|
|
||||||||



*
Department of Microbiology and Immunology,
Department of Internal Medicine, Division of Infectious Diseases,
Department of Pathology, and
Department of Anatomy, Division of Immunobiology, Virginia Commonwealth University, Richmond, VA 23298;
¶
Department of Neurology, Johns Hopkins University, Baltimore, MD 21287;
||
Theoretical Biology and Biophysics, Los Alamos National Laboratory, Los Alamos, NM 87545; and
#
Department of Microbiology, Brigham Young University, Provo, UT 84602
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In HIV infection, large quantities of virus (estimated at 1 x 10101 x 1011 virus particles) are trapped on FDCs during both acute and chronic infection, and active viral replication is found in cells surrounding these sites (10, 11, 12, 13, 14). Previously, we showed that HIV immune complexes on FDCs, both in vitro and in vivo, were infectious and that they could cause infection of susceptible target cells even in the presence of high quantities of neutralizing Abs (15). Although this study suggested that virus on FDCs in vivo might remain infectious for a few days, it did not examine the ability of FDCs to maintain the infectious nature of trapped HIV for longer than 5 days. Because of the ability of FDCs to preserve Ags for many months and maintain them in an unprocessed form, we hypothesized that FDCs may protect HIV from degradation and thus maintain its infectious nature for many months, thus creating a persisting reservoir of replication-competent virus that could perpetuate infection. The present study used both in vitro and in vivo models to test this hypothesis. In a nonpermissive murine model, FDCs maintained trapped HIV in an infectious form in vivo for at least 9 mo. In addition, human FDCs were also able to maintain HIV infectivity in vitro for at least 25 days. These data are consistent with the hypothesis that HIV trapped on FDCs in vivo persists in an infectious form for months, and suggest that this reservoir can serve as a long-term source of replication-competent virus.
| Materials and Methods |
|---|
|
|
|---|
Viral stocks were prepared by propagating
HIV-1IIIB in H9 cells:
HIV-1MC99IIIB
Tat-Rev in
CEM-TART (CEM cells transfected with HIV-1 tat and
rev) cells, and the primary strains LW1, 92US714, and
91US054 in PHA-stimulated (3-day), PBLs. Virus was harvested at the
time of peak reverse-transcriptase and/or p24 production, pooled,
filtered through a 0.45-µm membrane, and stored as aliquots in liquid
nitrogen until used.
HIV-1MC99IIIB
Tat-Rev,
HIV-1IIIB, 92US714, and 91US054 were obtained
from the National Institutes of Health AIDS Research and Reference
Reagent Program. The LW1 virus was provided by Dr. Suzanne Gartner.
HIV trapping and retention in vivo on murine FDCs
Female, BALB/cByJ mice (The Jackson Laboratory, Bar Harbor, ME),
58 wk of age, were passively immunized with 0.5 ml tissue culture
supernatant from the Chessie-8 hybridoma (murine IgG anti-HIV-1
gp41; average protein concentration 210 µg/ml). The next day,
HIV-1IIIB (50 µl of a stock cell-free virus
suspension containing 28 ng of p24) was injected in each of the hind
and fore feet to allow immune complex formation and FDC trapping in
multiple draining lymph nodes. Mice were rested for the indicated
times, their draining lymph nodes excised, and the FDCs isolated
according to previously published procedures (15, 16). Our
FDC-enriched preparations routinely contained 2550% FDCs with
contaminants of equal numbers of T and B lymphocytes. In some
experiments, FDCs were isolated from mice 1 mo after injection of
HIV-1IIIB, and a portion of the cells was
subjected to FDC depletion using a mAb directed against murine FDCs
(FDC-M1; rat, anti-murine FDC; a generous gift from Dr. Marie
Kosco-Vilbois, Serono Pharmaceutical Research Institute, Geneva,
Switzerland). Briefly, FDCs were incubated with biotin-conjugated
FDC-M1, washed to remove unbound Ab, and depleted using magnetic
streptavidin Dynabeads (Dynal, Lake Success, NY). This procedure
typically removes
90% of FDCs, as determined by FACS analysis.
Rescue of infectious HIV-1 trapped in vivo on FDCs
Murine FDCs bearing in vivo trapped HIV were used as the only source of virus for infection of target cells. Virus rescue was performed by adding isolated FDCs 10010(10010,000 per culture) to H9 cells (for primary HIV-1 isolates, 3-day PHA blasts were substituted for H9s) and coculturing for 6 days. Productive infection of the target cells was assessed using DNA PCR (qualitative and quantitative) and p24 Ag capture ELISA.
Qualitative DNA PCR for HIV gag was performed using primers
SK38/39, as previously described (15). As a control,
simultaneous amplification of
-globin (using primers GH20 and PCO4)
was also performed in the same vessel, as described previously
(15). PCR amplification was executed for 30 cycles
(denaturation, 94°C x 1 min; annealing, 55°C x 30
s; extension, 72°C x 2 min; after 30 cycles, an additional
extension at 72°C for 10 min was performed). Amplicons were analyzed
by electrophoresis on 2% agarose gels, and
-globin amplicons were
detected by ethidium bromide labeling, followed by Southern blotting
onto Hybond-N transfer membranes (Amersham, Arlington Heights, IL).
Detection of HIV gag was performed using a specific probe
(SK 19) and a commercial enhanced chemiluminescence procedure following
the manufacturers instructions (Amersham).
Quantitative-competitive PCR (QC-PCR) was used to determine the number of viral DNA copies present. Primers 6575 and 7330C were used in QC-PCR to amplify HIV env and the competitive fragment, p9.6 (17). DNA was isolated from the FDC-target cell cocultures and added to PCR tubes in the presence of an equal volume of working standard (dilutions of p9.6 competitive fragment representing 105, 104, 103, 102, and 101 copies of HIV env). ACH-2 cells were used as a positive control. PCR amplification was performed for 30 cycles (denaturation, 94°C x 1 min; annealing, 50°C x 30 s; extension, 72°C x 2 min; after 30 cycles, an additional extension at 72°C for 10 min was performed). Amplicons were analyzed by electrophoresis on 2% agarose gels and Southern blotted onto Hybond-N transfer membranes (Amersham). Detection of specific PCR products was performed using an HIV env-specific FITC-labeled oligonucleotide probe (CCTCAGGAGGGGACCCAGAAAT) and a commercial enhanced chemiluminescence procedure following the manufacturers instructions (Amersham). After development, hybridized PCR products were scanned and analyzed using Quantiscan software. DNA copy numbers were determined from linear regression analysis of density plots of the competitive and experimental PCR products (i.e., the intersection of density plots of the competitive fragment PCR product with the HIV env product).
HIV-1 p24 Ag capture ELISA was performed using a commercial kit (Coulter, Palo Alto, CA), as per the manufacturers directions. In each experiment in which p24 was measured, the FDC-trapped HIV (used as the only source of input virus) was subtracted from the total p24 in cultures to determine the quantity of p24 produced.
Infectious virus quantitation was determined by 50% tissue culture-infective dose (TCID50) assay using FDCs obtained from mice injected 6 days previously with HIV-1. FDCs were diluted (10-fold serial dilutions) over a range of 10,000 to 1 cell and cultured with H9 targets, as above. Determination of TCID50 units was based on the Reed-Muench accumulative titration method.
Isolation of human FDCs and maintenance of infectious virus in vitro
Human FDCs were isolated from the tonsils of HIV-uninfected
subjects, and in one instance from the lymph node of an
HIV+ subject treated with a combination of a
protease and reverse-transcriptase inhibitor. Tonsils were cut into
3-mm cubes and digested for 1 h at 37°C in a solution of RPMI
1640 containing collagenase D (10 mg/ml; Boehringer Mannheim,
Indianapolis, IN) and DNase I (1% v/v; Sigma, St. Louis, MO). After
incubation, free cells were collected and transferred into RPMI 1640
containing 33% FBS, and new enzyme solution was added to the remaining
tonsillar tissue and the incubation step was repeated. After the second
incubation step, the cells were again collected, centrifuged at
400 x g to remove enzyme, washed, and resuspended in
10 ml of serum-free RPMI 1640. Two milliliters of the resulting cell
suspension were gently added to the surface of preformed, 50%
continuous Percoll gradients (25-ml vol), and the mixture was subjected
to centrifugation for 25 min at 700 x g. The low
density fraction (1.0551.060 g/ml) containing FDCs, lymphocytes, and
macrophages was harvested and washed as before to remove residual
Percoll. The cells were then labeled with HJ2, a murine, IgM
anti-human FDC-specific mAb (kindly provided by Dr. Moon Nahm,
University of Rochester, Rochester, NY) and incubated for
2 h at
4°C. After washing the cells to remove unbound Ab, magnetic beads
conjugated with rat, anti-mouse IgM (Miltenyi Biotec, Auburn, CA)
were added and the FDCs were positively selected using MACS.
FDC-enriched preparations using this procedure typically contain
5080% FDCs with contaminants of T and B lymphocytes. Because FDCs
are resistant to radiation, our FDC preparations were subjected to 3000
rad of
-irradiation before use to minimize the ability of
contaminating lymphocytes to support HIV infection/replication. To
assess the ability of FDCs to maintain HIV infectivity in vitro,
HIV-1IIIB (360 pg p24) alone or in the presence
of anti-gp41 (Chessie 8; 0.3 mg) was incubated ± FDCs
(10,000) for 1 mo. At various time intervals, H9 target cells were
added to the cultures to rescue any remaining infectious virus. After 2
days of coculture, p24 production was determined and values greater
than 500 pg/ml were considered positive for infection.
Determination of HIV t1/2 on FDCs in vivo
To estimate the t1/2 of HIV on
FDCs, sucrose double-banded HIV-1IIIB (Advanced
Biotechnologies, Columbia, MD) was surface labeled with
125I. Fifty micrograms of virus were suspended in
phosphate buffer and incubated on ice for 45 min with 2 mCi of sodium
iodide (Amersham) in the presence of Iodobeads (Pierce Chemical,
Rockford, IL). After removing the Iodobeads, the sp. act. was
determined to be 22 µCi/µg HIV. The virus was gently centrifuged
through a Sephadex G-25 column to remove unbound label and resuspended
to a total volume of 4000 µl in PBS. Virus was immediately injected
into the left or right feet of anti-gp41 passively immunized mice.
At 6, 8, 10, and 12 wk, groups of mice were sacrificed and their
draining lymph nodes excised. FDC-associated radioactivity was
calculated after
counting and compared with a stored sample of
125I-labeled virus having a known concentration
and sp. act. The lymph nodes on the opposite side (contralateral) of
the animal were used as controls for background activity. The data
obtained from these experiments were log transformed and subjected to
linear regression analysis to estimate the
t1/2 of FDC retention of trapped
virus.
| Results |
|---|
|
|
|---|
Using a qualitative DNA PCR procedure for detection of HIV
gag, we found that FDC-trapped virus was infectious at all
time intervals examined including 9 mo after injection (Fig. 1
). Remarkably, as few as 100 FDCs bore
sufficient infectious virus particles to infect the target cells.
Although qualitative in nature and somewhat variable in signal
intensity (due to independent PCR analysis of samples from each time
interval), the hybridization signals on Southern blots suggested that
HIV DNA decreased in an FDC dose-dependent manner. Our hypothesis that
FDCs maintain virus infectivity is dependent on the absence of viral
replication in mice. Although mice are nonpermissive for HIV infection,
we wanted to ensure that the specialized microenvironment of the
germinal center did not permit infection to occur and thus contribute
to the HIV reservoir. Therefore, we injected a mutant virus,
HIV-1MC99IIIB
Tat-Rev, in which tat
and rev are disrupted so that viral replication can only
occur in cells that produce these proteins. After 1 mo in vivo, FDCs
bearing mutant virus were harvested and cocultured with CEM cells or
with CEM-TART (Fig. 2
). Infection was
observed as before with as few as 100 FDCs, but infection was confined
to CEM-TART cells. We interpret these data, coupled with our results
showing the absence of detectable PCR signal from any of our isolated
murine FDC preparations, and previous reports of murine immunity to HIV
infection (18) to indicate that viral replication is not
contributing to the reservoir of infectious HIV retained on murine
FDCs.
|
|
|
|
200 copies/ml)).
One hundred thousand FDCs isolated from this subject bore 39.7 ng of
p24, and when 10,000, 1,000, or 100 FDCs were cocultured with
CD4+ T cells, infectious virus was rescued, as
evidenced by production of 94.6, 32.8, and 12.9 ng/ml p24,
respectively. Although there is no way to determine how long the
rescued infectious virus had been trapped on FDCs (because some viral
replication is possible under HAART), the rescue of infectious virus is
consistent with the concept that FDC-associated virus may be a
potential problem even in treated subjects. To further assess virus persistence on FDCs, we 125I labeled the HIV surface and injected virus as before. Mean values of FDC-associated HIV were as follows: 14.9, 14.5, 14.9, and 8.9 pg/lymph node at weeks 6, 8, 10, and 12, respectively. Although the data are significantly impacted by the last time interval, a virus decay of -0.073 per week was calculated corresponding to a t1/2 of 9.5 wk. Thus, although there was variability from animal to animal, the persistence of radioactively labeled HIV on FDCs was similar to the 2-mo t1/2 seen previously using conventional protein Ags (2, 19).
Because our murine FDC preparations (i.e., FDC enriched) consist of
2550% FDCs with about equal numbers of contaminating B and T
lymphocytes (16), we sought to ensure that FDCs and not
another cell type were responsible for the maintenance of HIV in an
infectious state. We isolated cells from mice injected 1 mo earlier
with HIV and depleted the FDC population from one portion by means of a
biotin-conjugated anti-mouse FDC Ab and streptavidin-magnetic
beads. This procedure generates both FDC-depleted (<10% FDCs) and
purified (>90% FDCs) fractions (16). Ten thousand
FDC-depleted cells, FDC-enriched (i.e., not fractionated), or purified
FDCs were then cocultured with H9 target cells. When FDC-enriched
preparations were used as the only source of virus, over 120 ng p24/ml
was produced in the cultures, but this was reduced to 0.2 ng/ml when
cells depleted of FDCs were substituted (Fig. 3
). Furthermore, adding HIV-bearing
purified FDCs back to the cultures resulted in a restoration of p24
production. These data indicated that infectious virus is associated
with FDCs and not with other cells, and is consistent with the
hypothesis that FDCs are responsible for maintaining HIV in an
infectious state.
|
|
|
|
| Discussion |
|---|
|
|
|---|
Although the mechanism of FDC protection of HIV infectivity is not currently understood, it is an area of active investigation. We hypothesize that stabilization of viral envelope glycoproteins by virus-Ab-FDC-Fc receptor interactions may contribute. Recent studies implicate the adhesion molecule, DC-specific ICAM-3 grabbing nonintegrin (DC-SIGN), in binding and short-term protection of HIV-1 by dendritic cells (21, 22, 23, 24). An important difference between the protection of HIV infectivity mediated by DC-SIGN and that mediated by FDCs is the time that virus bound to the different cell types remains infectious: DC-SIGN maintains viral infectivity for <5 days in vitro, whereas FDCs protected infectivity for at least 25 days. The prolonged protection of virus by FDCs is consistent with their function as a long-term repository of native proteins (and in the case of HIV-1, infectious virus). Whatever, the mechanism(s) involved, the fact that trapped virus remains infectious for months in an in vivo setting without viral replication indicates that FDCs represent an important reservoir of infectious HIV that could reignite infection when permissive conditions occur.
The use of the murine model to study FDC maintenance of infectivity offers a number of advantages over other models that are permissive to HIV infection and replication. The mouse model permits the controlled introduction of defined amounts of virus that cannot replicate and thus replenish the FDC reservoir of HIV. Furthermore, virus retention on FDCs occurs in a physiological setting with an intact immune system and other conditions (e.g., presence of endogenous proteases and complement proteins) that are not recapitulated in culture. We also have significant experience in working with FDC trapping and retention in the mouse. Although the murine model makes it possible to examine the decay of infectious virus in the FDC compartment uncomplicated by replacement from ongoing replication, the model does have some limitations, including a lack of destruction of the FDC network and the lack of overall immune activation that would occur in a permissive model.
In some of our prior work, we used the mouse to model FDC trapping of
HIV immune complexes (with or without neutralizing Abs) for short
periods of time (
5 days) to determine whether trapped HIV was
infectious (15). However, this study differs significantly
from the earlier one in that our purpose here was to determine whether
FDC-trapped HIV (resulting from a single injection of virus) could
retain its infectious nature for many months and thus be a potential
dangerous reservoir. Our findings indicate that this is indeed the
case. The observation that after 9 mo in vivo as few as 100 FDCs
provide sufficient virus to cause productive infection of target cells
suggests that the FDC reservoir may be very potent.
In addition to the more controlled murine in vivo studies, we also examined the ability of human FDCs to preserve HIV infectivity in vitro. In contrast to HIV alone or in immune complex form, the presence of FDCs resulted in maintenance of HIV infectivity over 25 days. In other experiments examining FDC-mediated maintenance of HIV infectivity, we found that FDCs were unable to maintain virus infectivity in vitro unless specific Ab to determinants present on the virus envelope was present (Burton et al., unpublished). These results contrast with other studies in which HIV binding to FDCs appears to be dependent on adhesion molecules (CD54, CD11a) (25) or complement protein C3 or its fragments (26, 27). However, it should be noted that in one of the latter studies, the presence of specific Ab did increase virus trapping on FDCs (26). The reasons for these apparent discrepancies in the various studies may relate to differences in the experimental systems, such as source of Ab (e.g., polyclonal vs monoclonal, human vs murine), conditions under which immune complexes were formed, FDC isolation procedures, and heterogeneity in FDC populations.
We also examined FDCs isolated from lymphoid tissue obtained from a HAART-treated patient and found that this virus was infectious. However, in this study the use of FDCs obtained from lymphoid tissues of infected subjects is not definitive evidence that FDCs maintain HIV infectivity, because a contaminating infected cell (CD4+ T cell or macrophage) or incomplete suppression of viral replication by HAART (10, 28, 29, 30) could not be excluded as a potential source of infectious virus. This latter concern underscores the importance of our nonpermissive murine model to address the issue of FDC maintenance of HIV infectivity.
Although the demonstration that human FDCs increase the maintenance of
HIV infectivity in vitro is important, there are a number of reasons
that maintenance of viral infectivity does not persist as long as seen
in the mouse. First, the ability to maintain FDCs in culture is not
well understood and the 25-day period of maintenance may be at the
limit of our ability to keep FDCs fully functional in vitro.
Furthermore, it is known that cultured FDCs typically lose cell surface
markers, some of which may be important in the maintenance of virus
infectivity and FDC function (31). It is also known that B
cells are important in maintaining FDCs in vivo and contaminating B
cells in our cultures would have been destroyed by exposure to 3000 rad
of
irradiation before use (32).
The unique nature of FDC cocultures makes them more complex than typical infectious assays (e.g., TCID50). The amount of viral DNA or p24 detected depends not only on the amount of infectious virus present on added FDCs, but also on the amount of secondary or costimulatory signaling provided by the FDCs (16). In our hands, this signaling augments HIV infection/replication (33). This FDC costimulation is optimal at a ratio of 1 FDC per 10 lymphocytes. Although our FDC-lymphocyte assays are not quantitative for the number of infectious units present, they suggest that >1 TCID50 of HIV was present on 100 FDCs, because this number caused infection at all time points examined. We performed a TCID50 assay using FDCs obtained 1 wk after injection of HIV and determined that 100 FDCs bore 77 TCID50. Using the estimated 9.5-wk t1/2 of HIV decay on FDCs, 3.8 t1/2 would be lost after 9 mo, leaving about 5 TCID50 per 100 FDCs, consistent with the finding that 100 FDCs were able to transfer infection at each time interval examined.
In humans, the FDC reservoir of HIV is estimated at 1.5 x 108 copies of viral RNA per gram of lymphoid tissue (11, 34). HAART dramatically reduces the amount of viral RNA detected on FDCs (34, 35). However, even with HAART, some virus remains after prolonged therapy, and levels below 10,000 copies of viral RNA per gram tissue may not be detected (11, 34, 35). A recent study indicated that even in the absence of detectable viral RNA, p24 protein remained on FDCs (36). This residual p24 may simply be trapped viral protein; however, we reason that it may also represent virus on FDCs that is below the level of detection by in situ hybridization.
The rate of virus decay from FDCs in patients receiving HAART is biphasic: the first phase decays with a t1/2 of 1.7 days, and the second phase with a t1/2 of 14 days (34). These data are in apparent contradiction to the longer decay periods observed in our murine study, although Hlavacek et al. (37), using a stochastic model of decay, calculated that with a beginning virus load of 1011 copies of RNA, virions could still be expected for as long as 10 yr. We hypothesize that differences between the Cavert study and ours may be related to analysis of the FDC network under very different conditions of FDC-virus density. At high virus densities (as would occur in untreated subjects), limited numbers of FDC Fc and complement receptors may be available for binding viral immune complexes, resulting in many less stable, univalent interactions. At low densities (as in our mice), many FDC Fc and complement receptors should be available, and trapped HIV immune complexes could be anchored to FDCs in more stable, highly multivalent states of attachment. This postulate is consistent with mathematical modeling of HIV-1 dissociation from FDCs (37), as well as a model of the kinetics of viral decline in patients on HAART (38). Importantly, it has been reported that even under HAART, some HIV replication continues (10, 28, 29, 30, 39), and we reason that this may lead to recharging of the FDC reservoir, thus providing a continual source of virus that could renew infection once drug therapy is discontinued. Future intervention strategies may need to target this important reservoir to reduce the risk of reinfection following cessation of drug therapy.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Dr. Nikolaos I. Stilianakis, Department of Medical Informatics, Biometry and Epidemiology, Friedrich-Alexander-University of Erlangen-Nuenberg, Waldstrasse 6, 91054 Erlangen, Germany. ![]()
3 Address correspondence and reprint requests to Dr. Gregory F. Burton, Department of Microbiology; Brigham Young University, Room 775 WIDB, Provo, UT 84602. ![]()
4 Abbreviations used in this paper: FDC, follicular dendritic cell; CEM-TART, CEM cells transfected with HIV-1 tat and rev; DC-SIGN, DC-specific ICAM-3 grabbing nonintegrin; HAART, highly active antiretroviral therapy; QC-PCR, quantitative-competitive PCR; TCID50, 50% tissue culture-infective dose. ![]()
Received for publication July 5, 2000. Accepted for publication October 10, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. C. Thacker, X. Zhou, J. D. Estes, Y. Jiang, B. F. Keele, T. S. Elton, and G. F. Burton Follicular Dendritic Cells and Human Immunodeficiency Virus Type 1 Transcription in CD4+ T Cells J. Virol., January 1, 2009; 83(1): 150 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. F. Keele, L. Tazi, S. Gartner, Y. Liu, T. B. Burgon, J. D. Estes, T. C. Thacker, K. A. Crandall, J. C. McArthur, and G. F. Burton Characterization of the Follicular Dendritic Cell Reservoir of Human Immunodeficiency Virus Type 1 J. Virol., June 1, 2008; 82(11): 5548 - 5561. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Sundstrom, J. E. Ellis, G. A. Hair, A. S. Kirshenbaum, D. D. Metcalfe, H. Yi, A. C. Cardona, M. K. Lindsay, and A. A. Ansari Human tissue mast cells are an inducible reservoir of persistent HIV infection Blood, June 15, 2007; 109(12): 5293 - 5300. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ho, S. Moir, L. Kulik, A. Malaspina, E. T. Donoghue, N. J. Miller, W. Wang, T.-W. Chun, A. S. Fauci, and V. M. Holers Role for CD21 in the Establishment of an Extracellular HIV Reservoir in Lymphoid Tissues J. Immunol., June 1, 2007; 178(11): 6968 - 6974. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hatsukari, P. Singh, N. Hitosugi, D. Messmer, E. Valderrama, S. Teichberg, W. Chaung, E. Gross, H. Schmidtmayerova, and P. C. Singhal DEC-205-Mediated Internalization of HIV-1 Results in the Establishment of Silent Infection in Renal Tubular Cells J. Am. Soc. Nephrol., March 1, 2007; 18(3): 780 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Donaghy, J. Wilkinson, and A. L. Cunningham HIV interactions with dendritic cells: has our focus been too narrow? J. Leukoc. Biol., November 1, 2006; 80(5): 1001 - 1012. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Banki, D. Wilflingseder, C. G. Ammann, M. Pruenster, B. Mullauer, K. Hollander, M. Meyer, G. M. Sprinzl, J. van Lunzen, H.-J. Stellbrink, et al. Factor I-Mediated Processing of Complement Fragments on HIV Immune Complexes Targets HIV to CR2-Expressing B Cells and Facilitates B Cell-Mediated Transmission of Opsonized HIV to T Cells. J. Immunol., September 1, 2006; 177(5): 3469 - 3476. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-J. Dumaurier, S. Gratton, S. Wain-Hobson, and R. Cheynier The majority of human immunodeficiency virus type 1 particles present within splenic germinal centres are produced locally J. Gen. Virol., December 1, 2005; 86(12): 3369 - 3373. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Arrighi, M. Pion, E. Garcia, J.-M. Escola, Y. van Kooyk, T. B. Geijtenbeek, and V. Piguet DC-SIGN-mediated Infectious Synapse Formation Enhances X4 HIV-1 Transmission from Dendritic Cells to T Cells J. Exp. Med., November 15, 2004; 200(10): 1279 - 1288. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Estes, T. C. Thacker, D. L. Hampton, S. A. Kell, B. F. Keele, E. A. Palenske, K. M. Druey, and G. F. Burton Follicular Dendritic Cell Regulation of CXCR4-Mediated Germinal Center CD4 T Cell Migration J. Immunol., November 15, 2004; 173(10): 6169 - 6178. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Crowe, T. Zhu, and W. A. Muller The contribution of monocyte infection and trafficking to viral persistence, and maintenance of the viral reservoir in HIV infection J. Leukoc. Biol., November 1, 2003; 74(5): 635 - 641. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Maeda, M. Matsuda, H. Suzuki, and H.-a. Saitoh Immunohistochemical Recognition of Human Follicular Dendritic Cells (FDCs) in Routinely Processed Paraffin Sections J. Histochem. Cytochem., November 1, 2002; 50(11): 1475 - 1486. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Estes, B. F. Keele, K. Tenner-Racz, P. Racz, M. A. Redd, T. C. Thacker, Y. Jiang, M. J. Lloyd, S. Gartner, and G. F. Burton Follicular Dendritic Cell-Mediated Up-Regulation of CXCR4 Expression on CD4 T Cells and HIV Pathogenesis J. Immunol., September 1, 2002; 169(5): 2313 - 2322. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Smith-Franklin, B. F. Keele, J. G. Tew, S. Gartner, A. K. Szakal, J. D. Estes, T. C. Thacker, and G. F. Burton Follicular Dendritic Cells and the Persistence of HIV Infectivity: The Role of Antibodies and Fc{gamma} Receptors J. Immunol., March 1, 2002; 168(5): 2408 - 2414. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. W. Frost, J. Martinez-Picado, L. Ruiz, B. Clotet, and A. J. Leigh Brown Viral Dynamics during Structured Treatment Interruptions of Chronic Human Immunodeficiency Virus Type 1 Infection J. Virol., February 1, 2002; 76(3): 968 - 979. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Kaeser, M. A. Klein, P. Schwarz, and A. Aguzzi Efficient Lymphoreticular Prion Propagation Requires PrPc in Stromal and Hematopoietic Cells J. Virol., August 1, 2001; 75(15): 7097 - 7106. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |