|
|
||||||||

*
Departments of Pathology and Cellular and Molecular Medicine, University of California at San Diego, La Jolla, CA 92093; and
Holland Laboratory, American Red Cross, Rockville, MD 20855
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Combinatorial regulation of transcription involves multiprotein
complexes that bind cooperatively to specific target DNA sites. Such
composite transcription factor complexes permit the convergence of
disparate signaling pathways onto a defined DNA binding site, thereby
conferring greater regulatory control over target gene expression in
response to environmental signals (13). Composite DNA
binding complexes formed by transcription factors of the NFATc family
together with AP-1 proteins integrate calcium-dependent and
ras-mediated signaling pathways to regulate the transcription of target
genes that encode immunoregulatory proteins such as IL-2, IL-4,
IL-3/GM-CSF, TNF-
, CD40 ligand, and Fas ligand (6). The
NFAT family of transcription factors consists of four different
proteins, NFATc1 through NFATc4, which are related both structurally
and functionally (6). In addition to the high degree of
similarity within the DNA binding domain
(DBD),4 there is also
an amino-terminal region of similarity that contains a serine-rich
motif as well as serine/proline repeat motifs. Functionally, NFAT
proteins undergo rapid and dynamically regulated nuclear import
(14, 15), which is regulated by the equilibrium between
the activities of the calcium/calmodulin-dependent phosphatase
calcineurin, which promotes nuclear localization (16, 17, 18),
and several protein kinases that have been demonstrated to promote
cytosolic localization (19, 20, 21, 22). The conserved
amino-terminal domain represents the target of the phosphatase/kinase
pathways that regulate NFAT subcellular localization.
Recent studies have identified a novel protein that exhibits similarity to the NFAT DBD. This protein, which we refer to as NFATL15 (23, 24), was originally identified through a yeast one-hybrid cloning approach using a hypertonicity response element found in several tonicity responsive genes as a target DNA binding site (25, 26). This screen resulted in the identification of the cDNA encoding tonicity enhancer binding protein (TonEBP) (27). The same cDNA was also identified based on sequence similarity to the NFAT DBD and was designated NFAT5 (28) and NFATz (29). NFATL1 was also recently purified as the osmotic response element binding protein based on its ability to bind to a tonicity response element from the human aldose reductase (AR) gene (30). Although NFATL1 contains a region of similarity to the NFAT DBD, it lacks the amino-terminal NFAT homology region that mediates regulated nuclear translocation. Functional studies demonstrated that NFATL1 DNA binding activity and protein is induced upon hyperosmotic stimulus (27), and that the protein is present predominantly within the nucleus (27, 28). Interestingly, although residues of the NFATL1 DBD that mediate base-specific DNA contacts are identical with those of NFATc1 through NFATc4, those residues that correspond to AP-1 contact residues are not conserved. Consistent with this, the NFATL1 DBD is incapable of interacting with AP-1 in vitro (28). Thus, NFATL1 represents a functionally and structurally unique member of the NFAT family of transcription factors.
Our own efforts to further define transcriptional regulatory mechanisms involved in T lymphocyte differentiation also resulted in the identification of NFATL1 (24). The goal of this study was to further define the potential role of NFATL1 in the regulation of T lymphocyte function. Here we show that the NFATL1 protein is expressed constitutively in the thymus but is undetectable in mature lymphocytes. However, activation of either precursor or differentiated CD4+ T cells by cross-linking the TCR results in the induced expression of NFATL1. This induction, as well as inducible NFATL1-mediated transcription, is dependent upon the function of calcineurin but does not involve NFATc proteins. In contrast, the induction of NFATL1 by hyperosmotic stimulation occurs independently of calcineurin. The induction of NFATL1 by diverse intracellular signaling pathways, including both receptor-dependent as well as stress-induced pathways, suggests that NFATL1 functions to translate diverse extracellular stimuli into functionally appropriate transcriptional responses.
| Materials and Methods |
|---|
|
|
|---|
cDNA sequences exhibiting similarity to the consensus NFAT DBD were identified through searches of the expressed sequence tag (EST) database using the BLAST search algorithm. An EST cDNA clone (pMY2357) containing a region of similarity to the less well conserved carboxyl-terminal portion of the NFAT DBD was identified in a KG1a cDNA library (24). Nested primers derived from the 5' portion of the pMY2357 cDNA sequence were used in conjunction with vector-specific primers to amplify by PCR-related cDNA sequences from the KG1a cDNA library. A PCR amplification product containing an extended region of similarity to the NFAT DBD was used as a probe to screen a Jurkat cDNA library (Clontech Laboratories, Palo Alto, CA). Two cDNA clones (pJTh101 and pJTh103) were identified that differed by a splice variation, which resulted in predicted open reading frames encoding distinct amino-terminal sequences. Given that the similarity of the protein encoded by these cDNA clones to NFATc1 through NFATc4 was restricted to the DBD, and that the similarity within the DBD was significantly less than that observed upon comparison of the DBDs of NFATc1 through NFATc4, the gene was designated NFAT-like protein 1 or NFATL1 (23). The sequence of the NFATL1 cDNA corresponds to those previously reported as KIAA0827 (31), TonEBP (27), and NFAT5 (28) (GenBank accession numbers AB020634, AF089824, and AF134870, respectively). In keeping with already established designations, the cDNA predicted to encode a 1454-aa protein (27, 28, 32) represents the "a" isoform and that encoding a 1483-aa protein represents the "b" isoform (32). The 1531-aa protein predicted by the pJTh103 cDNA clone and by the KIAA0827 cDNA clone (31) represents usage of an in-frame start methionine located upstream of that used in isoform "b". Numbering of NFATL1 amino acids used in this study is based on the predicted 1531-aa protein.
DNA constructs and plasmids
The NFAT-GL3 reporter construct was generated by subcloning a
HinDIII-ClaI fragment derived from the
NFAT-SEAP plasmid (16) into the vector fragment from the
pGL3-promoter construct (Promega, Madison, WI) generated by digestion
with HinDIII and SmaI. The regulatory region
consists of the human IL-2 minimal promoter extending from nucleotide
-326 to +45 (numbered relative to the transcription start site) in
which the region from -290 to -77 has been deleted and replaced with
a trimerized NFAT binding site (-280 to -250) flanked by
XhoI sites (33). To construct the hTonE-GL3
reporter construct, a dimer of the hTonE site (25) was
generated by annealing and ligating the following oligonucleotides into
a pBSIIKS+ based vector, pSH-BS2(+), which contains XhoI
sites flanking an
AvrII-NheI-SpeI-XbaI
polylinker: 5'-ctagcttggtggaaaattaccgctggt and 5'-ctag
accagcggtaattttccaccaag (TonE site underlined). The binding
site dimer was removed by XhoI digestion and subcloned into
the NFAT-GL3 vector fragment generated by digestion with
XhoI, which removes the NFAT sites. A full-length cDNA
encompassing the complete NFATL1 open reading frame was assembled from
cDNA clones pJTh101 and pJTh103, as well as the EST cDNA clone 550442
(GenBank accession number AA100356) obtained through the I.M.A.G.E.
Consortium (34). An NFATL1 expression vector, designated
pNFATL1-hemagglutinin (HA), was generated by subcloning the full-length
NFATL1 cDNA (predicted open reading frame of 1531 aa) in-frame with a
carboxyl-terminal influenza HA epitope tag into a eukaryotic expression
vector that uses the SR
promoter (35). The dominant
negative NFATL1 construct (pJT501) consists of the NFATL1 DBD (aa
268543) subcloned in-frame with a carboxyl-terminal HA tag in the
SR
expression vector. All constructs containing previously
unsequenced cDNA fragments or DNA derived from PCR amplification were
subject to sequencing of both sense and anti-sense DNA strands. DNA
sequencing was performed through the University of California San Diego
Center for AIDS Research Molecular Biology Core facility. Eukaryotic
expression plasmids encoding a constitutively active form of
calcineurin (36), wild-type NFATc1 (pSH102; Ref.
37), and a dominant negative NFATc1 (37) have
been described.
Abs and Western analysis
Recombinant protein corresponding to the NFATL1 DBD (aa 268543) was expressed in Escherichia coli as a polyhistidine fusion protein, purified by nickel-agarose affinity chromatography, and used as an immunogen to generate a polyclonal rabbit antiserum (Josman Laboratories, Napa, CA). The antiserum was further purified by Ag affinity chromatography. A separate rabbit antiserum (27) raised against the amino-terminal portion of the protein (aa 76543) was provided by Dr. H. M. Kwon (Johns Hopkins University, Baltimore, MD). The two antisera functioned similarly in identifying NFATL1 by Western analysis. Whole-cell extracts used in Western analyses were generated by incubating cells on ice for 30 min in RIPA buffer (50 mM Tris-HCl, pH 8.0; 150 mM NaCl; 1% Nonidet P-40; 0.5% sodium deoxycholate; 0.1% SDS; 2 mM DTT) supplemented with protease inhibitors (1 mM PMSF, 10 µM leupeptin, 5 µM pepstatin, 2 mM EDTA). Insoluble material was pelleted by centrifugation at 15,000 x g for 15 min. Tissue extracts were prepared by Dounce homogenization in a Tris lysis buffer (50 mM Tris-HCl, pH 8.0; 400 mM NaCl; 1% Nonidet P-40; 5 mM DTT) supplemented with protease inhibitors (1 mM PMSF, 10 µM leupeptin, 5 µM pepstatin A, 5 mM EDTA). Insoluble material was pelleted by centrifugation. Equal amounts of protein, as determined by Bradford dye-binding analysis (Bio-Rad, Richmond, CA), were subject to SDS-PAGE and transferred to polyvinylidene difluo-ride membranes. The membranes were probed with the anti-NFATL1 antisera (1:10001:4000 dilution) in buffer containing PBS supplemented with 0.05% Tween 20, 250 mM sodium chloride, and 0.5% nonfat dry milk. Primary Ab binding was visualized using a secondary Ab consisting of an HRP-conjugated goat anti-rabbit Ig antiserum (1:4000; Fisher Scientific, Pittsburgh, PA), followed by enhanced chemiluminescent detection (Amersham, Arlington Heights, IL).
Cell culture and stimulation
Single cell suspensions obtained from spleens of C57BL6 mice
were purified by density gradient centrifugation (Lympholyte M;
Cedarlane Laboratories, Hornby, Ontario, Canada) after RBC lysis in
buffered ammonium chloride. CD4+ T lymphocytes
were isolated from splenocytes by positive magnetic cell sorting
(Miltenyi Biotech, Auburn, CA). Purification was monitored by flow
cytometric analysis using FITC-labeled anti-mouse CD4 (PharMingen,
San Diego, CA). Cells were cultured in complete media (RPMI 1640
supplemented with 10% heat-inactivated FBS, 2 mM
L-glutamine, 10 mM HEPES, 1000 U penicillin, 1000 µg/ml
streptomycin, and 50 µM 2-ME). Purified splenocyte and
CD4+ T cell populations were activated with 1
µM ionomycin and 10 ng/ml PMA or 2 µg/ml Con A. For TCR-dependent
activation, unfractionated splenocytes were cultured with 1 µg/ml
anti-CD3 (PharMingen). CD4+ T cells were
stimulated with plate-bound anti-CD3 by preincubating six-well
tissue culture plates overnight at 4°C with 6 µg anti-CD3.
Anti-CD28 (5 µg/ml) was added to CD4+ T cell
cultures as a means of costimulation. Cyclosporin A (CsA; Calbiochem,
La Jolla, CA) was added simultaneously with activating agents as
indicated. Unless otherwise noted, cytokine, Ab, and ELISA reagents
were obtained from PharMingen. Th1 differentiation was induced by
activating CD4+ T cells (0.2 x
106/ml) with plate-bound anti-CD3 plus
anti-CD28 and culturing the cells in media containing 20 ng/ml
recombinant murine IL-2, 20 ng/ml recombinant mouse IL-12, and 2
µg/ml anti-mouse IL-4. Th2 differentiation was induced in
parallel, culturing cells in media containing 20 ng/ml recombinant
mouse IL-2, 20 ng/ml recombinant mouse IL-4, and 5 µg/ml
anti-mouse IFN-
(R&D Systems, Minneapolis, MN). On day 5, T
cells were washed and restimulated with 1 µM ionomycin and 10 ng/ml
PMA. Supernatants were harvested 24 h later, and cytokine
production (IL-4 and IFN-
) was quantitated by ELISA. The Jurkat E6
cell line (American Type Culture Collection (ATCC), Manassas, VA), as
well as the derivative Jurkat TAg cell line that is stably transfected
with the SV40 large T Ag (38) were cultured in complete
medium without 2-ME. Jurkat cells were stimulated using 1 µM
ionomycin, 10 ng/ml PMA, 200 mM raffinose, 50 nM CsA, or as otherwise
specified.
RNA analyses
NFATL1 RNA levels in various human tissues were quantified using a human mRNA dot blot (Clontech Laboratories). RNA from cell lines and splenocytes was isolated using RNAzol (Tel-Test, Friendswood, TX). Radiolabeled cDNA fragments used to probe RNA blots consisted of the following: a 572-bp fragment of the hNFATL1 cDNA encompassing aa 268458; a 1267-bp EcoRI-XhoI fragment of a murine AR cDNA EST clone (GenBank accession number AA791571; ATCC); and a murine GAPDH fragment (Ambion, Austin, TX). Hybridizations and high stringency washes were performed using standard procedures. RNA levels were quantitated by phosphorescence using a Storm Phosphoimaging system (Molecular Dynamics, Sunnyvale, CA).
Cell transfection and reporter analysis
Jurkat cells (107 cells per 0.4 ml complete medium) were transfected by electroporation (Bio-Rad Gene Pulser; 950 µF, 0.25 V, 0.4-cm gap width). Cells were stimulated 24 h after transfection. Luciferase activity was measured in cell lysates generated 1624 h after stimulation. Lysates were prepared by repeated freeze-thaw cycles in 0.25 M Tris, pH 7.5 (typically 200 µl extract volume per 107 cells transfected). Insoluble material was pelleted by centrifugation, and luciferase activity in the resulting cell lysate was measured using a Lumat LB9507 luminometer. Luciferase assays typically used duplicate measurements of 10 µl of cell lysate added to 200 µl of assay buffer containing 2.5 mM glycylglycine, 15 mM MgSO4, 5 mM ATP, and 1 mg/ml BSA. Luciferase reactions were initiated by the injection of 100 µl 1 mM D-luciferin (Sigma, St. Louis, MO), and light activity was measured over a 10-s period. All reporter data presented are representative of at least three independent experiments.
| Results |
|---|
|
|
|---|
As a first step toward elucidating the function of NFATL1, the
tissue distribution of NFATL1 mRNA was determined. To quantitatively
assess NFATL1 mRNA levels in a wide spectrum of tissue types, including
mature and fetal tissues as well as tissues from functionally distinct
regions of the central nervous system, a multi-tissue human mRNA dot
blot was screened with a probe derived from the human NFATL1 cDNA clone
pJTh103. Results of this hybridization show that the NFATL1
gene is expressed ubiquitously, with readily detectable NFATL1 mRNA
present in all tissues (Fig. 1
a). The complete absence of
any detectable signal in the negative control samples indicates that
the observed hybridization signals are specific. Northern blot analysis
using the same probe identified a single
13 kb NFATL1 mRNA
transcript with no additional high-stringency hybridization signals
(data not shown). In addition, previously published results of Northern
analyses of NFATL1 expression demonstrated very similar patterns of
expression (27, 28). Therefore, the observed variation in
hybridization signals demonstrated by the dot blot analysis accurately
reflects variation in the levels of NFATL1 mRNA in different tissues.
The mRNA samples present in the multi-tissue dot blot have been
normalized such that the levels of eight different housekeeping genes
are equal between samples. Thus, expression of NFATL1 mRNA, although
ubiquitous, appears to be elevated relative to the level of expression
of housekeeping genes in tissues that are metabolically active or
proliferative, which include fetal tissues (particularly fetal kidney
and lung), glandular tissues (e.g., pituitary gland), or tissues such
as placenta, testis, and thymus (Table I
).
|
|
Inducible, cyclosporin-sensitive expression of NFATL1 in primary T cells
The high level of NFATL1 expression in the thymus suggests that
NFATL1 may play a role in regulating TCR-dependent programs of
thymocyte proliferation and differentiation. Therefore, the absence of
detectable NFATL1 protein in peripheral lymphoid tissues likely
reflects the absence of active receptor-dependent signaling in these
cells. To determine whether NFATL1 is induced in mature peripheral T
lymphocytes in response to TCR-dependent activation, NFATL1 expression
in quiescent and activated splenocytes was examined. As observed in
Western blots of whole tissue extracts, NFATL1 protein is not
detectable in unstimulated primary splenocytes. However, NFATL1 protein
is markedly induced upon activation of unfractionated splenocytes (Fig. 2
a). Incubation of cells with
the T cell mitogen Con A or cross-linking the TCR with immobilized
anti-CD3 Ab resulted in the induction of NFATL1 protein. In
addition, the phorbol ester PMA and the calcium ionophore ionomycin
acted synergistically to strongly induce NFATL1. These results
demonstrate that NFATL1 protein is inducibly expressed in T lymphocytes
in response to receptor-mediated mitogenic signals, and that this
induction is mediated by at least two distinct intracellular signaling
pathways defined by a calcium ionophore and the phorbol ester
PMA.
|
The TCR-dependent induction of NFATL1 protein expression was further
investigated in primary CD4+ T lymphocytes.
Murine splenocytes were fractionated by magnetic cell sorting into a
highly purified population of CD4+ T lymphocytes.
Similar to the results observed with unfractionated splenocytes, NFATL1
protein was not detectable in unstimulated CD4+ T
cells, and both Con A and anti-TCR stimulation resulted in the
induction of NFATL1 (Fig. 2
c). To further investigate NFATL1
expression in CD4+ T lymphocytes, purified
CD4+ T cells were cultured under conditions that
induce the differentiation of distinct effector cell populations, as
defined by cytokine production. Both the IFN-
producing Th1
population and the IL-4-producing Th2 populations generated over a
5-day culture period showed similar induction of NFATL1 upon
restimulation with ionomycin plus PMA (Fig. 2
d). Although
these results indicate that NFATL1 is not differentially expressed in
fully polarized Th1 and Th2 effector CD4+ T cell
populations, preferential expression of NFATL1 in Th1 cell populations
was observed at earlier time points (data not shown).
The induction of NFATL1 in primary splenocytes by the synergistic
combination of a calcium ionophore and PMA suggests that the
TCR-dependent induction of NFATL1 is mediated in part by a
calcium-dependent signaling mechanism. Given the pivotal role of the
CsA/FK506-sensitive, calcium/calmodulin-dependent phosphatase
calcineurin in T lymphocyte activation (16, 39), a
potential role for calcineurin in the induction of NFATL1 was
investigated. Primary splenocytes were activated in the presence and
absence of CsA. Induction of NFATL1 by not only ionomycin plus PMA, but
also by Con A and by TCR cross-linking was nearly completely inhibited
by CsA (Fig. 3
a). In addition,
NFATL1 induction was also inhibited by FK506, which acts to inhibit
calcineurin though interaction with cellular proteins distinct from
those targeted by CsA. The estimated concentration required for half
maximal inhibition of NFATL1 expression by both of these inhibitors
(Fig. 3
b) was similar to that necessary for inhibition of T
lymphocyte activation (16). These results indicate that
the induction of NFATL1 in primary splenocytes is dependent upon the
function of calcineurin.
|
To measure the transcriptional function of the endogenous NF-ATL1
protein, a luciferase reporter construct was generated in which NFAT
sites from the NFAT-GL3 reporter construct, which are present as a
trimer, were substituted with a dimer of the hTonE site, resulting in
the reporter construct designated hTonE-GL3 (Fig. 4
a). The hTonE site has been
previously demonstrated to represent a specific binding site for TonEBP
and has been used in the context of reporter constructs to monitor the
induction of TonEBP expression in response to hypertonic stimuli
(25, 27). These reporter constructs use the minimal
promoter of the human IL-2 gene (33). To determine the
extent to which this reporter construct detected the activity of
endogenous NFATL1, Jurkat cells were transiently transfected with
either the NFAT-GL3 or the hTonE-GL3 reporter construct and stimulated
with ionomycin, PMA, or raffinose. The NFAT-GL3 reporter vector
exhibited a 752- ± 122-fold induction (n = 6) upon
stimulation with ionomycin plus PMA, whereas the hTonE-GL3 reporter
vector was induced 106- ± 45-fold (n = 6) (Fig. 4
b). The hTonE reporter was not activated upon stimulation
with either ionomycin or PMA alone, indicating that activation of
NFATL1-dependent transcription requires the synergistic action of
distinct signaling pathways. This is consistent with the observation
that induction of NFATL1 protein in primary T cells also required
stimulation by both ionomycin plus PMA. Culture of transfected cells
under hyperosmotic conditions resulted in no detectable increase in
NFAT-GL3 reporter gene expression, but led to a 32- ± 15-fold
(n = 6) induction of the hTonE-GL3 reporter gene (Fig. 4
b). To determine whether NFATL1-dependent transcription in
Jurkat cells could be induced by cross-linking the TCR, cells were
stimulated with immobilized (plate-bound) anti-CD3 Ab.
TCR-dependent stimulation of Jurkat cells resulted in the induction of
NFATL1-dependent transcription similar in magnitude to that resulting
from stimulation with ionomycin plus PMA (Fig. 4
c).
|
To determine whether the induction of NFATL1-dependent
transcription involves a calcineurin-dependent mechanism of regulation,
Jurkat cells transfected with the hTonE-GL3 reporter construct were
stimulated with either ionomycin plus PMA or with raffinose in the
presence and absence of CsA. NFATL1-dependent transcription induced by
ionomycin plus PMA was inhibited in a dose-dependent manner (Fig. 5
a), consistent with the
CsA-mediated inhibition of NFATL1 protein expression induced by either
ionomycin plus PMA or by TCR cross-linking in primary murine
splenocytes (Fig. 3
). In contrast, NFATL1-dependent transcription
induced by raffinose was not inhibited by concentrations of CsA that
completely eliminated the response induced by ionomycin plus PMA (Fig. 5
a). Similar results were obtained using FK506 (data not
shown). To determine whether the observed induction and inhibition of
NFATL1-dependent transcription in Jurkat cells reflected changes in
NFATL1 expression, NFATL1 protein expression was measured by Western
analysis (Fig. 5
b). These results also demonstrate that
although the induction of NFATL1 by ionomycin plus PMA is inhibited by
CsA, the induction of NF-ATL1 expression by a hyperosmotic stimulus is
not inhibited. These results indicate that NFATL1 can be induced by
mechanisms that are both sensitive as well as resistant to inhibition
by CsA and FK506.
|
NFATc proteins play no role in the induction of NFATL1 activity
The calcineurin-dependent induction of the hTonE-GL3 reporter and
the requirement for both a calcium signal (ionomycin) and a
PMA-dependent signal suggests that an NFATc-dependent pathway may be
involved in the observed induction of hTonE-GL3 reporter activity.
Although this may occur indirectly through the NFATc-dependent
induction of NFATL1, the possibility that NFATc-containing DNA binding
complexes bind directly to the hTonE site to activate the hTonE-GL3
reporter has not been completely excluded. This point is particularly
relevant given the similarity between the NFAT and the hTonE DNA
binding sites. Thus, the potential role of NFATc in the observed
induction of the hTonE-GL3 reporter construct was determined by
cotransfection of full-length expression vectors encoding NFATc1 or
NFATL1. Overexpression of NFATc1 resulted in the calcium-independent
activation of the NFAT-GL3 reporter upon PMA stimulation as expected
(37), but resulted in no activation of the hTonE-GL3
reporter (Fig. 6
a). Similarly,
NFATL1 overexpression markedly activated the hTonE-GL3 reporter, but
did not activate the NF-AT-GL3 reporter. Interestingly, transfection of
greater amounts of the NFATL1 expression plasmid (3 µg) resulted in a
55 ± 18% reduction (n = 3) of the NFAT-GL3
reporter, suggesting a possible negative regulatory role for NFATL1 in
the regulation of NFAT-dependent transcription (data not shown). These
results indicate that the activity of the hTonE-GL3 reporter vector
specifically reflects the activity of endogenous NFATL1, and further
indicate that NFATc1 is neither directly nor indirectly involved in the
induction of NFATL1-dependent transcription. The induction of the
hTonE-GL3 reporter but not the NFAT-GL3 reporter by a hypertonic
stimulus (Fig. 4
b) further demonstrates the specificity of
the hTonE-GL3 reporter.
|
The hyperosmotic response gene AR is not induced upon T cell activation
Previous studies have identified hyperosmotic response genes such
as the sodium/myo-inositol cotransporter (SMIT1), the
betaine/
-aminobutyric acid transporter (BGT1), and AR as
putative NFATL1 target genes (see Discussion). To determine
whether the observed induction of NFATL1 occurring upon T lymphocyte
activation correlates with the induction of known hyperosmotic response
genes, the level of the well characterized hyperosmotic response gene
AR (30) was determined by Northern analysis in cells
stimulated with either a hyperosmotic stimulus or a TCR-dependent
stimulus (Fig. 7
). Primary murine T
lymphocytes were stimulated for 48 h with Con A plus IL-2. The
cells were subsequently stimulated for 16 h with a hyperosmotic
stimulus (200 mM raffinose), a TCR-dependent stimulus (Con A), or a
mitogenic pharmacologic stimulus (ionomycin plus PMA). In sharp
contrast to the hyperosmotic stimulus, which resulted in a marked
induction of AR mRNA, no induction was observed upon stimulation with
either Con A or ionomycin plus PMA. Quantitation of the results shown
demonstrates a 14-fold greater level of AR mRNA present in cells
subject to a hyperosmotic stimulus as compared with cells stimulated
with Con A or ionomycin plus PMA. These results indicate that NFATL1,
which is induced upon T cell activation, does not mediate the induction
of hyperosmotic response genes because these genes (as exemplified by
the AR gene) do not appear to be inducibly expressed upon T cell
activation.
|
| Discussion |
|---|
|
|
|---|
NFATL1, originally designated TonEBP, was cloned as a result of its ability to bind to specific DNA binding sites present in tonicity responsive genes, which include genes encoding AR, SMIT, and BGT1 (25, 27). These genes are expressed at high levels in the mammalian renal medulla where they function to increase the levels of compatible organic osmolytes (e.g., myoinositol or betaine), which maintain intracellular isotonicity within a hyperosmotic environment (41). Cell lines (e.g., MDCK and HeLa) subject to hyperosmotic conditions induce NFATL1 protein expression, DNA binding activity, and NFATL1-dependent transcription (25, 27). However, the expression of NFATL1 mRNA in a wide variety of cell and tissue types, including those that are not normally subject to the magnitude or duration of hyperosmolar stress that exists within the mammalian renal medulla or that is effective in inducing NFATL1 in cell lines, suggests that NFATL1 functions to regulate transcription in response to stimuli other than hyperosmolar stress. The results presented here confirm this speculation by demonstrating that NFATL1 can be induced by receptor-dependent mechanisms. Specifically, cross-linking of the TCR results in the induction of the NFATL1 protein in primary T lymphocytes and in the Jurkat human T cell line, which correlates with the induction of NFATL1-dependent transcription. The relatively abundant level of NFATL1 protein detected specifically in thymus further indicates that the induction of NFATL1 occurs in vivo as a result of receptor-dependent activation of cellular proliferation and/or differentiation, given that TCR-dependent signaling mediates the process of positive and negative selection that takes place during T cell development in the thymus (42).
Signaling mechanisms regulating NFATL1 expression
Mammalian cells respond to hyperosmotic conditions in culture by initiating a pleiotropic response that includes induction of heat shock proteins, activation of the p38, stress-activated protein kinase/c-Jun N-terminal kinase (JNK), and extracellular signal-related kinase mitogen-activated protein kinase (MAPK) pathways, and transcription of tonicity-responsive osmoregulatory genes (41). Although the initial identification of NFATL1 as a TonEBP that is induced in response to hyperosmolar conditions provides an additional signaling intermediate potentially linking upstream events with defined transcriptional responses, the mechanisms resulting in the induction of NFATL1 by hyperosmotic stimuli remain unclear. For example, although the MAPK and MAPK kinase homologs HOG1 and PBS2 mediate adaptive responses to hypertonicity in yeast by inducing the transcription of hyperosmolar response genes (43), several studies indicate that MAPK pathways do not play a significant role in the induction of the mammalian tonicity response genes (44, 45). Thus, the mechanisms involved in the regulation of NFATL1 expression in response to hyperosmotic conditions remain poorly defined.
We have demonstrated that NFATL1 is not only induced by hyperosmotic
stress, but is also induced in primary T cells upon TCR-dependent
signaling mediated by stimulation with either the lectin Con A or Abs
to the TCR. In addition, a calcium ionophore and PMA function
synergistically to induce NFATL1 in both primary T cells and in the
Jurkat T cell line. Induction of NFATL1 by these stimuli is inhibited
by either CsA or FK506, in marked contrast to the induction by
raffinose, which is not affected by these inhibitors. Inhibition by
both CsA and FK506, which inhibit calcineurin through the formation of
ternary complexes involving distinct cellular immunophilins (46, 47) combined with the calcium-independent induction of
NFATL1-dependent transcription that is observed upon expression of a
constitutively active form of calcineurin, clearly indicate that
calcineurin represents a critical signaling intermediate that is
necessary for the receptor-dependent induction of NFATL1 in T
lymphocytes. Furthermore, the lack of induction of NFATL1-dependent
transcription resulting from overexpression of NFATc1 and the absence
of any inhibition by a dominant negative NFATc1 indicate that the
requisite function of calcineurin does not involve the activation of
NFATc-dependent transcription. Although NFAT proteins represent perhaps
the best characterized direct targets of calcineurin
(16, 17, 18), several additional signaling mechanisms have
been shown to be regulated by calcineurin based on inhibition by CsA
and/or FK506. These include signaling pathways involving NF-
B, NO,
protein kinase A, stress-activated protein kinase/JNK, and p38
(48). In addition, the expression of a fairly wide
spectrum of genes has been shown to be inhibited by CsA or FK506, and a
role for NFAT proteins in the transcriptional regulation of many of
these genes, particularly genes encoding transcription factors, has not
been demonstrated (48). Thus NFATL1 represents a member of
a larger group of proteins that is regulated by calcineurin through
still poorly defined mechanisms that do not involve the
calcineurin-mediated activation of NFATc proteins.
The lack of inhibition by CsA of hypertonicity-induced NFATL1 expression is consistent with one previous study that demonstrated that CsA had no affect on the hypertonicity-dependent induction of BGT1 transporter activity in MDCK cells and that CsA and FK506 exhibited divergent effects on SMIT activity (49). The distinction between the calcineurin dependence of receptor-induced NFATL1 expression and the calcineurin independence of NFATL1 induced by hypertonicity suggests a sequential signaling pathway in which hypertonic stimulus leads to the activation of a signaling intermediate(s) that lie downstream of calcineurin. In addition, the requirement for a PMA-dependent signal acting in synergy with a calcium signal to induce NFATL1 in T lymphocytes further highlights the lack of overlap between signaling intermediates induced by PMA and those activated by a hyperosmotic stimulus, even though both of these stimuli activate common signaling pathways (44, 45). Alternatively, hyperosmotic stimulation may activate specific signaling intermediates that are either not activated or are activated to a significantly lesser degree by a receptor-dependent stimulus. Several studies have demonstrated that hyperosmotic stimulation activates MAPK signaling intermediates much more potently than do receptor-dependent stimuli (50). In addition, Jurkat cells stimulated by calcium ionophore plus PMA have been shown to induce MKK7 activity but little SEK1 (MKK4 or JNKK) activity, whereas a hypertonic stimulus strongly induced the activity of both of these enzymes (51). Thus, the lack of involvement of calcineurin in the induction of NFATL1 by a hyperosmotic stimulus, which contrasts to the calcineurin dependence of receptor-mediated NFATL1 induction, likely reflects the more potent and nonspecific activation of a broader spectrum of signaling intermediates that occurs upon hyperosmotic stress (52). Whether NFATL1 plays any role in mediating transcriptional responses to environmental stress stimuli other than osmotic stress remains an important question.
What is the function of NFATL1 in receptor-dependent cell activation?
Aniso-osmotic conditions of the magnitude and/or duration used in
studies of hyperosmotic responses are normally not seen outside of the
mammalian renal medulla. However, the osmotic regulation of mammalian
cell volume represents a physiologic process, albeit poorly defined,
that takes place in cells not subject to extremes of osmotic stress.
For example, quiescent lymphocytes undergo significant (i.e., 2- to
3-fold) increase in cell volume as they enter and progress through the
cell cycle, a process that is referred to as blastogenesis. Thus, one
possible role of NFATL1 induced upon receptor-dependent cellular
activation that is suggested by its role in regulating transcriptional
responses to hyperosmotic conditions would be to regulate the
transcription of genes involved in maintaining osmotic homeostasis in
response to the increase in cell volume that occurs during lymphocyte
activation. A hyperosmotic stimulus, particularly that used
experimentally in cell culture, induces a rapid reduction of cell
volume, which results in the concentration of intracellular
macromolecules and rapid uptake of inorganic salts (41).
Activation of signaling mechanisms in this context likely results from
the nonspecific, ligand-independent receptor clustering that has been
observed to occur upon hyperosmotic stimulation (52).
Although little is known concerning osmotic homeostasis and the
regulation of cell volume that takes place upon TCR-dependent
activation of quiescent T lymphocytes, there is no evidence for a
reduction in cell volume or rapid uptake of inorganic salts similar to
that induced by extracellular hypertonicity, and the TCR-dependent
induction of the known NFATL1 target genes that allow for the
accumulation of compatible osmolyte transporters has not been
demonstrated. Thus, alterations in the intracellular environment that
occur upon hyperosmotic stress differ markedly from those resulting
from TCR-mediated activation. Consistent with this, the results
presented here clearly demonstrate that the signaling requirements for
NFATL1 induction by hyperosmotic stress differ from those required for
NFATL1 induction resulting from TCR cross-linking, with calcineurin
being implicated as an important signaling intermediate mediating the
TCR-dependent but not the hypertonicity-dependent induction of NFATL1.
More importantly, although the well-characterized hyperosmotic response
gene AR is induced in primary murine T lymphocytes subject to
hyperosmotic conditions, it is not induced in T lymphocytes by the same
receptor-dependent stimuli that clearly induce NFATL1 protein and
transcriptional activity. This is particularly relevant in that a
dominant negative form of NFATL1 has been demonstrated to inhibit AR
gene expression (29). Thus, it seems likely that NFATL1
induced in response to specific receptor-dependent stimuli mediates as
yet undefined transcriptional responses unrelated to osmotic
homeostasis. Indeed, the use of specific transcription factors to
mediate diverse biological responses represents a well recognized theme
in the transcriptional regulation of gene expression, as perhaps best
exemplified by transcription factors such as NF-
B. NF-
B plays an
important role in regulating transcriptional responses to both
physiological, receptor-dependent stimuli as well as stress-induced
stimuli (53).
The observation that the calcium/calcineurin-dependent induction of
NFATL1 occurs independently of the function of NFATc proteins reveals a
new pathway linking calcium-dependent signaling events to a distinct
transcriptional regulator. Although pre-existing calcium-regulated
transcriptional regulators such as NF-
B, JNK, and NFATc might be
differentially activated by differences in calcium amplitude and
duration occurring shortly (i.e., minutes) after receptor-dependent
activation (15, 54, 55), a transcriptional regulator such
as NFATL1 that is itself induced in a calcium- and
calcineurin-dependent manner represents a temporally distinct mechanism
to translate differences in calcium amplitude and duration into
differences in transcriptional responses. Thus, NFATL1-dependent
transcriptional responses, which would be temporally delayed as
compared with transcription induced by NF-
B, c-jun, or NFATc
proteins, may be more reflective of the duration of a TCR-dependent
stimulus. It is possible that a more prolonged TCR-dependent stimulus,
which might result in the sustained activation of calcineurin as well
as potentially other signaling intermediates, would result in higher
levels of NFATL1 being expressed. The progressively increasing level of
NFATL1 protein expressed in primary splenocytes stimulated with
ionomycin plus PMA is perhaps reflective of the kinetics and magnitude
of NFATL1 induction that might be observed with a TCR interaction of
extended duration. In the thymus, induction of NFATL1 might thus
reflect a high avidity TCR interaction, which would lead to cell death
by negative selection, whereas in mature lymphocytes NFATLl induction
may represent a means to distinguish low avidity and potentially
autoreactive TCR signals from those signals induced by a high avidity
Ag that would lead to greater NFATL1 induction. Clearly, further
understanding of the integration of signaling events in T lymphocytes
by NFATL1 will require functional studies designed to define the role
played by NFATL1 in the process of both thymic development and T cell
activation and differentiation.
The results presented here demonstrate a role for NFATL1 (TonEBP/NFAT5)
as a novel transcription factor that is induced upon T cell activation
through a TCR-dependent, calcineurin-regulated signaling mechanism.
Although evidence exists for a role for NFATL1 in regulating
transcriptional responses to hyperosmotic stimuli, the functional role
played by NFATL1 in regulating receptor-dependent transcriptional
responses in T cells or in other cells that express NFATL1 remains
unknown. The broader role for NFATL1 as a receptor-induced
transcription factor, combined with the lack of receptor-dependent
induction of hyperosmotic response genes known to be targets of NFATL1,
strongly suggests that NFATL1 plays a role in regulating
transcriptional responses distinct from those induced by hypertonicity.
This is analogous to the role played by NF-
B in regulating
transcriptional responses to diverse environmental stimuli
(56). Therefore, further understanding of both the
upstream signaling pathways that regulate NF-ATL1 expression and
function, as well as the genes targeted by NFATL1, will lead to further
insight into mechanisms of cellular activation and differentiation not
only in T lymphocytes, but in other cells that use NFATL1 as a means to
translate environmental signals into specific transcriptional
responses.
Acknowledgements
We thank Drs. S. Kyoon Woo and H. Moo Kwon for providing anti-TonEBP antisera.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Steffan N. Ho, Department of Pathology, University of California at San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0644. ![]()
3 Abbreviations used in this paper: DBD, DNA binding domain; CsA, cyclosporin A; MAPK, mitogen-activated protein kinase; TonEBP, tonicity enhancer binding protein; EST, expressed sequence tag; AR, aldose reductase; SMIT, the sodium/myo-inositol cotransporter; BGT1, the betaine/
-aminobutyric acid transporter; JNK, c-Jun N-terminal kinase. ![]()
4 A consensus system of nomenclature for NFAT genes and proteins has not as yet been established. Synonyms are as follows: NFATc1, NFATc, NFAT2; NFATc2, NFATp, NFAT1; NFATc3, NFAT4, NFATx; NFATc4, NFAT3. Here these proteins are referred to as NFATc1 through NFATc4, as currently proposed by the Human Gene Nomenclature Committee. The designation NFATc is used here to refer to the NFATc1 through NFATc4 group. ![]()
5 Given the lack of consensus in NFAT nomenclature, we have elected to follow the published recommendations set forth by the Human Gene Nomenclature Committee (23 ) in using the designation NFATL1 (i.e., NFAT-like protein 1) to refer to this gene. We refer to the protein encoded by this gene as NFATL1. ![]()
Received for publication March 29, 2000. Accepted for publication August 1, 2000.
| References |
|---|
|
|
|---|
promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell. Biol. 8:466.