|
|
||||||||
Division of Cardiology, Department of Medicine, Duke University Medical Center, Durham, NC 27710
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The plt mutation arose spontaneously in a colony of DDD/1 mice at the University of Tokyo (11). Because this mutation was not initially recognized, the true parental line was lost, but a congenic strain, DDD/1-Mtv2, still exists (12). In a comparison of DDD/1 and DDD/1-Mtv2 mice, it was found that DDD/1 mice display a marked paucity of T cells in peripheral LNs (13). Further analysis revealed that this abnormality was due to the development of a recessive mutation (now designated plt) in the DDD/1 inbred line. DDD/1-plt mice demonstrate a 5- to 10-fold decrease in the number of naive T cells present in peripheral LNs and a defect in naive T cell homing to secondary lymphoid organs (14, 15). The plt locus was mapped to mouse chromosome 4 in a region of conserved synteny to human chromosome 9p13. Three human chemokine genes map to 9p13: SLC (CCL21), EBI-1 ligand chemokine (ELC; CCL19), and cutaneous T cell-attracting chemokine (CTACK; CCL27), although this was not known at the time plt mice were identified (16, 17, 18).
SLC was identified by several groups as a novel chemokine present in the National Center for Biologic Information expressed sequence tag (EST) database (17, 19, 20, 21). Three characteristics of SLC suggested that it may be the chemokine responsible for mediating the entry of T cells into secondary lymphoid organs. First, it is expressed in the high endothelial venules (HEV) of LNs and Peyers patches and within T cell zones of LNs, spleen, and Peyers patches (22). SLC is also expressed in thymic medulla and in the lymphatic endothelium of multiple tissues (9, 19, 22). Second, SLC is a highly efficacious chemoattractant for naive T cells (22, 23). Third, SLC stimulates the integrin-mediated adhesion of naive T cells to ICAM-1 and MadCAM-1 (24, 25, 26). The chemokine most similar to SLC is ELC (16). SLC and ELC share the same receptor, CCR7, and their genes are separated by <100 kb in humans (16, 27, 28). ELC is expressed by DC and stromal cells within LNs and spleen (29). Based on its expression pattern and activities, ELC is believed to act within lymphoid organs to mediate naive T cell-DC interactions (1). The most recently identified chemokine on human chromosome 9 is CTACK, which is expressed predominately in skin and is chemotactic for CLA+ memory T cells (30).
Once the probable function of SLC was recognized, its potential contribution to the plt mutation was examined. It was found that the plt phenotype and the SLC gene map to the same genetic locus on mouse chromosome 4. SLC mRNA is not expressed in the secondary lymphoid organs of plt mice despite the fact that an intact SLC gene is present in plt DNA (8). The expression of ELC mRNA is reduced in plt mice, but is clearly present. Subsequent studies have demonstrated that rolling naive T cells do not attach to HEV in the LNs or Peyers patches of plt mice (9, 10). In LN this defect can be partially reversed by the s.c. injection of SLC (9). plt mice also demonstrate abnormalities in DC localization and migration (8). The number of DCs in the LN and splenic white pulp of plt mice is markedly reduced, as is the number of DCs that migrate to these areas after inflammatory stimuli. Similar defects in DC migration are seen in mice after treatment with anti-SLC Abs (31). These studies strongly suggest that SLC is required for the migration of naive T cells and activated DC into the thymus-dependent areas of secondary lymphoid organs. Support for this view has come from studies of CCR7-deficient mice, which display a constellation of leukocyte trafficking abnormalities that are similar, but not identical, to those seen in plt mice (7).
To determine the basis of the plt phenotype, we initiated studies to examine the DNA abnormality in plt mice. These studies were complicated by the finding that marked genetic heterogeneity exists at this locus in wild-type mice. At least two CTACK, three SLC, and four ELC genes or pseudogenes are present in some inbred strains of mice. This locus includes the previously described duplication of Il11ra genes. At least three wild-type haplotypes of this locus are found in commonly used inbred mice. While these studies were in progress, another group demonstrated that wild-type mice express two forms of SLC and that one of these is deleted in plt mice (32). Our results confirm and extend those findings. The plt mutation represents a genomic deletion that leads to a unique combination of SLC and ELC genes in mice, eliminating the SLC gene expressed in secondary lymphoid organs and the sole functional ELC gene.
| Materials and Methods |
|---|
|
|
|---|
BALB/c-plt mice were produced by backcrossing plt mice 10 generations into a BALB/c genetic background. BALB/cJ control mice were obtained from The Jackson Laboratory (Bar Harbor, ME). All mice were maintained under specific pathogen-free conditions in accordance with institutional guidelines. Frozen tissues from DDD-Mtv2 and DDD-plt were obtained from Kazutosi Sayama (Shizuoka University, Shizuoka, Japan) and used for DNA preparation. P1 clones AD (controls 1573815741) were obtained from Incyte Genomics (St. Louis, MO) by PCR screening a 129/Ola library with SLC-specific primers (CCATATGAGTGATGGAGGGGGACAGG and CCTCGAGCTATCCTCTTGAGGGCTGTG). Bacterial artificial chromosomes (BACs) from the RPCI-23 library were identified by screening the BAC end-sequence database (http://www.tigr.org/tdb/humgen/bac_end_search/bac_end_search.html) with SLC, ELC, CTACK, and I1llra sequences and were obtained from Childrens Hospital Oakland Research Institute (Oakland, CA). P1 clone E, BAC1, and BAC2 were gifts from Jason Cyster. They were originally obtained from Incyte Genomics by screening with primers specific for the Scya19 gene.
Subcloning and sequencing
P1 clones were digested with HindIII or Asp718, and the resultant fragments were randomly ligated into HindIII- or Asp718-digested pBluescript (Stratagene, La Jolla, CA). Colonies were screened by colony lifts onto nylon filters. After alkaline lysis, filters were probed with randomly primed SLC or ELC cDNA. Clones containing SLC or ELC were picked from the original plates and prepared by standard procedures. Sequencing was performed using dye terminator technology.
Southern blot analyses
DNA was prepared from murine tissue by standard procedures or
was obtained from The Jackson Laboratory. For Southern blot analysis,
10 µg of genomic DNA or a normalized amount of P1 or BAC plasmid was
digested with restriction enzymes according to manufacturers
instructions (Roche, Indianapolis, IN), separated on 1% agarose gels
at 1 V/cm for 1018 h, and transferred to nylon membranes
(Hybond-N+, Amersham, Arlington Heights, IL) by
alkaline blotting (33). Blots were hybridized with
32P-labeled probe random primed from a
BglII-NsiI fragment of Scya21a (probe
A), a PvuII-XbaI fragment of Scya19
(probe B), a CTACK EST, or an IL-11R
EST in dextran sulfate
hybridization mixture overnight at 68°C. Blots were washed in 0.1x
SSC/0.1% SDS at 68°C before autoradiography.
SLC expression studies
For in situ hybridizations, paraffin sections (5 µm) from BALB/c and BALB/c-plt mice were deparaffinized, fixed in 4% paraformaldehyde, and treated with proteinase K. After washing in 0.5x SSC, the sections were covered with hybridization solution, prehybridized for 13 h at 55°C, and hybridized overnight with sense or antisense 35S-labeled riboprobe transcribed from the mouse SLC cDNA. After hybridization, sections were washed at high stringency, dehydrated, dipped in photographic emulsion NTB2 (Eastman Kodak, Rochester, NY), stored at 4°C for 4 wk, developed, and counterstained with hematoxylin and eosin. For RT-PCR-restriction fragment length polymorphism (RFLP) analysis, total RNA was prepared from mouse LN and spleen using TRIzol reagent (Life Technologies, Gaithersburg, MD), reverse transcribed using a First Strand Synthesis kit (Roche), and amplified with ELC-specific primers (AGGAGGACATCTGAGCGATTCC and TGGTGAACACAACAGCAGGCAC). A portion of the RT-PCR product was digested with NcoI, and digested and undigested samples were resolved by agarose gel electrophoresis.
For immunohistochemistry, frozen tissue sections were acetone fixed, blocked with PBS/5% normal donkey serum, and incubated with goat anti-murine SLC (R&D Systems, Minneapolis, MN), biotin-conjugated donkey anti-goat IgG (Jackson ImmunoResearch Laboratories, West Grove, PA), HRP-avidin-biotin conjugate (Vector, Burlingame, CA), developed with Vector VIP substrate (Vector), and counterstained with methyl green.
| Results |
|---|
|
|
|---|
To provide a basis for analyzing the plt mutation, the
wild-type SLC/ELC locus was examined. Five P1 genomic clones
(designated AE) and two BAC clones were identified in murine 129/Ola
or 129/SvJ genomic libraries. All clones contained both SLC and ELC by
Southern blot analysis. Restriction mapping of the P1 clones was
performed, but the results were not consistent with a single location
for either SLC or ELC. Some Southern blots also suggested that multiple
SLC and ELC genes are present in the murine genome (data not shown). To
examine this possibility, SLC- and ELC-containing fragments from all P1
clones were subcloned and sequenced. Sequence analysis of these
fragments demonstrated three distinct SLC genes (designated
Scya21ac; Fig. 1
A). The sequences of these
genes are highly conserved, although they each have scattered small
deletions relative to the consensus sequence. The exon sequences of
Scya21b and Scya21c are identical. They differ
from the exon sequence of Scya21a by several
single-nucleotide changes. One of these changes (C to T at position 251
of SLC mRNA) leads to an amino acid change at position 65 of the SLC
protein (serine in Scya21a to leucine in Scya21b
and Scya21c). In general, the sequences of the
Scya21a and Scya21b genes correspond to the
SLC-Ser (C6kine-Ser) and SLC-Leu (C6kine-leu) genes described by
Vassileva et al. (32).
|
Chemokine gene duplications in various inbred mouse strains
The presence of SLC and ELC genes in various inbred mouse strains
was determined using RFLPs that were identified by sequence analysis.
When P1 clones are examined by Southern blotting, three fragments are
found that correspond to the predicted sizes of the three SLC genes
(Fig. 2
A, SLC probe). When
mouse genomic DNA is digested and hybridized similarly, three distinct
patterns of hybridization are found (Fig. 2
B, SLC probe). In
the first pattern fragments corresponding to all three SLC genes are
present. In the second pattern only fragments corresponding to
Scya21a and Scya21b are present. In the third
pattern a fragment that corresponds to Scya21b is present
along with a second fragment of larger size. The evidence presented
below demonstrates that this larger fragment (identified in Southern
blots as Scya21a') is a RFLP of Scya21a.
|
It is known that several inbred strains of mice possess two copies of
the I1llra gene (I1llra1 and I1llra2)
(34, 35, 36). Because the 3' end of the I1llra gene
overlaps the 3' end of the CTACK gene (18), this finding
suggested that the I1llra and SLC/ELC gene duplications may
be related events and that CTACK and I1llra genes may be
present at the SLC/ELC locus. Southern blot analysis of P1 clones
revealed that a CTACK gene is present on P1 clone C (Fig. 2
A, CTACK probe). This same clone contains the
Scya21c and Scya19-ps3 genes. This clone also
contains the I1llra2 gene (data not shown), suggesting that
both murine I1llra genes are associated with CTACK
genes.
To determine the distribution of CTACK genes in various mouse strains,
we examined EcoRI digests of mouse genomic DNA. An
EcoRI polymorphism has been demonstrated immediately
downstream of the I1llra1 and I1llra2 genes in
the region where the CTACK gene is found (34). Southern
blot analysis reveals that two CTACK-hybridizing EcoRI
fragments are present in most strains of mice (Fig. 2
B,
CTACK probe). A single CTACK-hybridizing EcoRI fragment is
seen in C57BR, C57L, SJL, and SM/J mice (Fig. 2
B and data
not shown). Not surprisingly, the strains of mice found to have two
CTACK genes correspond exactly to those in which the I1llra2
duplication has been demonstrated (34). We have designated
the CTACK gene that is associated with the I1llra1 gene (the
3.4-kb EcoRI fragment) Scya27a. The CTACK gene
that is associated with the I1llra2 gene (the 4-kb
EcoRI fragment) is designated Scya27b. The
strains of mice that possess a single CTACK gene correspond to those
that demonstrate the Scya21a' form of the SLC-Ser
gene.
The distributions of SLC, ELC, CTACK, and I1llra genes in
the wild-type mouse strains we examined fall into three distinct
patterns. Because we find variations in the numbers of multiple genes
present at this site, we have designated this region chemokine locus
chromosome 4, or Cklc4. The above results demonstrate that
at least three distinct haplotypes exist at the Cklc4 locus
in commonly used inbred mouse strains. We have designated these
haplotypes Cklc4a,
Cklc4b, and Cklc4c. The
features of each haplotype are summarized in Table I
.
|
All P1 clones examined were derived from 129 mice and therefore
represent the Cklc4c haplotype. To
determine the position of these clones relative to each other, two
129/Sv BAC clones obtained in a screen for Scya19 were
examined for the presence of other genes. By Southern blot analysis,
BAC1 contains Scya21a and Scya19, but no other
SLC, ELC, CTACK, or I1llra genes (Fig. 2
C and
data not shown). BAC2 contains SLC genes Scya21a and
Scya21c, ELC genes Scya19 and
Scya19-ps3, the Scya27b CTACK gene, and the
I1llra2 gene (Fig. 2
C and data not shown).
To better define the arrangement of genes at the
Cklc4c locus, BAC clones from the C57BL/6
RPCI-23 library were examined. The database of RPCI-23 end sequences
was searched for the presence of Scya19, Scya21,
Scya27, and I1llra sequences. Eight BACs were
identified as positive for Cklc4 sequences and were
subjected to Southern blot analysis to determine the presence of
specific Scya19, Scya21, and I1llra
genes. All P1 and BAC clones were also examined for the presence the D4
Mit237 STS marker. During the mapping of the plt mutation,
it was determined that an inability to amplify D4 Mit237 from genomic
DNA is closely linked to the plt phenotype. PCR analysis
revealed that the D4 Mit237 marker is present on four BACs but none of
the P1 clones. The results of these analyses are summarized in Table II
. The localization of genes on P1 and
BAC clones allows the construction of a contig of the
Cklc4c locus. This contig includes the D4 Mit
237 marker, the three SLC genes, the four ELC genes, the
I1llra2 gene, and the Scya27b gene. The
I1llra1 and Scya27a genes are known to be located
near this region (35), but were not present on any the
clones examined. The contig presented in Table II
suggests the order of
genes in the Cklc4c haplotype. Determining the
organization of haplotypes Cklc4a and
Cklc4b will require the examination of genomic
DNA or clones derived from mice that harbor these haplotypes.
|
The Scya21a gene is not found in genomic digests of
BALB/c-plt DNA (32). This and the loss of the
D4 Mit237 STS marker suggest that the plt mutation involves
a genomic deletion. To identify genes involved in this deletion,
Southern blots of genomic DNA from DDD-Mtv2 mice and
BALB/c-plt mice were compared. DDD-Mtv2 mice are believed to
be representative of the DDD/1 strain on which the plt
mutation arose. BALB/c-plt mice have retained the genomic
organization of Cklc4 that is seen in DDD-plt
mice (data not shown). Southern blot analysis reveals that the
Scya21a' and Scya21b genes are present in
DDD-Mtv2 mice in a pattern corresponding to the
Cklc4a haplotype (Fig. 3
A). In BALB/c-plt
mice, the fragment corresponding to Scya21a' is absent,
leaving only the Scya21b gene. Strains of mice demonstrated
to possess the Scya21a' gene (DDD-Mtv2, DBA/2) express SLC
in secondary lymphoid organs, while strains of mice that have deleted
this gene (BALB/c-plt, DDD/1) do not (9) (data
not shown). This suggests that the Scya21a' fragment is a
variant of the Scya21a gene, and that this gene is expressed
in secondary lymphoid organs.
|
To determine whether an ELC transcript that contains the
Scya19 NcoI site is present in plt
mice, cDNAs derived from BALB/c and BALB/c-plt LNs and
spleen were subjected to PCR-RFLP analysis. When mRNA from BALB/c mice
is reverse transcribed and amplified with primers specific for all ELC
transcripts, the majority of PCR products (bases 63390 of mELC cDNA)
can be cleaved at an internal NcoI site (Fig. 3
D). In contrast, none of the PCR products from
plt-BAB/c mice is cleaved with NcoI. This finding
supports the conclusion that plt mice do not express an ELC
transcript that contains an initiation codon in the proper
location.
To determine whether the CTACK and I1llra genes are affected
by the plt mutation, these genes were analyzed by Southern
blot analysis as described above. DDD-Mtv2 genomic DNA contains a
single copy of the CTACK gene (Fig. 3
E) and a single copy of
the I1llra gene (Fig. 3
F). The pattern of
I1llra-hybridizing fragments corresponds to the
I1llra1 gene (34). A similar pattern is seen in
plt mice, suggesting that the plt deletion does
not include the CTACK or I1llra genes. Overall, the pattern
of intact and deleted genes in plt mice suggests that the
proximal end of the plt deletion is located between the
Scya19 gene and the next upstream SLC, ELC, CTACK, or
I1llra gene. The identity of this next upstream gene is not
known in the Cklc4a haplotype. Thus, the
plt deletion includes the SLC-Ser gene expressed in
secondary lymphoid organs, the lone functional ELC gene, and the D4
mit237 marker.
Expression pattern of Scya21b
By Northern blot analysis, SLC is expressed in nonlymphoid organs
of plt mice, predominately heart, lung, and gastrointestinal
tract (32). To determine specifically where SLC is
expressed in plt mice, in situ hybridization was performed
on multiple tissues from BALB/c and BALB/c-plt mice.
Consistent with published data, expression of SLC is not seen in the
spleen, LN, or Peyers patches of plt mice (data not
shown). SLC hybridization signal is observed on lymphatic endothelial
cells in the intestine, heart, lung, liver, and kidney of
plt mice (Fig. 4
and data not
shown). However, compared with wild-type mice, the hybridization signal
seen in tissues from plt mice is less intense and less
uniformly distributed within lymphatic vessels.
|
|
| Discussion |
|---|
|
|
|---|
One functional ELC gene and three ELC pseudogenes are present in the
mouse genome (Figs. 1
B and 2B). Scya19
and Scya19-ps1 are present in all mouse strains examined,
while Scya19-ps2 and Scya19-ps3 are present only
in those strains that have an Scya21c gene. By sequence
analysis, Scya19 represents the only functional ELC gene in
129/Sv mice. Because all ELC genes are transcribed, hybridization-based
methods of measuring ELC mRNA levels, such as Northern blotting and in
situ hybridization, will not be reliable measures of ELC function. It
was the presence of ELC pseudogene transcripts that led us to falsely
conclude the ELC function is preserved in plt mice
(8).
It has been previously demonstrated that two distinct I1llra genes are present in the mouse genome (34, 35, 36). I1llra1 represents the predominant form, is present in all mouse strains examined, and is expressed in all tissues. I1llra2 is present in about half the mouse strains examined and is expressed in testes, thymus, and LNs. Targeted deletion of the I1llra1 gene leads to female infertility due to defective uterine decidualization, but has no demonstrated effect on hemopoiesis (37, 38, 39). No specific function has been determined for I1llra2.
Our data suggest that at least two CTACK genes are present in the mouse
genome. Although we have not sequenced these regions, the two
CTACK-hybridizing EcoRI genomic fragments we observed (Fig. 2
B) correspond to fragments predicted to exist at the 3' end
of the I1llra1 and I1llra2 genes, the known
locations of the CTACK gene in humans and mice. We have not examined
the relative transcription levels of the Scya27 genes.
The Cklc4 haplotypes seen in mice appear to have arisen from a series of gene duplications and deletions. Such duplication events are not uncommon and are thought to be due to homologous recombination between repeated DNA segments on misaligned alleles (40). An example in humans is the variation in numbers of red and green photoreceptor genes that leads to color blindness (41). In mice, repeated and inverted DNA segments have led to multiple gene duplications and deletions at the T locus (42).
Although we have provided an initial characterization of Cklc4 haplotypes, the true complexity of these haplotypes is probably greater that we have demonstrated here. First, it is likely that other genes are involved in this series of duplications. As an example, the galactose-1-phosphate uridylyltransferase gene lies within 4 kb of the I1llra gene in humans, maps to the Cklc4 locus in mice, and displays strain-specific differences in the number of hybridizing fragments in Southern blots of genomic DNA (43, 44, 45). Therefore, it is likely that the galactose-1-phosphate uridylyltransferase gene in mice has been duplicated in a manner similar to the I1llra gene. Our preliminary data suggest that the region duplicated in mice spans at least 100 kb and that other genes are present in this region. Second, it is possible that more than three cluster types exist at the Cklc4 locus. We have observed Southern blot hybridization patterns in some mouse strains that do not correspond to any of the cluster types we have defined (data not shown). Whether this is due to incomplete digestions, RFLPs, or additional cluster types is not yet known. Third, the actual number of SLC, ELC, CTACK, or I1llra genes present at the Cklc4 locus may be greater than we have demonstrated here. Evidence suggests that up to six I1llra2 genes are present in some strains of mice (34). There is also evidence that a fourth SLC gene may exist in the Cklc4c haplotype. Some ESTs derived from C57BL/6 mice represent SLC transcripts that do not correspond to any of the SLC genes we have sequenced. Also, the end sequence of BAC 432P21 matches SLC sequence upstream of the transcription initiation site but does correspond exactly to Scya21ac. Because this BAC continues further upstream, we could not determine whether this sequence represents a true SLC gene.
The functional consequences of the gene duplications we describe are unknown. At least one strain-specific trait, leukocyte infiltration into the uterus in response to estrogen, has been mapped to the vicinity of the Cklc4 locus (46). It is possible that other strain-specific variations in lymphoid organ anatomy or immune response are due in part to heterogeneity at this locus in mice. Such variability in gene number does not occur at this locus in humans. The human genomic sequence that corresponds to the Cklc4 locus (GenBank accession no. AC026658) demonstrates no duplication of SLC, ELC, CTACK, or I1llra genes.
Most importantly for our purposes, characterizing the Cklc4 locus has allowed a greater understanding of the plt mutation. This mutation arose on a Cklc4a background that contains two SLC and two ELC genes, one CTACK gene, and one I1llra gene. In plt mice, the SLC gene that is expressed in secondary lymphoid organs and the lone functional ELC gene are deleted, leaving SLC-Leu as the only known CCR7 ligand in these animals. It remains possible that a gene other than SLC or ELC has been deleted in plt mice. However, preliminary studies suggest that all nonchemokine genes and ESTs in this region of the human genome are intact in plt mice.
In light of our findings, some reassessment of the mechanisms that lead to the plt phenotype is required. First, the lack of ELC in plt mice raises the possibility that this protein contributes to the extravasation of T cells across HEV. Although ELC is not expressed by high endothelial cells, it is possible that ELC protein is transported to HEV in a manner similar to the accumulation of SLC on splenic arterioles. No localization of ELC protein has been described. In contrast, SLC mRNA is expressed in HEV, SLC protein localizes to the luminal aspect of HEV, and the lack of T cell adhesion to HEV in plt mice can be reversed by the injection of exogenous SLC (9, 22). Thus, the available evidence suggests that SLC is the chemokine responsible for stimulating the firm adhesion of T cells to HEV, but does not entirely rule out a contributory role for ELC.
Our findings also suggest that SLC contributes to the migration of activated DC from peripheral tissues into afferent lymphatics. We have demonstrated that the migration of DC into dermal lymphatics is intact in plt mice (8). The preserved, albeit reduced, expression of SLC-Leu by lymphatic endothelial cells in plt mice would account for this migration. It is possible that a chemotactic gradient is established by the diffusion of SLC into the tissues surrounding afferent lymphatics and that this gradient serves to attract DC, which express CCR7 upon activation (47, 48, 49). Consistent with this hypothesis, the migration of DC to draining LN after contact sensitization is undetectable in mice lacking CCR7, whereas it is only reduced in plt mice (7, 8). plt mice also demonstrate abnormalities in the localization of those DC that reach draining LN. DC in plt mice accumulate in the subcapsular sinus and superficial cortex rather than reaching the LN paracortex (8). This localization defect may be due to the lack of SLC-Ser or ELC expression in the lymphoid organs of plt mice. Transgenic expression of SLC in pancreatic islets is sufficient to stimulate the proper localization of DC within neolymphoid structures, suggesting that SLC is the major determinant of DC localization (50). However, the possible induction of ELC expression in SLC transgenic mice has not been evaluated, and it remains possible that ELC plays a contributory role in this process. Determining the relative roles of SLC and ELC in leukocyte migration and immune response will require studies of mice in which the function of these chemokines is inhibited on an individual basis.
Finally, the localization of SLC protein on splenic arterioles may suggest a role for these vessels in the homing of T cells to splenic white pulp. Both plt mice and CCR7-deficient mice demonstrate defects in the migration of T cells into splenic T cell zones. By analogy with events demonstrated to occur in LN, SLC is likely to be expressed at the site of T cell extravasation into white pulp, where it would be predicted to stimulate the activation of lymphocyte integrins and the firm adhesion of these cells. The localization of SLC on splenic arterioles raises the possibility that these vessels are the site of lymphocyte integrin activation, and perhaps extravasation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Michael D. Gunn, Box 3547, Duke University Medical Center, Durham, NC 27710. ![]()
3 Abbreviations used in this paper: SLC, secondary lymphoid-tissue chemokine; DC, dendritic cell; BAC, bacterial artificial chromosome; CTACK, cutaneous T cell-attracting chemokine; ELC, EBI-1 ligand chemokine; HEV, high endothelial venules; LN, lymph node; RFLP, restriction fragment length polymorphism; EST, expressed sequence tag; Cklc4, chemokine locus chromosome 4. ![]()
Received for publication July 11, 2000. Accepted for publication October 6, 2000.
| References |
|---|
|
|
|---|
14+ T cells by Mtv-2 in the DDD mouse. Eur. J. Immunol. 23:2434.[Medline]
-locus chemokine (ILC), which is located on chromosome 9p13 and a potential homologue of a CC chemokine encoded by molluscum contagiosum virus. FEBS Lett. 460:544.[Medline]
-chemokine, thymus-derived chemotactic agent 4, with activity on T lymphocytes and mesangial cells. J. Immunol. 159:5671.[Abstract]
chemokine containing six conserved cysteines. J. Immunol. 159:1589.[Abstract]
4
7-mediated adhesion of lymphocytes to mucosal addressin cell adhesion molecule-1 (MAdCAM-1) under flow. J. Immunol. 161:952.
receptor CCR7. J. Cell Biol. 141:1053.
-chain and a related locus. J. Biol. Chem. 271:13754.
-chain gene (Il11Ra2) with a restricted pattern of expression. Genomics 40:387.[Medline]
function is required for normal decidua and fetoplacental development in mice. Genes Dev 12:2234.
-chain genes generate a fusion mRNA in normal cells: implication for the production of multidomain proteins during evolution. J. Biol. Chem. 273:16005.This article has been cited by other articles:
![]() |
M. R. Britschgi, A. Link, T. K. A. Lissandrin, and S. A. Luther Dynamic Modulation of CCR7 Expression and Function on Naive T Lymphocytes In Vivo J. Immunol., December 1, 2008; 181(11): 7681 - 7688. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ladi, T. A. Schwickert, T. Chtanova, Y. Chen, P. Herzmark, X. Yin, H. Aaron, S. W. Chan, M. Lipp, B. Roysam, et al. Thymocyte-Dendritic Cell Interactions near Sources of CCR7 Ligands in the Thymic Cortex J. Immunol., November 15, 2008; 181(10): 7014 - 7023. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shimizu and R. N. Mitchell The Role of Chemokines in Transplant Graft Arterial Disease Arterioscler Thromb Vasc Biol, November 1, 2008; 28(11): 1937 - 1949. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. McCaughtry, T. A. Baldwin, M. S. Wilken, and K. A. Hogquist Clonal deletion of thymocytes can occur in the cortex with no involvement of the medulla J. Exp. Med., October 27, 2008; 205(11): 2575 - 2584. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, R. R. Seethala, Q. Zhang, W. Gooding, C. van Waes, H. Hasegawa, and R. L. Ferris Autocrine and Paracrine Chemokine Receptor 7 Activation in Head and Neck Cancer: Implications for Therapy J Natl Cancer Inst, April 2, 2008; 100(7): 502 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takamura, S. Fukuyama, T. Nagatake, D.-Y. Kim, A. Kawamura, H. Kawauchi, and H. Kiyono Regulatory Role of Lymphoid Chemokine CCL19 and CCL21 in the Control of Allergic Rhinitis J. Immunol., November 1, 2007; 179(9): 5897 - 5906. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Manzo, S. Bugatti, R. Caporali, R. Prevo, D. G. Jackson, M. Uguccioni, C. D. Buckley, C. Montecucco, and C. Pitzalis CCL21 Expression Pattern of Human Secondary Lymphoid Organ Stroma Is Conserved in Inflammatory Lesions with Lymphoid Neogenesis Am. J. Pathol., November 1, 2007; 171(5): 1549 - 1562. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Haynes, C. D. C. Allen, R. Lesley, K. M. Ansel, N. Killeen, and J. G. Cyster Role of CXCR5 and CCR7 in Follicular Th Cell Positioning and Appearance of a Programmed Cell Death Gene-1High Germinal Center-Associated Subpopulation J. Immunol., October 15, 2007; 179(8): 5099 - 5108. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-G. Yang, T. Tanaka, M. H. Jang, Z. Bai, H. Hayasaka, and M. Miyasaka Binding of Lymphoid Chemokines to Collagen IV That Accumulates in the Basal Lamina of High Endothelial Venules: Its Implications in Lymphocyte Trafficking J. Immunol., October 1, 2007; 179(7): 4376 - 4382. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Wolf, B. Linas, G. J. Trevejo-Nunez, E. Kincaid, T. Tamura, K. Takatsu, and J. D. Ernst Mycobacterium tuberculosis Infects Dendritic Cells with High Frequency and Impairs Their Function In Vivo J. Immunol., August 15, 2007; 179(4): 2509 - 2519. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Xu, K. Aoyama, M. Kusumoto, A. Matsuzawa, E. C. Butcher, S. A. Michie, T. Matsuyama, and T. Takeuchi Lack of lymphoid chemokines CCL19 and CCL21 enhances allergic airway inflammation in mice Int. Immunol., June 1, 2007; 19(6): 775 - 784. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-L. del Rio, J.-I. Rodriguez-Barbosa, E. Kremmer, and R. Forster CD103- and CD103+ Bronchial Lymph Node Dendritic Cells Are Specialized in Presenting and Cross-Presenting Innocuous Antigen to CD4+ and CD8+ T Cells J. Immunol., June 1, 2007; 178(11): 6861 - 6866. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okada and J. G. Cyster CC Chemokine Receptor 7 Contributes to Gi-Dependent T Cell Motility in the Lymph Node J. Immunol., March 1, 2007; 178(5): 2973 - 2978. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yasuda, T. Kuwabara, H. Nakano, K. Aritomi, T. Onodera, M. Lipp, Y. Takahama, and T. Kakiuchi Chemokines CCL19 and CCL21 promote activation-induced cell death of antigen-responding T cells Blood, January 15, 2007; 109(2): 449 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Pietila, V. Veckman, A. Lehtonen, R. Lin, J. Hiscott, and I. Julkunen Multiple NF-{kappa}B and IFN Regulatory Factor Family Transcription Factors Regulate CCL19 Gene Expression in Human Monocyte-Derived Dendritic Cells J. Immunol., January 1, 2007; 178(1): 253 - 261. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Otero, M. Groettrup, and D. F. Legler Opposite Fate of Endocytosed CCR7 and Its Ligands: Recycling versus Degradation J. Immunol., August 15, 2006; 177(4): 2314 - 2323. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ato, A. Maroof, S. Zubairi, H. Nakano, T. Kakiuchi, and P. M. Kaye Loss of Dendritic Cell Migration and Impaired Resistance to Leishmania donovani Infection in Mice Deficient in CCL19 and CCL21 J. Immunol., May 1, 2006; 176(9): 5486 - 5493. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. Legler, P. Krause, E. Scandella, E. Singer, and M. Groettrup Prostaglandin E2 Is Generally Required for Human Dendritic Cell Migration and Exerts Its Effect via EP2 and EP4 Receptors J. Immunol., January 15, 2006; 176(2): 966 - 973. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, R. Han, I. Lee, A. S. Hancock, G. Xiong, M. D. Gunn, and W. W. Hancock Permanent Survival of Fully MHC-Mismatched Islet Allografts by Targeting a Single Chemokine Receptor Pathway J. Immunol., November 15, 2005; 175(10): 6311 - 6318. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-G. Wang, K. D. Kim, J. Wang, P. Yu, and Y.-X. Fu Stimulating Lymphotoxin {beta} Receptor on the Dendritic Cells Is Critical for Their Homeostasis and Expansion J. Immunol., November 15, 2005; 175(10): 6997 - 7002. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kanemitsu, Y. Ebisuno, T. Tanaka, K. Otani, H. Hayasaka, T. Kaisho, S. Akira, K. Katagiri, T. Kinashi, N. Fujita, et al. CXCL13 is an arrest chemokine for B cells in high endothelial venules Blood, October 15, 2005; 106(8): 2613 - 2618. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Carlsen, G. Haraldsen, P. Brandtzaeg, and E. S. Baekkevold Disparate lymphoid chemokine expression in mice and men: no evidence of CCL21 synthesis by human high endothelial venules Blood, July 15, 2005; 106(2): 444 - 446. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kursar, U. E. Hopken, M. Koch, A. Kohler, M. Lipp, S. H.E. Kaufmann, and H.-W. Mittrucker Differential requirements for the chemokine receptor CCR7 in T cell activation during Listeria monocytogenes infection J. Exp. Med., May 2, 2005; 201(9): 1447 - 1457. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Liu, T. Ueno, S. Kuse, F. Saito, T. Nitta, L. Piali, H. Nakano, T. Kakiuchi, M. Lipp, G. A. Hollander, et al. The role of CCL21 in recruitment of T-precursor cells to fetal thymi Blood, January 1, 2005; 105(1): 31 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chun, C.-C. Yin, J.-Z. Song, M.-X. Liu, J.-H. Piao, Q. Lin, X.-B. Wang, and H.-L. Huang Soluble Expression of Recombinant Human Secondary Lymphoid Chemokine (SLC) in E. coli and Research on Its In Vitro and In Vivo Bioactivity J. Biochem., December 1, 2004; 136(6): 769 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Qu, E. W. Edwards, F. Tacke, V. Angeli, J. Llodra, G. Sanchez-Schmitz, A. Garin, N. S. Haque, W. Peters, N. van Rooijen, et al. Role of CCR8 and Other Chemokine Pathways in the Migration of Monocyte-derived Dendritic Cells to Lymph Nodes J. Exp. Med., November 15, 2004; 200(10): 1231 - 1241. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Scimone, T. W. Felbinger, I. B. Mazo, J. V. Stein, U. H. von Andrian, and W. Weninger CXCL12 Mediates CCR7-independent Homing of Central Memory Cells, But Not Naive T Cells, in Peripheral Lymph Nodes J. Exp. Med., April 19, 2004; 199(8): 1113 - 1120. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kwan and N. Killeen CCR7 Directs the Migration of Thymocytes into the Thymic Medulla J. Immunol., April 1, 2004; 172(7): 3999 - 4007. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Martin-Fontecha, S. Sebastiani, U. E. Hopken, M. Uguccioni, M. Lipp, A. Lanzavecchia, and F. Sallusto Regulation of Dendritic Cell Migration to the Draining Lymph Node: Impact on T Lymphocyte Traffic and Priming J. Exp. Med., August 18, 2003; 198(4): 615 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ebisuno, T. Tanaka, N. Kanemitsu, H. Kanda, K. Yamaguchi, T. Kaisho, S. Akira, and M. Miyasaka Cutting Edge: The B Cell Chemokine CXC Chemokine Ligand 13/B Lymphocyte Chemoattractant Is Expressed in the High Endothelial Venules of Lymph Nodes and Peyer's Patches and Affects B Cell Trafficking Across High Endothelial Venules J. Immunol., August 15, 2003; 171(4): 1642 - 1646. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Louis, G. Dulude, S. Corneau, S. Brochu, C. Boileau, C. Meunier, C. Cote, N. Labrecque, and C. Perreault Changes in the lymph node microenvironment induced by oncostatin M Blood, August 15, 2003; 102(4): 1397 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yoshino, H. Yamazaki, H. Nakano, T. Kakiuchi, K. Ryoke, T. Kunisada, and S.-I. Hayashi Distinct antigen trafficking from skin in the steady and active states Int. Immunol., June 1, 2003; 15(6): 773 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okada, V. N. Ngo, E. H. Ekland, R. Forster, M. Lipp, D. R. Littman, and J. G. Cyster Chemokine Requirements for B Cell Entry to Lymph Nodes and Peyer's Patches J. Exp. Med., July 1, 2002; 196(1): 65 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Junt, H. Nakano, T. Dumrese, T. Kakiuchi, B. Odermatt, R. M. Zinkernagel, H. Hengartner, and B. Ludewig Antiviral Immune Responses in the Absence of Organized Lymphoid T Cell Zones in plt/plt Mice J. Immunol., June 15, 2002; 168(12): 6032 - 6040. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-C. Chen, G. Vassileva, D. Kinsley, S. Holzmann, D. Manfra, M. T. Wiekowski, N. Romani, and S. A. Lira Ectopic Expression of the Murine Chemokines CCL21a and CCL21b Induces the Formation of Lymph Node-Like Structures in Pancreas, But Not Skin, of Transgenic Mice J. Immunol., February 1, 2002; 168(3): 1001 - 1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-C. Chen, M. W. Leach, Y. Chen, X.-Y. Cai, L. Sullivan, M. Wiekowski, B. J. Dovey-Hartman, A. Zlotnik, and S. A. Lira Central Nervous System Inflammation and Neurological Disease in Transgenic Mice Expressing the CC Chemokine CCL21 in Oligodendrocytes J. Immunol., February 1, 2002; 168(3): 1009 - 1017. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ploix, D. Lo, and M. J. Carson A Ligand for the Chemokine Receptor CCR7 Can Influence the Homeostatic Proliferation of CD4 T Cells and Progression of Autoimmunity J. Immunol., December 15, 2001; 167(12): 6724 - 6730. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Christopherson II, J. J. Campbell, and R. A. Hromas Transgenic overexpression of the CC chemokine CCL21 disrupts T-cell migration Blood, December 15, 2001; 98(13): 3562 - 3568. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kriehuber, S. Breiteneder-Geleff, M. Groeger, A. Soleiman, S. F. Schoppmann, G. Stingl, D. Kerjaschki, and D. Maurer Isolation and Characterization of Dermal Lymphatic and Blood Endothelial Cells Reveal Stable and Functionally Specialized Cell Lineages J. Exp. Med., September 17, 2001; 194(6): 797 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Baekkevold, T. Yamanaka, R. T. Palframan, H. S. Carlsen, F. P. Reinholt, U. H. von Andrian, P. Brandtzaeg, and G. Haraldsen The Ccr7 Ligand ELC (Ccl19) Is Transcytosed in High Endothelial Venules and Mediates T Cell Recruitment J. Exp. Med., May 7, 2001; 193(9): 1105 - 1112. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |