|
|
||||||||
Promoter by IL-4 Is Dependent on AP-1 Transcription Factors1
Department of Molecular Genetics and Microbiology and Program in Immunology and Virology, University of Massachusetts Medical School, Worcester, MA 01655
| Abstract |
|---|
|
|
|---|
transcripts, an essential step
preceding Ig isotype switching to IgE, requires activation of
transcription factors by IL-4 and a B cell activator, e.g., CD40 ligand
or LPS. We demonstrate that AP-1 (Fos and Jun), induced transiently by
CD40 ligand or LPS, binds a DNA element in the mouse GL
promoter.
AP-1 synergizes with Stat6 to activate both the intact GL
promoter
and a minimal heterologous promoter driven by the AP-1 and Stat6 sites
of the mouse GL
promoter. By contrast, C/EBP
, which
trans-activates the human GL
promoter, inhibits IL-4
induction of the mouse promoter, probably by attenuating the
synergistic interaction between AP-1 and Stat6. Furthermore, AP-1 does
not trans-activate the human GL
promoter. Thus,
induction of GL
transcripts in mice and humans may be regulated
differently. In addition, although mouse GL
transcripts have a
half-life of
100 min, the RNA level continues to increase for up to
24 h, and the promoter appears to be active for at least 2 days
after B cell activation. Altogether, these data suggest that induction
of AP-1 activity, although transient, is required for activation of the
mouse GL
promoter by IL-4-induced Stat6. | Introduction |
|---|
|
|
|---|
An essential step in the process of switch recombination is the induction of specific classes of germline (GL)4 transcripts, which occurs before DNA recombination. Gene targeting experiments indicate that switching requires the synthesis of GL transcripts from the CH gene (3, 4). GL transcripts from different CH genes have a similar structure, and their transcription is driven by promoters located upstream of each switch region. The transcripts initiate at a 5'-exon (or I exon) and are transcribed through the switch region, terminating at the 3'-end of the CH gene. After splicing, the germline transcripts contain the I exon and the exons of the CH gene, deleting the switch region sequences and introns of the CH gene (1, 2, 5, 6).
Specific cytokines direct isotype-specific switching by regulating the
activities of GL promoters. IFN-
, IL-4, and TGF-
selectively
direct isotype switching in mouse B cells to IgG2a, to IgG1 and IgE,
and to IgA and IgG2b, respectively. In addition to cytokines, a second
signal that activates B cells, such as CD40 ligand (CD40L),
cross-linking of B cell receptors, or stimulation of murine B cells by
the mitogen LPS, is required for optimal induction of GL transcripts in
splenic B cells (1, 2, 7, 8).
Several reports have shown that IL-4 and CD40L costimulation induces GL
transcripts in both mouse and human B cells (9, 10, 11, 12).
IL-4 induces phosphorylation and homodimerization of the transcription
factor Stat6 through Janus kinase/STAT signaling pathways, and the
dimerized Stat6 is translocated from the cytoplasm into the nucleus,
where it binds the Stat6 site TTCNNNNGAA in the GL
promoter
(13, 14, 15, 16, 17). CD40L induces the transcription factors NF-
B,
AP-1, and NF-AT in B cells (18). Two
B sites downstream
of the Stat6 site in the GL
promoter bind NF-
B and are
responsible for promoter induction by CD40L (12, 19).
Previous studies have focused on the trans-activating roles
of Stat6 and NF-
B in activation of the GL
promoter to explain
the synergism between IL-4 and CD40L stimulation (12, 20).
Although activation of Stat6 and NF-
B correlate with induction of GL
transcripts, a DNA sequence element located immediately upstream of
the Stat6 site in both mouse and human GL
promoters is also
required for IL-4 induction of the promoter (12, 16, 21).
This essential DNA element was previously identified as a C/EBP binding
site (16). Several transcription factors of the C/EBP
family have been identified so far in different tissues. They form
homodimers or heterodimers that recognize the same DNA binding motif
(reviewed in Ref. 22). Among these factors, C/EBP
and
C/EBP
have been found in mouse splenic B cells, generally C/EBP
exerting positive effects and C/EBP
exerting negative effects on
regulating promoter activities (23). It was previously
found that recombinant mouse C/EBP
and recombinant human C/EBP
can bind to the mouse GL
-124/-98 and human GL
-116/-87
DNA fragments, respectively (16, 24). In addition,
overexpression of human C/EBP
and Stat6 can synergistically activate
a reporter gene driven by both the C/EBP and Stat6 sites of the human
GL
promoter in IL-4-treated human HEK293 cells or BJAB cells
(24). However, despite these in vitro demonstrations, no
evidence has shown that C/EBP proteins at a physiologic concentration,
constitutively or inducibly, are able to bind to the C/EBP site of
either the mouse or human GL
promoter, raising doubts about the
physiologic roles of C/EBP proteins in induction of GL
transcripts
in normal B cells.
The current study was therefore designed to identify the essential
factors binding to the C/EBP site in normal mouse splenic B cells
stimulated with IL-4 and CD40L and to determine the function of these
factors in induction of GL
transcripts. We found that AP-1
transcription factors (Fos and Jun proteins) (25) are
induced by CD40L and bind to the C/EBP site of the mouse GL
promoter. In addition, induction of AP-1 activity correlates with
induction of GL
transcripts in mouse splenic B cells. Therefore, we
redefine the C/EBP site as an AP-1 site.
We find that AP-1 proteins synergize with Stat6 to activate a reporter
gene containing either the intact mouse GL
promoter or containing a
heterologous promoter and an enhancer consisting of the AP-1 and the
Stat6 sites of the
promoter. Conversely, C/EBP
does not
synergize with Stat6 to activate such reporter genes, and instead
abolishes promoter induction by IL-4. By contrast, the C/EBP site in
the human GL
promoter allows C/EBP
, but not AP-1, to synergize
with Stat6 to activate transcription. Therefore, it appears that the
highly conserved GL
promoter sequences diverge at a critical AP-1
site in mouse and C/EBP site in human. It is possible that the diverged
mouse and human GL
promoters are regulated differently, because
AP-1 and C/EBP transcription factors are subject to different signaling
pathways, and because each factor can regulate the function of the
other factor in induction of GL
transcripts. Finally, a kinetics
study indicates that the level of mouse GL
transcripts continues to
increase up to 24 h and is sustained for at least another 24
h post IL-4/CD40L stimulation, although the
RNA is short-lived.
These results suggest that the GL
promoter is constantly active
during this time, although AP-1 activity is induced only transiently by
CD40L.
| Materials and Methods |
|---|
|
|
|---|
Splenic B cells were isolated from BALB/c mice (810 wk) by depletion of T cells as described previously (26). Mouse splenic B cells and the human B cell line BJAB were cultured at 37°C in an atmosphere of 5% CO2 in RPMI 1640 medium-10% FCS (FCS). The sIgM+ mouse B lymphoma cell line I.29µ clone 22D (7, 27) was grown at 37°C in an atmosphere of 8% CO2 in RPMI 164020% FCS.
Recombinant IL-4, CD40L, and LPS
Recombinant mouse IL-4 (a gift of W. E. Paul, National
Institutes of Health, Bethesda, MD) was a culture supernatant prepared
from insect cells infected with recombinant baculoviruses
(28). Recombinant mouse IL-4 was added to splenic B cell
cultures or I.29µ B cell cultures at 4000 U/ml. Recombinant human
IL-4 (Intergen, Purchase, NY) was added to BJAB cell cultures at 10
ng/ml. CD40L is a soluble CD40L-CD8
fusion protein secreted from
transfected J558L mouse myeloma cells cultured in RPMI 1640 medium-10%
FCS (29) and was added to splenic B cell cultures at a
final concentration of 20%. Supernatant from nontransfected J558L cell
cultures was used as a control. LPS (055:B5; Sigma, St. Louis, MO),
dissolved in RPMI 1640, was added to I.29µ B cell cultures at 50
µg/ml.
Sequences of oligonucleotides
The following oligonucleotide sequences (top strand) were used
for DNA probes or competitor fragments in EMSAs. GL
-124/-105:
5'-TGCCTTAGTCAACTTCCCAA-3'; octamer-binding protein
(Oct): 5'-TGTCGAATGCAAATCACTAGAA-3'; Stat6:
5'-ACTTCCCAAGAACA-3';
B: 5'-AAGGGAACTTCCAA-3'; AP-1:
5'-AGCTTGGTGACTCATCCG-3'; Ets:
5'-GGGCTGCTTGAGGAAGTATAAGAA-3'; C/EBP: 5'-TGCAGATTGCGCAATCTGCA-3';
wt (AP-1): same as GL
-124/-105; mutated (mt) AP-1 -115:
5'-TGCCTTAGTtAACTTCCCAA-3'; mt AP-1 -117/-116:
5'-TGCCTTAcaCAACTTCCCAA-3'; wt-consensus AP-1:
5'-TGCCTgAGTCAACTTCCCAA-3'; wt-C/G (AP-1):
5'-cGCgTTAGTCAgCTTCCgcg-3';
wt(Stat6): same as Stat6; mt Stat6 -104/-102:
5'ACTTCCCAActtCA-3'; wt-C/G(Stat6):
5'-gCTTCCgcgGAAgc-3'. The
bold lower case characters indicate mt base pairs, and the AP-1 and
Stat6 sequences are underlined.
Reporter plasmids
The luciferase reporter plasmid p(-56)FL was generated by
cloning the SalI/BamHI fragment containing the
minimal c-fos promoter from (-56)-c-fos-CAT
(30) into the SalI/BglII sites of
pXP2 vector (31). The following wild-type (wt) or mt
direct-repeat nucleotide sequences derived from the mouse GL
promoter--124/-99 segment with an additional 5' BamHI site
and an additional 3' HindIII site were cloned into the
BamHI/HindIII sites of p(-56)FL. wt:
5'-(TGCCTTAGTCAACTTCCCAAGAACAG)2-3';
mt AP-1 -115:
5'-(TGCCTTAGTtAACTTCCCAAGAACAG)2-3';
mt AP-1 -117/-116:
5'-(TGCCTTAcaCAACTTCCCAAGAACAG)2-3';
mt Stat6 -104/-102:
5'-(TGCCTTAGTCAACTTCCCAActtCAG)2-3';
wt-consensus AP-1:
5'-(TGCCTgAGTCAACTTCCCAAGAACAG)2-3';
wt-C/G:
5'-(cGCgTTAGTCAgCTTCCgcgGAAgcG)2-3'.
The underlined sequences represent the AP-1 (the 5' side) and the Stat6
(the 3' side) sites of the mouse GL
promoter, respectively. The
following sequences derived from the human GL
promoter -116/-87
segment were constructed in the same manner as described for the mouse
GL
sequences. wt:
5'-(GCTGTTGCTCAATCGACTTCCCAAGAACAG)2-3';
mt C/EBP -112/-111:
5'-(GCTGaaGCTCAATCGACTTCCCAAGAACAG)2-3';
mt Stat6 -92/-90:
5'-(GCTGTTGCTCAATCGACTTCCCAActtCAG)2-3'.
The underlined sequences represent the C/EBP (the 5' side)- and
Stat6 (the 3' side)-binding sites of the human GL
promoter,
respectively. The nucleotide sequences typed with bold lower case
characters are mutated from their wt sequences. The luciferase reporter
plasmids containing the whole mouse GL
promoter with the wt
(-162-Luc) or mt AP-1 site (mt13-Luc) have been described previously
(16). The luciferase reporter plasmids containing a
minimal alkaline phosphatase promoter linked upstream with (E4APLuc) or
without (APLuc) four copies of a C/EBP binding site were provided by C.
Cooper, University of Massachusetts Medical Center (Worcester, MA)
(23).
Expression plasmids
All of the cDNA or genomic sequences encoding the wt
transcription factors used in this study were cloned into the mammalian
expression vector pcDNA3 (Invitrogen, Berkeley, MO). The
EcoRI fragment containing the mouse c-Fos cDNA from
c-Fos-pCMV2 (provided by P. Dobner, University of Massachusetts Medical
School) (32) was first cloned into the EcoRI
site of pBluescript(SK-) (Stratagene, La Jolla, CA), followed by
cloning the BamHI/XhoI fragment containing the
c-Fos cDNA from the derived plasmid into the
BamHI/XhoI sites of pcDNA3. The
XmnI/XbaI fragment containing the mouse FosB cDNA
from FosB-pCMV2 (provided by P. Dobner) (32) was cloned
into the EcoRI/XbaI sites of pcDNA3. The
EcoRI/ScaI fragment containing the mouse c-Jun
cDNA from c-Jun-pCMV2 (provided by P. Dobner) (32) was
cloned into the EcoRI/EcoRV sites of pcDNA3. The
EcoRI/XhoI fragment containing the mouse JunB
cDNA from JunB-pGEM2 (ATCC 63025) was cloned into the
EcoRI/XhoI sites of pcDNA3. The
BamHI/XhoI fragment containing the mouse JunD
cDNA from JunD-pBluescript (SK-) (ATCC 63024) was cloned into the
BamHI/XhoI sites of pcDNA3. The
EcoRI/XhoI fragment containing the mouse
C/EBP
cDNA from MSV/EBP
-pBluescript (provided by S. Mcknight,
Tularik, South San Francisco, CA) was cloned into the
EcoRI/XhoI sites of pcDNA3. The
NotI/AvrII fragment containing the human genomic
c-fos sequence from pc-fos(human)-1 (ATCC 41042)
was cloned into the NotI/XbaI sites of pcDNA3.
The BamHI/BglII (blunt) fragment containing the
human JunD cDNA from pRSV-hjD (ATCC 95655) was cloned into the
BamHI/XhoI (blunt) sites of pcDNA3. The
EcoRI/XhoI fragment containing the human C/EBP
cDNA from pBlue 610 (provided by S. Akira, Osaka University) was cloned
into the EcoRI/XhoI sites of pcDNA3. To generate
the dominant negative c-Jun expression vector, the cDNA sequence
encoding the amino acid residues from 251 to 277 (containing the DNA
binding domain) of mouse c-Jun was deleted from the mouse c-Jun-pcDNA3
by oligonucleotide-directed mutagenesis, and the
EcoRI/XbaI fragment from the subsequently derived
plasmid was cloned into the EcoRI/XbaI sites of
pcDEF3 (33).
Transient transfection assays
All of the plasmids used for transfection were prepared by CsCl gradient purification. Mouse I.29µ B cells or human BJAB cells (5 x 107) mixed with 40 µg reporter plasmids and the indicated amount of expression plasmids in 1 ml RPMI 1640 were electroporated at 1250 µF/300 V and aliquoted into two fractions, one treated with IL-4 and the other left untreated in 10 ml complete medium for 12 h. Preparations of cell lysates and luciferase assays were performed as described previously (16).
EMSAs
Nuclear extracts of splenic B cells and of I.29µ B cells were
prepared as described previously (34), except that 1 mM
Na3VO4 and 1 mM
-glycerophosphate (Sigma) were included in buffers A and C. DNA
binding reactions were performed at room temperature for 30 min in
15-µl reaction volumes containing nuclear extracts of splenic B cells
(1 µg) or of I.29 µ B cells (5 µg), 1 pmol
32P-end-labeled DNA probe (25 fmol for probes
containing Oct, Stat6, or
B site), 2 µg poly(dI-dC), 12.5 mM HEPES
(pH 7.9), 10% (v/v) glycerol, 5 mM KCl, 0.1 mM EDTA, 0.05% Nonidet
P-40, and 1 mM DTT. For DNA competition experiments, a 100-fold molar
excess of unlabeled competitor oligonucleotides over the labeled probe
was included in the binding reaction. For Ab supershift experiments, 1
µl of either control or the indicated specific Ab was added to the
binding reaction, in which glycerol was replaced with 8% sucrose. The
binding reaction mixtures were then electrophoresed in 4 or 5% native
polyacrylamide gels with 0.5x Tris-borate-EDTA buffer, followed by
autoradiography. Abs against mouse c-Fos (sc-52X), FosB (sc-48X), c-Jun
(sc-45X), JunB (sc-46X), JunD (sc-74X), and C/EBP
(sc-150X) were
purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
Semiquantitative RT-PCR
Total RNA from cultured splenic B cells (5 x
106) was isolated using the Ultraspec RNA
isolation system (Biotecx Laboratories, Houston, TX). For reverse
transcription (RT) of RNA, a 10-µl volume of annealing reaction
containing total RNA (1 µg) and specific primers (50 pmol each) for
GL
transcripts (5'-CGTTGAATGATGGAGGAT-3'; Ref. 11) and
for HPRT transcripts (5'-TACTAGGCAGATGGCCACAGGACTA-3', positions
839815, GenBank accession number J00423) was incubated at 65°C for
10 min and cooled to room temperature, followed by addition of a
10-µl volume of RT premix (1.7 mM dNTP, 6.7 U RNasin RNase inhibitor,
2x Moloney murine leukemia virus (MMLV) RT buffer, 133 U MMLV reverse
transcriptase) (Promega) and by incubation at 39°C for 1 h. The
RT reaction products were then diluted 16-fold with 1x MMLV RT buffer,
except for samples from cells treated with IL-4 and CD40L for 24 h
(Fig. 7
B) and for 15 h (Fig. 7
D), in which
the RT reaction products were diluted 4-fold first and 0.5 volume of
which was serially 2-fold diluted up to 5 times with 1x MMLV RT buffer
to generate standard curves for measuring relative amount of cDNA. For
PCR amplification of cDNA, 1 µl of the diluted RT reaction products
was added to a 24-µl volume of PCR premix (1 µM each for top and
bottom strand primers, 0.8 mM dNTP, 1x PCR buffer, 0.83 U HotStarTaq
DNA polymerase) (Qiagen, Chatsworth, CA), and the samples were
incubated at 95°C for 15 min, then at 94°C for 30 s, 50°C
for 30 s, and 72°C for 30 s for 24 cycles. The top strand
primers for amplifying GL
and HPRT cDNAs are
5'-GCACAGGGGGCAGAAGAT-3' (11) and
5'-GTTGGATACAGGCCAGACTTTGTTG-3' (positions 601625, GenBank accession
number J00423), respectively, and the bottom strand primers are the
same as those used for RT reactions. Ten microliters of the PCR product
were mixed with 10 µl 2x formamide loading buffer (90% formamide
and 10% 10x Tris-borate-EDTA buffer), heated at 80°C for 3 min and
then chilled on ice. Fifteen microliters of each mixture were subject
to 5% denaturing PAGE (7 M urea, 0.5x Tris-borate-EDTA buffer)
followed by Southern blotting using
32P-end-labeled probes for detecting GL
cDNA
(5'-AGCCACTCACTTATCAGAGG-3') (35) and HPRT cDNA
(5'-CCTAAGATGAGCGCAAGTTG-3', positions 740759, GenBank accession
number J00423). The blots were exposed to the Molecular Imager System
(Bio-Rad, Richmond, CA), and the bands were quantitated by
densitometry. Under the conditions described above, a single band with
the expected size for GL
transcripts (325 bp) or for HPRT
transcripts (239 bp) was detected, and the intensity of the bands was
in a linear range of the standard curves with a minimal regression
coefficient of 0.98.
|
RNA half-life
After splenic B cells were cultured in the presence of IL-4
(4000 U/ml) and CD40L (20% culture medium) for 15 h,
transcription inhibitors actinomycin D (Act D, 10 µg/ml, Calbiochem,
La Jolla, CA) or 5,6-dichlorobenzimidazole riboside (DRB, 30 µg/ml,
Sigma) were added to the 10-ml cultures and total RNA was isolated from
5 x 106 cells at various times post
inhibitor addition using the Ultraspec RNA isolation system. No
significant loss of cell viability was observed by the trypan blue
exclusion method (>90% viable cells). The relative amount of GL
RNA was determined by semiquantitative RT-PCR as described above. One
microgram of total RNA was electrophoresed in a 1% agarose gel
followed by staining with ethidium bromide, and the relative amount of
28S rRNA in different samples were quantitated by the Fluro-S
Multiimager (Bio-Rad) and used to normalize the inputs of total RNA.
Linear regression of the normalized amount of GL
RNA vs time
post-inhibitor addition was plotted, and the half-life was determined
as the time when 50% of GL
RNA at time zero remains.
| Results |
|---|
|
|
|---|
-124/-105 promoter sequence
Previous studies have shown that the DNA sequence element
TTAGTCAAC at -120/-112, relative to the first RNA initiation site and
immediately upstream of a Stat6 site in the mouse GL
promoter, is
required for IL-4 induced activity of the promoter (16).
Although the DNA fragment containing this sequence element was
previously shown to bind recombinant C/EBP
(16), we
have been unable to demonstrate that C/EBP
or other C/EBP proteins
in nuclear extracts of B cells bind this site, suggesting that
transcription factors other than C/EBP proteins might function through
this site to induce GL
transcripts. To attempt to identify factors
binding to the C/EBP site of the GL
promoter under physiologic
conditions, we performed electrophoretic mobility shift assays (EMSAs)
using a labeled DNA probe containing the -124/-105 DNA segment of the
GL
promoter and nuclear extracts prepared from mouse splenic B
cells treated with IL-4 and/or CD40L for 4 or 24 h. As shown in
Fig. 1
A, nuclear extracts from
untreated cells form a complex with this probe (lane
2). Four hours after addition of CD40L to cells, the complex is
induced by 3-fold (lane 4), but not in cells treated
with IL-4 alone (lane 3). Addition of IL-4 does not
further increase the complex induced by CD40L (lane
5). These results suggest that the proteins binding to the GL
-124/-105 sequence are constitutively expressed in resting B cells
and can be further induced by CD40L.
|
B binding in EMSAs, respectively
(Fig. 1
Because the sequence of the -120/-114 segment closely resembles a
consensus site for AP-1 (TGAGTCA, differing only at the second
position), we examined whether AP-1 proteins are in the binding
complex. As shown in Fig. 1
B, addition of an unlabeled
double-stranded oligonucleotide containing the consensus AP-1 sequence
as a competitor in EMSAs completely abolished this complex, whereas
addition of a 100-fold molar excess of a consensus binding site for
different transcription factors (C/EBP or Ets) did not or only
partially reduced the complex. These results suggest that this complex
contains AP-1 proteins.
To identify which members of the AP-1 family form the complex, we
performed Ab supershift assays (Fig. 1
C). Components of the
complex formed with nuclear extracts from splenic B cells induced for
4 h with IL-4 and CD40L were supershifted when specific Abs
against c-Fos, FosB, c-Jun, or JunD were added, whereas components of
the complex formed with extracts from cells induced for 24 h were
supershifted with FosB, c-Jun, and JunD Abs but not with c-Fos Abs. No
JunB was detected in the complexes formed at 4 or 24 h (even in
overexposed autoradiographs). An Ab that can specifically and
efficiently supershift C/EBP
-containing complexes in EMSAs did not
supershift the complex (lanes 9 and 17),
indicating that components of the complex are shifted specifically by
Abs against certain AP-1 proteins. In addition, none of the Abs used in
these experiments shifted the labeled probe if no nuclear extracts were
included in the binding reactions. These Abs have been tested and shown
to be able to supershift their target proteins in EMSAs using nuclear
extracts from cells that express all these AP-1 proteins (data not
shown). These results suggest that c-Fos, FosB, c-Jun, and JunD are
present in the CD40L-inducible AP-1 complexes at 4 h, and FosB,
c-Jun, and JunD are components of the AP-1 complex(es) at 24 h.
Due to the limitation of our detection method, we could not determine
whether c-Fos is still present in the AP-1 complex at 24 h. We
have used competition and Ab supershift EMSAs to test for the presence
of two other families of transcription factors, cAMP response element
binding protein/activating transcription factor and C/EBP, which bind
to sequences closely related to an AP-1 site. These factors were not
found in this AP-1 complex (Fig. 1
, B and C, and
data not shown). Therefore, AP-1 proteins appear to be the only
proteins in this complex.
Both the AP-1 and Stat6 sites of the GL
promoter are necessary
and together are sufficient to confer IL-4 inducibility
Induction of GL
transcripts in B cells by IL-4 requires a
second signal such as CD40L or LPS which activates NF-
B and AP-1
transcription factors (Refs. 7, 8, 10, 18 and
36 and data not shown). The requirement for IL-4 and CD40L
costimulation to induce GL
transcripts in B cells has been
suggested to be due to synergistic activation of the promoter by Stat6
and NF-
B (12, 20). It has been shown, however, that
even in the presence of NF-
B, the GL
promoter cannot be
activated by IL-4 treatment if the sequence corresponding to the AP-1
site identified above is mutated (16), suggesting that
activation of the GL
promoter by IL-4-induced Stat6 is also
dependent on the AP-1 activities induced by CD40L or LPS.
A previous report demonstrated that a DNA segment containing the
-124/-98 sequence of the mouse GL
promoter is sufficient to
confer IL-4 inducibility to a heterologous promoter and that
8-nucleotide linker sequences replacing the newly identified AP-1 site
or the Stat6 site within this segment eliminate IL-4 inducibility of
the promoter (16). However, due to the substantial
sequence replacement, it was not clear from the previous experiments
whether the AP-1 site and the Stat6 site are both necessary, nor was it
certain whether they are sufficient for IL-4 inducibility of the
reporter plasmids.
To address these questions, more precise and limited nucleotide
substitutions (one to three nucleotides) were introduced into the
reporter constructs with identically oriented dimers of the -124/-99
segment containing the AP-1 and the Stat6 sites of the GL
promoter.
The plasmids were transiently transfected into I.29µ B lymphoma
cells. These cells express GL
transcripts which can be further
induced by IL-4 treatment (7, 16), and they constitutively
express a low level of AP-1 (which includes at least c-Fos, FosB,
c-Jun, JunB, and JunD, identified by Western blotting in data not
shown) and acquire Stat6 activity on IL-4 stimulation
(20). Presumably because of the constitutive expression of
AP-1 in I.29µ cells, we found it unnecessary to induce AP-1 activity
in reporter assays. Fig. 2
A
shows that the transcriptional activity of the wt reporter plasmid (wt)
is induced 18-fold by IL-4 stimulation, whereas mutation of the AP-1
site (mt AP -115 or mt AP -117/-116) or the Stat6 site (mt Stat6
-104/-102) in the reporter plasmid completely abolishes promoter
activity, demonstrating that both AP-1 and Stat6 sites are necessary
for IL-4-induced activity. To further demonstrate that AP-1 is able to
trans-activate the GL
segment, the T at position -119
was replaced with a G so that a consensus AP-1 site was created in the
enhancer sequence, resulting in an enhancement of the reporter activity
to 125-fold in the presence of IL-4 and 6-fold in the absence of
IL-4.
|
To assure that the IL-4 inducibilities of the wt and the mt reporter
plasmids correlate with the abilities of their corresponding AP-1 and
Stat6 binding sites to bind AP-1 and Stat6, we performed EMSAs with DNA
probes containing the wt and mt AP-1 or Stat6 binding sequences used in
the reporter plasmids. Nuclear extracts were prepared from I.29µ B
cells unstimulated (-) or stimulated (+) with LPS and IL-4. Although
AP-1 is expressed constitutively at a low level in I.29µ B cells, LPS
was added because it can further induce AP-1 in these cells, allowing
us to visualize the AP-1 complex in EMSAs. Fig. 2
B shows
that, regardless of the flanking nucleotide sequence, DNA fragments
containing the wt or consensus AP-1 binding sequences
(lanes 2, 8, and 10) bind AP-1, whereas
fragments with mt AP-1 sites (lanes 4 and
6) do not. Likewise, fragments containing wt Stat6 binding
sites (lanes 12 and 16) bind Stat6,
whereas a fragment with a mt Stat6 site does not (lane
14). These complexes contain AP-1 and Stat6 proteins because they
can each be competed specifically by consensus AP-1 and Stat6 fragments
in EMSAs (data not shown). The results of EMSAs are in accordance with
the results of the reporter gene assays, in which the IL-4 inducibility
is manifest only in reporter plasmids containing AP-1 and Stat6 sites
capable of binding their corresponding AP-1 and Stat6 proteins.
Different members of the AP-1 family synergize with Stat6 to trans-activate the reporter plasmid containing both AP-1 and Stat6 sites
To directly determine whether AP-1 factors can induce
transcription from the GL
promoter, we tested the effect of
cotransfection of expression plasmids for Fos and Jun proteins on
activity of the reporter plasmid containing the wt -124/-99 dimer
from the GL
promoter in I.29µ B cells. Luciferase activities were
measured in transfected cells, untreated or treated with IL-4 to
activate Stat6. It was not necessary to cotransfect a Stat6 expression
plasmid because IL-4 induces abundant activated Stat6 in I.29µ B
cells (Fig. 2
B, lane 12).
As shown in Fig. 3
A,
overexpressing Fos and Jun proteins in pairs greatly increases the
activity of the reporter plasmid in the presence of IL-4. These data
indicate that AP-1 proteins synergize with IL-4-activated Stat6 to
induce transcription. The synergy appears to be mediated by
heterodimers of Fos and Jun proteins, because in the presence of IL-4,
cells overexpressing either Fos proteins or Jun proteins alone gave
reporter activities similar to cells without AP-1 overexpression.
Synergistic activation of the promoter by AP-1 and Stat6 requires both
cognate AP-1 and Stat6 sites, because mutation at either the AP-1 or
the Stat6 site in the reporter plasmids abolishes promoter activity,
despite the presence of activated Stat6 together with overexpressed
FosB/JunD or c-Fos/JunD (Fig. 3
B).
|
promoter.
Both c-Fos/JunD and FosB/JunD are capable of synergizing with Stat6
to activate the whole GL
promoter
The reporter plasmid used in the above experiments contains a
dimer of only the AP-1 and Stat6 sites. Because it is possible that in
the context of the intact GL
promoter the functions of AP-1 and
Stat6 may be altered, we next examined whether AP-1 is able to
synergize with Stat6 to activate a reporter plasmid containing the
intact GL
promoter. We cotransfected a reporter plasmid
containing the -162/+53 GL
promoter (including the first
53 nucleotides of I
exon) along with expression plasmids for
c-Fos, FosB, or JunD or their combinations in reporter gene assays in
I.29µ B cells. We chose these three AP-1 proteins because they are
detected in nuclear extracts from CD40L-treated splenic B cells and
form complexes with the AP-1 site of the GL
promoter in EMSAs (Fig. 1
C).
As shown in Fig. 4
A, the GL
promoter is synergistically induced by the combination of
FosB/JunD or c-Fos/JunD and IL-4-induced Stat6. In cells
overexpressing FosB/JunD the GL
promoter activity is induced
49-fold in the presence of IL-4 and 11-fold in the absence of IL-4,
relative to the promoter activity in cells transfected with empty
expression vectors and no IL-4 treatment (1-fold). Similarly, in cells
overexpressing c-Fos/JunD proteins, promoter activity is induced
16-fold in the presence of IL-4 and 2-fold in the absence of IL-4. In
the absence of cotransfected AP-1 proteins, promoter activity is
induced 7-fold by IL-4. These data indicate that both FosB/JunD and
c-Fos/JunD are capable of synergizing with Stat6 to activate the GL
promoter, whereas the basal and IL-4-induced promoter activities in
cells overexpressing c-Fos, FosB, or JunD alone are not significantly
different from those in cells transfected with empty expression
vectors. The reporter gene assays taken together with the EMSA data
presented above suggest that the AP-1 proteins involved in the
synergistic activation of the promoter are heterodimers of FosB/JunD
and c-Fos/JunD. As expected, synergistic activation of the GL
promoter by Stat6 and FosB/JunD or c-Fos/JunD requires the AP-1 site of
the promoter, because disruption of the AP-1 site in the reporter
plasmid (mt13) abolishes the synergy (Fig. 4
B).
|
abolishes the IL-4 inducibility of the
GL C
promoter.
The DNA-binding domains of mouse C/EBP
(38) and
full-length recombinant mouse C/EBP
specifically bind in EMSAs to
the GL
AP-1 site identified in this study (Ref. 16 and
data not shown), consistent with the report that an AP-1 binding
sequence is also a consensus C/EBP site (39). To determine
whether C/EBP
can also synergize with Stat6 to activate the GL
promoter, we performed cotransfection experiments in I.29µ B cells
using the reporter plasmid containing the GL
promoter and an
expression plasmid for mouse C/EBP
. We found that overexpression of
mouse C/EBP
, in the presence or absence of IL-4, does not enhance
promoter activity (Fig. 4A
). Interestingly, the IL-4 inducibility of
the promoter was abolished when C/EBP
was overexpressed in cells.
These data indicate that mouse C/EBP
, in contrast to AP-1 proteins,
cannot synergize with Stat6 to activate the GL
promoter, despite
its potential binding ability to the AP-1 site of the promoter, and
also that C/EBP
inhibits the function of Stat6 in promoter
activation.
To demonstrate that the overexpressed C/EBP
we used is functional,
we performed reporter assays in I.29µ B cells using the same mouse
C/EBP
expression vector and a reporter gene driven by four copies of
Ig µ intron C/EBP binding sites as the enhancer sequence
(23). As shown in Fig. 4
C, the reporter with
C/EBP sites (E4APLuc) is activated by more than 5-fold when C/EBP
is
overexpressed compared with results with an empty expression vector.
The overexpressed C/EBP
cannot activate the reporter gene if it
lacks C/EBP enhancer sequences (APLuc). In conclusion, these data
indicate that the transfected C/EBP
expression vector can produce
functional C/EBP
proteins which have trans-activating
activity independent of IL-4 treatment in I.29µ B cells. Therefore,
the inability of C/EBP
to trans-activate the GL
promoter is not due to production of defective C/EBP
proteins.
Overexpression of C/EBP
abolishes the synergistic activation of
the reporter by AP-1 and Stat6
It is possible that C/EBP
abolishes IL-4 inducibility
of the GL
promoter by interrupting the functional interaction
between AP-1 proteins and Stat6. To test this possibility, we performed
reporter gene assays in I.29µ B cells using the reporter plasmid
driven by the GL
AP-1 and Stat6 sites and cotransfecting varying
amounts of C/EBP
- and c-Fos/JunD-expression plasmids. Fig. 5
A shows that the promoter
activity is increased by 2750-fold when cells were transfected with 20
µg each of c-Fos/JunD expression vectors and stimulated with IL-4,
demonstrating the strong synergistic activation of the promoter by AP-1
proteins and Stat6. The synergy is decreased dramatically when 20 µg
C/EBP
-expression vector are cotransfected and abolished when 40 or
80 µg C/EBP
expression vector are cotransfected, becoming equal to
the IL-4-induced activity in the absence of cotransfected AP-1. These
data indicate that C/EBP
inhibits the synergistic induction of the
promoter by AP-1 and Stat6.
|
expression vector was fixed (20 µg), whereas
variable amounts of c-Fos/JunD expression vectors were cotransfected
(from 0 to 80 µg each), show that both the IL-4 inducibility and
synergy with AP-1 which are inhibited by C/EBP
can be restored by
coexpressing excess c-Fos/JunD in cells. These data suggest that AP-1
and C/EBP
play competitive roles in regulating the mouse GL
promoter, AP-1 interacting with IL-4-activated Stat6 to synergistically
activate the promoter, and C/EBP
preventing AP-1 from interacting
with Stat6, therefore down-regulating the GL
promoter activity.
C/EBP
, but not AP-1, activates the human GL C
promoter
In contrast to the above results, it has been demonstrated that
human C/EBP
can synergize with Stat6 to activate a reporter plasmid
driven by a DNA segment containing both the C/EBP and Stat6 sites from
the human GL
promoter, which is similar to but not identical with
the equivalent mouse sequence used in our study (Ref. 24
and Fig. 6
A). We hypothesized
that the differences between mouse and human may be due to the
divergent sequences immediately upstream of the Stat6 site in the mouse
and human GL
promoters. In the mouse promoter, the DNA sequence
from -120 to -114 appears to be a better AP-1 site than a C/EBP site,
whereas in the human promoter, the DNA sequence from -113 to -105
appears to resemble an antisense consensus C/EBP site
([A/C]TTNCNN[A/C]A, differing only at the first position) rather
than an AP-1 site.
|
transcription factors from mouse and
human origins to synergize with Stat6. We used identical reporter
constructs containing either the mouse -124/-99 or human -116/-87
segment of the GL
promoter, and the assays were performed in either
mouse I.29µ B cells or human BJAB cells, in accordance with the
species origin of the promoters. As shown in Fig. 6
does. The opposite result was
observed using reporters with the human enhancer sequence. As shown in
Fig. 6
synergistically
activate the reporter with the human enhancer sequence in human BJAB
cells treated with IL-4, whereas neither human nor mouse c-Fos/JunD
does. The synergy shown in both reporter assays depends on both the
Stat6 and the AP-1 or C/EBP sites for mouse or human, respectively,
because mutation at either site eliminates this synergy (Fig. 6
The inability of C/EBP
and c-Fos/JunD to synergize with Stat6 to
activate the mouse and the human reporters in mouse I.29µ B cells and
human BJAB cells, respectively, is not due to the lack of appropriate
machineries to generate functional C/EBP
in I.29µ B cells or
c-Fos/JunD in BJAB cells, because in the presence of IL-4,
overexpression of human C/EBP
in mouse I.29µ B cells and
overexpression of mouse c-Fos/JunD in human BJAB cells, can
synergistically activate the human and mouse reporters, respectively
(data not shown).
In conclusion, these data suggest that AP-1, but not C/EBP
, is
capable of synergizing with Stat6 to activate the mouse GL
promoter, and by contrast, C/EBP
, but not AP-1, can synergize with
Stat6 to activate the human GL
promoter. Therefore, mouse and human
GL
promoter sequences diverge at this critical AP-1 or C/EBP site,
despite the fact that they share highly conserved sequences at all
other positions that have been shown to be important for regulated
expression of the GL
promoters.
Kinetics of induction and half-life of GL
transcripts in mouse
splenic B cells stimulated with IL-4 and CD40L
Because our current studies together with previous findings
demonstrate that IL-4-induced Stat6 and CD40L-induced AP-1 and NF-
B
activate the GL
promoter, we wished to determine whether induction
of these transcription factors coincides with induction of GL
transcription in mouse splenic B cells stimulated with IL-4 and
CD40L.
As shown in Fig. 7
A
(lanes 3, 6, 9, 12, 15, and 18), in
splenic B cells the DNA-binding activities of all three factors are
induced rapidly 1 h post stimulation, achieve maximal levels by
4 h, and decline with different kinetics. AP-1- and NF-
B
binding activities return to near basal levels after 24 h, whereas
induced Stat6 binding activity persists for at least 48 h post
stimulation. Competition experiments using consensus binding sites
(lanes 4, 7, 10, 13, 16, and 19) or
unrelated oligonucleotides (lanes 5, 8, 11, 14, 17,
and 20) indicate binding is specific for each probe.
The samples for different time points were loaded equally, because
similar levels of the noninducible Oct-1 protein were detected in the
different samples.
Consistent with the rapid induction of AP-1, Stat6, and NF-
B binding
activities, GL
transcripts are detectable by semiquantitative
RT-PCR 2 h after addition of IL-4 and CD40L (Fig. 7
B).
No GL
RNA could be detected at any time point if B cells were
treated with either IL-4 or CD40L alone, indicating that production of
GL
RNA requires both signals and that the
RNA detected is not
from preactivated B cells in spleen. As shown in Fig. 7
C,
the RNA level continued to increase up to 24 h, at which time the
steady state level was reached.
Interestingly, achievement of maximal levels of GL
transcripts does
not appear to require maximal induced levels of AP-1 and NF-
B
activities, because both AP-1 and NF-
B binding activities are
maximal at 4 h and have returned to near basal levels after
24 h, whereas the level of GL
transcripts is still low at
4 h and only reaches maximum at 24 h. One possible
explanation for this result is that the functions of CD40L-induced AP-1
and NF-
B are to initiate transcription and to allow IL-4-induced
Stat6 to bind and activate transcription through the Stat6 site on the
GL
promoter. Therefore, transient induction of AP-1 and NF-
B
might be sufficient to support activation of the GL
promoter by
Stat6.
However, another possible explanation for the kinetics of induction of
GL
transcripts would be that GL
transcripts are extremely
long-lived. To address this possibility, we measured the half-life of
GL
RNA in splenic B cells after induction by IL-4 and CD40L.
Transcription inhibitors, Act D or DRB, were added to the cultures
after splenic B cells were treated with IL-4 and CD40L for 15 h,
and the amount of RNA remaining at various times after inhibitor
addition was determined by semiquantitative RT-PCR (Fig. 7
D). Fig. 7
E presents the quantitation of these
data showing that after transcription is blocked by either Act D or DRB
treatment, GL
transcripts have a short half-life,
100 min.
Because the RNA level continues to increase up to 24 h, the short
half-life suggests that the GL
promoter is constantly active for at
least 2 days after addition of CD40L and IL-4. Consequently, these data
support the hypothesis that transient induction of AP-1 and NF-
B may
be sufficient to support transcriptional activation of the GL
promoter by Stat6.
| Discussion |
|---|
|
|
|---|
promoter and C/EBP
inhibits the promoter
In this study, we identify the transcription factor binding site
which is located immediately upstream of the Stat6 site in the mouse GL
promoter and which is required for IL-4-induced transcription by
Stat6 to be an AP-1 site. Endogenous AP-1 factors in nuclear extracts
from mouse splenic B cells specifically bind this site in EMSAs
(Fig. 1
). The AP-1 site sequence TTAGTCA at -120 to -114 in the mouse
GL
promoter is identical with sequences found in the control
regions of the phorbol ester-inducible genes of SV40 and polyoma
viruses, which have been shown to bind AP-1 factors induced by TPA
treatment (40).
Our data suggest that AP-1 proteins, but not C/EBP proteins, are the
endogenous proteins driving transcriptional activation of the Ig GL
promoter in normal mouse splenic B cells. First, AP-1 DNA binding
activities are detected in EMSAs using the mouse GL
promoter
-124/-105 fragment, and their binding activities are further enhanced
in nuclear extracts from mouse splenic B cells treated with CD40L or
LPS (Fig. 1
and data not shown). Conversely, we were unable to detect
C/EBP binding to the
promoter fragment using nuclear extracts from
LPS-treated splenic B cells or from I.29µ B cells, despite the fact
that C/EBP
is induced in splenic B cells by LPS treatment (Ref.
23 and data not shown). Second, functional data indicate
that AP-1 factors synergize with Stat6 to activate transcription,
whereas C/EBP
abolishes promoter activity induced by IL-4 in
reporter gene assays. In addition, the sequence upstream of the Stat6
site in mouse GL
promoter does not fit a consensus C/EBP motif,
T(T/G)NNGNAA(T/G) as found in many C/EBP binding sites
(41). The conserved G residue in the center of the
consensus C/EBP motif is not found in either orientation of the
sequence encompassing the AP-1 site of GL
promoter. With the
exception of recombinant C/EBP
or C/EBP
purified from transformed
Escherichia coli, C/EBP
from all sources, including in
vitro-translated C/EBP
from reticulocyte lysates and C/EBP
in
nuclear extracts from overexpressing HEK293 cells or from LPS-treated
splenic B cells, failed to bind the GL
promoter fragment
-124/-105 in EMSAs (data not shown). C/EBP
weakly binds to AP-1
sites (39), which can explain why we find that C/EBP
binds to the
-124/-105 fragment when sufficient amounts of
proteins are present in the binding reactions. Because, at physiologic
concentrations, C/EBP, in contrast to AP-1, does not detectably bind
the
-124/-105 fragment, we therefore redefine the previously
defined C/EBP site in mouse GL
promoter as an AP-1 site.
Interestingly, although C/EBP
may not bind the AP-1 site of the
mouse GL
promoter in vivo, overexpressed C/EBP
can down-regulate
the promoter activities induced by cooperative interaction between AP-1
and Stat6. A plausible mechanism to explain down-regulation by C/EBP
is the formation of Fos/C/EBP
and Jun/C/EBP
cross-family
heterodimers through their leucine zipper domains (39),
thereby preventing AP-1 from binding to the AP-1 site in the GL
promoter. This is analogous to the proposed mechanism by which Fos and
Jun inhibit transcriptional activation by C/EBP
of a reporter
plasmid containing C/EBP binding sites (39). Another
possibility is competition between AP-1 and C/EBP
for essential
molecules involved in induction of the promoter, such as Stat6,
coactivators, and the basal pol II transcription machinery. Although
the mechanism is unknown, it is likely that the induction of GL
transcripts, and therefore IgE production by mouse B cells, will be
inhibited if C/EBP
is induced. Thus, it is possible that the balance
between AP-1 and C/EBP
activities induced by different stimuli
regulates GL
transcripts.
It has been previously shown that c-Fos, FosB, Fra-1, JunB, and JunD
cellular mRNA and, in some cases, proteins are induced rapidly in mouse
splenic B cells treated with CD40L (42, 43). Consistent
with these findings, we detect binding to the GL
promoter
-124/-105 segment by c-Fos, FosB, c-Jun, and JunD at 4 h and by
FosB, c-Jun and JunD at 24 h after addition of CD40L. We did not
examine Fra-1 and Fra-2 Fos proteins in our study. It is very likely
that c-Fos and FosB form heterodimers with c-Jun and JunD and activate
the GL
promoter in vivo, because Fos proteins do not form
homodimers but do heterodimerize with Jun proteins and because Fos/Jun
heterodimers are more stable and have much higher DNA-binding
affinities than Jun homodimers (25, 44). In addition, we
found that coexpressed c-Fos/JunD or FosB/JunD synergize with Stat6 to
activate transcription, whereas overexpressed JunD alone does not
(Figs. 3
and 4
). JunB did not bind to the GL
promoter -124/-105
fragment in EMSAs, although JunB DNA-binding activity can be detected
when a consensus AP-1 sequence is used as the probe in EMSAs (data not
shown), suggesting that JunB might not bind to the GL
promoter
either as a homodimer or as a heterodimer with Fos. However, it is
possible that JunB may exert an indirect effect on the GL
promoter
by altering the stoichiometry of AP-1 dimers.
Kinetics of expression of GL
transcripts and class switching
Many reports have examined the kinetics of induction of GL
transcripts in mouse B cells stimulated with IL-4 in combination with
CD40L or LPS (5, 8, 11). In general, maximal levels of GL
transcripts are achieved 1 day after B cells are stimulated in
vitro, and this level is maintained for at least 4 days, at which time
the mature, productive mRNAs are detected. The early induction events,
however, have not been studied before. We detected the GL
transcripts in mouse splenic B cells as early as 2 h after
addition of IL-4 and CD40L. This suggests that all of the essential
transcription factors for activation of the GL
promoter by IL-4 and
CD40L must be induced immediately after cells receive the signals.
Indeed, we detect induced levels of Stat6, AP-1 and NF-
B DNA binding
activities as early as 1 h after cells are treated with IL-4 and
CD40L, consistent with the induction of GL
transcripts by 2 h
(Fig. 7
A).
Interestingly, whereas the level of GL
transcripts is low at 4
h and maximal at 24 to 48 h, AP-1 and NF-
B binding activities
are maximal at 4 h and decline to near basal levels by 24 to
48 h (Fig. 7
A). This raises doubts about their roles in
supporting transcription as the maximal RNA level is achieved. It is
possible that CD40L-induced AP-1 and NF-
B initiate transcription and
allow IL-4-induced Stat6 to bind and activate the GL
promoter.
Transient induction of AP-1 and NF-
B by CD40L may be sufficient to
support activation of the GL
promoter by the more long-lasting
IL-4-induced Stat6.
Resting mouse splenic B cells treated with IL-4 and CD40L can express
IgE only after cells have divided at least six times; this normally
requires at least 4 days (45). Due to the relatively short
half-life of GL
transcripts (100 min), prolonged active
transcription from the GL
gene is necessary to maintain the steady
state level of RNA in B cells treated with IL-4 and CD40L. Several
reports have demonstrated that transcription of the GL
CH gene loci per se is not sufficient for
switching and that the processed transcripts, the process of transcript
splicing, and/or the products of spliced-out intron sequences may
participate in switch recombination (46, 47, 48). Prolonged
active transcription may provide a continuous mode of RNA processing
throughout the whole period of switching, thereby increasing the
probability of targeting switch recombination to a specific
CH gene.
Synergistic induction of the Ig GL
promoter by Stat6, AP-1, and
NF-
B
As in most IL-4-inducible genes, the Stat6 binding site plays a
central role for activation of GL
transcription by IL-4. However,
Stat6 appears to be unique among Stat proteins in that it is unable to
activate a promoter containing only a Stat6 site even when the site is
multimerized (16, 20, 49, 50). Interaction between Stat6
and other transcription factors induced by CD40L is apparently required
for Stat6 to activate the GL
promoter. Here we show that AP-1,
induced by CD40L, is able to synergize with Stat6 and is essential for
activation of the GL
promoter. Physical association between AP-1
and NF-
B (51) and between Stat6 and NF-
B
(20) has been previously demonstrated, and such
cross-family interactions result in synergistic activation of
transcription. Each of these two sets of interactions, although
probably contributing to optimal activation of the promoter, is not by
itself sufficient to induce GL
transcripts. The evidence for this
is that when B cells are stimulated with either CD40L or LPS, both AP-1
and NF-
B are induced, but CD40L or LPS alone does not induce GL
transcripts, ruling out the possibility that AP-1 and NF-
B together
are sufficient to activate transcription. Furthermore, a reporter gene
containing the intact GL
promoter with an AP-1 site mutation cannot
be induced in IL-4-treated I.29µ B cells that contain abundant
activated Stat6 and NF-
B, indicating that interaction between Stat6
and NF-
B is not sufficient (16) (Fig. 4
B).
In this study, we provide evidence for another type of interaction,
that between AP-1 and Stat6. The reporter plasmid containing only the
AP-1 site and the Stat6 site cannot be induced by IL-4 in I.29µ B
cells if the AP-1 site is mutated. In addition, several different
combinations of Fos and Jun proteins strongly synergize with Stat6 to
activate transcription, whereas expression of dominant negative c-Jun
suppresses transcription, indicating that the
trans-activating ability of Stat6 and consequently the IL-4
inducibility of the promoter require the interaction between AP-1 and
Stat6.