|
|
||||||||
RIII by CD3
in Murine NK Cells1
Department of Molecular Genetics, Chiba University Graduate School of Medicine, Chiba, Japan
| Abstract |
|---|
|
|
|---|
RIII is involved in Ab-dependent cell-mediated cytotoxicity
(ADCC) and cytokine production by NK cells. Signaling and expression of
Fc
RIII are dependent on FcR
. Although NK cells express not only
FcR
but also CD3
, the role of CD3
in NK cell function remains
unclear. Here, we found that the expression of Fc
RIII on NK cells
from CD3
-deficient mice is unexpectedly up-regulated compared with
that on cells from normal mice. Furthermore, ADCC and IFN-
production upon Fc
RIII-cross-linking by NK cells from
CD3
-deficient mice were also up-regulated. Up-regulation of the
surface expression of Fc
RIII on CD3
-deficient NK cells is not
mediated by transcriptional augmentation of either Fc
RIII or FcR
gene because there was no significant difference in the expression of
mRNA for Fc
RIII and FcR
. Transfection of CD3
into a cell line
expressing Fc
RIII and FcR
induced a decrease in the cell surface
expression of Fc
RIII. These findings reveal a negative regulatory
role of CD3
in Fc
RIII-mediated function of murine NK
cells. | Introduction |
|---|
|
|
|---|
R with Ab (3, 4, 5). Among
different Fc
Rs, NK cells mainly express the low affinity receptor
for IgG termed Fc
RIII (CD16). Recently, human Fc
RIII on NK cells
has been shown to be involved in direct recognition of specific targets
in the absence of Ab (6), although its physiological
function is still unclear. Therefore, Fc
RIII expressed on NK cells
is involved in ADCC and partly in Ab-independent natural
cytotoxicity.
Fc
RIII is expressed on the cell surface in association with FcR
(Fc
RI
), which was originally identified as a signaling component
of the high affinity IgE receptor (Fc
RI) complex (7, 8). Because Fc
RIII cannot be expressed on the cell surface in
the absence of FcR
, NK cells obtained from FcR
-deficient (-/-)
mice do not express Fc
RIII or show ADCC function (9, 10). Furthermore, NK cells from
Fc
RIII-/- mice also fail to exhibit ADCC,
confirming that Fc
RIII is the IgG Fc receptor responsible for this
function in NK cells (11).
The CD3
-chain is one of the components of the TCR-CD3 complex and
possesses three tyrosine-based activation motifs (ITAM) in its
cytoplasmic domain. ITAMs of CD3
are rapidly tyrosine phosphorylated
upon TCR cross-linking and transduce activation signals in T cells
(12). In addition, CD3
is required for the cell surface
expression of the TCR complex and plays a crucial role in the
regulation of the assembly and intracellular transport of the TCR-CD3
complex. Indeed, the expression of TCR is severely impaired in
CD3
-deficient cells and mice (13, 14, 15, 16, 17).
CD3
is also expressed in both human and murine NK cells despite the
fact that NK cells do not express TCR and seem to be involved in NK
cell activation (18, 19). CD3
is phosphorylated upon
cross-linking of Fc
RIII and is thought to be involved in signal
transduction through Fc
RIII in human NK cells (20, 21).
However, it is known that there is a significant difference between
human and murine CD3
in Fc
RIII expression. Human CD3
as well
as FcR
can be associated with Fc
RIII and are involved in the
surface expression of Fc
RIII, whereas murine Fc
RIII can associate
only with FcR
, not with CD3
. (22). In addition, no
significant functional defects have been reported in NK cells from
CD3
-/- mice (17). From these
analyses, it has been widely believed that CD3
does not play any
important role in the activation of murine NK cells.
In the present study we found that Fc
RIII expression on NK cells
from CD3
-/- mice is greatly enhanced.
Furthermore, Fc
RIII-mediated functions of NK cells from
CD3
-deficient mice were also up-regulated. These findings
demonstrate a novel function of CD3
in murine NK cells in regulation
of the expression and function of Fc
RIII.
| Materials and Methods |
|---|
|
|
|---|
The establishment and characterization of
CD3
-/- mice were described previously
(14). CD3
-/- mice were
maintained in our animal facility and back-crossed to C57BL/6 mice
seven times. FcR
-/- mice were generated from
C57BL/6-derived embryonic stem cells as previously described
(10).
Preparation of NK cells
NK cells were purified as previously described (23). Briefly, splenocytes were mixed with anti-CD4 mAb (GK1.5) and anti-CD8 mAb (53.6.7) followed by incubation with magnetic beads (Advanced Magnetics, Cambridge, MA) coupled with goat anti-mouse IgG Ab and goat anti-rat IgG Ab (Cappel, Organon Teknika, West Chester, PA) to remove surface Ig+ (sIg+) B cells and CD4+ and CD8+ T cells. The residual cells were then incubated with PE-anti-NK1.1 mAb and FITC-anti-CD3 mAb (PharMingen, San Diego, CA). The stained cells were sorted into NK1.1+ CD3- cells by FACStarPlus (Becton Dickinson, Mountain View, CA). The purity of the sorted cells was always >99%.
Cell culture and stimulation
Purified NK cells were cultured in RPMI 1640 supplemented with
10% FCS, kanamycin (100 µg/ml), and 5 x
10-5 M 2-ME. NK cells were expanded by culturing
freshly purified NK cells for 57 days in the presence of 1000 U/ml
human rIL-2 (Ajinomoto, Kawasaki, Japan) and were used for further
analysis. For the analysis of IFN-
production, 5 x
104 NK cells were stimulated with immobilized
mouse IgG1 mAb (anti-biotin, Zymed, South San Francisco, CA) or
with recombinant mouse IL-12 (4.9 x 106
U/mg; supplied by Genetics Institute, Cambridge, MA) for 2 days. Mouse
IgG1 mAb was immobilized on a 96-well flat-bottom sterile ELISA plate
(Corning, Corning, NY) by incubation for 2 h at 37°C in 0.1 M
NaHCO3.
Measurement of IFN-
The amount of IFN-
produced in the culture supernatants was
measured by ELISA using a standard protocol with rIFN-
as the
standard (24). Anti-IFN-
mAb (R4-6A2, PharMingen) was
used to capture IFN-
. Biotinylated anti-IFN-
mAb (XMG1.2,
PharMingen) was used to detect captured IFN-
.
ADCC activity
ADCC activity was analyzed as previously described (25). P815 cells were surface biotinylated (26), followed by labeling with PKH-2-green fluorescence dye (Sigma, St. Louis, MO). Thereafter, PKH-2-labeled P815 cells were cultured with various numbers of NK cells at 37°C for 4 h in the presence of various concentrations of rabbit anti-biotin Ab (Rockland, Gilbertsville, PA). Dead cells were stained with propidium iodide, and the proportion of dead cells in PKH-2-stained target cells was determined by flow cytometry. Data are presented as the mean ± SD from triplicate cultures.
Flow cytometry
Cells were stained with fluorescence-labeled Abs and analyzed with FACScan or FACScalibur (Becton Dickinson). Fluorescence-labeled Abs used for flow cytometry were FITC- or PE-2.4G2 (PharMingen) and PE-anti-NK1.1 (PharMingen).
RT-PCR
Total cellular RNA was extracted by the
guanidinium-isothiocyanate method. Single-strand cDNA was synthesized
with reverse transcriptase from 0.5 µg of RNA and was used for PCR.
Primer sequences used were as follows:
-actin: 5' primer,
TGGAATCCTGTGGCATCCATGAAAC; 3' primer, TAAAACGCAGCTCAGTAACAGTCCG;
Fc
RIII: 5' primer, GTTTAAGGCCACAGTCAATG; 3' primer,
GGTTGGCTTTTGGGATAG; and FcR
: 5' primer, ATGATCTCAGCCGTGATCTTG;
3' primer, AGTCTCATATGTCTCCTGGCT. Various amounts of cDNAs were
amplified in PCR under the following conditions: 94°C for 1 min,
57°C for 1 min, and 72°C for 1.5 min with 20 cycles for
-actin
or with 26 cycles for Fc
RIII and FcR
. After amplification, PCR
products were separated by electrophoresis on 1.5% agarose gel
containing ethidium bromide and visualized by UV illumination.
Surface biotinylation, immunoprecipitation, and Western blotting
NK cells were surface biotinylated as previously described
(26). Biotinylated cells were lysed with a lysis buffer
containing 1% digitonin, 50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 10
µg/ml aprotinin, 10 µg/ml leupeptin, 1 mM PMSF, and 10 mM
iodoacetamide, at a concentration of 1 x
107 cell/ml. Immunoprecipitation was performed
with anti-CD3
(H146) or anti-Fc
RIII (2.4G2) mAbs.
Immunoprecipitates were separated on two-dimensional nonreducing (16%)
and reducing (18%) SDS-PAGE and transferred onto a polyvinylidene
difluoride membrane (Immobilon-P; Millipore, Bedford, MA). The
biotinylated proteins were detected using streptavidin-peroxidase
(Vecstain Elite ABC kit; Vector, Burlingame, CA), an ECL system
(Amersham International, Aylesbury, U.K.).
Transfection
cDNAs for Fc
RIII and FcR
were subcloned into pMx
retrovirus expression vector (provided by Dr. T. Kitamura, University
of Tokyo, Tokyo, Japan). These cDNAs were transiently transfected into
BOSC23 packaging cells using Lipofectamine Plus (Life Technologies,
Gaithersburg, MD). Culture supernatants were collected at 2 days after
transfection, and NIH-3T3 cells were infected by addition of the
supernatants. Fc
RIII-expressing cells were purified by
FACStarPlus, and a single-cell clone stably
expressing Fc
RIII was obtained. CD3
was subcloned into internal
ribosomal entry site (pIRES)-green fluorescence protein (EGFP)
expression vector (Clontech, Palo Alto, CA). Mutant CD3
in which
isoleucine in the transmembrane region was substituted to leucine
(I46L-CD3
) was generated by recombinant PCR and subcloned into
pIRES-EGFP vector. CD3
-IRES-GFP, I46L-CD3
-IRES-GFP, and IRES-GFP
(vector only) were transiently transfected into the Fc
RIII
transfectants. At 36 h after transfection, the expressions of GFP
and Fc
RIII on the transfectants were analyzed.
| Results |
|---|
|
|
|---|
RIII expression on CD3
-/- NK
cells
To analyze the role of CD3
in NK cells, we purified NK cells
from splenocytes from wild-type, CD3
-/-, and
FcR
-/- mice. Purified NK cells were expanded
for 5 days in the presence of IL-2, and the expression of NK1.1 and
Fc
RIII on the cell surface was analyzed (Fig. 1
). As previously reported,
FcR
-/- NK cells were deficient in Fc
RIII
expression, because FcR
is required for the surface expression of
Fc
RIII (9, 10). In contrast, Fc
RIII expression on
the cell surface of CD3
-/- NK cells was
significantly higher than that on wild-type NK cells. Similar results
were obtained when Fc
RIII expression was analyzed on freshly
isolated NK cells (data not shown). In contrast to Fc
RIII, the
surface expression of NK1.1, another FcR
-associated molecule on NK
cells (23), did not differ between wild-type and
CD3
-/- NK cells, suggesting that CD3
specifically down-regulates Fc
RIII expression on NK cells.
|
RIII in
NK cells from CD3
-/- mice is affected by the
elevated expression of the surface Fc
RIII. Because NK cells show
ADCC and are involved in Ab-mediated immune responses (4, 5), we first analyzed the ADCC activity by NK cells from
CD3
-/- mice.
CD3
-/- NK cells exhibited no significant
difference from wild-type NK cells in cytotoxicity against biotinylated
P815 cells in the absence of anti-biotin Ab (Fig. 2
-/- NK cells, which express a higher
level of Fc
RIII, showed significantly more potent cytotoxicity in
the presence of the anti-biotin Ab than wild-type NK cells (Fig. 2
-/-
NK cells were greater at lower concentrations of Ab. While
CD3
-/- NK cells showed almost maximum
cytotoxicity in the presence of 6.3 µg/ml of Ab, wild-type NK cells
did not reach maximum cytotoxicity with the same concentration of Ab,
and the cytotoxicity continued to gradually increase as Ab
concentrations were increased. In contrast, there was no significant
difference between wild-type and CD3
-/- NK
cells in natural cytotoxicity against NK-sensitive target cells, such
as YAC-1 (17) (Fig. 2
down-regulates ADCC activity, but not natural cytotoxicity
by NK cells.
|
RIII induces not only ADCC but
also IFN-
production. Wild-type and
CD3
-/- NK cells were stimulated with various
concentrations of immobilized IgG1 mAb or recombinant murine IL-12, and
the amount of IFN-
produced in culture supernatants was measured by
ELISA 2 days later. As shown in Fig. 3
produced by CD3
-/- NK cells upon stimulation
with immobilized IgG1 mAb was severalfold higher than that produced by
wild-type NK cells. In contrast, there was no difference in IFN-
production by these NK cells upon stimulation with IL-12 (Fig. 3
by CD3
-/- NK cells was not due to an
elevated capacity for IFN-
production. These results indicate that
not only the expression level of Fc
RIII but also its function are
up-regulated in NK cells lacking CD3
.
|
RIII and FcR
in both wild-type and CD3
-/- NK cells
To address the question of whether the enhanced expression of
Fc
RIII on the cell surface of CD3
-/- NK
cells can be attributed to an increase in mRNA for Fc
RIII or FcR
,
we analyzed the amounts of transcripts for Fc
RIII, FcR
, and
-actin in NK cells from wild-type,
CD3
-/-, and
FcR
-/- mice by semiquantitative RT-PCR. As
shown in Fig. 4
, we could not observe any
significant difference between wild-type and
CD3
-/- NK cells in the expression levels of
mRNA for Fc
RIII and FcR
. This observation suggests that the
augmented expression of Fc
RIII on CD3
-/-
NK cells was not due to the increased expression of mRNA of Fc
RIII
or FcR
and that CD3
regulates the expression of Fc
RIII by a
post-transcriptional mechanism.
|
-FcR
heterodimer on NK cells
FcR
is required for the surface expression of Fc
RIII on
mouse NK cells (8, 9, 10). Because NK cells express both
CD3
and FcR
, it is postulated that CD3
forms heterodimers with
FcR
similarly in T cells (27, 28), and the formation of
the heterodimers may affect the amount of the FcR
homodimers
required for efficient expression of Fc
RIII. Therefore, we analyzed
the expression of dimers containing CD3
and FcR
on the cell
surface of NK cells.
NK cells from wild-type mice were expanded in the presence of IL-2 and
surface biotinylated. The cell lysates were immunoprecipitated with
anti-CD3
and anti-Fc
RIII mAbs, and the precipitates were
analyzed on two-dimensional SDS-PAGE. As shown in Fig. 5
, immunoprecipitation with
anti-CD3
mAb revealed that CD3
was expressed mainly as
CD3
-FcR
heterodimers on the surface of NK cells, and CD3
homodimers were barely observed. By contrast, when Fc
RIII was
precipitated, only FcR
homodimers, but not CD3
-FcR
heterodimers, were detected. These results indicate that Fc
RIII
associates only with FcR
homodimers and that NK cells express
CD3
-FcR
heterodimers on the cell surface, but these heterodimers
do not associate with Fc
RIII, suggesting that CD3
regulates the
level of the FcR
homodimer through the formation of CD3
-FcR
heterodimers.
|
RIII expression by CD3
on Fc
RIII- and
FcR
-transfected NIH-3T3 cells
We next examined the direct effect of CD3
on Fc
RIII
expression by transfection of CD3
into cells expressing both
Fc
RIII and FcR
. We transfected Fc
RIII and FcR
cDNAs into
NIH-3T3 cells and isolated a clone that stably expresses Fc
RIII on
their cell surface. Thereafter, the wild-type CD3
and a mutant
CD3
containing a mutation within the transmembrane region were
transfected into the Fc
RIII-expressing NIH-3T3 clone.
It has been reported that the leucine 46 in the transmembrane region of
human CD3
is crucial for the association with Fc
RIII because the
substitution of leucine to isoleucine, which is an equivalent
substitution to murine CD3
, abrogated the interaction of CD3
with
Fc
RIII (22). Indeed, the cell surface expression of
mouse Fc
RIII was induced when Fc
RIII was transfected into COS
cells with murine CD3
possessing the substitution of isoleucine 46
to leucine (I46L-CD3
; data not shown). According to these
observations, wild-type CD3
as well as I46L-CD3
were transfected
into an Fc
RIII-expressing NIH-3T3 clone.
Because Ab against the extracellular region of CD3
is not available,
CD3
cDNAs were transfected using an expression vector containing
IRES-GFP gene to monitor CD3
-expressing cells by analyzing GFP
expression. We confirmed that the expression level of CD3
was
correlated with the amount of GFP in this system (data not shown). When
wild-type CD3
was transfected into an Fc
RIII-expressing NIH-3T3
clone, the surface expression of Fc
RIII was significantly decreased
in the GFP+ population, but not in the
GFP- population (Fig. 6
). In contrast, transfection of
I46L-CD3
and vector alone did not change the Fc
RIII expression on
the cell surface of GFP+ cells. These
observations provide evidence that the down-regulation of cell surface
expression of Fc
RIII is dependent on the inability of CD3
to
associate with Fc
RIII.
|
| Discussion |
|---|
|
|
|---|
plays an important role
in the regulation of Fc
RIII expression on murine NK cells. In the
absence of CD3
, the expression and function of Fc
RIII in NK cells
were augmented. Furthermore, transfection of murine CD3
into
transfectants expressing Fc
RIII and FcR
significantly reduced
Fc
RIII expression on the cell surface.
Both ADCC activity and IFN-
-producing capacity were up-regulated in
CD3
-/- NK cells. Particularly,
CD3
-/- NK cells showed significant
cytotoxicity even with low concentrations of Ab, suggesting that the
overall avidity of Fc
RIII on CD3
-/- NK
cells toward Ab-coated target cells is up-regulated. The up-regulation
of Fc
RIII-mediated function could be simply attributed to the
increased expression of Fc
RIII on the cell surface. The alternative
possibility is that the signaling capacity of Fc
RIII was
up-regulated by increasing the FcR
homodimer in the absence of
CD3
-FcR
heterodimers in CD3
-/- mice on
the basis that Fc
RIII associates only with FcR
homodimers.
Contrary to our findings, Liu et al. (17) previously
reported that CD3
-/- NK cells exhibit normal
ADCC function. However, they measured ADCC activity at a single
concentration of Ab. Indeed, our data demonstrated that
CD3
-/- NK cells exhibit similar ADCC
activity to that in wild-type NK cells at high concentrations of Ab
(Fig. 2
C). Therefore, it is likely that the previous report
used such a high concentration of Ab and that any significant
difference in ADCC activity could not be observed.
Although precise mechanism for CD3
-mediated down-regulation of the
cell surface expression of Fc
RIII remains unclear, our data suggest
that the regulatory function is dependent on the inability of murine
CD3
to associate with Fc
RIII. FcR
is required for the cell
surface expression of Fc
RIII, and human, but not murine, CD3
can
substitute for this function of FcR
(8, 22). Because
CD3
forms heterodimers with FcR
(27, 28), our data
suggest that wild-type CD3
interferes with the association of
Fc
RIII with FcR
homodimers by the formation of CD3
-FcR
heterodimers.
Surface biotinylation of NK cells demonstrated that FcR
homodimers,
but not CD3
-FcR
heterodimers, were associated with Fc
RIII on
the cell surface despite the fact that CD3
-FcR
heterodimers were
readily detected on the cell surface of NK cells (Fig. 5
). In addition,
the I46L-CD3
mutant failed to interfere with the surface expression
of Fc
RIII, and this mutant CD3
exhibits an affinity sufficient to
associate with Fc
RIII (Fig. 6
; our unpublished observation). These
observations suggest that CD3
down-regulates the expression of
Fc
RIII by forming CD3
-FcR
heterodimers that cannot associate
with Fc
RIII in NK cells.
We have previously shown that FcR
is also associated with NK1.1, and
this association is necessary for signal transduction through NK1.1
(23). In contrast to Fc
RIII, the surface expression of
NK1.1 did not increase on CD3
-/- NK cells
(Fig. 1
). Our previous finding that NK1.1 does not require FcR
for
its surface expression unlike Fc
RIII (23), may explain
the reason why the surface expression of NK1.1 was not increased on
CD3
-/- NK cells. Therefore, the
down-regulatory effect by CD3
is specific for receptors that require
FcR
for their cell surface expression.
Because CD3
has been thought to be a signal-transducing molecule for
Ag and Ab cell surface receptors, our study provides a novel negative
regulatory role of the immune response by CD3
. Recently, FcR
has
been reported to associate with paired Ig-like receptor A (29, 30) and Ig-like transcripts 1 (31) and seems to be
involved in transducing activation signal through these molecules.
Therefore, it might be possible that CD3
also negatively regulates
the functions of these FcR
-associated molecules in a manner similar
to that found for Fc
RIII. In contrast, because human CD3
can
associate with Fc
RIII, a similar regulatory mechanism of CD3
observed in this study for the mouse system will not be simply
applicable in human. However, the present findings might contribute to
develop new therapeutic methods to down-regulate the function of
Fc
RIII or other FcRs in humans.
| Acknowledgments |
|---|
RIII cDNA, Dr. T. Kitamura for pMx vector
and for IL-12, Drs. S. Taki and L. L. Lanier for
critical reading of the manuscript, M. Sakuma for technical
help, and H. Yamaguchi and Y. Kurihara for secretarial
assistance. | Footnotes |
|---|
2 Current address: Department of Microbiology and Immunology, University of California San Francisco, CA 94143. ![]()
3 Current address: Hooper Foundation, University of California, San Francisco, CA 94143. ![]()
4 Current address: Mitsui Pharmaceuticals Inc., Mobara 297-0017, Japan. ![]()
5 Current address: Division of Molecular Membrane Biology, Cancer Research Institute, Kanazawa University, Kanazawa 920-0934, Japan. ![]()
6 Address correspondence and reprint requests to Dr. Takashi Saito, Department of Molecular Genetics, Chiba University Graduate School of Medicine, Chiba 260-8670, Japan. ![]()
7 Abbreviations used in this paper: ADCC, Ab-dependent cell-mediated cytotoxicity; GFP, green fluorescence protein; IRES, internal ribosomal entry site; ITAM, immunoreceptor tyrosine-based activation motif; sIg, surface Ig. ![]()
Received for publication July 7, 2000. Accepted for publication September 27, 2000.
| References |
|---|
|
|
|---|
receptor and the mast cell receptor for IgE share an identical subunit. Nature 341:752.[Medline]
chain deletion results in pleiotrophic effector cell defects. Cell 76:519.[Medline]
deficient mice to fatal glomerulonephritis. J. Clin. Invest. 102:1229.[Medline]
RIII (CD16) deficient mice. Immunity 5:181.[Medline]
chain: structure and function of a partial T cell receptor complex. Cell 52:85.[Medline]
chains. EMBO J. 12:4357.[Medline]
/
gene. EMBO J. 12:4347.[Medline]
chain of the T cell antigen receptor complex. Science 261:918.
-/- mutant mice and identification of a novel T cell population in the intestine. EMBO J. 12:4863.[Medline]
TCR as part of a novel molecular complex. Nature 341:159.[Medline]
with a receptor (CD16) for IgG Fc on human natural killer cells. Nature 342:803.[Medline]
chain. Proc. Natl. Acad. Sci. USA 88:350.
RIII(CD16):
complex in human natural killer cells: induction by antibody-dependent cytotoxicity but not by natural killing. J. Immunol. 146:206.[Abstract]
is essential for activation signal through NKR-P1 (CD161) in natural killer (NK) cells and NK1.1+ T cells. J. Exp. Med. 186:1957.
production by natural killer (NK) cells and NK1.1+ T cells upon NKR-P1 cross-linking. J. Exp. Med. 183:2391.
/
+ thymocytes against a CD4+8+ thymocyte population associated with intact Fas antigen expression on the target. J. Exp. Med. 180:423.
chain independent of the TCR-CD3 complex in normal T cells. Immunity 2:639.[Medline]
/
+ T cells and expansion of NK1.1+ TCR-
/
+ T cell development in CD3
-deficient mice. J. Exp. Med. 182:891.
chain in the T cell antigen receptor complex by
/
T cells localized in epithelia. J. Exp. Med. 179:365.
chain. J. Exp. Med. 188:991.
-chain. J. Immunol. 162:5.This article has been cited by other articles:
![]() |
K. A. Rogers, F. Scinicariello, and R. Attanasio IgG Fc Receptor III Homologues in Nonhuman Primate Species: Genetic Characterization and Ligand Interactions J. Immunol., September 15, 2006; 177(6): 3848 - 3856. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xie, H. He, M. Colonna, T. Seya, T. Takai, and B. A. Croy Pathways Participating in Activation of Mouse Uterine Natural Killer Cells During Pregnancy Biol Reprod, September 1, 2005; 73(3): 510 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. D. Huntington, Y. Xu, S. L. Nutt, and D. M. Tarlinton A requirement for CD45 distinguishes Ly49D-mediated cytokine and chemokine production from killing in primary natural killer cells J. Exp. Med., May 2, 2005; 201(9): 1421 - 1433. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dhanji, K. Tse, and H.-S. Teh The Low Affinity Fc Receptor for IgG Functions as an Effective Cytolytic Receptor for Self-Specific CD8 T Cells J. Immunol., February 1, 2005; 174(3): 1253 - 1258. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Y. Setiady, P. Pramoonjago, and K. S. K. Tung Requirements of NK Cells and Proinflammatory Cytokines in T Cell-Dependent Neonatal Autoimmune Ovarian Disease Triggered by Immune Complex J. Immunol., July 15, 2004; 173(2): 1051 - 1058. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Shiratori, K. Ogasawara, T. Saito, L. L. Lanier, and H. Arase Activation of Natural Killer Cells and Dendritic Cells upon Recognition of a Novel CD99-like Ligand by Paired Immunoglobulin-like Type 2 Receptor J. Exp. Med., February 17, 2004; 199(4): 525 - 533. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Di Gaetano, E. Cittera, R. Nota, A. Vecchi, V. Grieco, E. Scanziani, M. Botto, M. Introna, and J. Golay Complement Activation Determines the Therapeutic Activity of Rituximab In Vivo J. Immunol., August 1, 2003; 171(3): 1581 - 1587. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Hope, P. Sopp, and C. J. Howard NK-like CD8+ cells in immunologically naive neonatal calves that respond to dendritic cells infected with Mycobacterium bovis BCG J. Leukoc. Biol., February 1, 2002; 71(2): 184 - 194. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Arase, T. Saito, J. H. Phillips, and L. L. Lanier Cutting Edge: The Mouse NK Cell-Associated Antigen Recognized by DX5 Moncoclonal Antibody is CD49b ({alpha}2 Integrin, Very Late Antigen-2) J. Immunol., August 1, 2001; 167(3): 1141 - 1144. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |