacologic activation. Activation induced a significant increase in RCA of 7.71 and 7.07 above resting levels upon transient transfection of PMA/PHA-activated Jurkat T cells with pCAT3e28b and pCAT3e28k, respectively (Fig. 10Go). Plasmids pCAT3e28h-2 (intact AP2 site) and pCAT3e28j (lacking AP2 site), which both have the mutated CD28GR, showed no significant increase in RCA (2.76 and 0.83, respectively). Moreover, no activation-enhanced change in transcriptional activity was seen with the construct containing most of the 5' upstream region and exon 1, pCAT3e28a. These data showed that after pharmacologic activation, the transcriptional activity driven by exon 1 constructs bearing a wild-type CD28GR (in the absence of the 5' upstream region) was enhanced significantly above the levels observed in resting Jurkat cells.



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 10. The effect of pharmacologic activation on CD28GR-driven transcriptional activity. Resting Jurkat cells were transfected in the same manner as for Fig. 2Go, but in quadruplicate wells. After 24-h transfection of the cells with 5 µg of each plasmid, two of the four wells were activated with 1 µg/ml of PHA and 25 ng/ml of PHA. All wells (resting and activated) were harvested for CAT assay after another 24-h incubation. The left panel shows the schematic diagrams of the various plasmids used. Hatched box represents CD28GR, open box represents mutated motif, and solid box represents the AP2 motif. The mean RCA was determined for each plasmid, then the RCA of resting cells was subtracted from that of the activated cells ({Delta}(A - R)). As shown in the right panel, expression of pCAT3e28k and pCAT3e28b was greatly enhanced after activation, demonstrating that CD28GR-driven transcription was increased following activation. The slightly higher (A - R) value of pCAT3e28h-2 over pCAT3e28j may indicate that transcription driven by the AP2 motif was also influenced by activation. No significant difference of the pCAT3e28a expression in resting and in activated Jurkat cells was observed. Data shown represent the mean A - R value ± SD from three to eight separate experiments. *, Values significantly greater (p < 0.001) than pCAT3e28a, pCAT3e28j, and pCAT3e38h-2.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study, we have identified a regulatory element, CD28GR, which is a functional Sp1/EGR-1 binding site, has the G-rich sequence, GGGGAGGAGGGG, and resides in exon 1 of the CD28 gene. The presence of CD28GR in exon 1, and not in an upstream region or initiation site, makes it an internal promoter sequence. This finding is unique, as no previous reports have identified any functional Sp1- or EGR-1-binding motifs that are positive internal promoter regulatory elements.

The first reported internal control region was shown in the transcriptional regulation of the 5S RNA gene (22). In this study, the entire upstream region of the gene could be deleted without inhibiting gene expression. The control element, which bound the transcription factor TFIIIA, was shown to be located 40 bases within the transcribed region. Subsequent studies have identified other internal promoter elements essential for transcription of genes encoding tRNA, 7SL RNA, the 7SK gene, and the Alu-repeated sequences (23). More recently, both negative and positive cis-acting elements have been reported in the first nontranslated exon of the human apolipoprotein B-100 gene (24). In our study, we showed that the CD28 5' upstream region (-448 to +1) or the 5' upstream region together with exon 1 was devoid of transcriptional activity. Transcriptional activity was maximal within exon 1 when no residual 5' upstream sequences were present (pCAT3e28b). Our data suggested that the ability of the internal promoter in CD28 exon 1 to drive transcription was, unlike the regulation of 5S RNA, inhibited by upstream elements. The CD28 5' upstream region contains no consensus promoter sequences, but has an AP-1-like element and an Alu family sequence. In exon 1-bearing constructs, truncation of the 5' region that included the Alu sequence alone or the AP-1-like element and Alu sequence together resulted in dramatic increases in exon 1-driven transcription (Fig. 2Go). These data suggest that these sequences (AP-1 and Alu) could be contributing negatively to exon 1-driven transcription. Although Alu sequences (which are present as 500,000 copies in the human genome) can contain elements that are functional promoters for RNA polymerase III (15, 25), Alu sequences that contain negative regulatory or reducer elements have been described (26). An alternative explanation for the repression of gene expression could be the result of interaction of the CD28 5' upstream region with elements of the SV40 enhancer of the pCAT3e plasmid, an effect that has been previously reported in the evaluation of transcriptional regulation of other genes (27).

Mutation of the CD28GR sequence (+181 to +192) in exon 1 resulted in the loss of Sp1 binding, and the abolished CD28 exon 1-driven reporter gene expression underscores the importance of this region in regulating CD28 gene transcription. Furthermore, as shown by the lack of transcriptional activity of pCAT3e28a, CD28GR is not an enhancer because it did not activate any potential promoter sequences from over 100 bp downstream of the transcription start site. Although the data in this study revealed an AP2 binding site at +81 to +112 and a Sp1 site at +177 to +206, the RPA and transfection data suggested that the Sp1 binding site (CD28GR) was the principal requirement for positive transcriptional control in exon 1. Sp1 and AP2 binding sites are often found in close proximity with each other in the promoter regions of many genes. These two proteins can work independently of each other or synergistically with each other (28, 29, 30). In our studies, we showed that not only were the AP2 site and CD28GR independent of one another, CD28GR alone was necessary and sufficient to positively regulate exon 1-induced gene expression in resting Jurkat cells.

Overlapping Sp1 and EGR-1 binding sites occur frequently among different human gene promoters (20, 31, 32, 33). However, Fig. 8Go demonstrates that both these zinc finger proteins bind to CD28GR in a nonoverlapping manner. The presence of the Sp1/EGR-1 binding site in CD28GR could be of functional significance in the regulation of CD28 expression because: 1) Reciprocal modulation between Sp1 and EGR-1 has been observed in which EGR-1 competitively inhibits the binding of Sp1 to overlapping Sp1/EGR-1 sites (13, 34); 2) Sp1 is constitutively expressed in resting Jurkat T cells, and both Sp1 and EGR-1 expression are augmented upon activation (19); and 3) CD28 expression has both a constitutive and an activation-inducible component (21). Thus, the effect of binding of these two distinct zinc finger proteins could play an important role in the gene regulation of CD28. From transient transfection studies, we showed that reporter gene expression of CD28 exon 1 construct was dramatically enhanced either following cotransfection with Sp1 or EGR-1 expression plasmid (although coexpression with EGR-1 plasmid showed greater effect on transcription than that of Sp1 plasmid) or upon activation by PMA/PHA in resting Jurkat T cells. These data suggest that: 1) both transcription factors play a functional role in regulating CD28GR-driven transcription (EGR-1 appears to exert a stronger influence than Sp1, however); 2) a positive influence of cotransfected expression vector dose of either transcription factor on CD28GR-induced transcription (an effect that mimics the effect of activation-induced elevation of these regulatory proteins (19)) suggests activation could enhance CD28GR-induced transcription through elevated expression of Sp1 and EGR-1; and 3) the regulation of CD28 expression through CD28GR has both constitutive and activation-inducible components.

We had previously demonstrated that an 18-mer ODN bearing the G-rich motif (G4N4G4) found in CD28GR could act as a molecular decoy by inhibiting Sp1 binding to CD28GR and subsequently reducing activation-induced CD28 expression in vitro (11). This study provided three noteworthy observations that apply to this present report. First, it provided further evidence to support the regulatory role of CD28GR. Furthermore, it provided information on the sequence requirements for CD28GR, as the bioactivity of the ODN was abolished when at least one G in either of the two GGGG sequences was substituted, but was unaffected by substitutions of the four central bases. Finally, we showed that this oligomer could act as a molecular decoy to inhibit CD28 expression, but not expression of other Sp1- or EGR-1-regulated genes, and that the selectivity may be the result of the lower affinity of Sp1 for CD28GR than for other Sp1 recognition sequences.

In conclusion, we have identified a Sp1/EGR-1 binding site in exon 1 of the CD28 gene. This G-rich region, designated CD28GR, has the motif GGGGAGGAGGGG and positively regulates transcription in resting Jurkat T cells, an effect that is augmented upon coexpression of Sp1 or EGR-1 or upon activation. Three lines of evidence suggest that this functional relationship between CD28 expression and the transcription factors, Sp1 and EGR-1, may provide insight into certain mechanisms of immunosuppression, particularly in HIV infection. First, a significant reduction in the percentage of CD28-bearing CD4+ and CD8+ T cells has been observed during HIV infection and correlates well with disease progression (35, 36, 37). Second, there is evidence that supports the involvement of Sp1 in a cooperative interaction with NF-{kappa}B and the HIV trans activator, Tat, in the initiation of HIV transcription (38). Given that the interaction with Tat changes the conformation of Sp1, affecting its ability to bind its cognate DNA sequence and to retain its zinc (39), it is feasible that this interaction could alter the ability of Sp1 to regulate CD28 expression through CD28GR. Finally, it is interesting that the HIV Tat protein has been shown to increase the transcription of the human Alu-repeated sequences by increasing the activity of the transcription factor, TFIIIC (40). This virally induced effect on Alu transcription has also been shown following HSV infection (41). The effect on Alu transcription has relevance when one considers that in our studies, the Alu-repeated sequences in the CD28 5' upstream region could have some negative regulatory effect on CD28 exon 1-driven transcription. Future studies should be performed to dissect the possible mechanisms by which viral infection can induce immunosuppression via the regulation of CD28 expression.


   Acknowledgments
 
We thank Dr. Weidong Zhong for invaluable critique and suggestions in the preparation of the manuscript; Drs. Robert Tjian, Stephen T. Smale, Eileen D. Adamson, and Rou-Pan Huang for their generous gifts of expression plasmids; Drs. Michael Smith and Susanna Wu-Pong for helpful discussion; and Jace Collins for administrative assistance.


   Footnotes
 
1 Address correspondence and reprint requests to Dr. Robert C. Tam, Department of Drug Discovery, ICN Pharmaceuticals, Inc., 3300 Hyland Avenue, Costa Mesa, CA 92626. Back

2 Abbreviations used in this paper: G-rich, guanosine-rich; CAT, chloramphenicol acetyltransferase; ODN, oligodeoxynucleotide; RCA, relative CAT activity; RPA, RNase protection assay; TIR, transcription initiation region. Back

Received for publication March 14, 2000. Accepted for publication March 6, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Linsley, P. S., J. A. Ledbetter. 1993. The role of the CD28 receptor during T cell responses to antigen. Annu. Rev. Immunol. 11:191.[Medline]
  2. Azuma, M., H. Yssel, J. H. Phillips, H. Spits, L. L. Lanier. 1993. Functional expression of B7/BB1 on activated T lymphocytes. J. Exp. Med. 177:845.[Abstract/Free Full Text]
  3. Boise, L. H., A. J. Minn, P. J. Noel, C. H. June, M. A. Accavitti, T. Lindstein, C. B. Thompson. 1995. CD28 costimulation can promote T cell survival by enhancing the expression of Bcl-xL. Immunity 3:87.[Medline]
  4. Thompson, C. B., T. Lindsten, J. A. Ledbetter, S. L. Kunkel, H. A. Young, S. G. Emerson, J. M. Leiden, C. H. June. 1989. CD28 activation pathway regulates the production of multiple cell-derived lymphokines/cytokines. Proc. Natl. Acad. Sci. USA 86:1333.[Abstract/Free Full Text]
  5. Mueller, D. L., M. K. Jenkins, R. H. Schwartz. 1989. Clonal expansion versus functional clonal inactivation: a costimulatory signalling pathway determines the outcome of T cell antigen receptor occupancy. Annu. Rev. Immunol. 7:445.[Medline]
  6. Lenschow, D. J., Y. Zeng, J. R. Thistlethwaite, A. Montag, W. Brady, M. G. Gibson, J. A. Bluestone. 1992. Long term survival of xenogeneic pancreatic islets induced by CTLA-4Ig. Science 257:789.[Abstract/Free Full Text]
  7. Lin, H., S. F. Bolling, P. S. Linsley, R. Q. Wei, D. Gordon, C. B. Thompson, L. A. Turka. 1993. Long term acceptance of major histocompatibility complex mismatched cardiac allografts induced by CTLA-4Ig plus donor-specific transfusion. J. Exp. Med. 178:1801.[Abstract/Free Full Text]
  8. Aruffo, A., B. Seed. 1987. Molecular cloning of a CD28 cDNA by a high-efficiency COS cell expression system. Proc. Natl. Acad. Sci. USA 84:8573.[Abstract/Free Full Text]
  9. Lee, K. P., C. Taylor, B. Petryniak, L. A. Turka, C. H. June, C. B. Thompson. 1990. The genomic organization of the CD28 gene: implications for the regulation of CD28 mRNA expression and heterogeneity. J. Immunol. 145:344.[Abstract]
  10. Tam, R. C., U. T. Phan, T. Milovanovic, B. Pai, C. Lim, J. Bard, L. He. 1997. Oligonucleotide-mediated inhibition of CD28 expression induces human T cell hyporesponsiveness and manifests impaired contact hypersensitivity in mice. J. Immunol. 158:200.[Abstract]
  11. Tam, R. C., C. J. Lin, C. Lim, B. Pai, V. Stoisavljevic. 1999. Inhibition of CD28 expression by oligonucleotide decoys to the regulatory element in exon of the CD28 gene. J. Immunol. 163:4292.[Abstract/Free Full Text]
  12. Decker, E. L., C. Skerka, P. F. Zipfel. 1998. The early growth response protein (EGR-1) regulates interleukin-2 transcription by synergistic interaction with the nuclear factor of activated T cells. J. Biol. Chem. 273:26923.[Abstract/Free Full Text]
  13. Huang, R. P., Y. Fan, Z. Ni, D. Mercola, E. D. Adamson. 1997. Reciprocal modulation between Sp1 and EGR-1. J. Cell. Biochem. 66:489.[Medline]
  14. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: a Laboratory Manual, 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, p. 6.46.
  15. Latchman, D.. 1995. Gene Regulation, A Eukaryotic Perspective 2nd Ed.148. Chapman & Hall, London.
  16. Vallejo, A. N., A. R. Nestel, M. Schirmer, C. M. Weyand, J. J. Goronzy. 1998. Aging-related deficiency of CD28 expression in CD4+ T cells is associated with the loss of gene-specific nuclear factor binding activity. J. Biol. Chem. 273:8119.[Abstract/Free Full Text]
  17. Dynan, W. S., R. Tjian. 1983. Isolation of transcription factors that discriminate between different promoters recognized by RNA polymerase II. Cell 32:669.[Medline]
  18. Cui, M. Z., G. C. Parry, P. Oeth, H. Larson, M. Smith, R. P. Huang, E. D. Adamson, N. Mackman. 1996. Transcriptional regulation of the tissue factor gene in human epithelial cells is mediated by Sp1 and EGR-1. J. Biol. Chem. 271:2731.[Abstract/Free Full Text]
  19. Skerka, C., E. L. Decker, P. F. Zipfel. 1995. A regulatory element in the human interleukin 2 gene promoter is a binding site for the zinc finger proteins Sp1 and EGR-1. J. Biol. Chem. 270:22500.[Abstract/Free Full Text]
  20. Riva, A., G. L. Wilson, J. H. Kehrl. 1997. In vivo footprinting and mutational analysis of the proximal CD19 promoter reveal important roles for an Sp1/EGR-1 binding and a novel site termed the PyG box. J. Immunol. 159:1284.[Abstract]
  21. Turka, L., J. A. Ledbetter, K. Lee, C. H. June, C. B. Thompson. 1990. CD28 is an inducible T cell surface antigen that transduces a proliferative signal in CD3+ mature thymocytes. J. Immunol. 144:1646.[Abstract]
  22. Sakonju, S., D. F. Bogenhagen, D. D. Brown. 1980. A control region in the center of the 5S RNA gene directs initiation of transcription. I. The 5' border of the region. Cell 19:13.[Medline]
  23. Sollner-Webb, B.. 1988. Surprises in polymerase III transcription. Cell 52:153.[Medline]
  24. Chuang, S. S., H. Zhuang, S. R. Reisher, S. I. Feinstein, H. K. Das. 1995. Transcriptional regulation of the apolipoprotein B-100 gene: identification of cis-acting elements in the first non-translated exon of the human apolipoprotein B-100 gene. Biochem. Biophys. Res. Commun. 215:394.[Medline]
  25. Schmid, C. W., W. R. Jelinek. 1982. The Alu family of dispersed repetitive sequences. Science 216:1065.[Abstract/Free Full Text]
  26. Saffer, J. D., S. J. Thurston. 1989. A negative regulatory element with properties similar to those of enhancers is contained within an Alu sequence. Mol. Cell. Biol. 9:355.[Abstract/Free Full Text]
  27. Fong, T. C., Y. Wu, T. J. Kipps. 1996. Identification of a promoter element that regulates tissue-specific expression of the human CD80 (B7-1) gene. J. Immunol. 157:4442.[Abstract]
  28. Yang, X., D. Fyodorov, E. S. Deneris. 1995. Transcriptional analysis of acetylcholine receptor {alpha}3 gene promoter motifs that bind Sp1 and AP2. J. Biol. Chem. 270:8514.[Abstract/Free Full Text]
  29. Hayashi, T., M. Usui, J. Nishioka, Z. X. Zhang, K. Suzuki. 1998. Regulation of the human protein C inhibitor gene expression in HepG2 cells: role of Sp1 and AP2. Biochem. J. 332:573.
  30. Yang, M., H. Nomura, Y. Hu, S. Kaneko, H. Kaneko, M. Tanaka, K. Nakashima. 1998. Prolactin-induced expression of TATA-less cyclin D3 gene is mediated by Sp1 and AP2. Biochem. Mol. Biol. Int. 44:51.[Medline]
  31. Skerka, C., E. L. Decker, P. F. Zipfel. 1997. Coordinate expression and distinct DNA-binding characteristics of the four EGR-zinc finger proteins in Jurkat T lymphocytes. Immunobiology 198:179.[Medline]
  32. Minc, E., P. deCoppet, P. Masson, L. Thiery, S. Dutertre, M. Amor-Gueret, C. Jaulin. 1999. The human copper-zinc superoxide dismutase gene (SOD1) proximal promoter is regulated by Sp1, EGR-1, and WT1 via non-canonical binding sites. J. Biol. Chem. 274:503.[Abstract/Free Full Text]
  33. Lin, J. X., W. J. Leonard. 1997. The immediate-early gene product EGR-1 regulates the human interleukin-2 receptor {beta}-chain promoter through non-canonical EGR-1 and Sp1 binding sites. Mol. Cell. Biol. 17:3714.[Abstract]
  34. Khachigian, L. M., A. J. Williams, T. Collins. 1995. Interplay of Sp1 and EGR-1 in the proximal platelet-derived growth factor A-chain promoter in cultured vascular endothelial cells. J. Biol. Chem. 270:27679.[Abstract/Free Full Text]
  35. Caruso, A., A. Cantalamessa, S. Licenziati, L. Peroni, E. Prati, F. Martinelli, A. D. Canaris, S. Folghera, R. Gorla, A. Balsari. 1994. Expression of CD28 on CD8+ and CD4+ lymphocytes during HIV infection. Scand. J. Immunol. 40:485.[Medline]
  36. Choremi-Papadopoulou, H., V. Viglis, P. Gargalianos, T. Kordossis, A. Iniotaki-Theodoraki, J. Kosmidis. 1994. Down-regulation of CD28 surface antigen on CD4+ and CD8+ T lymphocytes during HIV infection. J. Acquired Immune Defic. Syndr. 7:245.
  37. Burgisser, P., C. Hammann, D. Kaufmann, M. Battegay, O. T. Rutschmann. 1999. Expression of CD28 and CD38 by CD8+ T lymphocytes in HIV infection correlates with markers of disease severity and changes towards normalization under treatment: the Swiss HIV cohort study. Clin. Exp. Immunol. 115:458.[Medline]
  38. Perkins, N. D., N. L. Edwards, C. S. Duckett, A. B. Agranoff, R. M. Schmid, G. J. Nabel. 1993. A cooperative interaction between NK-{kappa}B and Sp1 is required for HIV-1 enhancer activation. EMBO J. 12:3551.[Medline]
  39. Seve, M., A. Favier, M. Osman, D. Hernandez, G. Vaitaitis, N. C. Flores, J. M. McCord, S. C. Flores. 1999. The human immunodeficiency virus-1 Tat protein increases cell proliferation, alters sensitivity to zinc chelator-induced apoptosis, and changes Sp1 DNA binding in HeLa cells. Arch. Biochem. Biophys. 361:165.[Medline]
  40. Jang, K. L., M. K. L. Collins, D. S. Latchman. 1992. The human immunodeficiency virus Tat protein increases the transcription of human Alu repeated sequences by increasing the activity of the cellular transcription factor, TFIIIC. J. Acquired Immune Defic. Syndr. 5:1142.
  41. Jang, K. L., D. S. Latchman. 1992. The herpes simplex virus immediate-early protein ICP27 stimulates the transcription of cellular Alu repeated sequences by increasing the activity of transcription factor, TFIIIC. Biochem. J. 284:667.



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
Z. Hu, S. Shanker, J. A. MacLean II, S. L. Ackerman, and M. F. Wilkinson
The RHOX5 Homeodomain Protein Mediates Transcriptional Repression of the Netrin-1 Receptor Gene Unc5c
J. Biol. Chem., February 15, 2008; 283(7): 3866 - 3876.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. E. Lewis, M. Merched-Sauvage, J. J. Goronzy, C. M. Weyand, and A. N. Vallejo
Tumor Necrosis Factor-{alpha} and CD80 Modulate CD28 Expression through a Similar Mechanism of T-cell Receptor-independent Inhibition of Transcription
J. Biol. Chem., July 9, 2004; 279(28): 29130 - 29138.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. N. Vallejo, E. Bryl, K. Klarskov, S. Naylor, C. M. Weyand, and J. J. Goronzy
Molecular Basis for the Loss of CD28 Expression in Senescent T Cells
J. Biol. Chem., November 27, 2002; 277(49): 46940 - 46949.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Carleton, M. C. Haks, S. A. A. Smeele, A. Jones, S. M. Belkowski, M. A. Berger, P. Linsley, A. M. Kruisbeek, and D. L. Wiest
Early Growth Response Transcription Factors Are Required for Development of CD4-CD8- Thymocytes to the CD4+CD8+ Stage
J. Immunol., February 15, 2002; 168(4): 1649 - 1658.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, C. J.
Right arrow Articles by Tam, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, C. J.
Right arrow Articles by Tam, R. C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS