The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trama, J.
Right arrow Articles by Ho, S. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trama, J.
Right arrow Articles by Ho, S. N.
The Journal of Immunology, 2000, 165: 4884-4894.
Copyright © 2000 by The American Association of Immunologists

The NFAT-Related Protein NFATL1 (TonEBP/NFAT5) Is Induced Upon T Cell Activation in a Calcineurin-Dependent Manner1

Jason Trama*, Qingjun Lu*, Robert G. Hawley{dagger} and Steffan N. Ho2,*

* Departments of Pathology and Cellular and Molecular Medicine, University of California at San Diego, La Jolla, CA 92093; and {dagger} Holland Laboratory, American Red Cross, Rockville, MD 20855


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NFAT DNA binding complexes regulate programs of cellular activation and differentiation by translating receptor-dependent signaling events into specific transcriptional responses. NFAT proteins, originally defined as calcium/calcineurin-dependent regulators of cytokine gene transcription in T lymphocytes, are expressed in many different cell types and represent critical signaling intermediates that mediate an increasingly wide spectrum of biologic responses. Recent studies have identified a novel protein containing a region of similarity to the NFAT DNA binding domain. Here we demonstrate that this protein, designated NFATL1 (also known as tonicity enhancer binding protein and NFAT5) is expressed at high levels in the thymus but is undetectable in mature lymphocytes. However, NFATL1 can be induced in both primary quiescent T lymphocytes and differentiated Th1 and Th2 cell populations upon mitogen- or Ag receptor-dependent activation. The induction of NFATL1 protein, as well as NFATL1-dependent transcription, is inhibited by cyclosporin A and FK506, and expression of constitutively active calcineurin induces NFATL1-dependent transcription. Overexpression of NFATc1 and inhibition of NFATc activity through the use of a dominant negative NFATc1 protein have no affect on NFATL1-dependent transcription, indicating that NFATc proteins do not play a role in the calcineurin-dependent induction of NFATL1. Interestingly, induction of NFATL1 by a hyperosmotic stimulus is not blocked by the inhibition of calcineurin. Moreover, osmotic stress response genes such as aldose reductase are not induced upon T cell activation. Thus inducible expression of NFATL1 represents a mechanism by which receptor-dependent signals as well as osmotic stress signals are translated into transcriptional responses that regulate cell function.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Activation of CD4+ T lymphocytes resulting from the Ag-specific cross-linking of the TCR leads to the proliferation, differentiation, and production of cytokines that mediate specific T cell effector functions (1, 2). Transcription factors that are activated early after receptor-dependent activation represent essential signaling intermediates that translate diverse extracellular signals into specific transcriptional responses (3). For example, the STAT4 protein integrates signals from the IL-12 receptor and is essential for the development of Th1 cells (4), whereas STAT6 integrates signals from the IL-4 receptor and is essential for the development of Th2 cells (5). NFAT4 transcription factors, originally identified as transcriptional regulators of cytokine gene expression, also play an important role in regulating T cell differentiation (6). Targeted disruption of NFATc1 results in impaired Th2 function (7, 8), whereas elimination of NFATc2 results in augmented T cell function (9, 10, 11, 12). Thus identification of transcription factors that are regulated in a receptor-dependent manner represents an essential prerequisite to obtaining a complete understanding of the mechanisms underlying the translation and integration of diverse extracellular signals into specific programs of T cell gene expression and function.

Combinatorial regulation of transcription involves multiprotein complexes that bind cooperatively to specific target DNA sites. Such composite transcription factor complexes permit the convergence of disparate signaling pathways onto a defined DNA binding site, thereby conferring greater regulatory control over target gene expression in response to environmental signals (13). Composite DNA binding complexes formed by transcription factors of the NFATc family together with AP-1 proteins integrate calcium-dependent and ras-mediated signaling pathways to regulate the transcription of target genes that encode immunoregulatory proteins such as IL-2, IL-4, IL-3/GM-CSF, TNF-{alpha}, CD40 ligand, and Fas ligand (6). The NFAT family of transcription factors consists of four different proteins, NFATc1 through NFATc4, which are related both structurally and functionally (6). In addition to the high degree of similarity within the DNA binding domain (DBD),4 there is also an amino-terminal region of similarity that contains a serine-rich motif as well as serine/proline repeat motifs. Functionally, NFAT proteins undergo rapid and dynamically regulated nuclear import (14, 15), which is regulated by the equilibrium between the activities of the calcium/calmodulin-dependent phosphatase calcineurin, which promotes nuclear localization (16, 17, 18), and several protein kinases that have been demonstrated to promote cytosolic localization (19, 20, 21, 22). The conserved amino-terminal domain represents the target of the phosphatase/kinase pathways that regulate NFAT subcellular localization.

Recent studies have identified a novel protein that exhibits similarity to the NFAT DBD. This protein, which we refer to as NFATL15 (23, 24), was originally identified through a yeast one-hybrid cloning approach using a hypertonicity response element found in several tonicity responsive genes as a target DNA binding site (25, 26). This screen resulted in the identification of the cDNA encoding tonicity enhancer binding protein (TonEBP) (27). The same cDNA was also identified based on sequence similarity to the NFAT DBD and was designated NFAT5 (28) and NFATz (29). NFATL1 was also recently purified as the osmotic response element binding protein based on its ability to bind to a tonicity response element from the human aldose reductase (AR) gene (30). Although NFATL1 contains a region of similarity to the NFAT DBD, it lacks the amino-terminal NFAT homology region that mediates regulated nuclear translocation. Functional studies demonstrated that NFATL1 DNA binding activity and protein is induced upon hyperosmotic stimulus (27), and that the protein is present predominantly within the nucleus (27, 28). Interestingly, although residues of the NFATL1 DBD that mediate base-specific DNA contacts are identical with those of NFATc1 through NFATc4, those residues that correspond to AP-1 contact residues are not conserved. Consistent with this, the NFATL1 DBD is incapable of interacting with AP-1 in vitro (28). Thus, NFATL1 represents a functionally and structurally unique member of the NFAT family of transcription factors.

Our own efforts to further define transcriptional regulatory mechanisms involved in T lymphocyte differentiation also resulted in the identification of NFATL1 (24). The goal of this study was to further define the potential role of NFATL1 in the regulation of T lymphocyte function. Here we show that the NFATL1 protein is expressed constitutively in the thymus but is undetectable in mature lymphocytes. However, activation of either precursor or differentiated CD4+ T cells by cross-linking the TCR results in the induced expression of NFATL1. This induction, as well as inducible NFATL1-mediated transcription, is dependent upon the function of calcineurin but does not involve NFATc proteins. In contrast, the induction of NFATL1 by hyperosmotic stimulation occurs independently of calcineurin. The induction of NFATL1 by diverse intracellular signaling pathways, including both receptor-dependent as well as stress-induced pathways, suggests that NFATL1 functions to translate diverse extracellular stimuli into functionally appropriate transcriptional responses.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Isolation of the NFATL1 cDNA

cDNA sequences exhibiting similarity to the consensus NFAT DBD were identified through searches of the expressed sequence tag (EST) database using the BLAST search algorithm. An EST cDNA clone (pMY2357) containing a region of similarity to the less well conserved carboxyl-terminal portion of the NFAT DBD was identified in a KG1a cDNA library (24). Nested primers derived from the 5' portion of the pMY2357 cDNA sequence were used in conjunction with vector-specific primers to amplify by PCR-related cDNA sequences from the KG1a cDNA library. A PCR amplification product containing an extended region of similarity to the NFAT DBD was used as a probe to screen a Jurkat cDNA library (Clontech Laboratories, Palo Alto, CA). Two cDNA clones (pJTh101 and pJTh103) were identified that differed by a splice variation, which resulted in predicted open reading frames encoding distinct amino-terminal sequences. Given that the similarity of the protein encoded by these cDNA clones to NFATc1 through NFATc4 was restricted to the DBD, and that the similarity within the DBD was significantly less than that observed upon comparison of the DBDs of NFATc1 through NFATc4, the gene was designated NFAT-like protein 1 or NFATL1 (23). The sequence of the NFATL1 cDNA corresponds to those previously reported as KIAA0827 (31), TonEBP (27), and NFAT5 (28) (GenBank accession numbers AB020634, AF089824, and AF134870, respectively). In keeping with already established designations, the cDNA predicted to encode a 1454-aa protein (27, 28, 32) represents the "a" isoform and that encoding a 1483-aa protein represents the "b" isoform (32). The 1531-aa protein predicted by the pJTh103 cDNA clone and by the KIAA0827 cDNA clone (31) represents usage of an in-frame start methionine located upstream of that used in isoform "b". Numbering of NFATL1 amino acids used in this study is based on the predicted 1531-aa protein.

DNA constructs and plasmids

The NFAT-GL3 reporter construct was generated by subcloning a HinDIII-ClaI fragment derived from the NFAT-SEAP plasmid (16) into the vector fragment from the pGL3-promoter construct (Promega, Madison, WI) generated by digestion with HinDIII and SmaI. The regulatory region consists of the human IL-2 minimal promoter extending from nucleotide -326 to +45 (numbered relative to the transcription start site) in which the region from -290 to -77 has been deleted and replaced with a trimerized NFAT binding site (-280 to -250) flanked by XhoI sites (33). To construct the hTonE-GL3 reporter construct, a dimer of the hTonE site (25) was generated by annealing and ligating the following oligonucleotides into a pBSIIKS+ based vector, pSH-BS2(+), which contains XhoI sites flanking an AvrII-NheI-SpeI-XbaI polylinker: 5'-ctagcttggtggaaaattaccgctggt and 5'-ctag accagcggtaattttccaccaag (TonE site underlined). The binding site dimer was removed by XhoI digestion and subcloned into the NFAT-GL3 vector fragment generated by digestion with XhoI, which removes the NFAT sites. A full-length cDNA encompassing the complete NFATL1 open reading frame was assembled from cDNA clones pJTh101 and pJTh103, as well as the EST cDNA clone 550442 (GenBank accession number AA100356) obtained through the I.M.A.G.E. Consortium (34). An NFATL1 expression vector, designated pNFATL1-hemagglutinin (HA), was generated by subcloning the full-length NFATL1 cDNA (predicted open reading frame of 1531 aa) in-frame with a carboxyl-terminal influenza HA epitope tag into a eukaryotic expression vector that uses the SR{alpha} promoter (35). The dominant negative NFATL1 construct (pJT501) consists of the NFATL1 DBD (aa 268–543) subcloned in-frame with a carboxyl-terminal HA tag in the SR{alpha} expression vector. All constructs containing previously unsequenced cDNA fragments or DNA derived from PCR amplification were subject to sequencing of both sense and anti-sense DNA strands. DNA sequencing was performed through the University of California San Diego Center for AIDS Research Molecular Biology Core facility. Eukaryotic expression plasmids encoding a constitutively active form of calcineurin (36), wild-type NFATc1 (pSH102; Ref. 37), and a dominant negative NFATc1 (37) have been described.

Abs and Western analysis

Recombinant protein corresponding to the NFATL1 DBD (aa 268–543) was expressed in Escherichia coli as a polyhistidine fusion protein, purified by nickel-agarose affinity chromatography, and used as an immunogen to generate a polyclonal rabbit antiserum (Josman Laboratories, Napa, CA). The antiserum was further purified by Ag affinity chromatography. A separate rabbit antiserum (27) raised against the amino-terminal portion of the protein (aa 76–543) was provided by Dr. H. M. Kwon (Johns Hopkins University, Baltimore, MD). The two antisera functioned similarly in identifying NFATL1 by Western analysis. Whole-cell extracts used in Western analyses were generated by incubating cells on ice for 30 min in RIPA buffer (50 mM Tris-HCl, pH 8.0; 150 mM NaCl; 1% Nonidet P-40; 0.5% sodium deoxycholate; 0.1% SDS; 2 mM DTT) supplemented with protease inhibitors (1 mM PMSF, 10 µM leupeptin, 5 µM pepstatin, 2 mM EDTA). Insoluble material was pelleted by centrifugation at 15,000 x g for 15 min. Tissue extracts were prepared by Dounce homogenization in a Tris lysis buffer (50 mM Tris-HCl, pH 8.0; 400 mM NaCl; 1% Nonidet P-40; 5 mM DTT) supplemented with protease inhibitors (1 mM PMSF, 10 µM leupeptin, 5 µM pepstatin A, 5 mM EDTA). Insoluble material was pelleted by centrifugation. Equal amounts of protein, as determined by Bradford dye-binding analysis (Bio-Rad, Richmond, CA), were subject to SDS-PAGE and transferred to polyvinylidene difluo-ride membranes. The membranes were probed with the anti-NFATL1 antisera (1:1000–1:4000 dilution) in buffer containing PBS supplemented with 0.05% Tween 20, 250 mM sodium chloride, and 0.5% nonfat dry milk. Primary Ab binding was visualized using a secondary Ab consisting of an HRP-conjugated goat anti-rabbit Ig antiserum (1:4000; Fisher Scientific, Pittsburgh, PA), followed by enhanced chemiluminescent detection (Amersham, Arlington Heights, IL).

Cell culture and stimulation

Single cell suspensions obtained from spleens of C57BL6 mice were purified by density gradient centrifugation (Lympholyte M; Cedarlane Laboratories, Hornby, Ontario, Canada) after RBC lysis in buffered ammonium chloride. CD4+ T lymphocytes were isolated from splenocytes by positive magnetic cell sorting (Miltenyi Biotech, Auburn, CA). Purification was monitored by flow cytometric analysis using FITC-labeled anti-mouse CD4 (PharMingen, San Diego, CA). Cells were cultured in complete media (RPMI 1640 supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine, 10 mM HEPES, 1000 U penicillin, 1000 µg/ml streptomycin, and 50 µM 2-ME). Purified splenocyte and CD4+ T cell populations were activated with 1 µM ionomycin and 10 ng/ml PMA or 2 µg/ml Con A. For TCR-dependent activation, unfractionated splenocytes were cultured with 1 µg/ml anti-CD3 (PharMingen). CD4+ T cells were stimulated with plate-bound anti-CD3 by preincubating six-well tissue culture plates overnight at 4°C with 6 µg anti-CD3. Anti-CD28 (5 µg/ml) was added to CD4+ T cell cultures as a means of costimulation. Cyclosporin A (CsA; Calbiochem, La Jolla, CA) was added simultaneously with activating agents as indicated. Unless otherwise noted, cytokine, Ab, and ELISA reagents were obtained from PharMingen. Th1 differentiation was induced by activating CD4+ T cells (0.2 x 106/ml) with plate-bound anti-CD3 plus anti-CD28 and culturing the cells in media containing 20 ng/ml recombinant murine IL-2, 20 ng/ml recombinant mouse IL-12, and 2 µg/ml anti-mouse IL-4. Th2 differentiation was induced in parallel, culturing cells in media containing 20 ng/ml recombinant mouse IL-2, 20 ng/ml recombinant mouse IL-4, and 5 µg/ml anti-mouse IFN-{gamma} (R&D Systems, Minneapolis, MN). On day 5, T cells were washed and restimulated with 1 µM ionomycin and 10 ng/ml PMA. Supernatants were harvested 24 h later, and cytokine production (IL-4 and IFN-{gamma}) was quantitated by ELISA. The Jurkat E6 cell line (American Type Culture Collection (ATCC), Manassas, VA), as well as the derivative Jurkat TAg cell line that is stably transfected with the SV40 large T Ag (38) were cultured in complete medium without 2-ME. Jurkat cells were stimulated using 1 µM ionomycin, 10 ng/ml PMA, 200 mM raffinose, 50 nM CsA, or as otherwise specified.

RNA analyses

NFATL1 RNA levels in various human tissues were quantified using a human mRNA dot blot (Clontech Laboratories). RNA from cell lines and splenocytes was isolated using RNAzol (Tel-Test, Friendswood, TX). Radiolabeled cDNA fragments used to probe RNA blots consisted of the following: a 572-bp fragment of the hNFATL1 cDNA encompassing aa 268–458; a 1267-bp EcoRI-XhoI fragment of a murine AR cDNA EST clone (GenBank accession number AA791571; ATCC); and a murine GAPDH fragment (Ambion, Austin, TX). Hybridizations and high stringency washes were performed using standard procedures. RNA levels were quantitated by phosphorescence using a Storm Phosphoimaging system (Molecular Dynamics, Sunnyvale, CA).

Cell transfection and reporter analysis

Jurkat cells (107 cells per 0.4 ml complete medium) were transfected by electroporation (Bio-Rad Gene Pulser; 950 µF, 0.25 V, 0.4-cm gap width). Cells were stimulated 24 h after transfection. Luciferase activity was measured in cell lysates generated 16–24 h after stimulation. Lysates were prepared by repeated freeze-thaw cycles in 0.25 M Tris, pH 7.5 (typically 200 µl extract volume per 107 cells transfected). Insoluble material was pelleted by centrifugation, and luciferase activity in the resulting cell lysate was measured using a Lumat LB9507 luminometer. Luciferase assays typically used duplicate measurements of 10 µl of cell lysate added to 200 µl of assay buffer containing 2.5 mM glycylglycine, 15 mM MgSO4, 5 mM ATP, and 1 mg/ml BSA. Luciferase reactions were initiated by the injection of 100 µl 1 mM D-luciferin (Sigma, St. Louis, MO), and light activity was measured over a 10-s period. All reporter data presented are representative of at least three independent experiments.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Thymus-specific expression of NFATL1 protein

As a first step toward elucidating the function of NFATL1, the tissue distribution of NFATL1 mRNA was determined. To quantitatively assess NFATL1 mRNA levels in a wide spectrum of tissue types, including mature and fetal tissues as well as tissues from functionally distinct regions of the central nervous system, a multi-tissue human mRNA dot blot was screened with a probe derived from the human NFATL1 cDNA clone pJTh103. Results of this hybridization show that the NFATL1 gene is expressed ubiquitously, with readily detectable NFATL1 mRNA present in all tissues (Fig. 1Goa). The complete absence of any detectable signal in the negative control samples indicates that the observed hybridization signals are specific. Northern blot analysis using the same probe identified a single ~13 kb NFATL1 mRNA transcript with no additional high-stringency hybridization signals (data not shown). In addition, previously published results of Northern analyses of NFATL1 expression demonstrated very similar patterns of expression (27, 28). Therefore, the observed variation in hybridization signals demonstrated by the dot blot analysis accurately reflects variation in the levels of NFATL1 mRNA in different tissues. The mRNA samples present in the multi-tissue dot blot have been normalized such that the levels of eight different housekeeping genes are equal between samples. Thus, expression of NFATL1 mRNA, although ubiquitous, appears to be elevated relative to the level of expression of housekeeping genes in tissues that are metabolically active or proliferative, which include fetal tissues (particularly fetal kidney and lung), glandular tissues (e.g., pituitary gland), or tissues such as placenta, testis, and thymus (Table IGo).



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 1. Tissue distribution of NFATL1 RNA and protein expression. a, A human mRNA dot blot was hybridized with a radiolabeled human NF-ATL1 cDNA probe. b, NFATL1 protein expression in adult murine tissue extracts was measured by Western blotting using a rabbit anti-NFATL1 antiserum.

 

View this table:
[in this window]
[in a new window]
  		Table I. Quantitation of NFATL1 mRNA expression

 
To further characterize the tissue distribution of NFATL1 expression, Western analyses of tissue extracts were performed using anti-NFATL1 antisera. In contrast to the ubiquitous expression of NFATL1 mRNA, only extracts from thymus contained readily detectable amounts of NFATL1 protein (Fig. 1Gob). Extracts from testis, lung, and brain contained low but detectable levels of NF-ATL1 protein, and the remaining tissues tested exhibited no detectable NFATL1 protein. Additional analysis of tissue extracts demonstrate the presence of detectable NFATL1 protein in pituitary, fetal lung, and fetal kidney (data not shown), in agreement with the increased levels of NFATL1 mRNA in these tissues (Table IGo). Although the observed differences between NFATL1 mRNA and protein expression may reflect limits in the sensitivity of detecting NFATL1 protein, the similar level of NFATL1 mRNA in tissues that exhibit clearly different levels of NFATL1 protein (for example, compare thymus and testis) suggests that this is not the case.

Inducible, cyclosporin-sensitive expression of NFATL1 in primary T cells

The high level of NFATL1 expression in the thymus suggests that NFATL1 may play a role in regulating TCR-dependent programs of thymocyte proliferation and differentiation. Therefore, the absence of detectable NFATL1 protein in peripheral lymphoid tissues likely reflects the absence of active receptor-dependent signaling in these cells. To determine whether NFATL1 is induced in mature peripheral T lymphocytes in response to TCR-dependent activation, NFATL1 expression in quiescent and activated splenocytes was examined. As observed in Western blots of whole tissue extracts, NFATL1 protein is not detectable in unstimulated primary splenocytes. However, NFATL1 protein is markedly induced upon activation of unfractionated splenocytes (Fig. 2Goa). Incubation of cells with the T cell mitogen Con A or cross-linking the TCR with immobilized anti-CD3 Ab resulted in the induction of NFATL1 protein. In addition, the phorbol ester PMA and the calcium ionophore ionomycin acted synergistically to strongly induce NFATL1. These results demonstrate that NFATL1 protein is inducibly expressed in T lymphocytes in response to receptor-mediated mitogenic signals, and that this induction is mediated by at least two distinct intracellular signaling pathways defined by a calcium ionophore and the phorbol ester PMA.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 2. Inducible expression of NFATL1 in primary murine T lymphocytes. a, Murine splenocytes were stimulated as indicated for 24 h (I, 1 µM ionomycin; P, 10 ng/ml PMA). NFATL1 expression was measured by Western analysis of whole cell extracts using a rabbit anti-NFATL1 antiserum. b, Unfractionated splenocytes were stimulated with I + P for the indicated time periods, and whole cell extracts were subject to Western analysis. c, A highly purified population of CD4+ splenic lymphocytes isolated by magnetic cell sorting was stimulated as indicated for 24 h. NFATL1 protein in whole cell extracts was measured by Western analysis. The flow cytometric profile demonstrating CD4 expression in the purified population as compared with the input splenocyte population is shown on the left. d, Purified CD4+ T lymphocytes cultured under polarizing conditions for 5 days were stimulated with ionomycin plus PMA for 24 h and whole cell extracts were subject to Western analysis of NFATL1 expression. Quantitation of IFN-{gamma} and IL-4 present in culture supernatants from the stimulated cells is shown on the left. All Western analyses are representative of at least three independent experiments.

 
To determine the kinetics of NFATL1 induction, splenocytes were stimulated for varying periods of time with ionomycin plus PMA. Western analysis demonstrated that NFATL1 protein is not detectable in quiescent splenocytes but is detectable 3.5 h after stimulation, and increases steadily over a subsequent 48-h period (Fig. 2Gob). Additional experiments have demonstrated NFATL1 protein induction as early as 2 h after stimulation (data not shown). These results indicate that NFATL1 is induced in the G1 phase of the lymphocyte cell cycle.

The TCR-dependent induction of NFATL1 protein expression was further investigated in primary CD4+ T lymphocytes. Murine splenocytes were fractionated by magnetic cell sorting into a highly purified population of CD4+ T lymphocytes. Similar to the results observed with unfractionated splenocytes, NFATL1 protein was not detectable in unstimulated CD4+ T cells, and both Con A and anti-TCR stimulation resulted in the induction of NFATL1 (Fig. 2Goc). To further investigate NFATL1 expression in CD4+ T lymphocytes, purified CD4+ T cells were cultured under conditions that induce the differentiation of distinct effector cell populations, as defined by cytokine production. Both the IFN-{gamma} producing Th1 population and the IL-4-producing Th2 populations generated over a 5-day culture period showed similar induction of NFATL1 upon restimulation with ionomycin plus PMA (Fig. 2God). Although these results indicate that NFATL1 is not differentially expressed in fully polarized Th1 and Th2 effector CD4+ T cell populations, preferential expression of NFATL1 in Th1 cell populations was observed at earlier time points (data not shown).

The induction of NFATL1 in primary splenocytes by the synergistic combination of a calcium ionophore and PMA suggests that the TCR-dependent induction of NFATL1 is mediated in part by a calcium-dependent signaling mechanism. Given the pivotal role of the CsA/FK506-sensitive, calcium/calmodulin-dependent phosphatase calcineurin in T lymphocyte activation (16, 39), a potential role for calcineurin in the induction of NFATL1 was investigated. Primary splenocytes were activated in the presence and absence of CsA. Induction of NFATL1 by not only ionomycin plus PMA, but also by Con A and by TCR cross-linking was nearly completely inhibited by CsA (Fig. 3Goa). In addition, NFATL1 induction was also inhibited by FK506, which acts to inhibit calcineurin though interaction with cellular proteins distinct from those targeted by CsA. The estimated concentration required for half maximal inhibition of NFATL1 expression by both of these inhibitors (Fig. 3Gob) was similar to that necessary for inhibition of T lymphocyte activation (16). These results indicate that the induction of NFATL1 in primary splenocytes is dependent upon the function of calcineurin.



View larger version (48K):
[in this window]
[in a new window]
  		FIGURE 3. Inhibition of NFATL1 expression by CsA. a, Splenocytes were stimulated as indicated in the presence or absence of CsA (50 nM) for 24 h and whole cell extracts were subject to Western analysis for NFATL1 expression. b, Splenocytes were stimulated with ionomycin plus PMA and varying concentrations of either CsA or FK506. NFATL1 expression was measured by Western analysis of whole cell extracts.

 
Inducible NFATL1-dependent transcription

To measure the transcriptional function of the endogenous NF-ATL1 protein, a luciferase reporter construct was generated in which NFAT sites from the NFAT-GL3 reporter construct, which are present as a trimer, were substituted with a dimer of the hTonE site, resulting in the reporter construct designated hTonE-GL3 (Fig. 4Goa). The hTonE site has been previously demonstrated to represent a specific binding site for TonEBP and has been used in the context of reporter constructs to monitor the induction of TonEBP expression in response to hypertonic stimuli (25, 27). These reporter constructs use the minimal promoter of the human IL-2 gene (33). To determine the extent to which this reporter construct detected the activity of endogenous NFATL1, Jurkat cells were transiently transfected with either the NFAT-GL3 or the hTonE-GL3 reporter construct and stimulated with ionomycin, PMA, or raffinose. The NFAT-GL3 reporter vector exhibited a 752- ± 122-fold induction (n = 6) upon stimulation with ionomycin plus PMA, whereas the hTonE-GL3 reporter vector was induced 106- ± 45-fold (n = 6) (Fig. 4Gob). The hTonE reporter was not activated upon stimulation with either ionomycin or PMA alone, indicating that activation of NFATL1-dependent transcription requires the synergistic action of distinct signaling pathways. This is consistent with the observation that induction of NFATL1 protein in primary T cells also required stimulation by both ionomycin plus PMA. Culture of transfected cells under hyperosmotic conditions resulted in no detectable increase in NFAT-GL3 reporter gene expression, but led to a 32- ± 15-fold (n = 6) induction of the hTonE-GL3 reporter gene (Fig. 4Gob). To determine whether NFATL1-dependent transcription in Jurkat cells could be induced by cross-linking the TCR, cells were stimulated with immobilized (plate-bound) anti-CD3 Ab. TCR-dependent stimulation of Jurkat cells resulted in the induction of NFATL1-dependent transcription similar in magnitude to that resulting from stimulation with ionomycin plus PMA (Fig. 4Goc).



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 4. Inducible NFATL1-dependent transcription. a, Reporter constructs used to compare NFAT- vs NFATL1-dependent transcription, shown schematically, contain either a trimerized NFAT site derived from the distal human IL-2 promoter or a dimerized hTonE site. Comparison of the sequence of the inserted duplex oligonucleotide is shown with the NFAT or TonEBP binding site underlined. b, Jurkat TAg cells were transfected with 3 µg of the NFAT-GL3 or hTonE-GL3 reporter constructs and 24 h later were stimulated as indicated (I, 1 µM ionomycin; P, 10 ng/ml PMA; H, 200 mM raffinose) for an additional 16 h. The data shown are representative of at least four independent experiments. c, Jurkat E6 cells were transfected with the NFAT-GL3 or hTonE-GL3 reporter constructs. The cells were stimulated as indicated 24 h after transfection and cell extracts were generated 16–24 h later. Anti-CD3 was immobilized by preincubating six-well tissue culture plates overnight at 4°C with 6 µg anti-CD3. The data shown is representative of three independent experiments.

 
Regulation of NFATL1-dependent transcription by calcineurin

To determine whether the induction of NFATL1-dependent transcription involves a calcineurin-dependent mechanism of regulation, Jurkat cells transfected with the hTonE-GL3 reporter construct were stimulated with either ionomycin plus PMA or with raffinose in the presence and absence of CsA. NFATL1-dependent transcription induced by ionomycin plus PMA was inhibited in a dose-dependent manner (Fig. 5Goa), consistent with the CsA-mediated inhibition of NFATL1 protein expression induced by either ionomycin plus PMA or by TCR cross-linking in primary murine splenocytes (Fig. 3Go). In contrast, NFATL1-dependent transcription induced by raffinose was not inhibited by concentrations of CsA that completely eliminated the response induced by ionomycin plus PMA (Fig. 5Goa). Similar results were obtained using FK506 (data not shown). To determine whether the observed induction and inhibition of NFATL1-dependent transcription in Jurkat cells reflected changes in NFATL1 expression, NFATL1 protein expression was measured by Western analysis (Fig. 5Gob). These results also demonstrate that although the induction of NFATL1 by ionomycin plus PMA is inhibited by CsA, the induction of NF-ATL1 expression by a hyperosmotic stimulus is not inhibited. These results indicate that NFATL1 can be induced by mechanisms that are both sensitive as well as resistant to inhibition by CsA and FK506.



View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 5. NFATL1-dependent transcription is regulated by calcineurin. a, Jurkat TAg cells were transfected with the hTonE-GL3 reporter construct and 24 h later the cells were stimulated with either ionomycin plus PMA or were subject to a hypertonic stimulus (I, 1 µM ionomycin; P, 10 ng/ml PMA; H, 200 mM raffinose). The cells were subsequently cultured for 16 h with the indicated concentrations of CsA. b, Jurkat TAg cells were stimulated as indicated for 16 h and NFATL1 expression was measured by Western analysis of whole cell extracts. c, Jurkat TAg cells transfected with either the NFAT-GL3 or the hTonE-GL3 reporter construct were cotransfected with a constitutively active calcineurin expression vector (3 µg) or with the same amount of vector DNA (control).

 
To directly demonstrate a role for calcineurin in regulating the function of NFATL1 in response to ionomycin plus PMA, a constitutively active form of calcineurin A was used in reporter gene studies. As expected (16), cotransfection of the constitutively active calcineurin construct rendered activation of transcription through the NFAT-GL3 reporter independent of the requirement for a calcium signal. Transcription mediated by the hTonE-GL3 reporter also was also rendered calcium independent upon cotransfection with the constitutively active calcineurin construct (Fig. 5Goc). Moreover, the hTonE-GL3 reporter exhibited a marked superinduction of the signal induced by ionomycin plus PMA as a result of cotransfection with the constitutively active calcineurin construct. This superinduction was not observed with the NFAT-GL3 reporter. These results provide direct evidence to support the conclusion that the inhibition of NFATL1-dependent transcription by CsA and FK506 results from the inhibition of calcineurin, and thus further indicate that a calcineurin-dependent signaling mechanism is involved in the induction of NFATL1.

NFATc proteins play no role in the induction of NFATL1 activity

The calcineurin-dependent induction of the hTonE-GL3 reporter and the requirement for both a calcium signal (ionomycin) and a PMA-dependent signal suggests that an NFATc-dependent pathway may be involved in the observed induction of hTonE-GL3 reporter activity. Although this may occur indirectly through the NFATc-dependent induction of NFATL1, the possibility that NFATc-containing DNA binding complexes bind directly to the hTonE site to activate the hTonE-GL3 reporter has not been completely excluded. This point is particularly relevant given the similarity between the NFAT and the hTonE DNA binding sites. Thus, the potential role of NFATc in the observed induction of the hTonE-GL3 reporter construct was determined by cotransfection of full-length expression vectors encoding NFATc1 or NFATL1. Overexpression of NFATc1 resulted in the calcium-independent activation of the NFAT-GL3 reporter upon PMA stimulation as expected (37), but resulted in no activation of the hTonE-GL3 reporter (Fig. 6Goa). Similarly, NFATL1 overexpression markedly activated the hTonE-GL3 reporter, but did not activate the NF-AT-GL3 reporter. Interestingly, transfection of greater amounts of the NFATL1 expression plasmid (3 µg) resulted in a 55 ± 18% reduction (n = 3) of the NFAT-GL3 reporter, suggesting a possible negative regulatory role for NFATL1 in the regulation of NFAT-dependent transcription (data not shown). These results indicate that the activity of the hTonE-GL3 reporter vector specifically reflects the activity of endogenous NFATL1, and further indicate that NFATc1 is neither directly nor indirectly involved in the induction of NFATL1-dependent transcription. The induction of the hTonE-GL3 reporter but not the NFAT-GL3 reporter by a hypertonic stimulus (Fig. 4Gob) further demonstrates the specificity of the hTonE-GL3 reporter.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 6. NFATc does not regulate the induction of NFATL1. a, Jurkat TAg cells were cotransfected with the NFAT-GL3 or hTonE-GL3 reporter constructs and with either an NFATc1 expression construct (pSH102, 1 µg), an NFATL1 expression construct (pNFATL1-HA, 1 µg), or with vector DNA (control). b, Jurkat TAg cells were cotransfected with the NFAT-GL3 or hTonE-GL3 reporter constructs and with either a dominant negative NFATc1 expression construct (3 µg), a dominant negative NFATL1 expression construct (pJT501, 3 µg), or with vector DNA (control). The data shown are representative of at least three independent experiments.

 
To further investigate a potential role for NFATc proteins in the induction of the hTonE-GL3 reporter, and to further evaluate the specificity of the hTonE-GL3 reporter vector in reading out the induction and activation of endogenous NFATL1, expression constructs encoding dominant negative forms of NFATc1 (37) and NFATL1 (27) were cotransfected with the NFAT-GL3 and hTonE-GL3 reporter constructs (Fig. 6Gob). Expression of the dominant negative NFATc1 protein (NFATc1-DN) resulted in 84 ± 5% inhibition (n = 3) of the NFAT-GL3 reporter construct, similar to previously reported results (37), but had minimal effect (10 ± 5% inhibition, n = 3) on the hTonE-GL3 reporter (Fig. 6Gob). Conversely, expression of the dominant negative NFATL1 protein (NFATL1-DN) resulted in 79 ± 5% (n = 3) inhibition of the hTonE-GL3 reporter and an augmentation (172 ± 50%, n = 3) of the NFAT-GL3 reporter. These results, using both the overexpression as well as the dominant inhibition of NFATc and NF-ATL1 proteins, indicate that the activity of the hTonE-GL3 reporter specifically reflects the function of NFATL1 in Jurkat cells. Given that the NFATc1-DN is capable of inhibiting NFATc-dependent transcription that is mediated by both NFATc1 and NFATc2 (37, 40), the lack of inhibition of the hTonE-GL3 reporter by the NFATc1-DN construct further suggests that NF-ATc proteins do not play a significant role in the induction of NFATL1 activity. Furthermore, the enhancement of the NFAT-GL3 reporter activity resulting from expression of the NFATL1-DN, in combination with the inhibition seen upon overexpression of full-length NFATL1 (data not shown), suggests that NFATL1 may play an inhibitory role in the regulation of NFATc-dependent transcriptional responses. Together these results define a calcineurin-dependent pathway leading to the induction of NFATL1 protein that is independent of the function of NFATc proteins.

The hyperosmotic response gene AR is not induced upon T cell activation

Previous studies have identified hyperosmotic response genes such as the sodium/myo-inositol cotransporter (SMIT1), the betaine/{gamma}-aminobutyric acid transporter (BGT1), and AR as putative NFATL1 target genes (see Discussion). To determine whether the observed induction of NFATL1 occurring upon T lymphocyte activation correlates with the induction of known hyperosmotic response genes, the level of the well characterized hyperosmotic response gene AR (30) was determined by Northern analysis in cells stimulated with either a hyperosmotic stimulus or a TCR-dependent stimulus (Fig. 7Go). Primary murine T lymphocytes were stimulated for 48 h with Con A plus IL-2. The cells were subsequently stimulated for 16 h with a hyperosmotic stimulus (200 mM raffinose), a TCR-dependent stimulus (Con A), or a mitogenic pharmacologic stimulus (ionomycin plus PMA). In sharp contrast to the hyperosmotic stimulus, which resulted in a marked induction of AR mRNA, no induction was observed upon stimulation with either Con A or ionomycin plus PMA. Quantitation of the results shown demonstrates a 14-fold greater level of AR mRNA present in cells subject to a hyperosmotic stimulus as compared with cells stimulated with Con A or ionomycin plus PMA. These results indicate that NFATL1, which is induced upon T cell activation, does not mediate the induction of hyperosmotic response genes because these genes (as exemplified by the AR gene) do not appear to be inducibly expressed upon T cell activation.



View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 7. The hyperosmotic response gene encoding AR is induced by hyperosmotic stimulation, but not by receptor-dependent activation, of primary T lymphocytes. Murine splenocytes were stimulated for 48 h with Con A plus IL-2. The cells were subsequently washed and restimulated for 16 h with either 200 mM raffinose (lane 2), Con A plus IL-2 (lane 3), or ionomycin plus PMA (lane 4). Lane 1, Unstimulated splenocytes. RNA isolated from these samples (20 µg total cellular RNA per lane) was subject to Northern analysis with probes corresponding to AR and GAPDH. The blot shown in the upper panel was stripped and reprobed to generate the results shown in the middle panel. The ethidium bromide-stained gel is shown in the lower panel.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Receptor-dependent induction of NFATL1

NFATL1, originally designated TonEBP, was cloned as a result of its ability to bind to specific DNA binding sites present in tonicity responsive genes, which include genes encoding AR, SMIT, and BGT1 (25, 27). These genes are expressed at high levels in the mammalian renal medulla where they function to increase the levels of compatible organic osmolytes (e.g., myoinositol or betaine), which maintain intracellular isotonicity within a hyperosmotic environment (41). Cell lines (e.g., MDCK and HeLa) subject to hyperosmotic conditions induce NFATL1 protein expression, DNA binding activity, and NFATL1-dependent transcription (25, 27). However, the expression of NFATL1 mRNA in a wide variety of cell and tissue types, including those that are not normally subject to the magnitude or duration of hyperosmolar stress that exists within the mammalian renal medulla or that is effective in inducing NFATL1 in cell lines, suggests that NFATL1 functions to regulate transcription in response to stimuli other than hyperosmolar stress. The results presented here confirm this speculation by demonstrating that NFATL1 can be induced by receptor-dependent mechanisms. Specifically, cross-linking of the TCR results in the induction of the NFATL1 protein in primary T lymphocytes and in the Jurkat human T cell line, which correlates with the induction of NFATL1-dependent transcription. The relatively abundant level of NFATL1 protein detected specifically in thymus further indicates that the induction of NFATL1 occurs in vivo as a result of receptor-dependent activation of cellular proliferation and/or differentiation, given that TCR-dependent signaling mediates the process of positive and negative selection that takes place during T cell development in the thymus (42).

Signaling mechanisms regulating NFATL1 expression

Mammalian cells respond to hyperosmotic conditions in culture by initiating a pleiotropic response that includes induction of heat shock proteins, activation of the p38, stress-activated protein kinase/c-Jun N-terminal kinase (JNK), and extracellular signal-related kinase mitogen-activated protein kinase (MAPK) pathways, and transcription of tonicity-responsive osmoregulatory genes (41). Although the initial identification of NFATL1 as a TonEBP that is induced in response to hyperosmolar conditions provides an additional signaling intermediate potentially linking upstream events with defined transcriptional responses, the mechanisms resulting in the induction of NFATL1 by hyperosmotic stimuli remain unclear. For example, although the MAPK and MAPK kinase homologs HOG1 and PBS2 mediate adaptive responses to hypertonicity in yeast by inducing the transcription of hyperosmolar response genes (43), several studies indicate that MAPK pathways do not play a significant role in the induction of the mammalian tonicity response genes (44, 45). Thus, the mechanisms involved in the regulation of NFATL1 expression in response to hyperosmotic conditions remain poorly defined.

We have demonstrated that NFATL1 is not only induced by hyperosmotic stress, but is also induced in primary T cells upon TCR-dependent signaling mediated by stimulation with either the lectin Con A or Abs to the TCR. In addition, a calcium ionophore and PMA function synergistically to induce NFATL1 in both primary T cells and in the Jurkat T cell line. Induction of NFATL1 by these stimuli is inhibited by either CsA or FK506, in marked contrast to the induction by raffinose, which is not affected by these inhibitors. Inhibition by both CsA and FK506, which inhibit calcineurin through the formation of ternary complexes involving distinct cellular immunophilins (46, 47) combined with the calcium-independent induction of NFATL1-dependent transcription that is observed upon expression of a constitutively active form of calcineurin, clearly indicate that calcineurin represents a critical signaling intermediate that is necessary for the receptor-dependent induction of NFATL1 in T lymphocytes. Furthermore, the lack of induction of NFATL1-dependent transcription resulting from overexpression of NFATc1 and the absence of any inhibition by a dominant negative NFATc1 indicate that the requisite function of calcineurin does not involve the activation of NFATc-dependent transcription. Although NFAT proteins represent perhaps the best characterized direct targets of calcineurin (16, 17, 18), several additional signaling mechanisms have been shown to be regulated by calcineurin based on inhibition by CsA and/or FK506. These include signaling pathways involving NF-{kappa}B, NO, protein kinase A, stress-activated protein kinase/JNK, and p38 (48). In addition, the expression of a fairly wide spectrum of genes has been shown to be inhibited by CsA or FK506, and a role for NFAT proteins in the transcriptional regulation of many of these genes, particularly genes encoding transcription factors, has not been demonstrated (48). Thus NFATL1 represents a member of a larger group of proteins that is regulated by calcineurin through still poorly defined mechanisms that do not involve the calcineurin-mediated activation of NFATc proteins.

The lack of inhibition by CsA of hypertonicity-induced NFATL1 expression is consistent with one previous study that demonstrated that CsA had no affect on the hypertonicity-dependent induction of BGT1 transporter activity in MDCK cells and that CsA and FK506 exhibited divergent effects on SMIT activity (49). The distinction between the calcineurin dependence of receptor-induced NFATL1 expression and the calcineurin independence of NFATL1 induced by hypertonicity suggests a sequential signaling pathway in which hypertonic stimulus leads to the activation of a signaling intermediate(s) that lie downstream of calcineurin. In addition, the requirement for a PMA-dependent signal acting in synergy with a calcium signal to induce NFATL1 in T lymphocytes further highlights the lack of overlap between signaling intermediates induced by PMA and those activated by a hyperosmotic stimulus, even though both of these stimuli activate common signaling pathways (44, 45). Alternatively, hyperosmotic stimulation may activate specific signaling intermediates that are either not activated or are activated to a significantly lesser degree by a receptor-dependent stimulus. Several studies have demonstrated that hyperosmotic stimulation activates MAPK signaling intermediates much more potently than do receptor-dependent stimuli (50). In addition, Jurkat cells stimulated by calcium ionophore plus PMA have been shown to induce MKK7 activity but little SEK1 (MKK4 or JNKK) activity, whereas a hypertonic stimulus strongly induced the activity of both of these enzymes (51). Thus, the lack of involvement of calcineurin in the induction of NFATL1 by a hyperosmotic stimulus, which contrasts to the calcineurin dependence of receptor-mediated NFATL1 induction, likely reflects the more potent and nonspecific activation of a broader spectrum of signaling intermediates that occurs upon hyperosmotic stress (52). Whether NFATL1 plays any role in mediating transcriptional responses to environmental stress stimuli other than osmotic stress remains an important question.

What is the function of NFATL1 in receptor-dependent cell activation?

Aniso-osmotic conditions of the magnitude and/or duration used in studies of hyperosmotic responses are normally not seen outside of the mammalian renal medulla. However, the osmotic regulation of mammalian cell volume represents a physiologic process, albeit poorly defined, that takes place in cells not subject to extremes of osmotic stress. For example, quiescent lymphocytes undergo significant (i.e., 2- to 3-fold) increase in cell volume as they enter and progress through the cell cycle, a process that is referred to as blastogenesis. Thus, one possible role of NFATL1 induced upon receptor-dependent cellular activation that is suggested by its role in regulating transcriptional responses to hyperosmotic conditions would be to regulate the transcription of genes involved in maintaining osmotic homeostasis in response to the increase in cell volume that occurs during lymphocyte activation. A hyperosmotic stimulus, particularly that used experimentally in cell culture, induces a rapid reduction of cell volume, which results in the concentration of intracellular macromolecules and rapid uptake of inorganic salts (41). Activation of signaling mechanisms in this context likely results from the nonspecific, ligand-independent receptor clustering that has been observed to occur upon hyperosmotic stimulation (52). Although little is known concerning osmotic homeostasis and the regulation of cell volume that takes place upon TCR-dependent activation of quiescent T lymphocytes, there is no evidence for a reduction in cell volume or rapid uptake of inorganic salts similar to that induced by extracellular hypertonicity, and the TCR-dependent induction of the known NFATL1 target genes that allow for the accumulation of compatible osmolyte transporters has not been demonstrated. Thus, alterations in the intracellular environment that occur upon hyperosmotic stress differ markedly from those resulting from TCR-mediated activation. Consistent with this, the results presented here clearly demonstrate that the signaling requirements for NFATL1 induction by hyperosmotic stress differ from those required for NFATL1 induction resulting from TCR cross-linking, with calcineurin being implicated as an important signaling intermediate mediating the TCR-dependent but not the hypertonicity-dependent induction of NFATL1. More importantly, although the well-characterized hyperosmotic response gene AR is induced in primary murine T lymphocytes subject to hyperosmotic conditions, it is not induced in T lymphocytes by the same receptor-dependent stimuli that clearly induce NFATL1 protein and transcriptional activity. This is particularly relevant in that a dominant negative form of NFATL1 has been demonstrated to inhibit AR gene expression (29). Thus, it seems likely that NFATL1 induced in response to specific receptor-dependent stimuli mediates as yet undefined transcriptional responses unrelated to osmotic homeostasis. Indeed, the use of specific transcription factors to mediate diverse biological responses represents a well recognized theme in the transcriptional regulation of gene expression, as perhaps best exemplified by transcription factors such as NF-{kappa}B. NF-{kappa}B plays an important role in regulating transcriptional responses to both physiological, receptor-dependent stimuli as well as stress-induced stimuli (53).

The observation that the calcium/calcineurin-dependent induction of NFATL1 occurs independently of the function of NFATc proteins reveals a new pathway linking calcium-dependent signaling events to a distinct transcriptional regulator. Although pre-existing calcium-regulated transcriptional regulators such as NF-{kappa}B, JNK, and NFATc might be differentially activated by differences in calcium amplitude and duration occurring shortly (i.e., minutes) after receptor-dependent activation (15, 54, 55), a transcriptional regulator such as NFATL1 that is itself induced in a calcium- and calcineurin-dependent manner represents a temporally distinct mechanism to translate differences in calcium amplitude and duration into differences in transcriptional responses. Thus, NFATL1-dependent transcriptional responses, which would be temporally delayed as compared with transcription induced by NF-{kappa}B, c-jun, or NFATc proteins, may be more reflective of the duration of a TCR-dependent stimulus. It is possible that a more prolonged TCR-dependent stimulus, which might result in the sustained activation of calcineurin as well as potentially other signaling intermediates, would result in higher levels of NFATL1 being expressed. The progressively increasing level of NFATL1 protein expressed in primary splenocytes stimulated with ionomycin plus PMA is perhaps reflective of the kinetics and magnitude of NFATL1 induction that might be observed with a TCR interaction of extended duration. In the thymus, induction of NFATL1 might thus reflect a high avidity TCR interaction, which would lead to cell death by negative selection, whereas in mature lymphocytes NFATLl induction may represent a means to distinguish low avidity and potentially autoreactive TCR signals from those signals induced by a high avidity Ag that would lead to greater NFATL1 induction. Clearly, further understanding of the integration of signaling events in T lymphocytes by NFATL1 will require functional studies designed to define the role played by NFATL1 in the process of both thymic development and T cell activation and differentiation.

The results presented here demonstrate a role for NFATL1 (TonEBP/NFAT5) as a novel transcription factor that is induced upon T cell activation through a TCR-dependent, calcineurin-regulated signaling mechanism. Although evidence exists for a role for NFATL1 in regulating transcriptional responses to hyperosmotic stimuli, the functional role played by NFATL1 in regulating receptor-dependent transcriptional responses in T cells or in other cells that express NFATL1 remains unknown. The broader role for NFATL1 as a receptor-induced transcription factor, combined with the lack of receptor-dependent induction of hyperosmotic response genes known to be targets of NFATL1, strongly suggests that NFATL1 plays a role in regulating transcriptional responses distinct from those induced by hypertonicity. This is analogous to the role played by NF-{kappa}B in regulating transcriptional responses to diverse environmental stimuli (56). Therefore, further understanding of both the upstream signaling pathways that regulate NF-ATL1 expression and function, as well as the genes targeted by NFATL1, will lead to further insight into mechanisms of cellular activation and differentiation not only in T lymphocytes, but in other cells that use NFATL1 as a means to translate environmental signals into specific transcriptional responses.

Acknowledgements

We thank Drs. S. Kyoon Woo and H. Moo Kwon for providing anti-TonEBP antisera.


   Footnotes
 
1 This work was supported by National Institutes of Health Grant GM59651 (to S.N.H.) and by the Rockefeller Brothers Fund through a Charles E. Culpeper Medical Scholar award (to S.N.H.). Back

2 Address correspondence and reprint requests to Dr. Steffan N. Ho, Department of Pathology, University of California at San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0644. Back

3 Abbreviations used in this paper: DBD, DNA binding domain; CsA, cyclosporin A; MAPK, mitogen-activated protein kinase; TonEBP, tonicity enhancer binding protein; EST, expressed sequence tag; AR, aldose reductase; SMIT, the sodium/myo-inositol cotransporter; BGT1, the betaine/{gamma}-aminobutyric acid transporter; JNK, c-Jun N-terminal kinase. Back

4 A consensus system of nomenclature for NFAT genes and proteins has not as yet been established. Synonyms are as follows: NFATc1, NFATc, NFAT2; NFATc2, NFATp, NFAT1; NFATc3, NFAT4, NFATx; NFATc4, NFAT3. Here these proteins are referred to as NFATc1 through NFATc4, as currently proposed by the Human Gene Nomenclature Committee. The designation NFATc is used here to refer to the NFATc1 through NFATc4 group. Back

5 Given the lack of consensus in NFAT nomenclature, we have elected to follow the published recommendations set forth by the Human Gene Nomenclature Committee (23 ) in using the designation NFATL1 (i.e., NFAT-like protein 1) to refer to this gene. We refer to the protein encoded by this gene as NFATL1. Back

Received for publication March 29, 2000. Accepted for publication August 1, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  2. Murphy, K. M.. 1998. T lymphocyte differentiation in the periphery. Curr. Opin. Immunol. 10:226.[Medline]
  3. Crabtree, G. R.. 1989. Contingent genetic regulatory events in T lymphocyte activation. Science 243:355.[Abstract/Free Full Text]
  4. Kaplan, M. H., Y. L. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382:174.[Medline]
  5. Kaplan, M. H., U. Schindler, S. T. Smiley, M. J. Grusby. 1996. Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 4:313.[Medline]
  6. Rao, A., C. Luo, P. G. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 15:707.[Medline]
  7. Yoshida, H., H. Nishina, H. Takimoto, L. E. Marengere, A. C. Wakeham, D. Bouchard, Y. Y. Kong, T. Ohteki, A. Shahinian, M. Bachmann, et al 1998. The transcription factor NFATc1 regulates lymphocyte proliferation and Th2 cytokine production. Immunity 8:115.[Medline]
  8. Ranger, A. M., M. R. Hodge, E. M. Gravallese, M. Oukka, L. Davidson, F. W. Alt, F. C. de la Brousse, T. Hoey, M. Grusby, L. H. Glimcher. 1998. Delayed lymphoid repopulation with defects in IL-4-driven responses produced by inactivation of NFATc. Immunity 8:125.[Medline]
  9. Xanthoudakis, S., J. P. Viola, K. T. Shaw, C. Luo, J. D. Wallace, P. T. Bozza, T. Curran, A. Rao. 1996. An enhanced immune response in mice lacking the transcription factor NFAT1. Science 272:892.[Abstract]
  10. Kiani, A., J. P. Viola, A. H. Lichtman, A. Rao. 1997. Down-regulation of IL-4 gene transcription and control of Th2 cell differentiation by a mechanism involving NFAT1. Immunity 7:849.[Medline]
  11. Heyer, J., B. Kneitz, K. Schuh, E. Jankevics, F. Siebelt, A. Schimpl, E. Serfling. 1997. Inefficient termination of antigen responses in NFATp-deficient mice. Immunobiology 198:162.[Medline]
  12. Schuh, K., B. Kneitz, J. Heyer, U. Bommhardt, E. Jankevics, F. Berberich-Siebelt, K. Pfeffer, H. K. Muller-Hermelink, A. Schimpl, E. Serfling. 1998. Retarded thymic involution and massive germinal center formation in NFATp-deficient mice. Eur. J. Immunol. 28:2456.[Medline]
  13. Miner, J. N., K. R. Yamamoto. 1991. Regulatory crosstalk at composite response elements. Trends Biochem. Sci. 16:423.[Medline]
  14. Shibasaki, F., E. R. Price, D. Milan, F. McKeon. 1996. Role of kinases and the phosphatase calcineurin in the nuclear shuttling of transcription factor NF-AT4. Nature 382:370.[Medline]
  15. Timmerman, L. A., N. A. Clipstone, S. N. Ho, J. P. Northrop, G. R. Crabtree. 1996. Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression. Nature 383:837.[Medline]
  16. Clipstone, N. A., G. R. Crabtree. 1992. Identification of calcineurin as a key signalling enzyme in T-lymphocyte activation. Nature 357:695.[Medline]
  17. Loh, C., K. T. Shaw, J. Carew, J. P. Viola, C. Luo, B. A. Perrino, A. Rao. 1996. Calcineurin binds the transcription factor NFAT1 and reversibly regulates its activity. J. Biol. Chem. 271:10884.[Abstract/Free Full Text]
  18. Shibasaki, F., E. Kondo, T. Akagi, F. McKeon. 1997. Suppression of signalling through transcription factor NF-AT by interactions between calcineurin and Bcl-2. Nature 386:728.[Medline]
  19. Beals, C. R., N. A. Clipstone, S. N. Ho, G. R. Crabtree. 1997. Nuclear localization of NF-ATc by a calcineurin-dependent, cyclosporin-sensitive intramolecular interaction. Genes. Dev. 11:824.[Abstract/Free Full Text]
  20. Chow, C. W., M. Rincon, J. Cavanagh, M. Dickens, R. J. Davis. 1997. Nuclear accumulation of NFAT4 opposed by the JNK signal transduction pathway. Science 278:1638.[Abstract/Free Full Text]
  21. Zhu, J., F. Shibasaki, R. Price, J. C. Guillemot, T. Yano, V. Dotsch, G. Wagner, P. Ferrara, F. McKeon. 1998. Intramolecular masking of nuclear import signal on NF-AT4 by casein kinase I and MEKK1. Cell 93:851.[Medline]
  22. Porter, C. M., M. A. Havens, N. A. Clipstone. 2000. Identification of amino acid residues and protein kinases involved in the regulation of NFATc subcellular localization. J. Biol. Chem. 275:3543.[Abstract/Free Full Text]
  23. White, J. A., P. J. McAlpine, S. Antonarakis, H. Cann, J. T. Eppig, K. Frazer, J. Frezal, D. Lancet, J. Nahmias, P. Pearson, et al 1997. Guidelines for human gene nomenclature (1997). HUGO Nomenclature Committee. Genomics 45:468.[Medline]
  24. Claudio, J. O., C. C. Liew, A. A. Dempsey, E. Cukerman, A. K. Stewart, E. Na, H. L. Atkins, N. N. Iscove, R. G. Hawley. 1998. Identification of sequence-tagged transcripts differentially expressed within the human hematopoietic hierarchy. Genomics 50:44.[Medline]
  25. Miyakawa, H., S. K. Woo, C. P. Chen, S. C. Dahl, J. S. Handler, H. M. Kwon. 1998. Cis- and trans-acting factors regulating transcription of the BGT1 gene in response to hypertonicity. Am. J. Physiol. 274:F753.[Abstract/Free Full Text]
  26. Rim, J. S., M. G. Atta, S. C. Dahl, G. T. Berry, J. S. Handler, H. M. Kwon. 1998. Transcription of the sodium/myo-inositol cotransporter gene is regulated by multiple tonicity-responsive enhancers spread over 50 kilobase pairs in the 5'-flanking region. J. Biol. Chem. 273:20615.[Abstract/Free Full Text]
  27. Miyakawa, H., S. K. Woo, S. C. Dahl, J. S. Handler, H. M. Kwon. 1999. Tonicity-responsive enhancer binding protein, a rel-like protein that stimulates transcription in response to hypertonicity. Proc. Natl. Acad. Sci. USA 96:2538.[Abstract/Free Full Text]
  28. Lopez-Rodriguez, C., J. Aramburu, A. S. Rakeman, A. Rao. 1999. NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. Proc. Natl. Acad. Sci. USA 96:7214.[Abstract/Free Full Text]
  29. Pan, S., R. Tsuruta, E. S. Masuda, R. Imamura, F. Bazan, K. Arai, N. Arai, S. Miyatake. 2000. NFATz: a novel rel similarity domain containing protein. Biochem. Biophys. Res. Commun. 272:765.[Medline]
  30. Ko, B. C., C. W. Turck, K. W. Lee, Y. Yang, S. S. Chung. 2000. Purification, identification, and characterization of an osmotic response element binding protein. Biochem. Biophys. Res. Commun. 270:52.[Medline]
  31. Nagase, T., K. Ishikawa, M. Suyama, R. Kikuno, M. Hirosawa, N. Miyajima, A. Tanaka, H. Kotani, N. Nomura, O. Ohara. 1998. Prediction of the coding sequences of unidentified human genes. XII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 5:355.[Abstract]
  32. Lopez-Rodriguez, C., J. Aramburu, A. S. Rakeman, N. G. Copeland, D. J. Gilbert, S. Thomas, C. Disteche, N. A. Jenkins, A. Rao. 1999. NFAT5: the NFAT family of transcription factors expands in a new direction. Cold Spring Harb. Symp. Quant. Biol. 64:517.[Medline]
  33. Durand, D. B., J. P. Shaw, M. R. Bush, R. E. Replogle, R. Belagaje, G. R. Crabtree. 1988. Characterization of antigen receptor response elements within the interleukin-2 enhancer. Mol. Cell. Biol. 8:1715.[Abstract/Free Full Text]
  34. Lennon, G., C. Auffray, M. Polymeropoulos, M. B. Soares. 1996. The I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their expression. Genomics 33:151.[Medline]
  35. Takebe, Y., M. Seiki, J. Fujisawa, P. Hoy, K. Yokota, K. Arai, M. Yoshida, N. Arai. 1988. SR {alpha} promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell. Biol. 8:466.[Abstract/Free Full Text]
  36. Woodrow, M., N. A. Clipstone, D. Cantrell. 1993. p21ras and calcineurin synergize to regulate the nuclear factor of activated T cells. J. Exp. Med. 178:1517.[Abstract/Free Full Text]
  37. Northrop, J. P., S. N. Ho, L. Chen, D. J. Thomas, L. A. Timmerman, G. P. Nolan, A. Admon, G. R. Crabtree. 1994. NF-AT components define a family of transcription factors targeted in T-cell activation. Nature 369:497.[Medline]
  38. Northrop, J. P., K. S. Ullman, G. R. Crabtree. 1993. Characterization of the nuclear and cytoplasmic components of the lymphoid-specific nuclear factor of activated T cells (NF-AT) complex. J. Biol. Chem. 268:2917.[Abstract/Free Full Text]
  39. Liu, J., Jr J. D. Farmer, W. S. Lane, J. Friedman, I. Weissman, S. L. Schreiber. 1991. Calcineurin is a common target of cyclophilin-cyclosporin A and FKBP-FK506 complexes. Cell 66:807.[Medline]
  40. Ho, S. N., D. J. Thomas, L. A. Timmerman, X. Li, U. Francke, G. R. Crabtree. 1995. NFATc3, a lymphoid-specific NFATc family member that is calcium-regulated and exhibits distinct DNA binding specificity. J. Biol. Chem. 270:19898.[Abstract/Free Full Text]
  41. Burg, M. B., E. D. Kwon, D. Kultz. 1997. Regulation of gene expression by hypertonicity. Annu. Rev. Physiol. 59:437.[Medline]
  42. Amsen, D., A. M. Kruisbeek. 1998. Thymocyte selection: not by TCR alone. Immunol. Rev. 165:209.[Medline]
  43. Burg, M. B., E. D. Kwon, D. Kultz. 1996. Osmotic regulation of gene expression. FASEB J. 10:1598.[Abstract]
  44. Kultz, D., A. Garcia-Perez, J. D. Ferraris, M. B. Burg. 1997. Distinct regulation of osmoprotective genes in yeast and mammals: aldose reductase osmotic response element is induced independent of p38 and stress-activated protein kinase/Jun N-terminal kinase in rabbit kidney cells. J. Biol. Chem. 272:13165.[Abstract/Free Full Text]
  45. Kwon, H. M., T. Itoh, J. S. Rim, J. S. Handler. 1995. The MAP kinase cascade is not essential for transcriptional stimulation of osmolyte transporter genes. Biochem. Biophys. Res. Commun. 213:975.[Medline]
  46. Schreiber, S. L., G. R. Crabtree. 1992. The mechanism of action of cyclosporin A and FK506. Immunol. Today 13:136.[Medline]
  47. Schreiber, S. L.. 1991. Chemistry and biology of the immunophilins and their immunosuppressive ligands. Science 251:283.[Abstract/Free Full Text]
  48. Ruhlmann, A., A. Nordheim. 1997. Effects of the immunosuppressive drugs CsA and FK506 on intracellular signalling and gene regulation. Immunobiology 198:192.[Medline]
  49. Atta, M. G., S. C. Dahl, H. M. Kwon, J. S. Handler. 1999. Tyrosine kinase inhibitors and immunosuppressants perturb the myo-inositol but not the betaine cotransporter in isotonic and hypertonic MDCK cells. Kidney. Int. 55:956.[Medline]
  50. Matsuda, S., H. Kawasaki, T. Moriguchi, Y. Gotoh, E. Nishida. 1995. Activation of protein kinase cascades by osmotic shock. J. Biol. Chem. 270:12781.[Abstract/Free Full Text]
  51. Matsuda, S., T. Moriguchi, S. Koyasu, E. Nishida. 1998. T lymphocyte activation signals for interleukin-2 production involve activation of MKK6–p38 and MKK7-SAPK/JNK signaling pathways sensitive to cyclosporin A. J. Biol. Chem. 273:12378.[Abstract/Free Full Text]
  52. Rosette, C., M. Karin. 1996. Ultraviolet light and osmotic stress: activation of the JNK cascade through multiple growth factor and cytokine receptors. Science 274:1194.[Abstract/Free Full Text]
  53. Pahl, H. L.. 1999. Activators and target genes of Rel/NF-kB transcription factors. Oncogene 18:6853.[Medline]
  54. Dolmetsch, R. E., R. S. Lewis, C. C. Goodnow, J. I. Healy. 1997. Differential activation of transcription factors induced by Ca2+ response amplitude and dura