|
|
||||||||
Department of Biochemistry, Microbiology, and Immunology, University of Ottawa, Ottawa, Ontario, Canada
| Abstract |
|---|
|
|
|---|
; however, little is known
regarding regulation of IL-12R expression on NK cells. In this study we
show that murine NK cells differentiate into IL-12Rß2low
and IL-12Rß2high subsets after in vitro stimulation with
IL-2 in the absence of exogenous polarizing cytokines. Subset
development occurs gradually as NK cells expand in vitro and is
generally complete by 812 days of culture. Once established,
IL-12Rß2low and IL-12Rß2high subsets are
highly stable in vitro and can be maintained for at least 20 days after
FACS sorting. Formation of these NK subsets appears to be strain
independent. Flow cytometric analyses demonstrate that both subsets
express a number of NK-associated markers, including NK1.1, DX-5,
Ly-49A, and Ly-49C, but that the Ly-49G2 class I inhibitory receptor is
expressed predominantly on the IL-12Rß2high population.
Both IL-12Rß2low and IL-12Rß2high NK cells
respond to exogenous IL-12 by rapid production of high levels of
IFN-
and increased lytic activity against NK-sensitive YAC-1 target
cells. Analyses of cytokine gene expression by RNase protection assay
indicated that similar to the recently described human NK1 subset, both
IL-12Rß2high and IL-12Rß2low murine NK
subsets expressed high levels of IFN-
, whereas neither subset
expressed mRNA for the NK2-associated cytokines IL-5 and
IL-13. | Introduction |
|---|
|
|
|---|
production from activated T and NK cells (1, 2, 3),
promoting Ag-specific cytolytic T cell responses (10, 11),
and enhancement of lytic activity in NK and lymphokine-activated killer
(LAK)3 cells
(10, 12, 13, 14). These activities are often synergistic or at
least additive with other cytokines, in particular IL-2 and TNF-
(for review, see Ref. 2). Knockout mice lacking the IL-12
p40 subunit (8) or the receptor for IL-12
(15) are severely compromised in IFN-
production, Th1
immune responses, and delayed-type hypersensitivity. IL-12 manifests its biological functions through interaction with a cell surface IL-12R. cDNAs for two IL-12R subunits have been cloned from human and mouse and designated IL-12Rß1 (16, 17) and IL-12Rß2 (18). Both the IL-12Rß1 and IL-12Rß2 subunits are type I transmembrane glycoproteins with molecular sizes of approximately 100 and 130 kDa, respectively. IL-12Rß1 belongs to the hemopoietin receptor family, and both IL-12Rß1 and IL-12Rß2 belong to the gp130 subgroup of the cytokine receptor superfamily (1). The IL-12Rß2 subunit contains two cytoplasmic cytokine box motifs and is thus thought to be the receptor component that transduces a signal after binding of IL-12 at the surface (19). However, both IL-12R subunits appear to be required for the formation of a high affinity IL-12 binding site, as transfection of COS-7 cells with individual subunits leads to the formation of homodimers/oligomers with low affinity IL-12 binding (16, 18). In contrast, cotransfection of COS-7 cells with both subunits of the human IL-12R results in high affinity binding of human IL-12 (18).
Resting, naive T cells do not express the IL-12R (16, 20, 21); however, activation of T cells with mitogens or anti-CD3 results in rapid, but transient, surface expression of high affinity IL-12 binding sites (for review, see Ref. 1, 2). Furthermore, a number of reports have demonstrated that whereas the IL-12Rß1 subunit is constitutively up-regulated in CD4+ T cells after TCR cell stimulation, expression of the IL-12Rß2 subunit is influenced by the presence of key cytokines and accessory molecules at the time of stimulation. In particular, the presence of IL-4 during in vitro stimulation of naive T cells has been shown to result in the down-regulation of the IL-12Rß2 chain in several different systems (22, 23). This loss of IL-12Rß2 in emerging Th2 populations is thought to render the cells refractory to the effects of IL-12, thus contributing to the stability of the Th2 phenotype. Conversely, IL-12 itself has a positive regulatory effect on IL-12Rß2 surface expression on T cells (24). Together, these mechanisms for regulating high affinity IL-12 binding sites on T cells through modulation of the IL-12Rß2 chain have obvious and profound implications for the development of an ensuing immune response considering the potent ability of IL-12 to drive Th1 differentiation.
As indicated above, IL-12 also has significant biological activity on
NK cells and was initially referred to as NK cell stimulatory factor
(12). Although the regulation of IL-12R expression on NK
cells is poorly characterized compared with that on
CD4+ T cells, it is generally considered to be
up-regulated after activation with IL-2 (21, 25). As was
observed in CD4+ T cells, differential expression
of the IL-12Rß2 chain has recently been reported to occur on human NK
cells after in vitro expansion in the presence of the Th1 or Th2
polarizing cytokines IL-12 and IL-4 (26). These polarized
cells (referred to as NK1 and NK2) were found to have distinct cytokine
production profiles, particularly with respect to the production of
IL-5 and IL-13 in the NK2 subset. However, despite the differential
level of IL-12Rß2 surface expression, both subsets retained the
capacity to respond to IL-12 by increased IFN-
production during
subsequent restimulation in the presence of IL-12.
In the present study we have generated a polyclonal antiserum against
the murine IL-12Rß2 chain for the purpose of analyzing the regulation
of IL-12Rß2 expression on murine lymphocytes. We report herein that
after in vitro activation with IL-2, murine NK cells develop into two
distinct populations with differential expression of the IL-12Rß2
chain. Furthermore, these subsets develop in the absence of exogenous
polarizing subsets and exhibit a highly stable phenotype once they are
established. Interestingly, expression of IL-12Rß2 was found to
correlate with expression of the NK inhibitory molecule Ly-49G2
(Lgl-1). However, despite the difference in levels of IL-12Rß2
surface expression both subsets respond similarly to IL-12 in terms of
IFN-
production and augmented cytotoxicity.
| Materials and Methods |
|---|
|
|
|---|
A portion of the extracellular domain of murine IL-12Rß2 (aa 24275) was expressed as a recombinant protein with an N-terminal 6xHis affinity tag in Escherichia coli using the pET17b T7 promoter system (Novagen, Madison, WI). Briefly, DNA encoding IL-12Rß2 was amplified from a plasmid containing the complete murine IL-12Rß2 gene (provided by K. M. Murphy, Washington University, St. Louis, MO) by PCR. The PCR primers had the following sequences: 5' primer, ATGGCTAGCCATCACCATCACCATCACAATATAGATGTGTGCAAGCTT; and 3' primer, CATGGAATTCTCAAGCCTCATTACTCATGAG. After amplification, the PCR product was digested with NheI and EcoRI and cloned into pET17b digested with the same enzymes. The rIL-12Rß2 extracellular domain (32 kDa) was then expressed in the BL21DE3(pLysS) host cell and purified to homogeneity by nickel-nitrilotriacetic acid affinity chromatography using standard methods (Qiagen, Valencia, CA). A polyclonal rat anti-murine IL-12Rß2 antiserum was generated by immunizing female Lewis rats (Charles River Laboratories, Lexington, MA) with 100 µg of rIL-12Rß2 in CFA. Rats were boosted three times at 4-wk intervals with rIL-12Rß2 in IFA, and total serum was obtained 7 days after the final boost.
Cytokines and Abs
Human IL-2 (huIL-2) was provided by Dr. Craig Reynolds (National
Cancer Institute, Bethesda, MD). Murine IL-12 (2.7 U/ng) was provided
by Genetics Institute (Cambridge, MA). FITC-conjugated, PE-conjugated,
and biotin-conjugated Abs, including goat anti-rat Ig,
anti-CD19 (1D3), anti-murine IFN-
(XMG1.2), anti-DX-5,
anti-NK1.1, anti-B220, anti-Ly-49G2 (4D11), and
anti-CD3 (145-2C11), were purchased from PharMingen (San Diego,
CA). PE-conjugated anti-NK1.1 (PK136) was purchased from Cedarlane
(Hornby, Canada). Biotin-conjugated anti Ly-49A (YE 1/32), Ly-49C
(4LO3311), and Ly-49G2 (4LO439) were provided by Dr. Suzanne Lemieux
(Institut Armand-Frappier, Laval, Canada).
Cell preparation
Mononuclear cells (MNC) were obtained from spleens of 6- to 8-wk-old female C57BL/6 or BALB/c mice (The Jackson Laboratory, Bar Harbor, ME) by purification over Histopaque-1083 (Sigma, St. Louis, MO). MNC were plated at a density of 1 x 106 cells/ml in RPMI 1640, 10% FCS with 25 mM HEPES, 50 µM 2-ME, and penicillin/streptomycin. Con A blasts were generated from MNC by culture for the indicated times with 2.5 µg/ml Con A plus 10 U/ml huIL-2. Activated NK cells were generated from MNC by culture in the presence of 1000 U/ml huIL-2. DX-5+ cells were purified from splenic MNC by positive selection using anti-DX-5 microbeads according to manufacturers instructions (Miltenyi Biotec, Auburn, CA). Cells obtained by this procedure were routinely >98% DX-5+. Purified DX-5+ cells were then expanded by culture in the presence of 1000 U/ml huIL-2 and were subcultured every 23 days with the addition of fresh IL-2. IL-12Rß2low and IL-12Rß2high subsets of IL-2-activated NK cells were obtained either by FACS (using rat anti-murine IL-12Rß2 antiserum plus FITC-labeled goat anti-rat Ig) or by magnetic selection using FITC-conjugated anti-Ly49G2 (as a surrogate marker for IL-12Rß2) plus anti-FITC microbeads (Miltenyi Biotec). Cells were sorted by FACS to >98% purity, and cells were sorted by magnetic selection to >90% purity. After sorting, cells were returned to culture and maintained in the presence of IL-2 (1000 U/ml)
Immunofluorescence and cell sorting
The surface phenotypes of cells were established using two-color flow cytometry. All stains were performed in a stepwise manner in the following order: 1) rat anti-murine IL-12Rß2 antiserum or equivalent nonimmune serum, 2) FITC- or PE-conjugated goat anti-rat Ig, 3) 1% normal rat serum to block free goat anti-rat Ig binding sites, 4) biotin-conjugated or PE-conjugated Ab against second surface marker as indicated, and 5) streptavidin-PE (as required) to detect biotin-conjugated Ab in step 4. Flow cytometric analyses were performed on an EPICS analyzer (Coulter, Hialeah, FL) using a minimum of 20,000 events. Cell sorting was performed on an ASTRA cell sorter (Coulter).
Intracellular staining for IFN-
IL-2 blasts generated from bulk splenic MNCs or purified
DX-5+ NK cells were incubated overnight in the
presence of murine IL-12 at the indicated concentrations. The next
morning, monensin (2 µM) was added, and incubation at 37°C was
continued for 4 h. Cells were then stained for surface IL-12Rß2
using rat anti-murine IL-12Rß2 antiserum and FITC-conjugated goat
anti-rat Ig. After a 15-min fixation with 4% paraformaldehyde plus
0.1% saponin, cells were stained for intracellular IFN-
by
incubation for 30 min with PE-conjugated anti-IFN-
in the
presence of 0.1% saponin.
RNase protection assays
IL-2 blasts generated from purified DX-5+ cells of C57BL/6 mice were sorted into IL-12Rß2low and IL-12Rß2high subsets (as described above) and were grown overnight in the presence or the absence of IL-12 (1 ng/ml). Total RNA was prepared using TRIzol according to the manufacturers instructions (Life Technologies, Gaithersburg, MD). Cytokine mRNAs were detected using the mouse cytokine set 1 multiprobe template set according to the manufacturers protocols (RiboQuant, PharMingen). RNase-protected probes were resolved on 6% denaturing polyacrylamide gels and were exposed to film (XAR, Eastman Kodak, Rochester, NY) overnight at -70°C.
Cytotoxicity assay
IL-2 blasts generated from purified DX-5+ cells of C57BL/6 mice were sorted into IL-12Rß2low and IL-12Rß2high subsets (as described above) and were grown overnight in the presence or the absence of IL-12 (1 ng/ml). Cells were then washed and used as effector cells in a standard 51Cr release assay using YAC-1 cells as targets. Briefly, 5 x 103 51Cr-labeled target cells and serial dilutions of effector cells were incubated together for 4 h. After this incubation, supernatants were harvested and counted with a gamma counter. The percent specific lysis was calculated as previously described (27).
| Results |
|---|
|
|
|---|
A recombinant protein comprising the extracellular domain of the
murine IL-12Rß2 chain (aa 24275) fused to an amino-terminal 6xHis
Tag was expressed in E. coli and was purified to homogeneity
by nickel-nitrilotriacetic acid affinity chromatography. The purified
protein was then used to generate a rat anti-mouse IL-12Rß2
polyclonal antiserum for the analysis of IL-12Rß2 expression on
murine splenocytes. As previously observed with PHA-activated human T
cells (20, 21), activation of murine splenic MNC with Con
A plus IL-2 resulted in low level IL-12Rß2 expression on the surface
of CD3+ T cells (Fig. 1
A). Activated NK cells are
also known to be responsive to IL-12; however, little is known
regarding the regulation of IL-12R on NK cells. Therefore, murine
splenic MNC were activated with IL-2 (1000 U/ml) for 710 days, and
the resulting cells (>70% DX5+ NK cells) were
analyzed for IL-12Rß2 surface expression by flow cytometry. We
repeatedly observed that the DX5+ NK cells in
these cultures formed two distinct populations after surface staining
with the anti-IL-12Rß2 antiserum (Fig. 1
B). Compared
with control samples stained with preimmune serum only, these two
populations correspond to IL-12Rß2low and
IL-12Rß2high subsets of NK cells. This pattern
of NK subset distribution based on IL-12Rß2 surface expression was
highly consistent and was observed in >10 different preparations of
IL-2 blasts. Furthermore, the phenomenon appeared to be strain
independent, as a similar staining pattern was observed in IL-2 blasts
originating from BALB/c, FVB/N, and C57BL/6 mice.
|
|
|
To determine whether IL-12Rß2low and
IL-12Rß2high IL-2 blasts differed from each
other phenotypically with respect to other markers in addition to
IL-12Rß2, cells were costained with the anti-IL-12Rß2 antiserum
and with a panel of mAbs specific for DX-5, NK1.1, Ly-49A, Ly-49C,
Ly-49G2, B220, CD19, and CD3 (Fig. 4
). As
shown in Fig. 2
, IL-2-activated DX-5+ C57BL/6
splenocytes were comprised of approximately equal populations of
IL-12Rß2low and
IL-12Rß2high cells. Furthermore, both the
IL-12Rß2low and
IL-12Rß2high populations stained positively for
NK1.1, further confirming that both subsets are derived from the
NK compartment. In agreement with previous findings (28),
these NK cells were heterogeneous in terms of the Ly-49 surface markers
that were expressed. Specifically, 23% of DX-5+
C57BL/6 IL-2 blasts stained positively for Ly-49A, 23% stained
positively for Ly-49C, and 61% stained positively for Ly-49G2. As was
observed with the DX-5 and NK1.1 markers, the
Ly-49A+ and Ly-49C+
populations were distributed equally between the
IL-12Rß2low and
IL-12Rß2high populations. In marked contrast,
expression of the Ly-49G2 marker was restricted to the
IL-12Rß2high population, resulting in
delineation of NK cells as being either
Ly-49G2-IL-12Rß2low or
Ly-49G2+IL-12Rß2high. B220, which is known to
be a marker of activated NK cells (29), was present on
both IL-12Rß2low and
IL-12Rß2high populations, implying that the two
subsets do not differ in terms of their activation state. Both the
IL-12Rß2low and
IL-12Rß2high subsets were negative for CD19
staining, demonstrating that IL-2 blasts derived from
DX-5+ splenocytes were free of contaminating B
cells. Finally, a small number of NK T cells were evident in the
DX-5+ blast cultures, as indicated by positive
staining with anti-CD3. In the example shown, the
DX-5+CD3+ NK T cells are
distributed equally between the IL-12Rß2low and
IL-12Rß2high populations. However, in some of
the IL-2 blast preparations that we analyzed, the NK T cell population
was comprised entirely of IL-12Rß2high cells
(data not shown), suggesting that, like conventional T cells, NK T
cells may have variable levels of IL-12Rß2 expression based on their
current state of activation.
|
|
Cytokine production by IL-12Rß2low and IL-12Rß2high DX-5+ IL-2 blasts
We then wished to determine whether
IL-12Rß2low and
IL-12Rß2high NK cell subsets differed in their
capacity to produce IFN-
in response to IL-12. Day 10
DX-5+ IL-2 blasts were incubated overnight in the
presence or the absence of 200 U/ml IL-12 and were analyzed for IFN-
production by intracellular staining. Surprisingly, both
IL-12Rß2low and
IL-12Rß2high cells produced significant levels
of IFN-
after overnight treatment with IL-12 (Fig. 6
, A and B). To
address whether IL-12 was acting directly on both cell types or whether
IL-12Rß2high cells were influencing the
IL-12Rß2low population through an indirect
mechanism, the assay was repeated using sorted
IL-12Rß2low and
IL-12Rß2high subsets. In addition, the cells
were incubated in decreasing amounts of IL-12 to determine whether the
IL-12Rß2high cells were more sensitive to IL-12
than the IL-12Rß2low subset. Although the
percentage of IFN-
-producing cells was somewhat higher in the
IL-12Rß2high subset, particularly at higher
IL-12 concentrations, both the IL-12Rß2low and
IL-12Rß2high subsets clearly responded to IL-12
stimulation with increased production of intracellular IFN-
(Fig. 6
C). Similar results were obtained by ELISA analysis of
IFN-
secreted into the culture supernatants of these same cells
(data not shown), indicating that the
IL-12Rß2low and
IL-12Rß2high subsets are similar in their
capacity to respond to IL-12 stimulation.
|
mRNA in
response to stimulation with PMA and ionomycin. Furthermore, both
subsets dramatically up-regulated levels of IFN-
mRNA in response to
stimulation with exogenous IL-12. Also, as previously reported
(26), IL-10 mRNA appeared to be highly up-regulated in
these cells in response to stimulation with exogenous IL-12. Neither
subset produced detectable levels of IL-5 or IL-13 mRNA either before
or after stimulation, indicating that despite different levels of
IL-12Rß2 surface expression both have the cytokine expression profile
of the previously described human NK1, but not the NK2, subset.
|
|
| Discussion |
|---|
|
|
|---|
In addition to influencing the level of surface IL-12Rß2 expression,
growth of human NK cells in NK1 or NK2 priming conditions resulted in
the preferential accumulation of mRNAs encoding the Th1-associated
cytokine IFN-
or the Th2-associated cytokines IL-5 and IL-13,
respectively (26). In contrast, neither the
IL-12Rß2low nor the
IL-12Rß2high murine NK cells reported herein
expressed detectable levels of IL-5 or IL-13 mRNA either before or
after stimulation with PMA/ionomycin or IL-12. This result suggests
that despite similarities in IL-12Rß2 surface expression, murine
IL-12Rß2low NK cells do not correspond to the
human NK2 subset described above. Indeed, after stimulation with PMA
and ionomycin, IFN-
mRNA expression was up-regulated in both
subsets. After stimulation with IL-12, IFN-
as well as IL-10 mRNA
expression was dramatically up-regulated in both subsets.
IL-12-mediated up-regulation of IL-10 production in NK cells has been
reported previously (26, 36), and although the biological
consequences of IL-10 on NK activities are not clear, it may have an
autoregulatory effect on IL-12 responsiveness. In summary, both the
IL-12Rß2low and
IL-12Rß2high NK cells reported herein have a
cytokine secretion pattern similar to that of the human NK1 subset,
again suggesting that the IL-12Rß2low murine NK
subset is not likely to be related to human NK2 cells. Interestingly,
with the exception of a small amount of IFN-
mRNA, murine NK cells
grown without additional exogenous stimulation (IL-2 only) did not
express detectable amounts of mRNA for any of the cytokine genes we
assessed. This result may have implications for LAK cell-based
therapies, since it suggests that these activated NK cells are primed
in the presence of IL-2, but require a further stimulus to achieve
their full potential in terms of cytokine production.
The results of the present study indicate that despite differences in
IL-12Rß2 surface expression, stimulation of IL-2-activated NK cells
with IL-12 elicited strong IFN-
production and augmented
cytotoxicity in both IL-12Rß2low and
IL-12Rß2high populations. This finding implies
that IL-12Rß2low NK cells are capable of
responding to IL-12 equally as well as the
IL-12Rß2high population. Previous results have
shown that very low levels of IL-12R on the surface of activated human
T cells (as observed in Fig. 1
) renders these cells functionally
responsive to IL-12 (37). Similarly, resting human
CD56+ NK cells are reported to express IL-12R at
levels that are barely detectable by flow cytometry, yet this level of
receptor renders these cells responsive to IL-12 as measured by
up-regulation of IL-12R (14). Since both
IL-12Rß2low and
IL-12Rß2high murine NK subsets appear to
respond equally to IL-12, it is interesting to speculate about the
potential role of the high levels of IL-12Rß2 in the
IL-12Rß2high subset. Firstly, it is possible
that this high level expression of IL-12Rß2 is artificially driven by
the high doses of IL-2 used for the in vitro activation of NK cells. In
fact, previous studies have indicated that IL-2, at doses much lower
than those used herein, has a direct influence on expression of the
IL-12R on human NK cells (21). To investigate this
possibility we are currently looking at various in vivo NK activation
strategies, such as poly(I:C) stimulation, to determine whether these
same subsets can be derived in vivo. Also, we are investigating whether
stimulation of NK cells with IL-15, which shares many of the
stimulatory characteristics, receptor molecules, and signaling pathways
of IL-2, is capable of promoting the differentiation of these two
subsets. Second, it would be interesting to determine the molecular
configuration of the IL-12Rß2 in the
IL-12Rß2high subset. For example, is the
IL-12Rß2 present at the cell surface in monomer form or is it
complexed as a homodimer or a heterodimer with IL-12Rß1 or another as
yet to be defined cytokine receptor molecule. In this regard it may be
relevant that IL-12Rß2 bears significant sequence homology to
receptor molecules for IL-6 and gp130. Perhaps, in NK cells at least,
IL-12Rß2 plays an additional role by contributing to the binding of
these or other related cytokines. Currently we do not have access to a
mAb against murine IL-12Rß1; therefore, we cannot asses the level of
surface expression of this subunit in the
IL-12Rß2low and
IL-12Rß2high subsets. However, preliminary
analysis of IL-12Rß1 expression at the mRNA level using RT-PCR
suggests that both the subsets express the IL-12Rß1 subunit after
activation with IL-2 (data not shown). Regardless, further studies are
required to determine the biological significance of
IL-12Rß2low and
IL-12Rß2high NK subsets and their potential
roles during an innate immune response.
Staining with a number of NK-associated markers, including the pan NK markers DX5 and NK1.1 as well as the NK cell inhibitory molecules Ly-49A and Ly-49C, confirmed that both the IL-12Rß2low and IL-12Rß2high cells were of NK origin. Essentially all cells in both subsets expressed the DX5 and NK1.1 markers, whereas specific subpopulations of IL-12Rß2low and IL-12Rß2high cells expressed the Ly-49A and Ly-49C markers. Furthermore, the Ly-49A+ and Ly-49C+ cells were equally distributed between the IL-12Rß2low and IL-12Rß2high subsets. In contrast, the Ly-49G2 marker was expressed exclusively on IL-12Rß2high NK cells. Thus, IL-2 activated murine NK subsets can be further defined as being either Ly-49G2-IL-12Rß2low or Ly-49G2+IL-12Rß2high. The Ly-49 multigene family encodes a complex and polymorphic family of NK cell surface receptors, at least some of which recognize class I MHC molecules and send an inhibitory signal that represses the lytic activity of NK cells (28, 33). The lytic activity of the Ly-49G2+ subset of NK cells is inhibited by target cells expressing H-2Dd and or H-2Ld (32), although inhibition by H-2Ld has recently come into question (38). As a consequence of this class I-mediated inhibitory activity, Ly-49G2+ LAK cells from C57BL/6 mice are incapable of lysing the LAK-sensitive target P815, which is H-2Dd (32). However, as observed in the present study, both Ly-49G2- and Ly-49G2+ NK cells from C57BL/6 mice are capable of lysing NK-sensitive YAC-1 target cells. The distinct pattern of IL-12Rß2 expression on these Ly-49G2- and Ly-49G2+ NK subsets is a novel finding that implies the coordinated regulation of IL-12Rß2 and Ly-49G2 during the activation of these cells. Considering the role of Ly-49G2 in inhibiting the lysis of H-2Dd-expressing targets and the reported ability of IL-12 to augment LAK activity, it would be interesting to determine whether IL-12 plays a role in modulating the class I-mediated inhibition of lytic activity in these cells. We are currently using purified preparations of IL-12Rß2low and IL-12Rß2high populations to investigate this possibility.
Also, it may be interesting to examine whether the coordinated expression of IL-12Rß2 and Ly-49G2 is a universal phenomenon in all strains of mice. Prior analyses found that Ly-49G2 was expressed on NK cells of all strains of mice examined, but that the percentage of Ly-49G2+ NK cells varied considerably among different strains (28). If high level IL-12Rß2 expression on NK cells is restricted to the Ly-49G2+ subset, then it follows that IL-12Rß2 expression would mirror strain-dependent differences in Ly-49G2 expression. However, it is important to remember that differences in IL-12Rß2 expression were noted only in NK cells that were activated in vitro with high doses of IL-2; therefore, the significance of this finding to in vivo responses is not yet clear.
In conclusion, we have identified two distinct subsets of murine NK cells that differ in terms of IL-12Rß2 surface expression after activation with IL-2. Furthermore, these two subsets correlate with the previously described Ly-49G2- and Ly-49G2+ NK cells subsets. Future studies will evaluate the physiological significance of these two subsets both in vitro and in vivo to establish their potential role during an innate and possibly an adaptive immune response.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. John R. Webb, Department of Biochemistry, Microbiology, and Immunology, University of Ottawa, Ottawa, Ontario, Canada K1H 8M5. ![]()
3 Abbreviations used in this paper: LAK, lymphokine-activated killer; huIL-2, human IL-2; MNC, mononuclear cells. ![]()
Received for publication February 8, 2000. Accepted for publication August 9, 2000.
| References |
|---|
|
|
|---|
production and type 1 cytokine responses. Immunity 4:471.[Medline]
1/
2 domains of H-2D(d), but not H-2L(d), induce "missing self" reactivity in vivo: no effect of H-2L(d) on protection against NK cells expressing the inhibitory receptor Ly49G2. Eur. J. Immunol. 28:4198.[Medline]
This article has been cited by other articles:
![]() |
Z. Zhao, S. Yu, D. C. Fitzgerald, M. Elbehi, B. Ciric, A. M. Rostami, and G.-X. Zhang IL-12R{beta}2 Promotes the Development of CD4+CD25+ Regulatory T Cells J. Immunol., September 15, 2008; 181(6): 3870 - 3876. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Deniz, G. Erten, U. C. Kucuksezer, D. Kocacik, C. Karagiannidis, E. Aktas, C. A. Akdis, and M. Akdis Regulatory NK Cells Suppress Antigen-Specific T Cell Responses J. Immunol., January 15, 2008; 180(2): 850 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Yun, A. Lundgren, J. Azem, A. Sjoling, J. Holmgren, A.-M. Svennerholm, and B. S. Lundin Natural Killer Cells and Helicobacter pylori Infection: Bacterial Antigens and Interleukin-12 Act Synergistically To Induce Gamma Interferon Production Infect. Immun., March 1, 2005; 73(3): 1482 - 1490. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takeda, E. Cretney, Y. Hayakawa, T. Ota, H. Akiba, K. Ogasawara, H. Yagita, K. Kinoshita, K. Okumura, and M. J. Smyth TRAIL identifies immature natural killer cells in newborn mice and adult mouse liver Blood, March 1, 2005; 105(5): 2082 - 2089. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Salem, A. N. Kadima, Y. Zhou, C. L. Nguyen, M. P. Rubinstein, M. Demcheva, J. N. Vournakis, D. J. Cole, and W. E. Gillanders Paracrine Release of IL-12 Stimulates IFN-{gamma} Production and Dramatically Enhances the Antigen-Specific T Cell Response after Vaccination with a Novel Peptide-Based Cancer Vaccine J. Immunol., May 1, 2004; 172(9): 5159 - 5167. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Eyles, D. Metcalf, M. J. Grusby, D. J. Hilton, and R. Starr Negative Regulation of Interleukin-12 Signaling by Suppressor of Cytokine Signaling-1 J. Biol. Chem., November 8, 2002; 277(46): 43735 - 43740. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Strengell, T. Sareneva, D. Foster, I. Julkunen, and S. Matikainen IL-21 Up-Regulates the Expression of Genes Associated with Innate Immunity and Th1 Response J. Immunol., October 1, 2002; 169(7): 3600 - 3605. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lassmann, C. Kincaid, V. C. Asensio, and I. L. Campbell Induction of Type 1 Immune Pathology in the Brain Following Immunization Without Central Nervous System Autoantigen in Transgenic Mice With Astrocyte-Targeted Expression of IL-12 J. Immunol., November 1, 2001; 167(9): 5485 - 5493. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |