The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sans, E.
Right arrow Articles by Duperray, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sans, E.
Right arrow Articles by Duperray, A.
The Journal of Immunology, 2001, 166: 544-551.
Copyright © 2001 by The American Association of Immunologists

Analysis of the Roles of ICAM-1 in Neutrophil Transmigration Using a Reconstituted Mammalian Cell Expression Model: Implication of ICAM-1 Cytoplasmic Domain and Rho-Dependent Signaling Pathway1

Emmanuelle Sans2, Elisabeth Delachanal and Alain Duperray2

Laboratoire de Migration Cellulaire et Infiltration Tumorale, Institut Albert Bonniot, Grenoble, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interaction between ICAM-1 (CD54) and fibrinogen (fg) has been shown to enhance leukocyte adhesion, but its specific role in the process of migration across endothelial cell junctions remains unclear. To overcome the problem of multiple adhesion receptors found on endothelial cells, we have engineered stable Chinese hamster ovary cell lines expressing ICAM-1 (Chinese hamster ovary ICAM-1). The transfection of ICAM-1 alone in these cells is sufficient to recapitulate the entire process of neutrophil adhesion and transmigration. This phenomenon was mediated by fg-ICAM-1 interactions, as depletion of fg, as well as the use of an Ab that specifically inhibits ICAM-1-fg interaction (2D5), completely abolished the effect of ICAM-1 expression on PMN transmigration. In addition, this ICAM-1-mediated transmigration is clearly dependent on the occurrence of fg-ICAM-1 interactions on the monolayer, and not on neutrophils, as the preincubation of the PMN with the mAb was ineffective. Furthermore, PMN transmigration, but not adhesion, is totally abolished when the ICAM-1 cytoplasmic domain is deleted, indicating that signaling inside the cell is required to mediate the fg-ICAM-1 effect on transmigration. Using a specific inhibitor of the small GTP-binding protein Rho, we have obtained evidence that this signaling cascade is involved. Thus, our results clearly show that ICAM-1 plays a key role in the migration of leukocytes across cell junctions, and indicate that this phenomenon is not a direct consequence of the enhanced adhesion mediated by the expression of ICAM-1.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The regulated migration of leukocytes through the endothelial cell (EC)3 barrier forms the basis of host defense mechanisms and immune-inflammatory responses. Diapedesis (or extravasation) depends on a stepwise adhesion cascade coordinated by the sequential ligand recognition of cell adhesion molecules expressed on leukocytes and endothelium (1). At least three steps have been identified in this phenomenon: selectin-mediated rolling, {beta}2 integrin-mediated leukocyte adhesion, and migration across EC junctions. This last step or transmigration consists in leukocyte migration across endothelial junctions. Little is known about the adhesion molecules and the intracellular mechanisms implicated in transendothelial migration. This process involves proteins expressed predominantly at intercellular junctions, such as platelet EC adhesion molecule-1 (PECAM-1) (2), a cell adhesion molecule of the Ig superfamily, which has been shown to play a major role in leukocyte transmigration (3). Proteins expressed at the apical surface of the cell may also be involved, either by transmitting a signal or by facilitating leukocyte migration toward the cell junctions (4).

ICAM-1 (5) is a key molecule in leukocyte-endothelium adhesion through its recognition of {beta}2 integrin counterreceptors CD11a/CD18 (LFA-1) (6) and CD11b/CD18 (Mac-1) (7). In addition to its interaction with cell-associated counterreceptors, ICAM-1 recognizes fibrinogen (fg) (8), an abundant plasma glycoprotein of 340 kDa, which is also a ligand for the neutrophil {beta}2 integrin Mac-1 (9). We have previously shown that fg interacts through its {gamma}-chain ({gamma}117–133) (10) with the first Ig-like domain of ICAM-1 (11), and that fg enhances the attachment of leukocytes to HUVEC by acting as a molecular bridge between the two cell types (8). In addition, fg-ICAM-1 interactions have been shown to enhance neutrophil transmigration, stimulating this process by 20- to 30-fold (12), but it remained to be determined whether this enhancement was due to a direct effect from endothelial or leukocyte ICAM-1 or to a more complex pathway involving other adhesion molecules expressed by EC.

Although Abs against ICAM-1 have been shown to inhibit transmigration in in vitro systems (13, 14, 15), these experiments failed to demonstrate the direct implication of ICAM-1 in leukocyte transmigration, as these mAbs may, in fact, block the prerequisite step of tight adhesion to endothelium. Thus, the implication of ICAM-1 in leukocyte transmigration is not clearly demonstrated. To investigate the specific contribution of ICAM-1-fg interaction in neutrophil emigration, we have transfected the cDNA encoding ICAM-1, PECAM-1, or the two in combination into Chinese hamster ovary (CHO) cells, a cell type not normally expressing these molecules, to obtain stable CHO cell lines. Using cells expressing ICAM-1 alone, we have been able to specifically study the role of ICAM-1 in neutrophil transmigration without the interference of PECAM-1, which is implicated in this step. The role of fg-ICAM-1 interactions in PMN transmigration was investigated in adhesion and transmigration assays in the presence of a well-known neutrophil chemoattractant, fMLP (16). In this paper, we show that ICAM-1 is able to support transmigration in the absence of other adhesion molecules expressed in EC. This enhancement of PMN migration across CHO ICAM-1 monolayers was fg dependent, as evidenced by the inhibition of transmigration obtained in the presence of fg-depleted plasma. This phenomenon was also blocked using function-blocking anti-ICAM-1 mAbs. These results demonstrate that ICAM-1, through its interaction with fg, is directly implicated in the process of neutrophil transmigration. Furthermore, a mutant of ICAM-1 lacking its cytoplasmic portion is not able to support PMN emigration, while PMN adhesion is not modified on these monolayers. This demonstrates that the enhanced transmigration induced by ICAM-1 is not a direct consequence of a facilitated adhesion. Finally, we show in this paper that ICAM-1-mediated transmigration involves the small GTP-binding protein Rho.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

The following mAbs were used: mouse mAbs 3D6 and 2D5 to human ICAM-1 (12); mouse Ab 5F4-10 (Hemeris, Grenoble, France) to human PECAM-1. Mouse mAb OKM1 directed against {beta}2 integrin Mac-1 was a kind gift from Dario Altier (Boyer Center for Molecular Medicine, Yale University School of Medicine). Anti-LFA-1 mAb 25.3.1 was obtained from Immunotech (Marseille, France). Tetramethylrhodamine isothiocyanate and FITC-conjugated goat anti-mouse IgG F(ab')2 secondary Abs were purchased from Jackson ImmunoResearch (Asniéres, France). C3 transferase was kindly provided by M. Popoff (Institut Pasteur, Paris, France).

Cell culture

HUVEC were isolated from human umbilical cords by collagenase treatment as described by Jaffe et al. (17). Cells were maintained in medium 199 (M199; BioWhittaker, Gagny, France) containing 20% FBS (Life Technologies, Cergy Pontoise, France), 100 U/ml penicillin, 100 µg/ml streptomycin, 0.25 µg/ml amphotericin B (Life Technologies), 50 µg/ml EC growth supplement (prepared from bovine brain), and 100 µg/ml heparin (Sigma, St. Louis, MO). In some experiments, HUVEC were stimulated with 200 U/ml TNF-{alpha} (Boehringer Mannheim, Meylan, France) for 4 h at 37°C. PMN were isolated by differential centrifugation on Ficoll-Hypaque gradients (Sigma), followed by dextran sedimentation and hypotonic lysis of erythrocytes.

Transfection experiments

A full-length cDNA clone encoding human PECAM-1 (18) in the mammalian expression vector pcDNA3 (Invitrogen, Groningen, The Netherlands) was transfected in wild-type (WT) CHO cells by electroporation. Recombinant CHO cells were selected in DMEM (BioWhittaker) containing 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and nonessential amino acids (BioWhittaker) plus 1 mg/ml G418 (Geneticin; Life Technologies) for selection or 500 µg/ml for routine culture.

CHO cells were transfected with a full-length cDNA clone encoding human ICAM-1 (19) in the mammalian expression vector pRC/CMV by electroporation (Invitrogen, San Diego, CA), with selection of stable transfectants in DMEM complemented with 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, 1 mM L-glutamine, and nonessential amino acids plus G418 as described previously (10).

CHO cells expressing ICAM-1 cytoplasmic deletion mutant (CHO ICAM-1 {Delta}cyt) were generated. A PCR procedure was performed to delete the cytoplasmic domain of ICAM-1 using the pcDNA3 plasmid containing the human ICAM-1 coding sequence. The following primers were used: a sense primer (5'-931TGTGCTGGAATTCCTCAGCC950-3') containing the EcoRI restriction site and an antisense primer (5'-GCTCTAGATCA2467GTTATAGAGG2458-3') containing a stop codon (underlined) and the XbaI restriction site to facilitate subsequent cloning. The PCR product was digested by EcoRI and XbaI and ligated into the pcDNA3 vector containing native human ICAM-1 that was also cut by the same enzymes. CHO cells were then transfected with the resulting construction and recombinant cells were selected in DMEM (BioWhittaker) containing 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and nonessential amino acids (BioWhittaker) plus 1 mg/ml G418 (Geneticin; Life Technologies) for selection or 500 µg/ml for routine culture.

CHO ICAM-1/PECAM-1 were obtained by transfection of CHO ICAM-1 cells with a full-length cDNA clone encoding human PECAM-1 in the mammalian expression pUT-SV1 (Eurogentec, Seraing, Belgium). Selection of stable transfectants was performed in DMEM complemented with 10% FBS, 1 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, 500 µg/ml G418, and nonessential amino acids plus 50 µg/ml phleomycin (Eurogentec) for selection or 25 µg/ml for routine culture.

Phenotypic characterization of WT, ICAM-1, ICAM-1 {Delta}cyt, PECAM-1, or ICAM-1/PECAM-1 transfectants was conducted by flow cytometry and immunofluorescence staining on adherent cells with anti-ICAM-1 (3D6) or anti-PECAM-1 (5F4-10) mAbs.

Flow cytometry analysis

Single-cell suspensions obtained after trypsinization were centrifuged (400 x g, 5 min) and resuspended in medium containing 5% FBS. After incubation with 20 µg/ml primary mAbs for 30 min at 4°C, cell suspensions were washed and mixed with a FITC-conjugated secondary Ab (20 µg/ml) (Jackson ImmunoResearch) for an additional 30 min at 4°C. After washing, cells were analyzed on a Becton Dickinson FACScan (Mountain View, CA).

Immunofluorescence staining and confocal imaging

CHO cells were seeded on glass coverslips and grown to confluency before immunofluorescence staining. Glass coverslips were coated with 25 µg/ml human plasma fibronectin (prepared from human plasma, as described by Engvall and Ruoslahti (20)). Cells were fixed with 2% paraformaldehyde, permeabilized with 0.5% Triton X-100, and processed for indirect immunofluorescence microscopy. Incubation with the primary Ab was followed by incubation with tetramethylrhodamine isothiocyanate-conjugated secondary Ab (Jackson ImmunoResearch), with three washes in 1x PBS, Ca2+, Mg2+, 1% BSA, and 0.05% Tween 20 between the various steps. Coverslips were then mounted in Aquamount (BDH Laboratory Supplies, Dorset, U.K.) before microscopic observation. Cells were imaged using a Zeiss confocal microscope (Zeiss, Oberkochen, Germany). Cross-sectional reconstruction was accomplished with a Metamorph program (Princeton Instruments, Evry, France) to combine the entire Z series into a stack projection and to overlay and process the final image.

Permeability assay

Cells (104 at seeding in 100 µl) were cultured for 4 days on 6.5-mm diameter polycarbonate membranes of 0.4-µm pore size (Costar; Dominique Dutscher, Brumath, France), previously coated with human fibronectin (25 µg/ml) for 2 h at 37°C and rinsed with 1x PBS. Six hundred microliters of culture medium filled the lower compartment. Before the experiment, the culture medium of both the upper and lower compartments was replaced, without washing, with DMEM supplemented with 5% FBS (0.1 ml, upper chamber and 0.6 ml, lower chamber). Special culture medium for HUVEC (described above) was used for assessment of HUVEC permeability. HRP (35 nM; VI-A type, 44,000 m.w.; Sigma) was added in the upper compartment. After 1 h at 37°C, 10 µl of the upper compartment was collected and kept on ice until enzymatic activity of HRP was assayed using a Sigma Fast kit (Sigma). The reaction was allowed to proceed for 20 min at room temperature (RT) before measuring the absorbance at 490 nm. To control monolayer permeability in the same condition as in the transmigration assay, CHO monolayers were assessed for cellular integrity 3 days after seeding on 0.4-µm polycarbonate membranes. Medium from the lower compartments was replaced by DMEM/HEPES (20 mM, pH 7.4). The upper compartments were filled with the same medium plus plasma (1:5 dilution) and 100 µM D-phenylalanyl-L-prolyl-L-arginine chloromethyl ketone (Boehringer Mannheim). After 3 h at 37°C in 5% CO2, 7 µl of HRP at 0.5 µM was added in the upper compartment, followed by gentle agitation and a 30-min incubation at 37°C in 5% CO2. Quantification of HRP presence in the lower compartment was determined as described above.

Adhesion assay

WT or recombinant CHO cells were grown to confluency onto 48-well plates (Falcon; Becton Dickinson). In some cases, CHO cell monolayers were pretreated with a specific inhibitor of Rho proteins, C3 transferase (50 µg/ml in complete medium). After a 4 h-incubation at 37°C, cells were extensively washed before addition of labeled PMN. PMN (at 5 x 106/ml) were fluorescently labeled with 7.5 µM calcein acetoxymethyl (Molecular Probes, Leiden, The Netherlands) in RPMI 1640/HEPES (20 mM, pH 7.4) for 30 min at 37°C, washed in the same medium, and resuspended in RPMI 1640/HEPES. PMN were incubated with 10 µM fMLP (Calbiochem, La Jolla, CA), with or without purified fg at 300 µg/ml (Diagnostica Stago, Asnieres, France). After a 20-min incubation at RT, 2 x 105 calcein acetoxymethyl-labeled PMN were added to CHO cell monolayers for increasing time intervals between 10 and 45 min at RT. At the end of each incubation, cells were washed and fluorescent adherent cells were evaluated using a fluorescence plate reader (Fluoroskan Ascent; Labsystems, Helsinki, Finland) set at excitation 490 nm and emission 535 nm.

Transmigration assay

CHO cell monolayers were grown to confluency on fibronectin-coated porous membranes (6.5-mm diameter and 5-µm pore size; Costar) for 3 days at 37°C. CHO cells were then incubated in duplicate with PMN (2 x 105/well); to maintain the viability of human PMN, autologous normal human plasma (1:5 dilution in DMEM/HEPES (20 mM, pH 7.4) was added with the PMN in the upper compartment in the presence of 100 µM D-phenylalanyl-L-prolyl-arginine chloromethyl ketone (Boehringer Mannheim), which is a specific inhibitor of thrombin. A total of 2 x 10-8 M fMLP or 10-8 M IL-8 (Calbiochem) in DMEM/HEPES (20 mM, pH 7.4) was added in the lower compartment to create a chemotactic gradient for PMN. In some experiments, plasma was fg depleted before the experiment by incubation with 1 U/ml thrombin (from human plasma; Sigma) for 5 min at 37°C, followed by centrifugation (18 000 x g, 5 min). PMN were incubated with fg-depleted plasma alone or in the presence of purified fg at 300 µg/ml (Diagnostica Stago). In mAb inhibition experiments, PMN suspensions and cell monolayers were separately preincubated with anti-ICAM-1 mAbs 2D5 or 3D6 (20 µg/ml) for 5 min at RT for PMN and 10 min at 37°C for cell monolayers before the addition of autologous plasma. Anti-Mac-1 or anti-LFA-1 mAbs (20 µg/ml) were incubated for 10 min at RT with PMN before the addition of plasma and incubation on CHO monolayers. In assays performed with C3 transferase, monolayers were treated with C3 transferase (50 µg/ml, 37°C) before addition of PMN, following extensive washing and replacement into new medium; PMN were added after a 4-h incubation. Migrated neutrophils were recovered from the bottom of the well after 3 h at 37°C in 5% CO2, centrifuged, stained with trypan blue, and counted microscopically.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recombinant CHO cell lines

We have developed stable CHO cell lines expressing ICAM-1 or PECAM-1 (CHO ICAM-1 and CHO PECAM-1, respectively) or the two adhesion molecules in combination (CHO ICAM-1/PECAM-1). Expression levels of ICAM-1 and PECAM-1 in the three recombinant cell lines were quantified by FACScan analysis.

As expected, WT CHO did not express ICAM-1 or PECAM-1 (Fig. 1GoA), whereas CHO ICAM-1 expressed ICAM-1 at a high expression level comparable to TNF-{alpha}-stimulated HUVEC (Fig. 1GoB). In CHO PECAM-1, PECAM-1 is expressed at nearly the same level as in HUVEC, where its expression is constitutive. Similar expression levels of both proteins were found for the cell line coexpressing ICAM-1 and PECAM-1 (Fig. 1GoA).



View larger version (71K):
[in this window]
[in a new window]
 
FIGURE 1. Characterization of CHO cell lines. A and B, FACS analysis of ICAM-1 and PECAM-1 expression in comparison to control Ab on: A, WT CHO, CHO ICAM-1, CHO PECAM-1, and CHO ICAM-1/PECAM-1; B, resting or TNF-{alpha}-stimulated HUVEC. C and D, Immunofluorescence staining and confocal imaging of CHO transfectants expressing ICAM-1 (C) or PECAM-1 (D). CHO cells were fixed and stained with anti-ICAM-1 (3D6) or anti-PECAM-1 (5F4-10) mAbs (20 µg/ml), respectively, followed by incubation with rhodamine-conjugated secondary Ab, as described in Materials and Methods. Cells were imaged using confocal microscopy with reconstruction in the z-axis to provide representative cross-sectional image (lower panels). Bar, 10 µm.

 
On HUVEC, ICAM-1 is distributed over the whole cell surface whereas PECAM-1 is almost exclusively expressed at interendothelial junctions. To verify the correct localization of ICAM-1 and PECAM-1 at the cell surface after transfection, confluent CHO ICAM-1 and CHO PECAM-1 monolayers were examined by immunofluorescence staining, followed by confocal analysis. The localization of ICAM-1 and PECAM-1 was determined using confocal microscopy with reconstruction in an x-z cross-sectional plane to directly visualize cell surface and cell-cell junctions. Confocal analysis clearly shows that ICAM-1 was uniformly distributed on the upper cell surface, including the cell junctions of the recombinant cell line (Fig. 1GoC) while PECAM-1 was concentrated at the intercellular junctions (Fig. 1GoD), indicating a correct localization of these recombinant proteins in CHO cells. Similar results were found for the cell line coexpressing ICAM-1 and PECAM-1 (data not shown).

Since we intended to use these CHO cell lines for transmigration assays instead of HUVEC monolayers, we assessed their capacity to form confluent monolayers in comparison to resting or TNF-{alpha}-stimulated HUVEC. The integrity of the monolayers and their function as barriers were studied by a permeability assay using HRP (21).

Three days after seeding, resting and TNF-{alpha}-stimulated HUVEC presented a low permeability level with 19.4 ± 0.1% and 21.6 ± 0.1% of controls, respectively (Fig. 2Go). CHO ICAM-1, CHO PECAM-1, and CHO ICAM-1/PECAM-1 formed monolayers that were nearly impermeable to HRP, with 12.9 ± 3.1%, 17.2 ± 4.1%, and 15.7 ± 4.4% of controls, respectively; these values are similar to those obtained with WT CHO monolayers (11.9 ± 1.1%) (Fig. 2Go). Permeability across WT CHO or CHO ICAM-1 was also investigated in the conditions established for transmigration assays. Monolayers were incubated for 3 h at 37°C with a 1:5 dilution of plasma (in the medium used in transmigration) before the addition of HRP in the upper compartment to verify if plasma could have any effect on monolayer integrity. In these conditions, similar results were obtained with no significant difference between the two cell lines (data not shown). These results show that recombinant CHO cells are able to form correct, continuous monolayers with a high cohesion of cell–cell contacts and a permeability level comparable to that observed with EC. Finally, the cellular location of recombinant proteins was identical to that observed for ICAM-1 and PECAM-1 in EC.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. Permeability analysis of resting or TNF-{alpha} stimulated HUVEC and CHO monolayers expressing ICAM-1, PECAM-1, or both in combination in comparison to WT CHO. HRP permeability was referred as percentage of control, corresponding to fibronectin-coated Transwell without cells. Data are expressed as mean ± SD of three separate experiments.

 
Human plasma enhances leukocyte transmigration across CHO ICAM-1 monolayers

To study the role of ICAM-1 by itself in neutrophil transmigration, we used CHO ICAM-1 monolayers in an in vitro transmigration assay. The implication of ICAM-1-fg interactions in our model was first studied in a protein-free medium with or without fg. In these conditions, few PMN were able to migrate across CHO monolayers after a 3-h incubation time period and most of migrated PMN were either dead or adherent to the well surface. To maintain the viability of human neutrophils, all subsequent experiments were done in the presence of autologous human plasma.

In preliminary experiments, we tested PMN transmigration across WT CHO and CHO cells expressing either ICAM-1 or PECAM-1 or the two in combination toward fMLP or IL-8 gradients, which are well-known neutrophil chemoattractants (16). It has previously been shown that PECAM-1 plays a crucial role in leukocyte transendothelial migration during inflammation (3). Fig. 3Go clearly shows that PECAM-1 expressed on CHO cells can support transmigration, with a 4-fold increase in the number of transmigrated cells in comparison to WT CHO (29.8 ± 4.5% vs 6.7 ± 3.9%), demonstrating that the function of PECAM-1 is maintained in these transfected cells.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. Effect of fMLP (2 x 10-8 M) or IL-8 (10-8 M) on PMN transmigration across WT CHO or CHO monolayers expressing ICAM-1, PECAM-1, or both molecules in combination. Transmigration assay was conducted as described in Materials and Methods.

 
Surprisingly, CHO cells transfected with ICAM-1 alone were also able to promote transmigration of human PMN in the presence of a fMLP gradient at a comparable level to CHO PECAM-1 (31.6 ± 8.8% vs 29.8 ± 4.5% of transmigrated PMN, respectively) (Fig. 3Go). Similar results were obtained when IL-8 was used instead of fMLP. All subsequent experiments were conducted in the presence of a fMLP gradient. It can be noted that, in our model, coexpression of the two proteins did not provide any additional effect in comparison to CHO cells expressing ICAM-1 or PECAM-1 alone (Fig. 3Go). These data clearly show that ICAM-1 is directly implicated in PMN transmigration.

We next investigated the effect of the absence of fg on PMN transmigration. fg was depleted from human plasma by action of thrombin, which is known to specifically degrade fg. Interestingly, results in Fig. 4Go show that the addition of fg-depleted plasma reduced PMN transmigration across CHO ICAM-1 to only 22 ± 3%, while no effect was observed on PECAM-1-dependent transmigration or across WT CHO monolayers. This demonstrates that ICAM-1-fg interactions are implicated in this process.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. Effect of complete plasma or plasma fg-depleted (plasma/{Delta}fg) or fg-depleted plasma complemented with purified fg at physiologic concentration (300 µg/ml) on PMN transmigration across CHO monolayers expressing ICAM-1 or PECAM-1. fMLP at 2 x 10-8 M was added to the lower compartment. Transmigration assay was performed as described in Materials and Methods. Data shown represent mean ± SD of three separate experiments.

 
To confirm that fg plays a direct role in PMN emigration, we performed experiments using purified fg added to fg-depleted plasma. As shown in Fig. 4Go, addition of purified fg in fg-depleted plasma completely restored PMN migration across CHO ICAM-1 monolayers, demonstrating that fg depletion of plasma has no side effects and that the observed inhibition was due to the lack of fg.

Furthermore, depletion of fg had the same effect when the transmigration assay was performed toward a gradient of IL-8 (data not shown). This demonstrates that fg via its interaction with ICAM-1 is directly involved in the passage of PMN across the cell barrier, independently of the chemoattractant used.

Fg-dependent transmigration is blocked by anti-ICAM-1 mAbs

To better understand this mechanism, we used anti-ICAM-1 mAbs in transmigration assays. A panel of mAbs recognizing different ICAM-1 domains is available in our laboratory (12). Among these, 2D5 mAb binds to domain 1 of ICAM-1 and is known to completely suppress ICAM-1-fg interactions, while 3D6, which interacts with the second domain, has no effect on these interactions (11). The effect of 2D5 and 3D6 mAbs was tested on transmigration of PMN across CHO ICAM-1 and CHO PECAM-1 monolayers in the presence of human plasma.

As shown in Fig. 5Go, neither 2D5 nor 3D6 had inhibitory effects on PMN transmigration across WT CHO or CHO PECAM-1 monolayers. However, 2D5 mAb completely inhibited ICAM-1-dependent PMN transmigration across CHO ICAM-1 monolayers, resulting in only 19.2 ± 6.1% of transmigrated PMN. Interestingly, 3D6 did not have any effect on ICAM-1-mediated transmigration. These inhibition experiments with 2D5 mAb provide evidence for a direct role of fg-ICAM-1 interactions in neutrophil transmigration.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of anti-ICAM-1 2D5 and 3D6 mAbs on PMN migration across CHO monolayers expressing ICAM-1 or PECAM-1. The experiment was performed in the presence of complete plasma; in some cases, 2D5 or 3D6 mAbs were added to PMN and CHO cells in the presence of complete plasma. After a 10-min incubation period, mAbs added to CHO monolayers were washed out and PMN incubated 5 min with 2D5 or 3D6 were added to CHO cells without removing the mAbs. Transmigration assay was conducted as described in Materials and Methods. Data represent mean ± SD of three separate experiments.

 
Because 2D5 mAb can recognize ICAM-1 on both CHO cells and PMN, it was important to determine which cell type was targeted by this inhibitory effect. For this, either PMN or CHO monolayers were pretreated with 2D5 mAb.

PMN transmigration was almost totally abolished when 2D5 was added on both PMN and CHO cells with only 4.7 ± 1.1% of transmigrated PMN (Fig. 6Go). The inhibition was similar when 2D5 was added on CHO ICAM-1 alone (3.6 ± 2% of transmigrated PMN), whereas 3D6 used in the same conditions, as a control, had no effect. In contrast, preincubation of 2D5 with PMN alone did not inhibit their transmigration (24.3 ± 3.2% of transmigrated PMN) (Fig. 6Go). These results demonstrate that the enhancement of PMN emigration is due to interaction of fg with ICAM-1 expressed on CHO cells.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of anti-ICAM-1 2D5 or 3D6 mAbs on PMN transmigration across CHO monolayers expressing ICAM-1. The experiment was performed in the presence of complete plasma either in the absence of 2D5 or with 2D5 incubated on PMN and CHO cells in combination or alone. 3D6 mAb was incubated on CHO cells alone. In each condition, mAbs were removed from monolayers or PMN by extensive washes. Percentage obtained with WT CHO was subtracted for all of the experiments. Transmigration assay was performed as described in Materials and Methods. Data shown represent mean ± SD of three separate experiments.

 
We have investigated which receptor on PMN was implicated in this interaction. Although anti-LFA-1 mAb did not have any effect on PMN transmigration across CHO ICAM-1 monolayers, OKM1, an anti-Mac-1 that specifically blocks fg-Mac-1 interaction, inhibited this extravasation by 62% (data not shown). These results demonstrate that fg interacts with ICAM-1 on CHO monolayers and Mac-1 on PMN.

Because we wanted to understand the mechanism that regulates ICAM-1-mediated transmigration, we evaluated the implication of ICAM-1 in a signaling cascade.

Fg-dependent transmigration requires the presence of ICAM-1 cytoplasmic sequence

The ability of ICAM-1 to function as a signaling molecule has been demonstrated in previous studies. In brain EC, ICAM-1 cross-linking leads to tyrosine phosphorylation of cytoskeleton proteins and enhanced lymphocyte migration across brain EC (22, 23). To assess whether ICAM-1 might be implicated in a signaling cascade in our system, we have produced a recombinant cell line expressing ICAM-1 without its cytoplasmic portion (CHO ICAM-1 {Delta}cyt). Expression level of this mutated protein was comparable to native ICAM-1 expressed in CHO ICAM-1 (Fig. 7GoA). Furthermore, this mutation did not have any effect on ICAM-1 localization on the cell (Fig. 7GoB) since we found the protein expressed uniformly on the whole cell surface.



View larger version (66K):
[in this window]
[in a new window]
 
FIGURE 7. Characterization of the CHO ICAM-1 {Delta}cyt cell line. A, FACS analysis of ICAM-1 expression in comparison to control Ab. B, Immunofluorescence staining and confocal imaging of ICAM-1 on CHO ICAM-1 {Delta}cyt. CHO cells were fixed and stained for ICAM-1 with mAb 3D6 (20 µg/ml) followed by incubation with rhodamine-conjugated secondary Ab as described in Materials and Methods. Cells were imaged using confocal microscopy with reconstruction in the z-axis to provide representative cross-sectional image (lower panels). Bar, 10 µm.

 
We have investigated PMN adhesion and transmigration across CHO cells expressing ICAM-1 with or without its cytoplasmic portion. Results in Fig. 8Go clearly show that ICAM-1 expressed on CHO cells are able to support PMN adhesion in the presence of purified fg, with a 2-fold increase of adherent cells in comparison to WT CHO (63.3 ± 4.8% and 30 ± 3.3%, respectively). Furthermore, the absence of fg led to a decrease in adherent PMN, whereas no effect was observed on WT CHO monolayers. Interestingly, CHO ICAM-1 {Delta}cyt are able to support PMN adhesion in the presence of fg (62 ± 2.7%) to the same level as that of native protein (Fig. 8GoA), while ICAM-1-dependent adhesion was inhibited in the absence of fg (40.2 ± 5.3%). Surprisingly, PMN transmigration across CHO ICAM-1 {Delta}cyt monolayers was totally abolished in the presence or absence of fg (2.3 ± 3.1% vs 0.2 ± 2.3%, respectively) (Fig. 8GoB). This defect in PMN transmigration is not due to an impaired interaction between fg and ICAM-1 {Delta}cyt protein. First, adhesion of PMN is enhanced in the presence of purified fg, as it does on CHO ICAM-1 monolayers. Second, using anti-fg polyclonal Ab followed by an immunofluorescence experiment, we have demonstrated that fg was able to interact with WT ICAM-1 and mutated ICAM-1 (data not shown).



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 8. Effect of the deletion of ICAM-1 cytoplasmic C-ter domain on PMN adhesion and transmigration. A, Adhesion of human PMN on WT CHO, CHO ICAM-1 or CHO ICAM-1 {Delta}cyt was performed in the presence or absence of purified fg. Results are expressed as percentage of adherent PMN. Adhesion assays were performed as described in Materials and Methods. Data represent mean ± SD of three separate experiments. B, PMN transmigration across CHO ICAM-1 and CHO ICAM-1 {Delta}cyt monolayers was realized in the presence of complete plasma or plasma fg depleted (plasma/{Delta}fg) in response to a gradient of fMLP. Percentage obtained with WT CHO, which was considered as background, was subtracted. Transmigration assay was performed as described in Materials and Methods. Data represent mean ± SD of three separate experiments.

 
We have investigated whether this inhibition in transmigration resulted from a defect in a signaling event which in the WT ICAM-1 could be induced by interaction of ICAM-1 cytoplasmic domain with an intracellular protein. It has been shown that ICAM-1 can associate via its cytoplasmic domain with {alpha}-actinin, an actin-binding cytoskeletal protein (24). The small GTP-binding protein Rho is a key mediator of actin cytoskeletal remodeling induced by intracellular signals (25).The observation that ICAM-1 can associate with components of the actin cytoskeleton suggested that Rho protein could be involved in regulating adhesion and transmigration mediated by this receptor. Furthermore, endothelial ICAM-1 has been implicated recently in lymphocyte migration across brain EC via a Rho-dependent pathway (23). Since deletion of the ICAM-1 cytoplasmic sequence dramatically inhibited PMN transmigration, the potential role of Rho was assessed in our PMN transmigration assay. CHO cell monolayers were treated with the bacterial toxin C3 transferase, which is capable of entering the cells and specifically inactivating Rho proteins by ADP ribosylation (26). As shown in Fig. 9GoA, treatment of the cells with 50 µg/ml C3 transferase did not influence PMN adhesion on CHO ICAM-1, whereas it significantly reduced PMN transmigration to the level reached across WT CHO cells (16.15 vs 15.44%, respectively). The same treatment had no effect on transmigration achieved across WT CHO (Fig. 9GoB). These results clearly demonstrate that ICAM-1 is implicated in a cascade of signaling events involving the small GTP-binding protein Rho; this signaling pathway is probably involved in the subsequent transmigration of leukocytes.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 9. Effect of C3 transferase on PMN adhesion and transmigration across CHO ICAM-1 monolayers. Adhesion (A) and transmigration (B) assays were performed in the presence of purified fg or complete plasma, respectively. CHO monolayers were incubated in the absence or presence of C3 transferase, a specific inhibitor of Rho protein (50 µg/ml, 4 h, 37°C). Transmigration assay was performed as described in Materials and Methods. Data shown represent the mean of two separate experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we show that ICAM-1 can mediate the entire transmigration process in the absence of other adhesion molecules known to have a role in this phenomenon, such as PECAM-1. ICAM-1 has been shown to be important for adhesion of leukocytes to endothelium (1, 27), which is a prerequisite step for subsequent migration of leukocytes toward and across interendothelial junctions. Classically, investigations on the implication of adhesion molecules on transendothelial migration have used mAbs against these proteins to test their ability to inhibit the efflux of leukocytes. This approach has shown that anti-ICAM-1 mAbs are capable of inhibiting the transmigration process in vitro (13, 14, 15), leading to the conclusion that ICAM-1 is implicated in this phenomenon. In vivo (28), in a mouse model of induced pneumonia, neutrophil emigration was partially inhibited by anti-ICAM-1 Abs. Furthermore, in vivo studies using mice deficient in ICAM-1 have also demonstrated a partial defect in leukocyte recruitment (29, 30). However, since ICAM-1 is required for leukocyte adhesion, this low transmigration may be due to an impaired adhesion leading to a defect in migration across EC monolayers. In addition, EC express many other adhesion molecules, which can be implicated in the subsequent transmigration.

To test the specific role of ICAM-1 in the process of transmigration, we have engineered stable CHO cell lines expressing human ICAM-1 or PECAM-1 or coexpressing both proteins. To be used as a model of leukocyte transendothelial migration, these transfectants must share common characteristics with EC expressing the native molecules in terms of expression level, localization at the cell surface, and the ability to form cohesive and confluent monolayers. In these recombinant cell lines, we obtained expression levels similar to those found in EC, with an ICAM-1 expression level comparable to TNF-{alpha}-stimulated HUVEC. As revealed by immunofluorescence experiments, ICAM-1 is localized uniformly at the cell surface, whereas PECAM-1 is concentrated at the cell-cell contacts of these recombinant cells; these findings are in agreement with ICAM-1 and PECAM-1 localization on EC and on recombinant cells described in other studies (31, 32, 33, 34).

The results obtained with our model of CHO cells expressing ICAM-1 alone indicate that in addition to its well-known function in leukocyte adhesion, ICAM-1 plays a direct role in the migration of these cells across the junction. This enhanced transmigration mediated by ICAM-1 could be the end result of the increase in adhesion, with other molecules expressed at the cell junctions being responsible for the transmigration. Our results indicate that this is not the case. First, if the above hypothesis was correct, CHO ICAM-1 would have an increase in leukocyte adhesion, with no modification of the transmigration level, while CHO ICAM-1/ PECAM-1 would be expected to show an even higher increase in transmigration. However, transmigration across CHO ICAM-1/PECAM-1 or ICAM-1 monolayers was very similar, suggesting that in our system, ICAM-1 participates extensively in PMN transmigration, independently of PECAM-1. This is supported by the fact that CD31-deficient mice exhibit leukocyte transendothelial migration to the same degree as WT mice (35), thus suggesting the existence of a CD31-independent pathway to sustain leukocyte migration. Second, results obtained with cells expressing ICAM-1 {Delta}cyt clearly demonstrate that adhesion can be dissociated from transmigration. Cells transfected with this mutant protein are able to support adhesion, to a level similar to the one obtained with WT ICAM-1, but can no longer support PMN transmigration.

One surprising result was that there was no additive effect of ICAM-1 and PECAM-1 in our model of recombinant CHO cells. One possibility is that ICAM-1 is already stimulating transmigration to its maximum and that the addition of PECAM-1 produces no further effect. This is supported by the fact that in our model, ICAM-1-mediated transmigration reached the same level as PMN transmigration across CHO PECAM-1 monolayers.

All of the above experiments were done in the presence of autologous plasma to overcome the problem of neutrophil viability in the absence of protein. As we have previously shown that fg-ICAM-1 interactions enhance leukocyte transmigration across resting HUVEC monolayers (12), we have performed experiments to address the question of the importance of fg-ICAM-1 interactions using our recombinant model. Replacement of normal plasma with fg-depleted plasma led to a decrease of the observed transmigration to control level, demonstrating the involvement of fg-ICAM-1 interaction in neutrophil transmigration. Addition of purified fg to fg-depleted plasma counteracted the inhibition due to the depletion of fg. These data clearly demonstrate the fundamental implication of fg in ICAM-1-mediated neutrophil transmigration. In contrast, fg depletion has no effect on PMN transmigration across WT CHO or CHO PECAM-1 monolayers.

To further confirm the implication of fg-ICAM-1 interaction in PMN transmigration, we used anti-ICAM-1 mAbs. 2D5, which interacts with domain 1 and inhibits fg-ICAM-1 recognition (12), had no effect on PECAM-1-induced transmigration but completely suppressed PMN migration across CHO ICAM-1. Interestingly, this 2D5 inhibitory effect was observed when CHO monolayers were preincubated with the mAb, but not when PMN alone were preincubated. These results indicate that the enhanced PMN transmigration is directly mediated by ICAM-1 expressed on CHO cells. Using anti-Mac-1 Abs, we conclude that on PMN, fg interacts with the {beta}2 integrin Mac-1, as previously demonstrated by Altieri et al. (9).

The previous data are consistent with the hypothesis of an intracellular signal in the cell monolayer. The mechanism by which fg-ICAM-1 interaction leads to the increase of transmigrated neutrophils remains to be determined. Several mechanisms can explain this marked increase. Interaction between endothelial ICAM-1 and a ligand expressed on leukocytes or a soluble ligand, like fg, could induce an intracellular signaling cascade leading to the opening of intercellular junctions associated with leukocyte transmigration. Indeed, Hicks et al. (36) have shown that fg, via its binding to ICAM-1, initiates signaling pathways leading to the synthesis of vasoactive mediators. ICAM-1 has also been implicated in signal transduction mechanism involving tyrosine phosphorylation of cytoskeleton-associated proteins (22, 37), resulting in enhanced lymphocyte migration across brain EC monolayers (23). To test the hypothesis of an intracellular signaling pathway, we investigated the implication of ICAM-1 cytoplasmic domain. Interestingly, in the presence or absence of fg, ICAM-1 {Delta}cyt protein supports PMN adhesion, whereas ICAM-1-mediated PMN transmigration is totally abolished.

This result is consistent with a role for ICAM-1 in intracellular signaling events which may lead to facilitated PMN infiltration into tissues. Since the Rho signaling pathway was previously implicated in lymphocyte migration across brain EC (23), we investigated its implication in our model of PMN transmigration by pretreatment of CHO monolayers with C3 transferase, a specific inhibitor of Rho proteins. PMN adhesion is not affected by C3, whereas ICAM-1-mediated transmigration is totally abolished. These results demonstrate that ICAM-1 is implicated in a signaling cascade involving Rho proteins expressed in CHO cells. As previously reported (38), Rho itself may be activated through cell surface signals propagated through the actin cytoskeleton. A possible mechanism is that ICAM-1-fg interactions induced strong adhesion of PMN on cell monolayers which led to intracellular signals involving ICAM-1 cytoplasmic domain and Rho proteins. One hypothesis to explain the observed effect of fg-ICAM-1 interaction on PMN transmigration is that the subsequent activation of Rho might induce some modifications of junctional proteins which may facilitate PMN infiltration.

Another likely possibility is that neutrophils may migrate more easily on the surface of EC using fg-ICAM-1 interactions, leading to an increase in the number of leukocytes reaching the intercellular junctions. This hypothesis is supported by the demonstration that VCAM-1 was able to increase monocyte transendothelial chemotaxis (4) by facilitating lateral migration of monocytes on EC. We are currently investigating this possibility.

Taken together, these results demonstrate the implication of ICAM-1 in neutrophil transmigration via its interaction with fg. It is the first time that the role of ICAM-1 by itself is directly demonstrated in the process of neutrophil transmigration, without the interfering presence of other adhesion molecules expressed by EC. In addition, we demonstrate that this effect is mediated through the ICAM-1 cytoplasmic domain and the activation of Rho.

Further studies are now in progress to elucidate the mechanisms underlying this phenomenon. In addition, this recombinant CHO model will be useful to precisely determine which amino acids in the ICAM-1 sequence are important in fg-dependent transmigration.


    Acknowledgments
 
We thank Nathalie Bertacchi for technical assistance.


    Footnotes
 
1 This work was supported by the Association de Recherche sur la Polyarthrite, Association pour la Recherche sur le Cancer, and Ligue Centre le Cancer, Comités de la Drôme et de l’Isére. Back

2 Address correspondence and reprint requests to Dr. Emmanuelle Sans or Dr. Alain Duperray, Laboratoire de Migration Cellulaire et Infiltration Tumorale, Institut Albert Bonniot, Domaine de la Merci, 38706 La Tronche Cedex, France. Back

3 Abbreviations used in this paper: EC, endothelial cell; PECAM-1, platelet/EC adhesion molecule-1; fg, fibrinogen; CHO, Chinese hamster ovary; WT, wild type; RT, room temperature. Back

Received for publication July 18, 2000. Accepted for publication October 3, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Carlos, T. M., J. M. Harlan. 1994. Leukocyte-endothelial adhesion molecules. Blood 84:2068.[Abstract/Free Full Text]
  2. DeLisser, H. M., P. J. Newman, S. M. Albelda. 1994. Molecular and functional aspects of PECAM-1/CD31. Immunol. Today 15:490.[Medline]
  3. Muller, W. A., S. A. Weigl, X. Deng, D. M. Phillips. 1993. PECAM-1 is required for transendothelial migration of leukocytes. J. Exp. Med. 178:449.[Abstract/Free Full Text]
  4. Weber, C., T. A. Springer. 1998. Interaction of very late antigen-4 with VCAM-1 supports transendothelial chemotaxis of monocytes by facilitating lateral migration. J. Immunol. 161:6825.[Abstract/Free Full Text]
  5. van de Stolpe, A., P. T. van der Saag. 1996. Intercellular adhesion molecule-1. J. Mol. Med. 74:13.[Medline]
  6. Marlin, S. D., T. A. Springer. 1987. Purified intercellular adhesion molecule-1 (ICAM-1) is a ligand for lymphocyte function-associated antigen 1 (LFA-1). Cell 51:813.[Medline]
  7. Diamond, M. S., D. E. Staunton, A. R. de Fougerolles, S. A. Stacker, J. Garcia-Aguilar, M. L. Hibbs, T. A. Springer. 1990. ICAM-1 (CD54): a counter-receptor for Mac-1 (CD11b/CD18). J. Cell Biol. 111:3129.[Abstract/Free Full Text]
  8. Languino, L. R., J. Plescia, A. Duperray, A. A. Brian, E. F. Plow, J. E. Geltosky, D. C. Altieri. 1993. Fibrinogen mediates leukocyte adhesion to vascular endothelium through an ICAM-1-dependent pathway. Cell 73:1423.[Medline]
  9. Altieri, D. C., R. Bader, P. M. Mannucci, T. S. Edgington. 1988. Oligospecificity of the cellular adhesion receptor Mac-1 encompasses an inducible recognition specificity for fibrinogen. J. Cell Biol. 107:1893.[Abstract/Free Full Text]
  10. Altieri, D. C., A. Duperray, J. Plescia, G. B. Thornton, L. R. Languino. 1995. Structural recognition of a novel fibrinogen {gamma} chain sequence (117–133) by intercellular adhesion molecule-1 mediates leukocyte-endothelium interaction. J. Biol. Chem. 270:696.[Abstract/Free Full Text]
  11. Duperray, A., L. R. Languino, J. Plescia, A. McDowall, N. Hogg, A. G. Craig, A. R. Berendt, D. C. Altieri. 1997. Molecular identification of a novel fibrinogen binding site on the first domain of ICAM-1 regulating leukocyte-endothelium bridging. J. Biol. Chem. 272:435.[Abstract/Free Full Text]
  12. Languino, L. R., A. Duperray, K. J. Joganic, M. Fornaro, G. B. Thornton, D. C. Altieri. 1995. Regulation of leukocyte-endothelium interaction and leukocyte transendothelial migration by intercellular adhesion molecule 1-fibrinogen recognition. Proc. Natl. Acad. Sci. USA 92:1505.[Abstract/Free Full Text]
  13. Furie, M. B., M. C. Tancinco, C. W. Smith. 1991. Monoclonal antibodies to leukocyte integrins CD11a/CD18 and CD11b/CD18 or intercellular adhesion molecule-1 inhibit chemoattractant-stimulated neutrophil transendothelial migration in vitro. Blood 78:2089.[Abstract/Free Full Text]
  14. Issekutz, A. C., D. Rowter, T. A. Springer. 1999. Role of ICAM-1 and ICAM-2 and alternate CD11/CD18 ligands in neutrophil transendothelial migration. J. Leukocyte Biol. 65:117.[Abstract]
  15. Smith, C. W., S. D. Marlin, R. Rothlein, C. Toman, D. C. Anderson. 1989. Cooperative interactions of LFA-1 and Mac-1 with intercellular adhesion molecule-1 in facilitating adherence and transendothelial migration of human neutrophils in vitro. J. Clin. Invest. 83:2008.
  16. Huang, A. J., S. C. Silverstein. 1992. Mechanisms of neutrophil migration across endothelium. N. Simionescu, and M. Simionescu, eds. Endothelial Cell Dysfunctions 201. Plenum Press, New York.
  17. Jaffe, E. A., R. L. Nachman, C. G. Becker, C. R. Minick. 1973. Culture of human endothelial cells derived from umbilical veins: identification by morphologic and immunologic criteria. J. Clin. Invest. 52:2745.
  18. Simmons, D. L., C. Walker, C. Power, R. Pigott. 1990. Molecular cloning of CD31, a putative intercellular adhesion molecule closely related to carcinoembryonic antigen. J. Exp. Med. 171:2147.[Abstract/Free Full Text]
  19. Simmons, D., M. W. Makgoba, B. Seed. 1988. ICAM, an adhesion ligand of LFA-1, is homologous to the neural cell adhesion molecule NCAM. Nature 331:624.[Medline]
  20. Engvall, E., E. Ruoslahti. 1977. Binding of soluble form of fibroblast surface protein, fibronectin, to collagen. Int. J. Cancer 20:1.[Medline]
  21. Lampugnani, M. G., M. Resnati, M. Raiteri, R. Pigott, A. Pisacane, G. Houen, L. P. Ruco, E. Dejana. 1992. A novel endothelial-specific membrane protein is a marker of cell-cell contacts. J. Cell Biol. 118:1511.[Abstract/Free Full Text]
  22. Etienne, S., P. Adamson, J. Greenwood, A. D. Strosberg, S. Cazaubon, P. O. Couraud. 1998. ICAM-1 signaling pathways associated with Rho activation in microvascular brain endothelial cells. J. Immunol. 161:5755.[Abstract/Free Full Text]
  23. Adamson, P., S. Etienne, P. O. Couraud, V. Calder, J. Greenwood. 1999. Lymphocyte migration through brain endothelial cell monolayers involves signaling through endothelial ICAM-1 via a rho-dependent pathway. J. Immunol. 162:2964.[Abstract/Free Full Text]
  24. Carpen, O., P. Pallai, D. E. Staunton, T. A. Springer. 1992. Association of intercellular adhesion molecule-1 (ICAM-1) with actin-containing cytoskeleton and {alpha}-actinin. J. Cell Biol. 118:1223.[Abstract/Free Full Text]
  25. Ridley, A. J.. 1996. Rho: theme and variations. Curr. Biol. 6:1256.[Medline]
  26. Aktories, K., U. Braun, S. Rosener, I. Just, A. Hall. 1989. The rho gene product expressed in E. coli is a substrate of botulinum ADP-ribosyltransferase C3. Biochem. Biophys. Res. Commun. 158:209.[Medline]
  27. Albelda, S. M., C. W. Smith, P. A. Ward. 1994. Adhesion molecules and inflammatory injury. FASEB J. 8:504.[Abstract]
  28. Qin, L., W. M. Quinlan, N. A. Doyle, L. Graham, J. E. Sligh, F. Takei, A. L. Beaudet, C. M. Doerschuk. 1996. The roles of CD11/CD18 and ICAM-1 in acute Pseudomonas aeruginosa-induced pneumonia in mice. J. Immunol. 157:5016.[Abstract]
  29. Broide, D. H., D. Humber, S. Sullivan, P. Sriramarao. 1998. Inhibition of eosinophil rolling and recruitment in P-selectin- and intracellular adhesion molecule-1-deficient mice: [Published erratum appears in 1998 Blood 92:343.]. Blood. 91:2847.[Abstract/Free Full Text]
  30. Sligh, P., Jr cJ. E., C. M. Ballantyne, S. S. Rich, H. K. Hawkins, C. W. Smith, A. Bradley, A. L. Beaudet. 1993. Inflammatory and immune responses are impaired in mice deficient in intercellular adhesion molecule 1. Proc. Natl. Acad. Sci. USA 90:8529.[Abstract/Free Full Text]
  31. Albelda, S. M., W. A. Muller, C. A. Buck, P. J. Newman. 1991. Molecular and cellular properties of PECAM-1 (endoCAM/CD31): a novel vascular cell-cell adhesion molecule. J. Cell Biol. 114:1059.[Abstract/Free Full Text]
  32. Almenar-Queralt, A., A. Duperray, L. A. Miles, J. Felez, D. C. Altieri. 1995. Apical topography and modulation of ICAM-1 expression on activated endothelium. Am. J. Pathol. 147:1278.[Abstract]
  33. Schimmenti, L. A., H. C. Yan, J. A. Madri, S. M. Albelda. 1992. Platelet endothelial cell adhesion molecule, PECAM-1, modulates cell migration. J. Cell Physiol. 153:417.[Medline]
  34. Sun, J., C. Paddock, J. Shubert, H. Zhang, K. Amin, P. J. Newman, S. M. Albelda. 2000. Contributions of the extracellular and cytoplasmic domains of platelet-endothelial cell adhesion molecule-1 (PECAM-1/CD31) in regulating cell-cell localization. J. Cell Sci. 113:1459.[Abstract]
  35. Duncan, G. S., D. P. Andrew, H. Takimoto, S. A. Kaufman, H. Yoshida, J. Spellberg, J. Luis de la Pompa, A. Elia, A. Wakeham, B. Karan-Tamir, et al 1999. Genetic evidence for functional redundancy of platelet/endothelial cell adhesion molecule-1 (PECAM-1): CD31-deficient mice reveal PECAM-1-dependent and PECAM-1-independent functions. J. Immunol. 162:3022.[Abstract/Free Full Text]
  36. Hicks, R. C., J. Golledge, R. Mir-Hasseine, J. T. Powell. 1996. Vasoactive effects of fibrinogen on saphenous vein. Nature 379:818.[Medline]
  37. Durieu-Trautmann, O., N. Chaverot, S. Cazaubon, A. D. Strosberg, P. O. Couraud. 1994. Intercellular adhesion molecule 1 activation induces tyrosine phosphorylation of the cytoskeleton-associated protein cortactin in brain microvessel endothelial cells. J. Biol. Chem. 269:12536.[Abstract/Free Full Text]
  38. Nobes, C. D., A. Hall. 1995. Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81:53.[Medline]



This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Guo, D. Daines, J. Tang, Q. Shen, R. M. Perrin, Y. Takada, S. Y. Yuan, and M. H. Wu
Fibrinogen-{gamma} C-Terminal Fragments Induce Endothelial Barrier Dysfunction and Microvascular Leak via Integrin-Mediated and RhoA-Dependent Mechanism
Arterioscler. Thromb. Vasc. Biol., March 1, 2009; 29(3): 394 - 400.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Kanters, J. van Rijssel, P. J. Hensbergen, D. Hondius, F. P. J. Mul, A. M. Deelder, A. Sonnenberg, J. D. van Buul, and P. L. Hordijk
Filamin B Mediates ICAM-1-driven Leukocyte Transendothelial Migration
J. Biol. Chem., November 14, 2008; 283(46): 31830 - 31839.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J. D. van Buul, M. J. Allingham, T. Samson, J. Meller, E. Boulter, R. Garcia-Mata, and K. Burridge
RhoG regulates endothelial apical cup assembly downstream from ICAM1 engagement and is involved in leukocyte trans-endothelial migration
J. Cell Biol., September 24, 2007; 178(7): 1279 - 1293.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. D. van Buul, E. Kanters, and P. L. Hordijk
Endothelial Signaling by Ig-Like Cell Adhesion Molecules
Arterioscler. Thromb. Vasc. Biol., September 1, 2007; 27(9): 1870 - 1876.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. D. Sithu, W. R. English, P. Olson, D. Krubasik, A. H. Baker, G. Murphy, and S. E. D'Souza
Membrane-type 1-Matrix Metalloproteinase Regulates Intracellular Adhesion Molecule-1 (ICAM-1)-mediated Monocyte Transmigration
J. Biol. Chem., August 24, 2007; 282(34): 25010 - 25019.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. M. Rao, L. Yang, G. Garcia-Cardena, and F. W. Luscinskas
Endothelial-Dependent Mechanisms of Leukocyte Recruitment to the Vascular Wall
Circ. Res., August 3, 2007; 101(3): 234 - 247.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
H.-M. Oh, S. Lee, B.-R. Na, H. Wee, S.-H. Kim, S.-C. Choi, K.-M. Lee, and C.-D. Jun
RKIKK Motif in the Intracellular Domain Is Critical for Spatial and Dynamic Organization of ICAM-1: Functional Implication for the Leukocyte Adhesion and Transmigration
Mol. Biol. Cell, June 1, 2007; 18(6): 2322 - 2335.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Celli, J.-J. Ryckewaert, E. Delachanal, and A. Duperray
Evidence of a Functional Role for Interaction between ICAM-1 and Nonmuscle {alpha}-Actinins in Leukocyte Diapedesis
J. Immunol., September 15, 2006; 177(6): 4113 - 4121.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. J. Chancey, K. V. Khanna, J. F. M. L. Seegers, G. W. Zhang, J. Hildreth, A. Langan, and R. B. Markham
Lactobacilli-Expressed Single-Chain Variable Fragment (scFv) Specific for Intercellular Adhesion Molecule 1 (ICAM-1) Blocks Cell-Associated HIV-1 Transmission across a Cervical Epithelial Monolayer
J. Immunol., May 1, 2006; 176(9): 5627 - 5636.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Q. Wang, M. Yerukhimovich, W. A. Gaarde, I. J. Popoff, and C. M. Doerschuk
MKK3 and -6-dependent activation of p38{alpha} MAP kinase is required for cytoskeletal changes in pulmonary microvascular endothelial cells induced by ICAM-1 ligation
Am J Physiol Lung Cell Mol Physiol, February 1, 2005; 288(2): L359 - L369.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. L. Tsikitis, N. A. Morin, E. O. Harrington, J. E. Albina, and J. S. Reichner
The Lectin-Like Domain of Complement Receptor 3 Protects Endothelial Barrier Function from Activated Neutrophils
J. Immunol., July 15, 2004; 173(2): 1284 - 1291.
[Abstract] [Full Text] [PDF]


Home page
Mol. Interv.Home page
R. A. Adams, M. Passino, B. D. Sachs, T. Nuriel, and K. Akassoglou
Fibrin Mechanisms and Functions in Nervous System Pathology
Mol. Interv., June 1, 2004; 4(3): 163 - 176.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Akassoglou, R. A. Adams, J. Bauer, P. Mercado, V. Tseveleki, H. Lassmann, L. Probert, and S. Strickland
Fibrin depletion decreases inflammation and delays the onset of demyelination in a tumor necrosis factor transgenic mouse model for multiple sclerosis
PNAS, April 27, 2004; 101(17): 6698 - 6703.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Wang, G. R. Pfeiffer II, and W. A. Gaarde
Activation of SRC Tyrosine Kinases in Response to ICAM-1 Ligation in Pulmonary Microvascular Endothelial Cells
J. Biol. Chem., November 28, 2003; 278(48): 47731 - 47743.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Lyck, Y. Reiss, N. Gerwin, J. Greenwood, P. Adamson, and B. Engelhardt
T-cell interaction with ICAM-1/ICAM-2 double-deficient brain endothelium in vitro: the cytoplasmic tail of endothelial ICAM-1 is necessary for transendothelial migration of T cells
Blood, November 15, 2003; 102(10): 3675 - 3683.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Greenwood, C. L. Amos, C. E. Walters, P.-O. Couraud, R. Lyck, B. Engelhardt, and P. Adamson
Intracellular Domain of Brain Endothelial Intercellular Adhesion Molecule-1 Is Essential for T Lymphocyte-Mediated Signaling and Migration
J. Immunol., August 15, 2003; 171(4): 2099 - 2108.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. van Wetering, N. van den Berk, J. D. van Buul, F. P. J. Mul, I. Lommerse, R. Mous, J.-P. t. Klooster, J.-J. Zwaginga, and P. L. Hordijk
VCAM-1-mediated Rac signaling controls endothelial cell-cell contacts and leukocyte transmigration
Am J Physiol Cell Physiol, August 1, 2003; 285(2): C343 - C352.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
G. Cepinskas, J. Savickiene, C. V. Ionescu, and P. R. Kvietys
PMN transendothelial migration decreases nuclear NF{kappa}B in IL-1{beta}-activated endothelial cells: role of PECAM-1
J. Cell Biol., May 12, 2003; 161(3): 641 - 651.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. H. Wyman, A. J. Bjornsen, D. J. Elzi, C. W. Smith, K. M. England, M. Kelher, and C. C. Silliman
A two-insult in vitro model of PMN-mediated pulmonary endothelial damage: requirements for adherence and chemokine release
Am J Physiol Cell Physiol, December 1, 2002; 283(6): C1592 - C1603.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. Hokari, S. Miura, H. Nagata, H. Fujimori, S. Koseki, S. Kato, I. Kurose, E. Sekizuka, D. N. Granger, and H. Ishii
Intercellular cell adhesion molecule-1 regulates lymphocyte movement into intestinal microlymphatics of rat Peyer's patches
J. Leukoc. Biol., December 1, 2001; 70(6): 896 - 902.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
S. Takashi, Y. Okubo, and S. Horie
Contribution of CD54 to human eosinophil and neutrophil superoxide production
J Appl Physiol, August 1, 2001; 91(2): 613 - 622.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sans, E.
Right arrow Articles by Duperray, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sans, E.
Right arrow Articles by Duperray, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS