The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hyun Kim, S.
Right arrow Articles by Dinarello, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hyun Kim, S.
Right arrow Articles by Dinarello, C. A.
The Journal of Immunology, 2001, 166: 148-154.
Copyright © 2001 by The American Association of Immunologists

Functional Reconstitution and Regulation of IL-18 Activity by the IL-18R{beta} Chain1

Soo Hyun Kim*, Leonid L. Reznikov*, Rogier J. L. Stuyt*, Craig H. Selzman*, Giamilia Fantuzzi*, Tomoaki Hoshino2,{dagger}, Howard A. Young{dagger} and Charles A. Dinarello3,*

* Department of Medicine, Division of Infectious Diseases, University of Colorado Health Sciences Center, Denver, CO 80262; and {dagger} Laboratory of Experimental Immunology, National Cancer Institute, Frederick Cancer Research and Development Center, Frederick, MD 21702


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-18 and IL-12 are major IFN-{gamma}-inducing cytokines but the unique synergism of IL-18 and IL-12 remains unclear. In the human NK cell line NKO, IL-18R{alpha}, and IL-18R{beta} are expressed constitutively but IL-18 did not induce IFN-{gamma} unless IL-12 was present. COS-1 fibroblasts, which produce the chemokine IL-8 when stimulated by IL-1{beta} or TNF-{alpha}, do not respond to IL-18, despite abundant expression of the IL-18R{alpha} chain. COS-1 cells lack expression of the IL-18R{beta} chain. The IL-18R{beta} cDNA was cloned from a human T-B lymphoblast cDNA library and COS-1 cells were transiently transfected with the IL-18R{beta} chain and a luciferase reporter. In transfected COS-1 cells, IL-18 induced IL-8 and luciferase in the absence of IL-12 and independently of IL-1 and TNF. Ab against the IL-18R{alpha} chain, however, prevented IL-18 responsiveness in COS-1 cells transfected with the IL-18R{beta} chain, suggesting that both chains be functional. In NKO cells and PBMC, IL-12 increased steady-state mRNA levels of IL-18R{alpha} and IL-18R{beta}; the production of IFN-{gamma} corresponded to IL-12-induced IL-18R{alpha} and IL-18R{beta} chains. We conclude that functional reconstitution of the IL-18R{beta} chain is essential for IL-12-independent proinflammatory activity of IL-18-induced IL-8 in fibroblasts. The synergism of IL-18 plus IL-12 for IFN-{gamma} production is, in part, due to IL-12 up-regulation of both IL-18R{alpha} and IL-18R{beta} chains, although postreceptor events likely contribute to IFN-{gamma} production.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin 18, initially described in 1989 as IFN-{gamma}-inducing factor (1), is structurally similar to IL-1{beta} and shares with IL-1 the same family of receptors (reviewed in Refs. 2, 3). The IL-18 receptor complex consists of two receptor chains: a ligand-binding chain termed the IL-18R{alpha} chain and a signal-transducing chain termed the IL-18R{beta} chain. The IL-18R{alpha} chain was initially isolated as a cell surface protein binding to radiolabeled IL-18; the protein was purified and its amino acid sequence revealed identity with a previously reported orphan receptor termed the IL-1R-related protein (IL-1Rrp)4 (4). Although the IL-1Rrp was cloned using oligonucleotides coding for the extracellular domains of the IL-1R type I (5), IL-1Rrp did not bind IL-1. IL-1Rrp remained an orphan receptor until IL-18 was identified as its specific ligand (4). The importance of the IL-1Rrp (IL-18R{alpha} chain) in IL-18 signal transduction was demonstrated by transient transfection of the receptor into COS-1 cells which imparted IL-18 responsiveness and activation of an NF-{kappa}B-driven luciferase reporter gene (4). In cells from mice deficient in IL-18R{alpha} chain, activation of NF-{kappa}B or c-Jun N-terminal kinase was not observed in Th1 cells and Th1 development was also impaired (6). In addition, NK cells from IL-18R{alpha}-deficient mice exhibited decreased cytolytic activity and IFN-{gamma} production in response to IL-18. Nevertheless, it was proposed that a second chain was required for full responsiveness to IL-18 (7).

The second chain of the IL-18 receptor complex was identified as another member of the IL-1 receptor family with amino acid similarities to the IL-1 receptor accessory protein, the non-ligand binding chain of the IL-1R complex (8). The second chain of IL-18R was cloned and termed IL-1R accessory protein-like protein (IL-18R{beta}) (9). The IL-18R{alpha} has a weak affinity for the ligand (18–40 nM) (4), whereas the complete IL-18R complex has a high affinity (10). Transfection with a dominant negative mutant of the IL-18R{beta} reduced IL-18 signal transduction, suggesting a role for this chain in IL-18 responsiveness (9). However, immunoprecipitation revealed that the IL-18R{beta} chain does not bind significantly to the isolated ligand (9). This is similar to that observed with the IL-1R accessory protein, which also does not bind to IL-1 but is essential for IL-1 signal transduction (8, 11, 12).

IL-18-induced transcriptional regulation of the IFN-{gamma} gene has been studied in the human myelomonocytic cell line KG-1 (13). This cell line responds to IL-18 in the absence of IL-12. An IL-18-inducible NF-{kappa}B binding site was located at -786 to -776 of the IFN-{gamma} promoter. Based on transient transfection studies, this binding site appears to be required for IFN-{gamma} gene expression. However, in fresh lymphocytes, the ability of IL-18 to induce IFN-{gamma} has been consistently a function of coactivation with other cytokines such as IL-2, but most prominently with IL-12. Although IL-12 increases the expression of IL-18R{alpha} chain (10), the role of IL-12 on expression of the IL-18R{beta} chain is unknown. In the present study, the ability of an IL-18-unresponsive fibroblast cell line (COS-1) to be reconstituted for IL-18 responsiveness by transfection with the IL-18R{beta} chain was investigated. We used the proinflammatory, but IL-12-independent, property of IL-18, i.e., induction of the chemokine IL-8 as previously reported by our group (14). In addition, the role of IL-12 on gene expression of both IL-18R chains was analyzed in the context of IFN-{gamma} from NK cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents and cytokines

RPMI 1640 and DMEM culture media were purchased from Life Technologies (Grand Island, NY) and supplemented with 10 mM L-glutamine, 24 mM NaHCO3, 10 mM HEPES, 100 U/ml penicillin, 100 µg/ml streptomycin (Cellgro, Waukesha, WI), and FBS (Life Technologies). Histopaque-1077 was purchased from Sigma (St. Louis, MO). Recombinant human IL-18 was obtained from Vertex Pharmaceuticals (Cambridge, MA) as described previously (14). Recombinant human IL-1{beta} was supplied by Cistron Biotechnology (Pine Brook, NJ). IL-1R antagonist (IL-1Ra) and TNF-binding protein (TNFbp) (15) were supplied by C. K. Edwards (Amgen, Thousand Oaks, CA). IL-2 was purchased from R&D Systems (Minneapolis, MN). Recombinant human IL-12 and TNF-{alpha} were kindly provided by Vertex Pharmaceuticals as described previously (14). Recombinant human IL-18-binding protein (IL-18BP) was expressed and purified as previously described (16). mAb to human IL-18R{alpha} (also termed IL-1Rrp) was a gift from Monica Tsang (R&D Systems).

Isolation and culture of PBMC

These studies were approved by the Combined Colorado Investigational Review Board. Residual leukocytes following plateletpheresis of healthy human donors were rinsed from blood tubing and subjected to centrifugation over Histopaque. PBMC were aspirated from the interface, washed three times in pyrogen-free saline (Baxter Healthcare, Deerfield, IL), and resuspended at 2.5 x 106/ml in RPMI 1640. The cells were cultured in flat-bottom 24-well plates (Becton Dickinson, Lincoln Park, NY) with either RPMI 1640(control), 20 ng/ml IL-18, or 10 ng/ml IL-1{beta} in the presence of 5 ng/ml IL-12. Cells were incubated for various times at 37°C in humidified air with 5% CO2.

Cell lines

A previously described clone of SV40-transformed African green monkey kidney cell line (COS-1, ATCC CRL 1650) (17) was grown in plastic flasks in DMEM medium plus 10% FBS. After three passages, a cell suspension was prepared from confluent monolayers by a gentle scraping; cells were then cultured in 6-well flat-bottom plates (Becton Dickinson) and allowed to grow for 24–48 h until a confluence of ~70% had been reached. After changing culture media, cells were stimulated with cytokines or transfection was performed as described below. After 24 h, supernatants were collected and assayed for IL-8 or cells were harvested and lysed for luciferase NF-{kappa}B reporter assay as described below.

The original NK92 cell line was obtained from Hans Klingerman (Rush Medical Center, Chicago, IL). The human NKO cell line used in the present studies was a subclone of that cell line. NKO cells were maintained in supplemented RPMI 1640 medium containing 10% FBS and 50 pg/ml IL-2. For assays, NKO cells were suspended at 2 x 106/ml in RPMI 1640 and stimulated in 2-ml volumes in 6-well plates with different concentrations of IL-12 and/or IL-18 or IL-1{beta}. After 1, 8, or 24 h at 37°C, the culture supernatant was collected for IFN-{gamma} measurement and cells were harvested for total RNA isolation as described below.

Analysis of cytokines

The liquid-phase electrochemiluminescence (ECL) method was used to measure IFN-{gamma} (18) and IL-8 (14) in cell culture media. The amount of ECL was determined using an Origen Analyzer (Igen, Gaithersburg, MD). The limit of detection of IFN-{gamma} and IL-8 was 62 and 40 pg/ml, respectively.

RNA isolation and RT-PCR

Total RNA was isolated from PBMC, NKO, and COS-1 cells using Tri-Reagent (Molecular Research Center, Cincinnati, OH). Briefly, cells were lysed in Tri-Reagent and the total RNA was sequentially isolated following chloroform extraction and isopropanol precipitation. The total RNA was dissolved in water and quantitated using GeneQuant (Pharmacia Biotech, Cambridge, U.K.). To prepare cDNA, 1–3 µg of total RNA was reverse transcribed by using random primer in final concentration of 5 mM MgCl2, 50 mM KCl, and 10 mM Tris-HCl (pH 8.3), 1 mM each of dNTPs, 20 U of RNase inhibitor, and 50 U of SuperScript II reverse transcriptase (Life Technologies). The reaction was incubated at 42°C for 30 min and terminated by incubation at 95°C for 5 min. For PCR, 2 µl of reverse transcriptase product was used in the total volume of 50 µl containing 1.7 mM MgCl2, 50 mM KCl, and 10 mM Tris-HCl (pH 8.3), 0.2 mM each of dNTPs, and 1 U of Taq polymerase (Life Technologies).

The sense primer for IL-18R{alpha} chain was 5'-CACAGACACCAAAAGCTTCATCT and the reverse primer was 5'-GCTCAGTCCCCAGAATATCTTGA. The sense primer for IL-18R{beta} chain was 5'- TGCTCCTGTACATCCTGCTTG and the reverse primer was 5'-TCTGTCCAGCAACATCTCTATC. The sense primer for GAPDH was 5'-ACCACAGTCCATGCCATCAC and the reverse primer was 5'-AGGTGGTGGGACAACGACAT. PCR was performed on a Peltier Thermal Cycler-200 (MJ Research, Watertown, MA). For each PCR, the following sequence was used: preheat 94°C for 5 min, 94°C for 45 s, 55°C for 2 min, and 72°C for 1 min, with a final extension phase at 72°C for 10 min. A variable number of cycles was used to ensure that amplification occurred in the linear phase and that differences between control and experimental conditions were maintained by adopting a limited number of cycles. The PCR amplification using GAPDH as the internal control was performed on each sample to ensure that differences between tubes were not the result of unequal concentrations of total RNA. The PCR products were separated on a 1% agarose gel containing 0.5x Tris borate-EDTA buffer (50 mM Tris, 45 mM boric acid, 0.5 mM EDTA, pH 8.3) with 0.5 µg/ml ethidium bromide, visualized by UV illumination and photographed. Densitometry was performed on the negative image (ImageQuant software; Molecular Dynamics, Sunnyvale, CA) and the relative absorbance of the cytokine PCR products were corrected against the absorbance obtained for GAPDH.

PCR cloning and construction of IL-18R{beta} chain expression vector

The IL-18R{beta} chain cDNA open reading frame was obtained by PCR using a human T-B lymphoblast cDNA library (Stratagene, La Jolla, CA). The sense primer was 5'-GCTATCCTCACATCATTCAGGA and the reverse primer was 5'-TCTGTCCAGCAACATCTCTATC (GenBank accession number AF077346).

The IL-18R{beta} chain cDNA was inserted into the mammalian expression vector pTARGET (Promega, Madison, WI) using TA cloning (pTARGET-IL-18R{beta}). The pTARGET-IL-18R{beta} had a single point mutation in the cytosolic domain at Lys508-Arg as revealed by DNA sequencing. The pTARGET-IL-18R{beta} chain was reconstructed to insert the Kozak sequence before first codon (ATG). The sense primer pertains to the XhoI site before the Kozak sequence 5'-ATATCTCGAGGCCACCATGCTCTGTTTGGG and the reverse primer included a NotI site 5'-TATAGCGGCCGCTCACCATTCCTTAGGCTGGGA to generate restriction sites for pTARGET. The pTARGET-IL-18R{beta} containing the Kozak sequence was verified again by DNA sequencing.

NF-{kappa}B luciferase reporter

pTKLUE-NF-{kappa}B was constructed by inserting the NF-{kappa}B consensus sequence 5'-GATCCAGTTGAGGGGACTTTCCCAGGCA before the thymidine kinase promoter. The precut of BamHI sense and BglII reverse NF-{kappa}B was annealed on a Peltier Thermal Cycler-200 (MJ Research) by incubation at 95°C for 10 min, then decreasing each 10°C for 1 min until a temperature of 20°C was reached. {gamma}-Phosphate of ATP was transferred to the 5'-hydroxyl terminus of the annealed double strand of NF-{kappa}B oligonucleotides by T4 polynucleotide kinase (New England BioLabs, Beverly, MA) to increase ligation efficiency. Insertion of the NF-{kappa}B consensus sequence in the pTKLUE promoter vector was confirmed by DNA sequencing.

Transient transfections

To assess pTKLUE-NF-{kappa}B activation, COS-1 cells were transiently transfected using SuperFect Transfection Reagent (Qiagen, Chatsworth, CA) according to the instructions and as described previously (19). COS-1 cells (70% confluent in 6-well plates) were washed with PBS. pTKLUE-NF-{kappa}B (800 ng) was added to cells along with 800 ng of pTARGET-IL-18R{beta} chain or 800 ng of the empty pTARGET vector (mock). After 4 h, the cells were washed with PBS and stimulated with the experimental cytokines added in RPMI 1640 containing 10% FBS. After an additional 24 h, supernatants were collected for the IL-8 assay. The cells were then washed in PBS and incubated with 200 µl/well of reporter lysis buffer (Promega) for 10 min, dislodged with a rubber policeman, added to Eppendorf tubes, and vortexed for 1 min. Cells were subjected to one freeze-thaw cycle, vortexed, and centrifuged at 12,000 x g for 15 s. Twenty microliters of supernatant was mixed with luciferase substrate reagent (Luciferase Assay System; Promega). Luciferase activity was determined in a Lumat LB 9501 luminometer (Berthold, GmbH, Munich, Germany).

Statistical analysis

Data are expressed as the mean ± SEM. Group means were compared by ANOVA Fisher’s least significant difference. Statistical significance was accepted within 95% confidence limits. ANOVA and correlation analysis were performed with the statistical packages Statview 512+ (BrainPower, Calabasas, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-18R{beta} chain deficiency is associated with lack of response to IL-18 but not IL-1{beta}

PBMC, NKO, and COS-1 were stimulated with IL-18 in the absence or presence of IL-12. In addition, in separate cultures, the same cells were stimulated with IL-1{beta}. After 24 and 48 h, the production of IL-8 and IFN-{gamma} were measured, respectively As depicted in Table IGo, IL-18 as well as IL-1{beta} induced IL-8 and IFN-{gamma} in PBMC in the presence of IL-12. The amount of IFN-{gamma} induced by IL-18 plus IL-12 was 400-fold greater than that induced by the combination of IL-1{beta} plus IL-12. In the absence of IL-12, IL-18 did not result in significant production of IFN-{gamma} but IL-8 production was unaffected (data not shown).


View this table:
[in this window]
[in a new window]
 
Table I. Responsiveness of cells to IL-18 or IL-1{beta}

 
In NKO cells, production of IFN-{gamma} induced by IL-18 alone was not significant even at concentrations as high as 100 ng/ml (data not shown);however, in the presence of IL-12, large amounts of IFN-{gamma} were measured. Although highly responsive to IL-18-induced IFN-{gamma} in the presence of IL-12, NKO cells did not produce IL-8. The induction of IFN-{gamma} by the combination of IL-1{beta} plus IL-12 was 200-fold less than that of IL-18 plus IL-12. These results are similar to those observed in PBMC as described above. Of note, the amount of IL-12 used in either PBMC or NKO cells (5 ng/ml) did not itself induce IFN-{gamma}.

In contrast to PBMC and NKO cells, COS-1 cells were not responsive to IL-18 (with or without IL-12) but did produce large amounts of IL-8 when stimulated by IL-1{beta}. COS-1 cells also produced IL-8 in response to TNF-{alpha} at concentrations similar to those of IL-1{beta} (data not shown). It in unclear why COS-1 cells do not produce IFN-{gamma}.

As shown in Fig. 1Go, these findings correspond to the presence of the IL-18R{beta} chain. Of interest, PBMC, NKO cells, and COS-1 cells express abundant amounts of the IL-18R{alpha} chain. However, the lack of responsiveness of COS-1 cells to IL-18 is associated with lack of the IL-18R{beta} chain.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 1. Gene expression of IL-18R chains in various cells. The PCR products are shown. The data represent one of four experiments. The upper panel indicates the genes whereas the lower panel indicates the cell source of the mRNA.

 
IL-18R{beta} chain is required for IL-18 signaling in COS-1 cells

In COS-1 cells, IL-1{beta} induced both NF-{kappa}B activation as well as the production of IL-8 (Fig. 2Go). Incubation of COS-1 cells for 24 h with 10 ng/ml IL-1{beta} increased IL-8 production almost 50-fold over that of control unstimulated cells (Fig. 2GoA). In these cells, IL-1{beta} increased NF-{kappa}B-driven luciferase production 4-fold that of over control (Fig. 2GoB). In contrast, IL-18 did not induce IL-8 production or NF-{kappa}B activity after 24 h of stimulation (Fig. 2Go) or after 48 and 72 h (data not shown). However, when COS-1 cells were transiently transfected with the IL-18R{beta} chain cDNA, IL-18-induced IL-8 production was observed (Fig. 3GoA) compared with cells transiently transfected with the empty vector. Moreover, NF-{kappa}B-driven luciferase activity increased 25-fold in these cells (Fig. 3GoB). There was no luciferase increase in response to IL-18 in mock-transfected COS-1 cells (Fig. 3GoB).



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 2. IL-8 production and NF-{kappa}B-mediated luciferase activity in COS-1 cells. COS-1 cells were seeded in six-well plates and after reaching 70% confluence were transfected with NF-{kappa}B reporter construct as described in Materials and Methods. After 4 h, IL-1{beta} (10 ng/ml) or IL-18 (100 ng/ml) was added. Following incubation at 37°C for 24 h, IL-8 was measured in the supernatants and cells were harvested to measure luciferase activity. A, Concentration of IL-8 in cell supernatant shown as mean fold increase ± SEM over unstimulated control. B, Luciferase activity in cells presented as mean fold increase ± SEM over unstimulated control (n = 3).

 


View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 3. IL-18-induced IL-8 production and NF-{kappa}B-mediated luciferase activity in COS-1 cells transfected with IL-18R{beta}. COS-1 cells transfected with pTKLUE-NF-{kappa}B reporter vector were cotransfected with IL-18R{beta} or empty vector. After a 24-h incubation with 100 ng/ml IL-18, supernatants was collected for the IL-8 assay and cells were harvested for luciferase activity. Transfected IL-18R{beta} ({square}) or mock transfection ({blacksquare}) are shown as mean fold increase ± SEM over unstimulated control. A, IL-8 in supernatants. B, relative luciferase activity (n = 3).

 
IL-18 responsiveness in reconstituted COS-1 cells is not IL-1 or TNF dependent

As depicted in Fig. 4Go, IL-18BP significantly (p < 0.05) decreased both IL-8 production as well as NF-{kappa}B-driven luciferase activity in COS-1 cells transiently transfected with IL-18R{beta} chain. Since COS-1 cells are highly responsive to IL-1{beta} and TNF-{alpha}, IL-18R{beta} chain reconstituted COS-1 cells were stimulated with IL-18 in the presence of IL-1Ra or TNFbp to prevent the activation of the cells by IL-1 and/or TNF-{alpha}. As shown in Fig. 4Go, there was no effect by IL-1Ra or TNFbp on IL-18-induced IL-8 production (Fig. 4GoA) or IL-18-induced NF-{kappa}B activation (Fig. 4GoB) in IL-18R{beta}-expressing COS-1 cells.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 4. Effect of IL-18BP, TNFbp, and IL-1Ra on IL-18-induced IL-8 production and NF-{kappa}B-mediated luciferase activity in IL-18R{beta}-transfected COS-1 cells. COS-1 cells were cotransfected with the pTKLUE-NF-{kappa}B reporter vector and IL-18R{beta}. After 4 h, cells were stimulated with 100 ng/ml IL-18 in the absence or presence of IL-18BP (500 ng/ml IL-18BP), TNFbp (1 µg/ml), or IL-1Ra (10 µg/ml). Supernatants were collected for the IL-8 assay and cells were harvested for luciferase activity after an additional 24 h of incubation. A, Mean fold increase ± SEM in IL-8 production. B, Mean ± SEM fold increase in relative luciferase activity (n = 4).

 
IL-18R{alpha} chain is required for IL-18 signaling in COS-1 cells expressing IL-18R{beta}

As demonstrated (Fig. 1Go), COS-1 cells express abundant amounts of IL-18R{alpha} chain. This component of the IL-18R complex is also essential for IL-18 signaling in COS-1 cells transfected with IL-18R{beta}. In the experiments shown in Fig. 5Go, preincubation of anti-IL-18R{alpha} Ab in COS-1 cells transiently transfected with IL-18R{beta} resulted in a dose-dependent reduction of both IL-18-induced IL-8 production (Fig. 5GoA) and NF-{kappa}B-driven luciferase activation (Fig. 5GoB).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of anti-IL-18R{alpha} Ab on IL-18-induced IL-8 production and NF-{kappa}B-mediated luciferase activity in IL-18R{beta}-transfected COS-1 cells. COS-1 cells were cotransfected with pTKLUE-NF-{kappa}B reporter vector and IL-18R{beta}. After 4 h, cells were stimulated with 100 ng/ml IL-18 in the absence or presence of increasing concentrations of anti-IL-18R{alpha} Ab (micrograms per milliliter under the horizontal axis). Supernatants were collected for the IL-8 assay and cells were harvested for luciferase activity after an additional 24 h of incubation. A, Mean fold increase ± SEM in IL-8 over unstimulated control cultures. B, Mean ± SEM fold increase in relative luciferase activity (n = 3).

 
IL-18R{alpha} and IL-18R{beta} are up-regulated by IL-12 in NKO cells

NKO cells, which naturally express both IL-18R chains, were incubated with increasing concentrations of IL-12. To evaluate the effect of IL-12 on the components of the IL-18R, cells were lysed after 4 h to assess expression of IL-18R{alpha} and IL-18R{beta} genes by RT-PCR. In addition, IL-12-stimulated NKO cells were incubated for 12 h to measure IFN-{gamma} production. As shown in Fig. 6Go, a dose-dependent increase in IL-12-induced IFN-{gamma} and steady-state expression of IL-18R{alpha} and IL-18R{beta} was observed. At a concentration of 10 and 20 ng/ml, IL-12 significantly increased both IL-18R{alpha} and IL-18R{beta} gene expression (Fig. 6Go, B and C). As shown in Fig. 6GoA, in these same cells, IL-12 increased the production of IFN-{gamma} at 12 h. However, the increase in IFN-{gamma} by IL-12 in these studies was independent of IL-18 since the addition of IL-18BP (20) did not affect IL-12-induced IFN-{gamma} production in three experiments. In these latter experiments, a concentration range from 10 to 1000 ng/ml of IL-18BP was added to IL-12-stimulated NKO cells without affecting IFN-{gamma} production (data not shown).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of IL-12 on IL-18R{alpha} and IL-18R{beta} chain gene expression and IFN-{gamma} production in NKO cells. NKO cells were stimulated with IL-12 at concentrations shown in nanograms per milliliter under the horizontal axes. A, Levels of IFN-{gamma} in supernatants after 12 h. Mean fold increase ± SEM over control is shown for three experiments. B, RT-PCR for IL-18R{alpha} after 4 h of IL-12 treatment (one experiment of three). C, RT-PCR for IL-18R{beta} after 4 h (one experiment of three).

 
IL-18-induced IFN-{gamma} production correlates with IL-12-induced IL-18R{alpha} and IL-18R{beta} expression

NKO cells were incubated with of IL-12 alone or in combination with IL-18 for 1, 8, and 22 h. As depicted in Fig. 7GoA, at this concentration of IL-12 (1 ng/ml), IFN-{gamma} production was barely elevated during the time course tested. In addition, in the absence of IL-12, IL-18 (20 ng/ml) alone did not induce measurable IFN-{gamma} (<62 pg/ml). However, the combination of IL-18 plus IL-12 at the above concentrations resulted in the dramatic increase in IFN-{gamma} production after 8 and 22 h of incubation (Fig. 7GoA). These results corresponded to elevations in the expression of both IL-18R chains by IL-12 during the same time course. As shown in Fig. 7Go, B and C, expression of the IL-18R chains occurred in NKO cells incubated with IL-12 from 1 to 22 h. The most dramatic gene expression was observed in both IL-18R{alpha} and IL-18R{beta} at 22 h. However, IL-12-induced elevation in IL-18R{alpha} gene expression was detected as early as 1 h (Fig. 7GoB). In the case of the IL-18R{beta} chain, the increase in mRNA was observed at 8 h (Fig. 7GoC).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 7. Kinetics of IL-12-augmented IL-18-induced IFN-{gamma} production and IL-12-induced IL-18R{alpha} and IL-18R{beta} chain gene expression in NKO cells. NKO cells were incubated with 1 ng/ml IL-12 alone or in combination with 20 ng/ml IL-18 for 1, 8, and 22 h as shown under the horizontal axes. In the absence of IL-12, IL-18 did not induce IFN-{gamma}. A, Mean fold increase ± SEM in IFN-{gamma} over control in culture supernatants (n = 3). B, NKO cells stimulated with IL-12 (1 ng/ml) followed by RT-PCR for IL-18R{alpha} at different time points. C, NKO cells stimulated with IL-12 (1 ng/ml) followed by RT-PCR for IL-18R{beta}. The data in B and C represent one of three similar experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present study was performed to examine the role of the components of IL-18R complex in IL-18 signaling, particularly in IL-18-induced NF-{kappa}B nuclear translocation and IFN-{gamma} and IL-8 production. The importance of the IL-18R{beta} chain for responsiveness to IL-18 was studied in three different cells: freshly obtained human PBMC, the NKO cell line, and a primate kidney fibroblast cell, COS-1. In PBMC and NKO cells, constitutive expression of the IL-18R{beta} chain mRNA was demonstrated but because the presence of low concentrations of IL-12 (1 ng/ml) was required for IL-18-induced IFN-{gamma} production suggests that the constitutive expression of both IL-18R{alpha} and IL-18R{beta} chains is not optimal in these cells. Indeed, despite the ample presence of both chains in NKO cells, high concentrations of IL-18 do not induce IFN-{gamma}. The presence of low concentrations of IL-12 was needed for IL-18-induced IFN-{gamma} production in these cells. Moreover, the ability of IL-18 to induce IFN-{gamma} in these cells correlated with the ability of IL-12 to increase IL-18R{alpha} as well as IL-18R{beta} steady-state mRNA levels. In freshly obtained human PBMC, IL-12 is also permissive for optimal responsiveness to IFN-{gamma} production by IL-18 (21). On the other hand, COS-1 cells transiently transfected with IL-18R{beta} chain respond to IL-18 in the absence of IL-12. It remains unclear why COS-1 cells produce IL-8 but not IFN-{gamma} and why NKO cells produce IFN-{gamma} but not IL-8. One likely explanation is that these cells lines have drifted genetically.

In the lpr/lpr mouse that lacks functional Fas and spontaneously develops a systemic autoimmune disease, there is constitutive expression of the IL-18R{alpha} in lymphocytes and over expression of IL-18R{beta} compared with the control mouse strain expressing Fas (D. Boraschi, personal communication). The overexpression of IL-18R{beta} may explain the elevated production of IFN-{gamma} in these mice. Production of IFN-{gamma} has been linked to the pathogenesis of the autoimmune disease in these mice (22). In the present study, we describe the functional reconstitution of COS-1 cells to IL-18 responsiveness by the introduction of the IL-18R{beta} chain. In fact, transient transfection of IL-18R{beta} into COS-1 cells reconstituted NF-{kappa}B-driven luciferase induction by >20-fold compared with mock-transfected cells. Since native COS-1 cells lack IL-18R{beta} chain mRNA but express abundant IL-18R{alpha} chain, these results suggest an absolute requirement of the {beta}-chain for IL-18 biological activity. This activity was observed for IL-8 synthesis as well as for NF-{kappa}B-driven luciferase activation. Furthermore, as shown in Fig. 5Go, both functional aspects of IL-18 are also dependent on the IL-18R{alpha} chain since Ab to the {alpha}-chain significantly reduced IL-18 activity.

In NKO cells and PBMC, but not COS-1 cells, IL-12 acts as a permissive factor for IL-18 activity. In NKO cells, the induction of IFN-{gamma} by IL-18 appears to correlate with IL-12-induced increases in gene expression of both chains. The IL-18/IL-12 synergism extends to transcription factors such as STATs, AP-1, and NF-{kappa}B (23). The present study revealed that both IL-18R{alpha} and IL-18R{beta} chains are up-regulated by IL-12. Others have reported a dramatic synergism of IL-12 plus IL-18 and the increased expression of the IL-18R{alpha} chain by IL-12 (10) in Th1 and B cells. The time course of IL-18R{alpha} and IL-18R{beta} chain up-regulation proceeded the logarithmic increase in IFN-{gamma} production. Therefore, one may conclude that a biological response to IL-18 requires both components of the receptor and that the synergism of IL-18 and IL-12 is, in part, explained by the ability of IL-12 to increase gene expression of both chains of the IL-18R complex.

Since native COS-1 cells are highly responsive to IL-1 and TNF, it was necessary to rule out that transfection of the IL-18R{beta} chain cDNA did not result in synthesis of IL-1 or TNF which can occur with synthetic DNA (24). Thus, the responsiveness to IL-18 observed in these studies appears to be direct and independent of IL-1 or TNF induction. The results are also consistent with those showing transfection with dominant negative cDNA for IL-18R{beta} chain reduced signaling in a NF-{kappa}B reporter by IL-18 (9). In COS-1 cells transiently transfected with IL-18R{beta}, there was full IL-18 responsiveness in not only a NF-{kappa}B reporter but also in the gene activation of IL-8 in the absence of IL-12.

In examining the transcription factors involved in IL-12-induced IFN-{gamma}, it was observed that IL-12 activates the IFN-{gamma} promoter only in combination with activation of CD3/28. On the other hand, IL-18 alone activates the IFN-{gamma} promoter (23). These data suggest that the major pathway of IL-12-induced IFN-{gamma} is up-regulation of IL-18 receptors. Our data implicate a role for IL-12 induced-IFN-{gamma} in NKO cells not only by the up-regulation of IL-18R{alpha} but also by up-regulation of the IL-18R{beta} chain that participates in IL-18 signaling.

The ability of IL-18 to participate in the Th1 response appears to be controlled at three levels. Despite the unusual finding that both human and rodent primary cells constitutively express the IL-18 gene and protein (25, 26, 27, 28), the precursor of IL-18 is inactive. Therefore, the first level of regulation of IL-18 activity is at processing, particularly by the IL-1-converting enzyme (ICE) (29, 30), and secretion of the IL-18 precursor. After IL-18 is processed and released, it encounters the second level of control, which is its binding to the high-affinity and constitutive concentrations of the IL-18-binding protein (16), which neutralizes IL-18 at equimolar concentrations (20). The third level of control of IL-18 activity is the regulation of the IL-18R{alpha} and IL-18R{beta} chains. Two populations of receptors exist on IL-12-stimulated murine T cells; a large number (5500) of low-affinity (Kd = 31.4 nM) receptors and a small number (405) of high-affinity (Kd = 430 pM) receptors (reviewed in Refs. 2, 10). As shown in the NKO cell line, despite the presence of mRNA for both chains, these cells do not produce IFN-{gamma} unless IL-12 is present. Although we did not assess the surface expression of the two IL-18R chains, we assume that the increase in their steady-state mRNA levels results in increased surface expression.

In most models of microbial infection, it can be assumed that the macrophage contribution to the Th1 response includes the production of both IL-12 and IL-18. IL-12 is readily secreted from activated macrophages whereas IL-18 requires the active ICE. Nevertheless, high concentrations of IL-12 result in small increases in IFN-{gamma} whereas in the presence of mature IL-18, relatively low amounts of IL-12 result in IFN-{gamma} expression. In mice given daily injections of IL-12, production of IFN-{gamma} is markedly reduced in ICE-deficient mice and completely absent in mice pretreated with anti-IL-18 Abs (26). Interestingly, IL-18 sustains the expression of IL-12R{beta}2 chain mRNA (31). The ability of IL-12 to increase gene and surface expression of IL-18R{alpha} has been noted in several reports (10, 31, 32). However, Fehniger et al. (32) stated that up-regulation of IL-18R{beta} using semiquantitative PCR in purified primary NK cells by IL-12 or IL-15 was not observed. Although IL-18R{beta} chain products of PCR were not shown in that report, the amount of IL-18R{beta} chain in primary NK cells may be low.

In summary, these observations provide data on the proinflammatory property of IL-18 as well as the property of IL-18 as an inducer of IFN-{gamma}. As we initially reported, IL-18 induces the chemokine IL-8 (and macrophage-inflammatory protein-1{alpha}) (14), which is evidence that IL-18 is a proinflammatory cytokine. Fibroblasts are a major source of chemokines, e.g., in the synovium of patients with rheumatoid arthritis. We now show that expression of the IL-18R{beta} is required in these nonimmunocompetent cells for production of IL-8 but independent of IL-12. In contrast, in immunocompetent cells, PBMC, and NKO cells, both IL-18R are present at the level of mRNA but unresponsive to IL-18 in the absence of IL-12. However, in the presence of IL-12, both IL-18R chains are up-regulated and large amounts of IFN-{gamma} are produced. Although these receptors are increased at the level of gene expression, it remains likely that postreceptor events also account for the synergism of IL-18 plus IL-12 in the production of IFN-{gamma}.


    Acknowledgments
 
We thank Dr. Ron Pinkus of InterPharm Laboratories, Ltd. (Nes Ziona, Israel) for providing the purified IL-18BP and Dr. Carl Edwards of Amgen, Inc. for the TNFbp and IL-1Ra.


    Footnotes
 
1 These studies were supported by National Institutes of Health Grants AI-15614 (to C.A.D.), AI-2532359 (to L.L.R.), and CA-46934. Back

2 Current address: Department of Internal Medicine 1, Kurume University School of Medicine, 67 Asahi-machi, Kurume 830-0011, Japan. Back

3 Address correspondence and reprint requests to Dr. Charles A. Dinarello, Division of Infectious Diseases, B168, University of Colorado Health Sciences Center, 4200 East Ninth Avenue, Denver, CO 80262. Back

4 Abbreviations used in this paper: IL-1Rrp, IL-1R-related protein; IL-18BP, IL-18-binding protein; IL-1Ra, IL-1R antagonist; TNFbp, TNF-binding protein; ICE, IL-1-converting enzyme. Back

Received for publication April 28, 2000. Accepted for publication September 29, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nakamura, K., H. Okamura, M. Wada, K. Nagata, T. Tamura. 1989. Endotoxin-induced serum factor that stimulates {gamma} interferon production. Infect. Immun. 57:590.[Abstract/Free Full Text]
  2. Okamura, H., H. Tsutsui, S.-I. Kashiwamura, T. Yoshimoto, K. Nakanishi. 1998. IL-18: a novel cytokine that augments both innate and acquired immunity. Adv. Immunol. 70:281.[Medline]
  3. Dinarello, C. A.. 1999. IL-18: a Th1-inducing, proinflammatory cytokine and new member of the IL-1 family. J. Allergy Clin. Immunol. 103:11.[Medline]
  4. Torigoe, K., S. Ushio, T. Okura, S. Kobayashi, M. Taniai, T. Kunikate, T. Murakami, O. Sanou, H. Kojima, M. Fuji, et al 1997. Purification and characterization of the human interleukin-18 receptor. J. Biol. Chem. 272:25737.[Abstract/Free Full Text]
  5. Parnet, P., K. E. Garka, T. P. Bonnert, S. K. Dower, J. E. Sims. 1996. IL-1Rrp is a novel receptor-like molecule similar to the type I interleukin-1 receptor and its homologues T1/ST2 and IL-1R AcP. J. Biol. Chem. 271:3967.[Abstract/Free Full Text]
  6. Hoshino, K., H. Tsutsui, T. Kawai, K. Takeda, K. Nakanishi, Y. Takeda, S. Akira. 1999. Cutting edge: generation of IL-18 receptor-deficient mice: evidence for IL-1 receptor-related protein as an essential IL-18 binding receptor. J. Immunol. 162:5041.[Abstract/Free Full Text]
  7. Thomassen, E., T. A. Bird, B. R. Renshaw, M. K. Kennedy, J. E. Sims. 1998. Binding of interleukin-18 to the interleukin-1 receptor homologous receptor IL-1Rrp1 leads to activation of signaling pathways similar to those used by interleukin-1. J. Interferon Cytokine Res. 18:1077.[Medline]
  8. Greenfeder, S. A., P. Nunes, L. Kwee, M. Labow, R. A. Chizzonite, G. Ju. 1995. Molecular cloning and characterization of a second subunit of the interleukin-1 receptor complex. J. Biol. Chem. 270:13757.[Abstract/Free Full Text]
  9. Born, T. L., E. Thomassen, T. A. Bird, J. E. Sims. 1998. Cloning of a novel receptor subunit, AcPL, required for interleukin-18 signaling. J. Biol. Chem. 273:29445.[Abstract/Free Full Text]
  10. Yoshimoto, T., K. Takeda, T. Tanaka, K. Ohkusu, S. Kashiwamura, H. Okamura, S. Akira, K. Nakanishi. 1998. IL-12 upregulates IL-18 receptor expression on T cells, Th1 cells and B cells: synergism with IL-18 for IFN{gamma} production. J. Immunol. 161:3400.[Abstract/Free Full Text]
  11. Yoon, D. Y., C. A. Dinarello. 1998. Antibodies to domains II and III of the IL-1 receptor accessory protein inhibit IL-1{beta} activity but not binding: regulation of IL-1 responses is via type I receptor, not the accessory protein. J. Immunol. 160:3170.[Abstract/Free Full Text]
  12. Martin, M. U., W. Falk. 1997. The interleukin-1 receptor complex and interleukin-1 signal transduction. Eur. Cytokine Network 8:5.[Medline]
  13. Kojima, H., Y. Aizawa, Y. Yanai, K. Nagaoka, M. Takeuchi, T. Ohta, H. Ikegami, M. Ikeda, M. Kurimoto. 1999. An essential role for NF-{kappa}B in IL-18-induced IFN-{gamma} expression in KG-1 cells. J. Immunol. 162:5063.[Abstract/Free Full Text]
  14. Puren, A. J., G. Fantuzzi, Y. Gu, M. S.-S. Su, C. A. Dinarello. 1998. Interleukin-18 (IFN-{gamma}-inducing factor) induces IL-1{beta} and IL-8 via TNF{alpha} production from non-CD14+ human blood mononuclear cells. J. Clin. Invest. 101:711.[Medline]
  15. McComb, J., T. Gould, E. Chlipala, G. Sennelo, J. Frazier, G. Kieft, J. Seely, III C. K. Edwards, A. Bendele. 1999. Antiarthritic activity of soluble tumor necrosis factor receptor type I forms in adjuvant arthritis: correlation of plasma levels with efficacy. J. Rheumatol. 26:1347.[Medline]
  16. Novick, D., S.-H. Kim, G. Fantuzzi, L. Reznikov, C. A. Dinarello, M. Rubinstein. 1999. Interleukin-18 binding protein: a novel modulator of the Th1 cytokine response. Immunity 10:127.[Medline]
  17. Gluzman, Y.. 1981. SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23:175.[Medline]
  18. Puren, A. J., P. Razeghi, G. Fantuzzi, C. A. Dinarello. 1998. Interleukin-18 enhances lipopolysaccharide-induced interferon-{gamma} production in human whole blood cultures. J. Infect. Dis. 178:1830.[Medline]
  19. Yang, S. H., P. R. Yates, A. J. Whitmarsh, R. J. Davis, A. D. Sharrocks. 1998. The Elk-1 ETS-domain transcription factor contains a mitogen-activated protein kinase targeting motif. Mol. Cell. Biol. 18:710.[Abstract/Free Full Text]
  20. Kim, S.-H., M. Eisenstein, L. Reznikov, G. Fantuzzi, D. Novick, M. Rubinstein, C. A. Dinarello. 2000. Structural requirements of six naturally occurring isoforms of the interleukin-18 binding protein to inhibit interleukin-18. Proc. Natl. Acad. Sci. USA 97:1190.[Abstract/Free Full Text]
  21. Reznikov, L. L., S. H. Kim, J. Y. Westcott, J. Frishman, G. Fantuzzi, D. Novick, M. Rubinstein, C. A. Dinarello. 2000. IL-18 binding protein increases spontaneous and IL-1-induced prostaglandin production via inhibition of IFN-{gamma}. Proc. Natl. Acad. Sci. USA 97:2174.[Abstract/Free Full Text]
  22. Peng, S. L., J. Moslehi, J. Craft. 1997. Roles of interferon-{gamma} and interleukin-4 in murine lupus. J. Clin. Invest. 99:1936.[Medline]
  23. Barbulescu, K., C. Becker, J. F. Schlaak, E. Schmitt, K.-H. Meyer zum Büschenfelde, M. F. Neurath. 1998. IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN-{gamma} promoter in primary CD4+ T lymphocytes. J. Immunol. 160:3642.[Abstract/Free Full Text]
  24. Hartmann, G., M. Bidlingmaier, A. Eigler, U. Hacker, S. Endres. 1997. Cytokines and therapeutic oligonucleotides. Cytokines Cell. Mol. Ther. 3:247.[Medline]
  25. Puren, A. J., G. Fantuzzi, C. A. Dinarello. 1999. Gene expression, synthesis and secretion of IL-1{beta} and IL-18 are differentially regulated in human blood mononuclear cells and mouse spleen cells. Proc. Natl. Acad. Sci. USA 96:2256.[Abstract/Free Full Text]
  26. Fantuzzi, G., D. A. Reed, C. A. Dinarello. 1999. IL-12-induced IFN{gamma} is dependent on caspase-1 processing of the IL-18 precursor. J. Clin. Invest. 104:761.[Medline]
  27. Cameron, L. A., R. A. Taha, A. Tsicopoulos, M. Kurimoto, R. Olivenstein, B. Wallaert, E. M. Minshall, Q. A. Hamid. 1999. Airway epithelium expresses interleukin-18. Eur. Respir. J. 14:553.[Abstract]
  28. Stoll, S., G. Mueller, M. Kurimoto, J. Saloga, T. Tanimoto, H. Yamauchi, H. Okamura, J. Knop, A. H. Enk. 1997. Production of IL-18 (IFN-{gamma}-inducing factor) messenger RNA and functional protein by murine keratinocytes. J. Immunol. 159:298.[Abstract]
  29. Gu, Y., K. Kuida, H. Tsutsui, G. Ku, K. Hsiao, M. A. Fleming, N. Hayashi, K. Higashino, H. Okamura, K. Nakanishi, et al 1997. Activation of interferon-{gamma} inducing factor mediated by interleukin-1{beta} converting enzyme. Science 275:206.[Abstract/Free Full Text]
  30. Ghayur, T., S. Banerjee, M. Hugunin, D. Butler, L. Herzog, A. Carter, L. Quintal, L. Sekut, R. Talanian, M. Paskind, et al 1997. Caspase-1 processes IFN-{gamma}-inducing factor and regulates LPS-induced IFN-{gamma} production. Nature 386:619.[Medline]
  31. Xu, D., W. L. Chan, B. P. Leung, D. Hunter, K. Schulz, R. W. Carter, I. B. McInnes, J. H. Robinson, F. Y. Liew. 1998. Selective expression and functions of interleukin 18 receptor on T helper (Th) type 1 but not Th2 cells. J. Exp. Med. 188:1485.[Abstract/Free Full Text]
  32. Fehniger, T. A., M. H. Shah, M. J. Turner, J. B. VanDeusen, S. P. Whitman, M. A. Cooper, K. Suzuki, M. Wechser, F. Goodsaid, M. A. Caligiuri. 1999. Differential cytokine and chemokine gene expression by human NK cells following activation with IL-18 or IL-15 in combination with IL-12: implications for the innate immune response. J. Immunol. 162:4511.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J BiochemHome page
N. Nagai, Y. Ito, and H. Okamura
Involvement of Interleukin 18 in Cataract Development in Hereditary Cataract UPL Rats
J. Biochem., November 1, 2007; 142(5): 597 - 603.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
C. A Dinarello
Interleukin 1 and interleukin 18 as mediators of inflammation and the aging process
Am. J. Clinical Nutrition, February 1, 2006; 83(2): 447S - 455S.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Sahar, R. S. Dwarakanath, M. A. Reddy, L. Lanting, I. Todorov, and R. Natarajan
Angiotensin II Enhances Interleukin-18 Mediated Inflammatory Gene Expression in Vascular Smooth Muscle Cells: A Novel Cross-Talk in the Pathogenesis of Atherosclerosis
Circ. Res., May 27, 2005; 96(10): 1064 - 1071.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
S-M Dai, Z-Z Shan, K Nishioka, and K Yudoh
Implication of interleukin 18 in production of matrix metalloproteinases in articular chondrocytes in arthritis: direct effect on chondrocytes may not be pivotal
Ann Rheum Dis, May 1, 2005; 64(5): 735 - 742.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-K. Lee, S.-H. Kim, E. C. Lewis, T. Azam, L. L. Reznikov, and C. A. Dinarello
Differences in signaling pathways by IL-1{beta} and IL-18
PNAS, June 8, 2004; 101(23): 8815 - 8820.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Azam, D. Novick, P. Bufler, D.-Y. Yoon, M. Rubinstein, C. A. Dinarello, and S. H. Kim
Identification of a Critical Ig-Like Domain in IL-18 Receptor {alpha} and Characterization of a Functional IL-18 Receptor Complex
J. Immunol., December 15, 2003; 171(12): 6574 - 6580.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. M. Gherardi, J. C. Ramirez, and M. Esteban
IL-12 and IL-18 act in synergy to clear vaccinia virus infection: involvement of innate and adaptive components of the immune system
J. Gen. Virol., August 1, 2003; 84(8): 1961 - 1972.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Wu, P. Sakorafas, R. Miller, D. McCarthy, S. Scesney, R. Dixon, and T. Ghayur
IL-18 Receptor {beta}-Induced Changes in the Presentation of IL-18 Binding Sites Affect Ligand Binding and Signal Transduction
J. Immunol., June 1, 2003; 170(11): 5571 - 5577.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Bufler, T. Azam, F. Gamboni-Robertson, L. L. Reznikov, S. Kumar, C. A. Dinarello, and S.-H. Kim
A complex of the IL-1 homologue IL-1F7b and IL-18-binding protein reduces IL-18 activity
PNAS, October 15, 2002; 99(21): 13723 - 13728.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. C. M. Morel, C. C. Park, K. Zhu, P. Kumar, J. H. Ruth, and A. E. Koch
Signal Transduction Pathways Involved in Rheumatoid Arthritis Synovial Fibroblast Interleukin-18-induced Vascular Cell Adhesion Molecule-1 Expression
J. Biol. Chem., September 13, 2002; 277(38): 34679 - 34691.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-H. Kim, T. Azam, D. Novick, D.-Y. Yoon, L. L. Reznikov, P. Bufler, M. Rubinstein, and C. A. Dinarello
Identification of Amino Acid Residues Critical for Biological Activity in Human Interleukin-18
J. Biol. Chem., March 22, 2002; 277(13): 10998 - 11003.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Gatti, J. Beck, G. Fantuzzi, T. Bartfai, and C. A. Dinarello
Effect of interleukin-18 on mouse core body temperature
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2002; 282(3): R702 - R709.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Wirtz, C. Becker, R. Blumberg, P. R. Galle, and M. F. Neurath
Treatment of T Cell-Dependent Experimental Colitis in SCID Mice by Local Administration of an Adenovirus Expressing IL-18 Antisense mRNA
J. Immunol., January 1, 2002; 168(1): 411 - 420.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Iwasaki, T. Mukai, C. Nakajima, Y.-F. Yang, P. Gao, N. Yamaguchi, M. Tomura, H. Fujiwara, and T. Hamaoka
A Mandatory Role for STAT4 in IL-12 Induction of Mouse T Cell CCR5
J. Immunol., December 15, 2001; 167(12): 6877 - 6883.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. Siegmund, G. Fantuzzi, F. Rieder, F. Gamboni-Robertson, H.-A. Lehr, G. Hartmann, C. A. Dinarello, S. Endres, and A. Eigler
Neutralization of interleukin-18 reduces severity in murine colitis and intestinal IFN-gamma and TNF-alpha production
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2001; 281(4): R1264 - R1273.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Nakahira, M. Tomura, M. Iwasaki, H.-J. Ahn, Y. Bian, T. Hamaoka, T. Ohta, M. Kurimoto, and H. Fujiwara
An Absolute Requirement for STAT4 and a Role for IFN-{gamma} as an Amplifying Factor in IL-12 Induction of the Functional IL-18 Receptor Complex
J. Immunol., August 1, 2001; 167(3): 1306 - 1312.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hyun Kim, S.
Right arrow Articles by Dinarello, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hyun Kim, S.
Right arrow Articles by Dinarello, C. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS